Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

Spis treści

1 2

Wstęp — zarys historii genetyki .......................... Chromosomy i podziały jądra komórkowego ..
2.1. 2.2. 2.3. 2.4. 2.5. 2.6. Budowa chromosomu ......................................................................... Barwienie prążkowe chromosomów .................................................... Mitoza..............................................................................., ...................... Kariotyp .............................................................................................. Mejoza ................................................................................................. Gametogeneza ......................................................................................

n 1 5
16 23 31 33 37 43

3

Gen i jego ekspresja ..........................................
3.1. Budowa kwasów nukleinowych .............................................................. 3.1.1. DNA ................................................................................................. 3.1.2. RNA ................................................................................................. 3.2. Replikacja DNA .................................................................................... 3.3. Kod genetyczny .................................................................................... 3.4. Transkrypcja .......................................................................................... 3.5. Translacja ................................................................................................. 3.6. Budowa genu ........................................................................................... 3.7. Regulacja ekspresji genu ....................................................................... . 3.7.1. Czynniki transkrypcyjne .................................................................. 3.7.2. Geny homeotyczne .......................................................................... 3.7.3. Metylacja DNA .................................................................................... 3.7.4. Piętno gametyczne ......................................................................... 3.7.5. Inaktywacja chromosomu X w zarodkach żeńskich ......................

48
48 49 50 52 53 54 56 57 60 61 62 63 64 66

4

Metody analizy i modyfikacji genomu .................
4.1. Endonukleazy restrykcyjne ................................................................. 4.2. Wektory....................................................................................................

69
69 72

4.3. Rekombinacja molekularna i klonowanie ............................................ 4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) . . 4.5. Techniki hybrydyzacji i sondy molekularne ........................................... 4.6. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) ......................... 4.7. Biblioteki genomowe i genowe ............................................................ 4.8. Sekwencjonowanie DNA ....................................................................... 4.9. Badanie ekspresji genów ...................................................................... 4.10. Transgeneza ......................................................................................

76 78 82 86 87 88 91 91

5

Mutacje .............................................................
5.1. Mutacje genomowe .............................................................................. 5.2. Mutacje chromosomowe ..................................................................... 5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce .............................................................................. 5.4. Mutacje genowe ................................................................................... 5.4.1. Przyczyny i rodzaje mutacji genowych ............................................. 5.4.2. Skutki mutacji genowych ................................................................... 5.4.3. Mutacje genowe wpływające na cechy produkcyjne zwierząt . . . 5.4.4. Mutacje genowe wywołujące choroby genetyczne ........................ 5.4.4.1. Geny letalne, semiletalne i subwitalne ..................................... 5.4.4.2. Choroby monogenowe wywołujące wrodzone wady rozwojowe 5.4.4.3. Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych .......................................................................................... 5.4.4.4. Ograniczanie występowania chorób genetycznych....................... 5.4.5. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny ............................................................................................ 5.5. Mutacje w mitochondrialnym DNA ....................................................

95
96 100 111 112 112 118 123 124 124 127 132 135 143 144

6

Podstawowe mechanizmy dziedziczenia cech ..
6.1. Dziedziczenie cech warunkowanych jedną parą alleli ........................... 6.1.1. Współdziałanie alleli ...................................................................... 6.1.2. Niezależne dziedziczenie cech (II prawo Mendla) ......................... 6.1.3. Dziedziczenie cech sprzężonych ................................................... 6.1.4. Cechy sprzężone z płcią ................................................................. 6.1.5. Plejotropia ....................................................................................... 6.2. Współdziałanie genów z różnych lód w kształtowaniu fenotypu . . . 6.2.1. Komplementarność ............................................................................. 6.2.2. Epistaza ........................................................................................... 6.2.3. Geny modyfikujące ............................................................................ 6.2.4. Sumujące działanie genów ................................................................. 6.3. Dziedziczenie umaszczenia..................................................................... 6.4. Penetracja i stopień ekspresji (ekspresywność) genów ........................... 6.5. Dziedziczenie pozajądrowe .................................................................

146
147 147 150 152 157 160 160 161 162 163 164 164 175 176

7

Zmienność cech.....................................
7.1. Rodzaje zmienności i czynniki ją wywołujące ........................................ 7.2. Miary zmienności .................................................................................... 7.2.1. Miary skupienia .............................................................................

179
179 182 182

8

7.2.2. Miary rozproszenia ........................................................................ 7.3. Zmienność cech ilościowych .................................................................... 7.3.1. Dziedziczenie cech ilościowych ....................................................... 7.3.2. Zmienność transgresywna .............................................................. 7.3.3. Geny o dużym efekcie ....................................................................

185 187 187 189 190

8 Podstawy genetyki populacji ...............................
8.1. Prawo równowagi genetycznej ............................................................ 8.2. Frekwencja genów i genotypów w przypadku dominowania ........... 8.3. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych ....................................................... 8.4. Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8.5. Czynniki naruszające równowagę genetyczną .................................... 8.6. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami .............................................................. .

198
198 201 201 204 205 210

9 Determinacja i różnicowanie płci oraz interseksualizm ..................................................
9.1. Determinacja płci ssaków .................................................................... 9.2. Interseksualizm ....................................................................................

210
216 221

10

Genetyczne podstawy odporności i oporności ..
10.1. Genetyczne podłoże różnorodności przeciwciał ................................... 10.2. Genetyczne podłoże różnorodności receptorów limfocytów T . . . . 10.3. Główny układ zgodności tkankowej — MHC ................................... 10.3.1. Struktura i funkcje głównego układu zgodności tkankowej . . . 10.3.1.1. Główny układ zgodności tkankowej myszy ........................... 10.3.1.2. Główny układ zgodności tkankowej człowieka ...................... 10.3.1.3. Główny układ zgodności tkankowej zwierząt gospodarskich 10.3.2. Identyfikacja cząsteczek głównego układu zgodności tkankowej 10.3.3. Znaczenie głównego układu zgodności tkankowej ................... 10.3.3.1. Związek MHC z odpornością na choroby .............................. 10.3.3.2. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10.4. Zarys przebiegu reakcji odpornościowej ........................................... 10.5. Genetyczna oporność na choroby ......................................................

227
227 230 231 233 236 237 239 243 243 243 244 245 247

11

Markery genetyczne .............................................
11.1. 11.2. 11.3. 11.4. 11.5. 11.6. Antygeny erytrocytarne (grupy krwi) ................................................. Białka surowicy krwi, erytrocytów i leukocytów ............................... Allotypy immunoglobulin i lipoprotein ............................................... Białka mleka ....................................................................................... Polimorfizm DNA .............................................................................. Wykorzystanie markerów genetycznych w hodowli zwierząt...............

253
254 259 263 263 265 268

9

1 2 Mapy genomowe ...............................................
12.1. Organizacja DNA jądrowego ................................................................. 12.2. Organizacja DNA mitochondrialnego ................................................. 12.3. Markerowa mapa genomu ................................................................. 12.3.1. Fizyczna mapa genomu ............................................................... 12.3.2. Genetyczna mapa genomu ........................................................ 12.3.3. Strategia mapowania genomu......................................................... 12.3.4. Aktualny stan map genomowych zwierząt gospodarskich . . . . 12.3.5. Wykorzystanie markerowych map genomowych w hodowli . . .

275
275 277 279 280 284 287 289 292

Literatura uzupełniająca ............................................
Podręczniki ................................................................................................ Artykuły przeglądowe ....................................................................................

293
298 298

Skorowidz ...................................................................

301

Rozdział

1

Wstęp - zarys historii genetyki

Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych, której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX. Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów, tkanek, komórek i ich organelli, a z drugiej formułowaniem przełomowych hipotez i teorii, wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków, chemików, konstruktorów, a ostatnio również informatyków. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii. Autorami pierwszej z nich — teorii komórkowej budowy organizmów, ogłoszonej w 1838 roku, byli Schwann i Schleiden. Główną tezą tej teorii było twierdzenie, że wszystkie rośliny i zwierzęta są zbudowane z komórek, korę mogą powstawać jedynie przez podział innych komórek. Okazało się to niezwykle stymulujące dla rozwoju cytologii, czyli nauki o budowie i funkcji komórek. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. O powstawaniu gatunków drogą doboru naturalnego, które stało się początkiem nauki o ewolucji. Zgodnie z teorią Darwina, podstawą ewolucji organizmów żywych jest dobór naturalny, który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania, umożliwiając im nie tylko przeżycie, ale także przekazanie tych korzystnych właściwości potomstwu. W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. Badania nad mieszańcami roślin, stanowiącą zaczątek genetyki. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum), rośliny samopylnej. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty
11

czerwone lub białe, nasiona gładkie lub pomarszczone, nasiona żółte lub zielone itd. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi, Mendel uzyskał pierwsze pokolenie mieszańców (F1), które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2). Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków, że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet, przy czym jedna gameta zawiera tylko jeden taki element. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki, w tym struktur związanych z dziedziczeniem. Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. Pierwsze doniesienia o „pałeczkowatych" strukturach, nazwanych w 1888 roku przez Waldeyera chromosomami, zostały podane przez polskiego botanika Strasburgera w 1880 roku. Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. Opis mitozy przedstawił w 1882 roku Flemming, a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. Na początku XX wieku podjęto wiele badań, których celem było poznanie praw rządzących dziedziczeniem cech. Dopiero wówczas zrozumiano genialność odkryć Mendla. Stało się to za sprawą trzech badaczy: Corrensa, de Yriesa i Tschermacka, którzy niezależnie od siebie doszli do wniosków, które kilkadziesiąt lat wcześniej podał Mendel. Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. Rok później Morgan ogłosił chromosomową teorię dziedziczenia, którą można uważać za początek cytogenetyki. W latach 20. Fischer, Wright i Haldane wprowadzili do genetyki metody statystyczne, które okazały się bardzo istotnymi narzędziami badawczymi, za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. cech ilościowych. Ten dział genetyki określa się często jako genetykę cech ilościowych. Niektórzy autorzy uważają, że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie, że można je określać tylko jednym terminem — genetyka populacji. Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne, do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. Przez wiele lat przypuszczano, że nośnikiem informacji genetycznej są białka, o których różnorodności wiedziano już wówczas dość dużo. Przełom nastąpił w 1944 roku, kiedy to trzej badacze: Avery, MacLeod i McCarty wykazali, że
12

nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA). Do wniosku tego doszli na podstawie wyników eksperymentu, w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości. W doświadczeniu tym można upatrywać początku genetyki molekularnej. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów. Początek lat 50. to czas usilnych badań, których celem było poznanie struktury chemicznej DNA. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego. Zostały one zakończone w pierwszej połowie lat 60., a wiodącą rolę w tych badaniach odegrali między innymi Khorana, Nirenberg i Ochoa. W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw. teorii operonu, która wyjaśniała mechanizm ekspresji genów u bakterii. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna. Odkrycie enzymów restrykcyjnych (1962 r.) oraz enzymu odwrotnej transkryptazy (1970 r.), opracowanie techniki rekombinacji i klonowania DNA (1972 r.), sekwencjonowania DNA (1975 r.) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r.) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. Warto podkreślić, że molekularne poznanie genomów człowieka, zwierząt, roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych, hodowlą zwierząt i roślin, wykrywaniem 1 zwalczaniem patogenów, przetwórstwem żywności, ochroną środowiska itp. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków, jak świnia, bydło, koń, owca, kura czy pies. Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie. W przypadku człowieka celem jest nie tylko mapowanie genomu, ale również jego sekwencjonowanie, tzn. ustalenie kolejności par nukleotydów w całym DNA ludzkim, liczącym ponad trzy miliardy par nukleotydów. Program ten został urucho miony w 1987 roku, a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań. Warto zaznaczyć, że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang. Human Genome Organisation Project)
13

oraz 2) prywatną firmę CELERA. W grudniu 2002 roku ustalono sekwencję genomu myszy, a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa. Przewiduje się, że do 2005 roku zostaną zsekwencjonowane genomy bydła, świni i kury. Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji, czego jednym z licznych przykładów jest hodowla zwierząt. Głównymi metodami hodowlanymi są selekcja i krzyżowanie, dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. Istotnym elementem pracy hodowlanej jest kontrola pochodzenia, którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek, a ostatnio także polimorfizmu DNA. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych, a w przypadku mutacji genowych — metod genetyki molekularnej. Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji, bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych. Pierwsze osiągnięcia zostały już opublikowane. Ustalono, jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła, wysoką plenność owiec rasy boorola i inverdale, wysoką mięsność świń czy wydajność tłuszczu w mleku krów. Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój. Wydaje się, że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów, roślin, zwierząt, a także człowieka powinna wywołać głębokie zastanowienie się nad tym, gdzie jest granica, której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć.

Rozdział

2

Chromosomy i podziały jądra komórkowego

W podziale systematycznym organizmów żywych wyróżnia się, biorąc pod uwagę organizację informacji genetycznej i budowę komórki, dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota). Prokarionty nie mają wyodrębnionego jądra komórkowego, zdolnego do podziałów (kariokinezy). Odpowiednikiem jądra komórkowego jest nukleoid, zbudowany z „nagiej" kolistej cząsteczki DNA. Tym samym organizmy te zawierają pojedynczy zestaw genów, czyli są haploidalne. Do prokariontów zalicza się bakterie i sinice. Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. Eukarionty zbudowane są z komórek mających jądra komórkowe, które podlegają podziałom (mitoza, mejoza). W jądrze komórkowym występują chromosomy, które są zbudowane z kwasów nukleinowych i białek. Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię, a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. Do eukariontów zalicza się wszystkie organizmy komórkowe, oprócz bakterii i sinic. Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana, który w 1910 roku ogłosił chromosomową teorię dziedziczenia. Głównymi tezami tej teorii było twierdzenie, że: 1) geny zlokalizowane są w chromosomach, 2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie. Należy jednak podkreślić, że nie
15

wiedziano wówczas, z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu.

2.1. Budowa chromosomu
Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA), kwasów rybonukleinowych (RNA), białek histonowych i niehistonowych. Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego. Dzięki kondensacji cząsteczki DNA, która następuje za pomocą białek histonowych i niehistonowych, chromosom

Ryć. 2-1. Fazy (GO, Gl, S, G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu. Oznaczenia: P — profaza, M — metafaza, A — anafaza i T — telofaza

16

osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej. Wówczas to chromosom ma długość rzędu kilku mikrometrów, a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną, która obejmuje nie tylko ustalenie liczby chromosomów, ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym, określanym jako centromer. O chromatydach mówi się, że są siostrzane, ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć. 2-1). Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). Część końcowa ramienia chromosomowego nazywana jest telomerem. Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC. Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-, submeta-, subtelo-i akro-(telocentryczny) (ryć. 2-2). Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu. Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1,00-1,70), (1,71-3,00), (3,01-7,00) i (7,01-oo). Niektóre chromosomy mają, oprócz przewężenia pierwotnego, także przewężenie wtórne, określane inaczej jako obszar jąderkotwórczy — NOR (ang. nucleolar organizer region), który jest odpowiedzialny za uformowanie jąderek podczas interfazy. W jąderkach budowane są podjednostki rybosomów. W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5.8S, 18S i 28S. Czwarta

chromarydy siostrzane

Ryć. 2-2. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17

frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. Fragment ramienia chromosomu, który występuje za przewężeniem wtórnym, nazywa się satelitą. Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej, jak i żeńskiej. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. W każdej parze jeden chromosom pochodzi od matki, a drugi od ojca danego osobnika. Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego. Heterochromosomy, oznaczane u ssaków symbolami X oraz Y, występują w układzie XX u samic oraz XY u samców. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y), morfologii, układu prążków poprzecznych oraz, co najważniejsze — zestawu loci genów, które są w nich położone. Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć. 2-3). Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y, która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny. Oznacza to, że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację, podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X. Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału. W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy, która z kolei zawiera jedną cząsteczkę DNA. Podczas fazy S następuje replikacja — 18

Ryć. 2-4. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt, 1997, PWN)

samoodtworzenie DNA, która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu, w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. Przyjmuje się, że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo, a procesy te, ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki, charakteryzują się niezwykłą precyzją (ryć. 2-4). Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom. Jest on zbudowany z rdzenia białkowego (oktamer histonowy, zawierający po dwie cząsteczki histonów: H2A, H2B, H3 i H4), na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów, inaczej par zasad (pz). Fragment DNA owinięty na oktamerze histonowym (1,8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz. Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz, w zakresie od 0 do 80 pz.

19

Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid. W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl, które odpowiadają za zbliżenie się sąsiednich nukleosomów. Solenoid podlega dalszej spiralizacji, a jej ostatecznym etapem jest utworzenie domen pętlo wych, które są zakotwiczone w rdzeniu białkowym chromatydy, zbudowanym z białek niehistonowych. Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu, należącymi do rodziny białek HMG (ang. high mobility group). Dlatego te sekwencje DNA określane są terminem S AR (ang. scaffold attachment region), czyli regionami wiążącymi się ze szkieletem chromosomu. Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości, z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. W niej zlokalizowane są kodujące sekwencje DNA, czyli geny. Podlega ona replikacji w początkowym okresie fazy S. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną. Heterochromatyna fakultatywna jest częścią chromatyny, która może ulec trwałej kondensacji; przykładem jest jeden z chromosomów X u osobników żeńskich, który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw. ciałka Barra. Heterochromatyna konstytutywna jest frakcją chromatyny, która zawsze występuje w stanie skondensowanym. Zbudowana jest z niekodującycK. sekwencji nukleotydowych, głównie powtarzalnych sekwencji DNA. Jej replikacja występuje w późnym okresie fazy S. Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny, rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego. Wiadomo jednak, że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. domeny, przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów, które tworzą większe chromocentra. Chromosomy interfazowe zachowują strukturę nukleosomowa. Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów. Pojawia się ona podczas zapłodnienia, wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20

w oocycie drugiego rzędu (komórce jajowej). W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych, w których jeden chromosom jest pochodzenia ojcowskiego, a drugi matczynego. Chromosomy homologiczne mają loci tych samych genów, ale mogą zawierać w nich różne allele

21

Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale, od 30 u norki do 78 u psa (tab. 2-1, ryć. 2-5 i 2-6). Należy podkreślić, że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota. Chromosomy B, czyli nadliczbowe względem podstawowego ze-

22

stawu A, charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych. Efektem tego jest zmienność ich liczby zarówno między osobnikami, jak i pomiędzy komórkami w obrębie jednego osobnika. Do tej pory nie poznano funkcji tych chromosomów, chociaż wiadomo, że często są zbudowane z heterochromatyny konstytutywnej, czyli można przypuszczać, iż są nieaktywne genetycznie. Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej, np. fuzji centrycznej u lisów polarnych. Konsekwencją tego jest występowanie u lisów osobników, które mogą mieć 50,49 lub 48 chromosomów.

2.2. Barwienie prążkowe chromosomów
Zróżnicowanie wewnętrzne chromosomu, wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T, może być uwidocznione za pomocą technik barwienia różnicującego. Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. Okazało się, że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii, ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. Prążki mają identycz23

ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku. Wynika z tego, że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów, ale także układ prążków na chromosomach. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole. Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym, po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny. Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące
24

(ryć. 2-7a). Silne wiązanie barwnika kwinakryny następuje w miejscach, gdzie dominują pary zasad A-T. Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny), a następnie barwienia roztworem Giemsy. W efekcie na chromosomach

25

pojawiają się prążki ciemne i jasne (ryć. 2-8). Prążki ciemne występują w tych samych miejscach, gdzie przy barwieniu QFQ obserwowane są prążki świecące, a prążki jasne odpowiadają nie świecącym prążkom Q. Prążki R, pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. 2-7b). Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG), po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. Oznacza to na przykład, że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu, gdzie przy barwieniu QFQ występuje prążek nie świecący, a przy barwieniu GTG prążek jasny. Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. Zależność ta jest szczególnie interesująca, ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. wysepki CpG). Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach, są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl, H2 i H3. Największe zagęszczenie genów występuje w obrębie izochor H3, w których jest też najwięcej wysepek CpG. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T. Wskazuje to zatem, że prążki R są głównymi regionami, w których zlokalizowane są geny, a miejscami szczególnie bogatymi w loci genów są prążki T. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. Ponadto, są one niezbędne przy mapowaniu fizycznym genów, które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych, które zaszły w kariotypach zwierząt. Oprócz opisanych wyżej metod prążkowych, wykorzystywanych do identyfikacji chromosomów homologicznych, znane są metody, które pozwalają na uwidocznienie charakterystycznych regionów chromosomu, takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze. Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. W takich warunkach znaczna część euchromatyny zostaje usunięta, a pozostają trudne do usunięcia, silnie skondensowane obszary heterochromatynowe, które się wybarwiają roztworem Giemsy. Heterochromatyna konstytutywna
26

jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. 2-9a), a rzadziej na końcach, czy też w częściach środkowych ramion. Znane są również takie gatunki zwierząt, u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona, np. ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć. 2-9b). Prążki Ag-I, inaczej Ag-NOR, to barwienie azotanem srebra, które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). W miejscach tych następuje wytrącenie metalicznego srebra, które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć. 2-10). 27

Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków. Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych.
28

Bydło, 2n - 60 (ryć. 2-5b). Wszystkie autosomy są akrocentryczne. Chromosomy płci są łatwe do identyfikacji, ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem, a chromosom Y jest małym metacentrykiem. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach, natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim, a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. 2-9a). Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. Koza, 2n = 60. Podobnie jak w przypadku bydła, także koza ma wszystkie autosomy akrocentryczne. Również akrocentryczny jest chromosom X, a chromosom Y jest małym metacentrykiem. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów. W chromosomie X brak jest centromerowego prążka C. Obszary jąderkotwórcze występują, podobnie jak u bydła, w części telomerowej ramion długich pięciu par autosomów. Owca, 2n = 54 (ryć. 2-6a). Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków. Chromosom X jest dużym akrocentrykiem, a chromosom Y jest małym metacentrykiem. W stadium prometafazy, w którym nie jest jeszcze zakończona kondensacja chromosomów, w chromosomie X widoczne są krótkie ramiona, co odróżnia go od autosomów akrocentrycznych o podobnej wielkości. Układ prążków C, a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. Świnia, 2n = 38 (ryć. 2-5a). Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta- i submetacentrycznych) oraz 6 par akrocentrycznych. Chromosom X jest średniej wielkości metacentrykiem, trudnym do odróżnienia na podstawie morfologii od autosomów. Chromosom Y jest najmniejszym chromosomem metacentrycznym. Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X, natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych, w ramionach krótkich, w pobliżu centromeru (ryć. 2-10a). Koń, 2n = 64 (ryć. 2-6b). Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków. Chromosom X jest dużym chromosomem metacentrycznym, a chromosom Y jest akrocentrykiem. Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X, który ma dodatkowy prążek 29

interstycjalny w ramieniu długim. Chromosom Y jest w znacznej części heterochromatynowy. Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. 2-10b). Kura, 2n = 78. W kariotypie kury, podobnie jak u innych ptaków, występuje liczna grupa bardzo małych chromosomów, nazywanych mikrochromosomami, dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. W grupie dużych autosomów analizuje się najczęściej 8 par, wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne. Chromosom Z jest dużym metacentrykiem, a chromosom W jest małym metacentrykiem. Obszar jąderkotwórczy występuje tylko w jednej parze autosomów, z grupy mikrochromosomów. Lis pospolity, 2n = 34 +B (ryć. 2-7a). Wszystkie autosomy z grupy A są chromosomami dwuramiennymi, a chromosomy z grupy B są akroćentryczne lub subtelocentryczne. Chromosom X jest dużym metacentrykiem, a chromosom Y bardzo małym akrocentrykiem, którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B. Liczba chromosomów B waha się od O do 7, przy czym najczęściej obserwowano l, 2 lub 3 chromosomy B. Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną, którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów, w okolicach centromeru, oraz w chromosomie Y. W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. Lis polarny, 2n = 50, 49 lub 48. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. Chromosom X jest dużym metacentrykiem, a chromosom Y bardzo małym akrocentrykiem. Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. Wszystkie chromosomy, łącznie z chromosomami płci, mają bloki heterochromatynowe w okolicy centromeru. Ponadto, 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. 2-9b). Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych.
30

Pies, 2n = 78 (ryć. 2-8b). Wszystkie autosomy są akrocentryczne. Chromosom X jest dużym metacentrykiem, a chromosom Y jest małym metacentrykiem. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów, chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y, w części terminalnej ramion długich.

2.3. Mitoza
Mitoza to proces podziału jądra komórkowego, który prowadzi do powstania dwóch komórek potomnych, mających genotyp identyczny z tym, jaki miała komórka rodzicielska. Komórki potomne mają nie tylko taką samą liczbę chromosomów, ale także identyczną sekwencję nukleotydów w DNA. Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu, odnawianiem niektórych komórek u dorosłych organizmów (np. komórki krwi, nabłonka), proliferacją limfocytów przy reakcji odpornościowej organizmu, a także z pierwszymi etapami gametogenezy. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki. Fazy Gl, S i G2 tworzą okres międzypodziałowy — interfazę, a czwartą fazą jest podział. W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki, a faza S jest związana z procesem samoodtworzenia się DNA (replikacja). Rozpoczęcie fazy S oznacza, że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. Jeżeli ilość DNA wyrazimy za

31

pomocą umownych wartości C, to w jądrze komórkowym po replikacji jest 4C, a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. W trakcie omawiania podziału mej etycznego pokazane zostanie, że najmniejszą zawartość DNA (1C) mają gamety (ryć. 2-11). Mitoza składa się z czterech faz: profazy, metafazy, anafazy i telofazy (ryć. 2-12). W profazie rozpoczyna się proces kondensacji chromosomów. Istotnym zmianom podlegają również inne organelle komórkowe. Centriołe, odpowiedzialne za powstanie wrzeciona podziałowego, rozchodzą się do przeciwległych biegunów komórki. W obrębie jądra komórkowego zanikają jąderka, organelle komórkowe odpowiedzialne za wytwarzanie rybosomów. W końcu, dezintegracji ulega błona jądrowa. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. W tej fazie chromosomy są rozprzestrzenione w całej komórce. Następuje formowanie się wrzeciona podziałowego, którego włókienka, wychodzące z centrosomu (obszar wokół centrioli), łączą się z centromerami chromosomów w taki sposób, że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi, które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. W telofazie zachodzą procesy odwrotne do tych, jakie występują w profazie. Chromosomy ulegają dekondensacji, odbudowuje się błona jądrowa oraz jąderka, a centriole dzielą się na dwie parzyste struktury. W wyniku kariokinezy w komórce powstają dwa jądra potomne, mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska, w których każdy z chromosomów jest zbudowany z jednej chromatydy. Po zakończeniu podziału jądra komórkowego następuje cytokineza, czyli podział cytoplazmy i rozdział organelli komórkowych. Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych.

2.4. Kariotyp
Uszeregowanie chromosomów, występujących w jądrze komórki somatycznej, w pary homologiczne określane jest terminem kariotyp. Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32

spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów.

Być. 2-12. Schemat przebiegu podziału mitotycznego. Oznaczenia: P — profaza, PM — prometafaza, M — metafaza, A — anafaza, T — telofaza, C — cytokineza, a — centriole, b— zanikające jaderko, c — dezintegrująca błona jądrowa, d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt, Wydawnictwo AR, Poznań 1988)

33

Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych, do których zalicza się: długość chromosomu, położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-, submeta-, subtelo- lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q, G lub R. Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu, ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. Jest to spowodowane tym, że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła, kozy i psa, w których wszystkie

Ryć. 2-13. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds. Standaryzacji Kariotypu Świni. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć. 2-8a

34

chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości, przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne. Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy

Ryć. 2-14, Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds. Standaryzacji Kariotypu Świni (Hereditas 109:151-157,1988)

35

zróżnicowane pod względem morfologicznym, precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe. Przykładem może być kariotyp świni (2n = 38), w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. 2-13). Graficzne przedstawienie kariotypu, obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków, nazywa się idiogramem (ryć. 2-14). Opracowanie kariotypu, czasami określanego kariogramem, dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem, przyjętym dla danego gatunku. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery, w zakresie wyznaczonym przez liczbę par dla danego gatunku. Każda para homologiczna ma opisaną morfologię, wielkość oraz wzór prążkowy (najczęściej prążki G lub R). Ponadto, dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang. landmarks). Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony, które są numerowane (ryć. 2-14). W obrębie regionów numerowane są także kolejne prążki, które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej, która odbyła się w 1976 roku w Reading (W. Brytania). Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła, świni, konia, owcy, kozy i kota. W latach 80. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni, bydła, owcy, kozy i konia. Natomiast w drugiej połowie lat 90. opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11

Wykaz gatunków, dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G, Q, R G, Q, R R G, R G, R G, C, Ag-I G, C, Ag-I G G G, R Źródło
Cytogenetics and Celi Genetks 92:283-299, 2001
jw. i 85:317-324, 1999

J w-

Hereditas 109:151-157, 1988

Chromosome Research 5:433-443, 1997
Hereditas 103:33-38, 1985 Hereditas 103:171-176, 1985

Cytogenetics and Celi Genetks 31:240-248, 1981 Chromosome Research 4:306-309, 1996 Cytogenetics and Celi Genetks 86:271-276, 1999

szych par spośród 39) oraz poprawiono wzorzec kariotypu konia. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. W tabeli 2-II zestawione są gatunki, dla których opracowano wzorce, z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów.

2.5. Mejoza
Podział mejotyczny prowadzi do powstania komórek, w których liczba chromosomów jest zredukowana o połowę, czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną, tzn. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. Ponadto, komórki te mają zmniejszoną do poziomu 1C zawartość DNA. Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. Mejoza składa się z dwóch podziałów, w których występują takie same fazy jak w mitozie, tzn.: profaza, metafaza, anafaza i telofaza (ryć. 2-15). Wejście komórki w podział mejotyczny poprzedzone jest, podobnie jak w przypadku podziałów mitotycznych, replikacją DNA w fazie S. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten, zygoten, pachyten, diploten i diakinezę. Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym, które występują również w mitozie. Należą do nich: kondensacja chromosomów, dezintegracja błony jądrowej, zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych, polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych. Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej, pojawiającej się w zygotenie i pachytenie profazy I, która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. Strukturą tą jest kompleks synaptonemalny (ang. synaptonemal complex — SC), który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. 2-16 i 2-17). Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne, które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu, a element centralny powstaje w miejscu, gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. Każdy element lateralny zakończony jest tarczką przylegającą, która mocuje chromosom do wewnętrznej strony błony jądrowej. Elementy lateralne
37

Tli

Ryć. 2-15. Schemat przebiegu podziału mejotycznego. Oznaczenia: PI — profaza I, L — leptoten, Z — zygoten, P — pachyten, DL — diploten, DK — diakineza, MI — metafaza I, AI — anafaza I, TI — telofaza I, Pil — profaza II, MII — metafaza II, Ali — anafaza II, Tli — telofaza II, a — tarczka przylegająca, b — centromer, c — początek budowania kompleksu synaptonemalnego, d — guzek rekombinacyjny, e — chiazma (wg: Genetyka zwierząt, Wydawnictwo AR, Poznań 1988)

łączą się tylko z niewielką częścią DNA chromosomów (około 1%). Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. domen pętlowych, których długość, zależnie od gatunku, mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz). Wynika z tego, że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego. Ponieważ koniugacja ma charakter homologiczny, to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi, chociaż jeszcze nie poznanymi, sekwencjami DNA, występującymi w tej części domen pętlo wy ch, które są zakotwiczone w rdzeniu białkowym chromatydy. Wiele wskazuje na to, że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE). Badania białek SC pokazały, że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. U ssaków dobrze poznano strukturę trzech białek SCP (ang. synaptonemal complex protein): SCP1, SCP2 i SCP3. Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej, która z kolei miała umożliwiać zajście crossing over na początku pachytenu. Ostatnio przeprowadzone badania pokazały jednak, że crossing over może zajść, zanim dojdzie do koniugacji za pośrednictwem SC. Koniugacja chromosomów
39

zostaje zakończona na początku pachytenu (ryć. 2-17b). Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów. Biwalent jest także formowany przez heterochromosomy X i Y (ryć. na okładce), dzięki
40

niewielkim regionom pseudoautosomalnym (ang. pseudoautosomal region — PAR), które uruchamiają homologiczną koniugację. Na początku pachytenu występuje zjawisko crossing over, które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. Zasadniczo crossing over jest zdarzeniem losowym, tzn. zachodzi w przypadkowym miejscu biwalentu, przy czym liczba tych zdarzeń waha się od l do 5. Losowość zachodzenia crossing over jest jednak ograniczona. Wiadomo, że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. Zjawisko to określane jest terminem interferencji. Przyjmuje się, że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. Potencjalnie mogłoby istnieć niebezpieczeństwo, że na jednych chromosomach liczba ta byłaby znaczna, a na innych brak byłoby takich wymian. Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I, ponieważ brak crossing over pociąga za sobą brak chiazm. Ponieważ tak się nie dzieje, dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over. Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji, a w świetle ostatnich badań można przypuszczać, że SC jest w to istotnie zaangażowany. Losowość crossing over naruszona jest również przez to, że zachodzi ono rzadziej w pobliżu centromeru, a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T, które są podklasą prążków R. Należy podkreślić, że crossing over jest zjawiskiem obligatoryjnym, czyli musi zajść w obrębie każdego biwalentu. Zasada ta dotyczy także biwalentu X-Y, gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. Chromatyda, która uczestniczyła w wymianie, uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego, w przeciwieństwie do sytuacji, jaka była przed crossing over. Wówczas to chromosom, a tym samym i jego chromatydy, miał zestaw alleli tylko jednego z rodziców, co wynika z zasady, że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca, a drugi od matki. Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału), której efektem jest zmienność w świecie ożywionym. Należy jednak pamiętać, że pierwotnym źródłem zmienności są mutacje, które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. Po zakończeniu pachytenu — w diplotenie, następuje rozkład kompleksów synaptonemalnych, poza miejscami, gdzie wystąpiło crossing over, w których powstają chiazmy, stanowiące cytologiczny dowód zajścia crossing over. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm, tzn. ich zanikania. W metafazie I biwalenty, składające się z maksymalnie skondensowanych chromosomów homologicznych, zmierzają do płaszczyzny równikowej

41

komórki (ryć. 2-18a). Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób, że do centromeru przyłączają się włókna tylko z jednego bieguna, natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego. Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I, w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć. 2-18b). Oznacza to, że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej, czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym. W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. 2-18c). Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział, który nie jest poprzedzony replikacją DNA. Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA.
42

Drugi podział ma przebieg zgodny z mitozą, z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów, a ich chromatydy mają zrekombinowane układy alleli. Po ustawieniu się chromosomów podczas metafazy II (ryć. 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny, rozpoczyna się telofaza, w której zachodzą procesy odwrotne do tych, jakie występują w profazie mitotycznej. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C. Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd, wśród których jedne są pochodzenia ojcowskiego, inne matczynego, a niektóre mają zrekombinowany układ alleli. Rekombinacje genetyczne zachodzące podczas mejozy, rozumiane w szerokim sensie, można podzielić na: chromosomowe, chromatydowe i wewnątrzchromatydowe. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego, przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy, które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. Ten typ określany jest jako rekombinacja chromatydowa. Trzystopniowa rekombinacja sprawia, że wśród gamet nie występują dwie o tym samym zestawie alleli. Ten fenomen, obok mutacji, jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów.

2.6. Gametogeneza
Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym. Przebieg mejozy, a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają, że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza), 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43

geneza, która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. 2-19). Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. Pierwszy podział prowadzi do powstania dwóch spermatogoniów, z których jedna komórka zajmuje miejsce pierwotnego spermatogonium, a druga podlega dalszym podziałom. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. stem cells), czyli komórek nie w pełni zróżnicowanych, które wykazują zdolność do samoodnawiania. Następne podziały mitotyczne spermatogoniów, a jest ich najczęściej sześć, nie kończą się cytokinezą. Podziały te są zsynchronizowane, a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu, które rozpoczynają podział mejotyczny. Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. Ostatecznie, po zakończeniu mejozy, powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi, która jest określana jako syncytium. Spermatydy, jako komórki niezróżnicowane, podlegają głębokim przeobrażeniom podczas procesu spermiogenezy, w wyniku którego powstają plemniki. Główne zmiany, jakie zachodzą podczas spermiogenezy, polegają na: 1) przekształceniu aparatu Golgiego w akrosom, który okrywa górną część jądra komórkowego znajdującego się w główce plemnika, 2) zgrupowaniu mitochondriów w pobliżu centrioli, które są umiejscowione po przeciwnej, w stosunku do akrosomu, stronie jądra komórkowego, 3) wykształceniu na bazie centrioli włókna osiowego witki, 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach, czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika. Dojrzały plemnik zbudowany jest z główki, w której jest umiejscowione jądro komórkowe i akrosom, wstawki znajdującej się u podstawy główki, w której zgrupowane są mitochondria, oraz witki, która stanowi przedłużenie wstawki. Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. 2-20). Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki, w których komórki linii płciowej lokują się w części korowej gonad. Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu, które niezwłocznie rozpoczynają podział mejotyczny. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego. Oocyty przechodzą w stan spoczynkowy, który jest nazywany diktiotenem. W ten sposób wszystkie oogonia, które występowały w jajniku, zostają przekształcone w oocyty I rzędu, będące w stadium diktiotenu. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych.
44

Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. W kolejnych cyklach płciowych, regulowanych hormonalnie, pewna część pęcherzyków rozpoczyna wzrost, a w nich rozrasta się również oocyt, który jest wspomagany przez otaczające komórki pęcherzykowe. W pęcherzykach, których wzrost był wystarczająco intensywny, przed owulacją następuje ponowne uruchomienie podziału mejotycznego. Oocyt I rzędu kończy pierwszy podział mejotyczny, w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. Oocyt znajduje się w stadium metafazy II. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji. Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki, to może nastąpić dokończenie oogenezy. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej, przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu. Dzieje się to na drodze wyrzucenia przez oocyt zawartości
45

ziaren korowych, znajdujących się pod powierzchnią oocytu, do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. Powoduje to „utwardzenie" osłonki przejrzystej, która staje się barierą nie do pokonania dla plemników. Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego, po czym następuje telofaza II. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie, a chromatyna plemnika, który zapłodnił oocyt, podlega dekondensacji i powstaje przedjądrze męskie. Zapłodniony oocyt II rzędu przekształca się w zygotę, w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika, a drugie reprezentujące zestaw chromosomów żeńskich, które pozostały w oocycie
46

po zakończeniu drugiego podziału mejotycznego. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA. Zawartość DNA wzrasta do poziomu 4C, co powoduje, że zygota jest gotowa do rozpoczęcia podziału mitotycznego. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów, z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii), a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów), który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. Na przykład, profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich. Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja), inseminacja, przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. samic dawczyń do rogów macicy tzw. samic biorczyń, kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro). Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki, które umożliwiają uzyskiwanie potomstwa pożądanej płci. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. Warto zauważyć, że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne), jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu, zygotach, zarodkach, a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu, z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II). Do takich oocytów, które są określane jako enukleowane, można wprowadzić techniką elektrofuzji komórkę somatyczną, pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). W taki właśnie sposób sklonowano słynną owcę Doiły, do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy.

Rozdział

3
Gen i jego ekspresja

Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi, który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości. Badania te przeprowadzili badacze amerykańscy O.T. Avery, C.M. MacLeod i M. McCarty. W ślad za tym odkryciem nastąpiły następne. W 1953 roku J.D. Watson i F. Crick przedstawili model budowy DNA, a przez następne lata rozszyfrowywano kod genetyczny, przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy. DNA charakteryzuje się trzema właściwościami, które są niezbędne do pełnienia funkcji nośnika informacji genetycznej. Po pierwsze, w sekwencji nukleotydów zapisana jest, za pomocą kodu genetycznego, informacja o pierwszorzędowej strukturze białek, a także o strukturze cząsteczek rybosomowego (rRNA), transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. Po drugie, DNA ma zdolność do samoodtwarzania się, czyli replikacji. Po trzecie, DNA może podlegać mutacjom, czyli procesowi generującemu pierwotną zmienność genetyczną, które z kolei podlegają rekombinacjom podczas mejozy.

3.1. Budowa kwasów nukleinowych
Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA). Z kolei proces ekspresji
48

genu jest nierozerwalnie związany z RNA, występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu, rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów, które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji, i tRNA (transportujący RNA), który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów.

3.1.1. DNA
Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. Struktura ta określana jest w języku polskim terminem podwójna helisa (ang. helix), a rzadziej podwójny heliks. Podstawową jednostką struktury DNA jest deoksyrybonukleotyd, w którego skład wchodzą: zasada azotowa, cukier deoksyryboza i reszta kwasu fosforowego (ryć. 3-1). W DNA występują cztery zasady azotowe, które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C). W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy. Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi

49

z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności, tzn. naprzeciw adeniny zawsze występuje tymina, a naprzeciw guaniny znajduje się cytozyna. Taka organizacja podwójnej helisy DNA sprawia, że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. Pomiędzy zasadami powstają słabe wiązania wodorowe; tak więc w parze AT są dwa wiązania wodorowe, a w parze GC trzy takie wiązania. Długość cząsteczki DNA wyraża się liczbą par nukleotydów, lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. polskim lub bp od słów angielskich base pairs), bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane. Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla, czyli każdy łańcuch ma koniec 3' i 5'. Przeciwna polaryzacja polega na tym, że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha. Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji, a w przypadku mRNA także dla procesu translacji. Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą.

3.1.2. RNA
Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych, w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA), który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. W jąderku zlokalizowane są cztery rodzaje rRNA, które są wyróżniane ze względu na wielkość cząsteczki, określaną wielkością S — stała sedymentacji. Trzy rodzaje rRNA: 5.8S, 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang. nucleolar organizer region — NOR), inaczej nazywanych przewężeniami wtórnymi. Podczas transkrypcji, prowadzonej przez polimerazę I RNA, powstaje pre-rRNA o stałej sedymentacji 45S, z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA. Przyjmuje się, że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA, którego długość wynosi około 14 000 pz. Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku, natomiast liczba aktyw50

nych obszarów, czyli takich, które podlegają transkrypcji, jest zmienna. Czwarty rodzaj — 5S rRNA jest kodowany przez gen, występujący w wielu powtórzeniach w innej części genomu. Geny 5S rRNA są transkrybowane przez polimerazę III RNA. Wymienione rodzaje rRNA uczestniczą w budowie rybosomu, zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu, a trzy pozostałe rodzaje, tzn. 5S, 5.8S i 28S, zlokalizowane są w podjednostce dużej (60S). Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA), który jest zaangażowany w dostarczanie aminokwasów do rybosomów. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. W nici takiej mogą jednak występować fragmenty komplementarne, które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów, a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć. 3-2). W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową, która katalizuje związanie tRNA z.właściwym aminokwasem; 2) pętla II — antykodonowa, zawiera układ trzech nukleotydów, które są komplementarne do kodonu aminokwasu transportowanego przez tRNA; 3) pętla III — dodatkowa, o mało poznanej funkcji; 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem. Na końcu 3' cząsteczki tRNA występuje sekwencja CCA, w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas. Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60, co oznacza, że przekracza liczbę znanych aminokwasów.
51

Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. Na uwagę zasługuje jeszcze jedna klasa RNA, określana terminem niekodujący RNA (ncRNA — ang. noncoding RNA). Ostatnie badania wykazują, że jest to bardzo ważna grupa RNA, która bierze udział w procesie wycinania intronów z pre-mRNA, modyfikacji nukleotydów, a także regulacji ekspresji genów.

3.2. Replikacja DNA
Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego, czyli mitozy, bądź mejozy. Każdy podział mitotyczny musi być poprzedzony replikacją. Podobnie jest w przypadku mejozy, z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji. Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach, które określane są jako replikony. Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji. Na przykład, liczba replikonów w genomie ssaków szacowana jest na około 25 000, a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów.

52

Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. W ten sposób powstają tzw. widełki replikacyjne (ryć. 3-3). Rozplecione łańcuchy polinukleotydowe stanowią matryce, na których w sposób komplementarny syntetyzowane są drugie łańcuchy. Wynika z tego, że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego. Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA, który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). Oznacza to, że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. fragmenty Okazaki), które następnie są łączone przez enzym ligazę w ciągłą nić. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą, a nić powstająca w sposób nieciągły opóźnioną.

3.3. Kod genetyczny
Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego, mającego charakter trójkowy, tzn. trzy kolejne nukleotydy (kodon, tryplet) w DNA zawierają informację o aminokwasie, który ma być wbudowany w procesie biosyntezy białka. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów, to ogółem możliwe jest utworzenie 64 trójek (tab. 3-1). Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne, tzn. takie, które nie kodują żadnego aminokwasu, a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. Tryplet AUG, który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym, rozpoczyna część kodującą genu. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia, że sekwencje nukleotydów w tych łańcuchach, w obrębie danego odcinka DNA, są różne. Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. Drugi, komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. Po pierwsze, kod ma charakter trójkowy, o czym była już mowa wyżej. Po drugie, jest on uniwersalny, tzn. w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. Od tej zasady są tylko nieliczne wyjątki, które dotyczą niektórych kodonów w mitochondrialnym DNA, np. kodon UGA w kodzie uniwersalnym jest
53

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

3.7. Regulacja ekspresji genu
W genomie ssaków występuje około 35 tysięcy genów. Wśród nich znaczną grupę stanowią geny pełniące tzw. funkcje gospodarza komórki (ang. housekeeping genes). Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki, takie jak: przemiany energetyczne, replikacja DNA, budowa struktur komórkowych itp. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. Warto pamiętać, że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele, które mogą występować w układzie homo- lub heterozygotycznym, co ma oczywiście związek z ekspresją genów. Podczas rozwoju ontogenetycznego, obok genów ulegających powszechnej ekspresji, jest włączana i wyłączana ekspresja różnych genów, zależnie od tego, w jakim kierunku różnicuje się dana komórka. Z drugiej strony, w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. Jest to bardzo złożony proces, którego całościowe poznanie wymaga jeszcze wielu lat badań. Niemniej znanych jest już wiele mechanizmów, które są zaangażowane w kontrolę ekspresji genów, czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. Ekspresja genu obejmuje procesy: transkrypcji, potranskrypcyjnej modyfikacji mRNA, translacji i potranslacyjnej modyfikacji białka. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. elektroforeza białek, badania serologiczne — grupy krwi, hybrydyzacja ze znakowanym przeciwciałem itp.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. umaszczenie, obecność rogów, podatność na stres itp.). W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw. poligeny, wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji, zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. Należy jednak pamiętać, że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA, regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek. Modyfikacja mRNA, oprócz zmian opisanych w podrozdziale poświęconym transkrypcji, obejmuje także inne procesy. Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu, w skład którego będą wchodziły różne kombinacje eksonów. Mechanizm ten nazywa się alternatywnym składaniem mRNA. Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. Zakończenie transkrypcji związane jest z sekwencją AAUAAA, która wskazuje, że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu, czyli dobudowa60

nie sekwencji poliA (tzw. ogonek poliA) na końcu 3' mRNA. Okazuje się, że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty. Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. Forma rozpuszczalna tego białka powstaje na matrycy mRNA, który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. Wreszcie mRNA powstały podczas transkrypcji może ulegać, przed przejściem do cytoplazmy, modyfikacjom polegającym na zmianie sekwencji nukleotydów. Proces ten nazywa się redagowaniem mRNA. Efektem tego może być na przykład pojawianie się w transkryptach, powstających w niektórych tkankach, dodatkowego kodonu stop. Funkcjonują wówczas dwa rodzaje mRNA, powstałe na bazie tego samego matrycowego DNA, odpowiedzialne za syntezę polipeptydów o różnej długości. Taką formę modyfikowania mRNA opisano m.in. w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA). Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie, czyli od jego stabilności.

3.7.1. Czynniki transkrypcyjne
Czynnikami transkrypcyjnymi nazywane są białka, które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji. Białka te w swojej strukturze zawierają dwa istotne obszary. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza, a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. Czynniki transkrypcyjne, zależnie od ich struktury trzeciorzędowej, są zaliczane do następujących grup: białka zawierające tzw. palce cynkowe (ang. zinc finger), białka o strukturze typu heliks-skręt-heliks (ang. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang. leucine zipper). Wymienione struktury wchodzą w kontakt z nicią DNA. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych, takich jak hormony. Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć. 3-7). W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik
61

Ryć. 3-7. Schemat regulacji ekspresji genów za pomocą hormonów. Oznaczenia: HP — hormon peptydowy, HS — hormon steroidowy, R — receptor hormonu peptydowego, RS — receptor hormonu steroidowego, T1 T2 — przekaźniki wewnątrzkomórkowe, Pl P2 — promotory genów, Gj, G2 — części strukturalne genów

transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu. Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. Domena wiążąca DNA jest aktywna tylko wówczas, gdy do receptora jest przyłączony hormon steroidowy. Hormony peptydowe (np. hormon wzrostu, insulina itp.) nie wnikają do wnętrza komórki, a jedynie wiążą się z receptorami błonowymi. Wiązanie takie wywołuje wiele reakcji. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników, których mechanizm działania jest jeszcze słabo rozpoznany, lub też z udziałem przekaźników modyfikujących białka w cytoplazmie, co można uznać za regulację ekspresji genów na etapie potranslacyjnym.

3.7.2. Geny homeotyczne
Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych, a z drugiej strony od różnicowania się komórek. Poznanie genów od62

powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. Rozwój muszki owocowej przebiega pod kontrolą genów, które odpowiadają za poszczególne etapy morfogenezy. Geny te funkcjonują w układzie hierarchicznym, tzn. ich ekspresja następuje w ściśle określonej kolejności. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną. Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne, które w genomie muszki owocowej występują w dwóch kompleksach, ANT-C i BX-C, położonych w jednym chromosomie. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia, a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. Struktura tych genów wykazuje zaskakujące podobieństwo. Okazało się, że mają one sekwencję o długości około 180 pz (tzw. homeoboks), która koduje fragment białka (tzw. domena białkowa) o długości 60 aminokwasów. Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks. Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. U ssaków geny te, w liczbie około 30, zgrupowane są w czterech kompleksach: HOX1, HOX2, HOX3 i HOX4.

3.7.3. Metylacja DNA
Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA, która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej, czego skutkiem jest przejście DNA w stan nieaktywny. Oznacza to, że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu. Prawie cały DNA zawiera zmetylowaną cytozynę, a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. Trzeba jednak podkreślić, że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się, że około 56% genów zawiera te sekwencje. Wynika z tego, że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów. Obok wielu genów, których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących
63

w części poprzedzającej gen, czyli ze strony końca 5', znane są liczne geny, dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną, czyli nie wpływa na prawidłowość replikacji wysepek CpG. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji, wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych. Jeden z nich -— HpaII przecina sekwencję CCGG, w której cytozyny nie są metylowane, a drugi — MspI przecina tę sekwencję niezależnie od tego, czy cytozyna jest metylowana, czy niemetylowana.

3.7.4. Piętno gametyczne
W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze, tzn. genotyp Aa jest równoważny genotypowi aA, czyli nieistotne jest, od którego z rodziców pochodzi allel A, a od którego allel a. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję, zależną od tego, czy allel pochodzi od ojca, czy od matki. Zjawisko to niekiedy dotyczy całych regionów chromosomowych, które mogą być nieaktywne, gdy pochodzą np. od matki, lub aktywne, jeśli pochodzą od ojca. Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. gametic imprinting). Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego, a także w komórkach somatycznych organizmu dorosłego. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna, typowy dla danej płci (ryć. 3-8). Dowód na to, że do rozwoju osobniczego niezbędny jest zarówno genom ojca, jak i genom matki, a nie tylko diploidalna liczba chromosomów, znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. Powstałe na drodze manipulacji zarodki ginogenetyczne, tzn. zawierające dwa genomy żeńskie, rozwijały się dość dobrze, z tym jednak że struktury wywodzące się z trofoblastu, czyli uczestniczące w formowaniu łożyska, były zdecydowanie niedorozwinięte. Natomiast zarodki androgenetyczne, tzn. mające dwa genomy męskie, dobrze rozwijały struktury trofoblastu, niedorozwinięty zaś był sam zarodek. W obu przypadkach dochodziło do obumarcia zarodka. Jedynie zarodki zawierające zarówno genom żeński, jak i męski rozwijały się prawidłowo. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych, w które zaangażowane są fragmenty podlegające piętnowaniu. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca, to
64

M

r

ZYGOTA
2ENSKA

M P ZYGOT-A MĘSKA

Ryć. 3-8. Piętnowanie gametyczne. Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony, a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym. P — chromosom pochodzący od ojca, M — chromosom pochodzący od matki

wówczas rozwija się zespół zmian fenotypowych (m.in. otyłość i niedorozwój umysłowy), który nosi nazwę zespołu Pradera-Willego. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m.in. głębokie upośledzenie umysłowe, brak mowy, drgawki) określanych jako zespół Angelmana. Przyjmuje się, że fragment chromosomu 15 podlega piętnowaniu gametycznemu. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca, a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. Podobna sytuacja powstaje, gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego, a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska). Wiadomo, że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego, podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. ubiquitin protein ligase E3) pochodzenia matczynego. Wynika z tego, że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej, a inny w gametogenezie żeńskiej. Tak więc, tylko jeden gen — UBE3A nie podlega ekspresji, jeśli pochodzi od ojca, natomiast kilka genów (m.in. gen SNRPN — ang. smali nuclear ribonucleoprotein polypep65

tide N), nie ulega ekspresji, jeśli są położone w chromosomie pochodzącym od matki. W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. Może się jednak zdarzyć, że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. Przykładem może być gen Igf2 (ang. insulin growth factor type 2) u myszy, który podlega piętnowaniu podczas gametogenezy żeńskiej. W genie tym występują dwa regiony, które podlegają metylacji. W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji, a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego. Sytuacja ta jest spowodowana tym, że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca, do którego nie może się przyłączyć białko (represor), wywołujące zahamowanie transkrypcji. W efekcie oba allele są transkrybowane. Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego, co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych, niezbędnych do podjęcia transkrypcji. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych, które są objęte zjawiskiem piętnowania gametycznego. Na przykład, duże fragmenty chromosomu 7, a także 11 i 12 podlegają piętnowaniu. Obecnie znane są 34 geny, które podlegają piętnowaniu gametycznemu u myszy.

3.7.5. Inaktywacja chromosomu X w zarodkach żeńskich
Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. W komórkach męskich występuje tylko jeden chromosom X, obok chromosomu Y. Stan taki określany jest terminem hemizygotyczności. W komórkach żeńskich występują dwa chromosomy X, ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. Okazało się, że inaktywacją chromosomu X jest formą piętnowania, które zachodzi podczas wczesnego rozwoju zarodkowego. W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX). W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X, czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego, albo matczynego.
66

Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. W konsekwencji organizm żeński jest swoistą mozaiką, w której część komórek ma aktywny chromosom pochodzenia ojcowskiego, a część pochodzenia matczynego (ryć. 3-9). Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym, a jego obecność ujawnia się w postaci tzw. ciałka Barra. W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R, które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. Barwienie to pokazuje, że nieaktywny chromosom X jest replikowany w późnym okresie fazy S. Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X. Wiadomo, że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3. W centrum inaktywacji zidentyfikowano locus Xist (ang. X inactive specific transcript), który pełni główną rolę w uruchomieniu inaktywacji. Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X. Później, ekspresja genu Xist pojawia się losowo, albo w chromosomie ojcowskim, albo matczynym. W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu. Inaktywacja jest związana z metylacją DNA danego chromosomu, który to stan jest utrzymywany w komórkach potomnych. Warto zaznaczyć, że produktem locus Xist jest niekodujący RNA (ncRNA). Spełnia on funkcję regulacyjną, w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X.

Rozdział

4

4.1. Endonukleazy restrykcyjne
Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. metody in situ) bądź w wyizolowanym DNA lub RNA. Większość metod wymaga fragmentacji (pocięcia; strawienia) DNA, co umożliwia np. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne, nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów, niszcząc niepożądane, obce cząsteczki DNA. W celu ochrony własnego DNA przed działaniem restryktaz, bakterie wykształciły system restrykcji-modyfikacji. System ten polega na tym, że bakterie wytwarzają dwa rodzaje enzymów. Jeden to endonukleazy, rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów, drugi to metylotransferazy (zwane też metylazami), które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak, by nie zostały przecięte przez endonukleazy. Ponieważ obcy, np. wirusowy, DNA nie jest odpowiednio oznaczony (zmetylowany), niszczony jest przez endonukleazy bakterii. Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz. Nazewnictwo endonukleaz tworzone jest w ten sposób, że pierwsza litera stanowi skrót nazwy rodzaju bakterii, druga i trzecia — gatunku, następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii, ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii. Na przykład, enzym HindIII pochodzi z bakterii Haemophilus influenzae, serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. Endonukleazy dzieli się na trzy klasy, w zależności od ich mechanizmu działania, substratów i produktów, a także kofaktorów. Do klasy I enzymów 69

zaliczane są te restryktazy, które wykazują aktywność nukleazy, a ich działanie zależy od obecności takich kofaktorów, jak ATP, jony magnezu (Mg2+) i S-adenozylometionina. Cechą tych enzymów, utrudniającą ich wykorzystywanie w analizie DNA, jest to, iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów, ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I, czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna, ale wzmacnia ich aktywność). Różnica między tymi dwiema klasami polega na tym, że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1.
Tabela 4-1
Przykłady enzymów restrykcyjnych

70

Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. 4-1). Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6, rzadziej 8 nukleotydów, charakteryzujące się dwustronną symetrią (tzw. sekwencje palindromowe). Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie, dając fragmenty mające tzw. tępe końce. Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach, czego konsekwencją jest powstawanie fragmentów DNA o tzw. lepkich końcach. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej. Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję:

Niektóre enzymy, mimo że pochodzą z różnych szczepów bakterii, rozpoznają te same sekwencje DNA. Są to izoschizomery. Jednak miejsca, w których enzymy przecinają te sekwencje, mogą być różne.

Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum)

przecinają rozpoznaną sekwencję w różnych miejscach:

od rozpoznawanej sekwencji. Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'...GAAGA(N)8'...3' 3'...CTTCT(N)7...5'
podobnie enzym FokI (Flavobacterium okeanokoites):

5'...GGATG(N)9'...3' 3'...CCTAC(N)13...5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA, a tylko nieliczne enzymy (np. HinPI) tną jednoniciowy DNA. Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą, w której mieszanina DNA z enzymem jest inkubowana, oraz składem buforu. Niektóre enzymy potrzebują takich samych buforów. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych. Są one podstawowym narzędziem, wykorzystywanym m.in. do sporządzania map genomowych, sekwencjonowania DNA, izolacji i identyfikacji genów, klonowania molekularnego i rekombinacji genów czy fragmentów genomu, diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP).

4.2. Wektory
Wektory są podstawowym narzędziem klonowania DNA. Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora, do którego fragment ten został uprzednio włączony (rekombinacja molekularna). W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii). Wektor (np. plazmidowy, fagowy, drożdżowy) jest zdolny do autonomicznej replikacji. Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA, opisane pod względem fizycznym i genetycznym, mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza, • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców), • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki, którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji, • powinny mieć jeden lub kilka silnych promotorów tak, aby wstawiając
72

w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów, • zawierają znaczniki (markery), za pomocą których można je ziden tyfikować, np. geny oporności na antybiotyki, • nie są zdolne do przeżycia poza komórką gospodarza, • ze względów etycznych wektor nie powinien mieć genów, korę mogą stanowić zagrożenie ekologiczne.
RODZAJE WEKTORÓW

Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi), plazmidy i kosmidy.
Wektory plazmidowe

Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori, gen oporności na antybiotyk, umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd, „polilinker" (miejsce wielokrotnego klonowania), którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. Najczęściej jest to gen kodujący enzym, rozkładający barwny substrat, np. gen β-galaktozydazy oznaczony symbolem lacZ. Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie. Przykładowy wektor plazmidowy pUC19, który ma długość 2686 par zasad, przedstawiony jest na rycinie 4-1.
Kosmidy

Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. Kosmidy służą do klonowania większych cząsteczek DNA, długości 10-40 kpz, i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych.
Wektory fagowe

Spośród wektorów fagowych największe znaczenie ma fag λ. Za pomocą modyfikacji molekularnych (np. eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. Podobnie jak
73

Ryć. 4-1. Schemat wektora plazmidowego pUC19. Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz

w przypadku wektorów plazmidowych, do wektorów fagowych wprowadzono polilinkery, geny markerowe i silne promotory. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych, ale efektywność tego działania jest większa.
Sztuczny chromosom bakteryjny (BAC)

Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang. bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. coli. Do klonowania fragmentów DNA w organizmach eukariotycznych (np. drożdżach, komórkach ssaków) stosowane są:
Wektory — pochodne wirusów

Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych. W przypadku komórek zwierzęcych są to pochodne wirusów SV40, Papilloma, krowianki, bakulowirusów, adenowirusów i retrowirusów. Najwcześniej był stosowany wirus SV40, którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu, wadą natomiast organiczona długość wbudowanego obcego DNA. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). Są one również stosowane w somatycznej terapii różnych schorzeń.
Wektory drożdżowe

Wektory te wykazują zdolność replikacji tak w komórkach drożdży, jak
74

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

przerwa. Enzymem używanym do tej reakcji jest termostabilna ligaza, która łączy specyficznie dwa przyległe oligonukleotydy, gdy są one zhybrydyzowane z komplementarną matrycą. Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C). Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje, że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami), wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. Te dwa etapy są powtarzane, a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach, amplifikując badany gen (odcinek DNA). Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. mutacja punktowa), wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji. Reakcja ta stosowana jest do wykrywania mutacji punktowych, co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych). W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego, np. z zastosowaniem biotyny. O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. RT-PCR (ang. reverse transcription-polymerase chain reaction). Odwrotna transkrypcja-PCR. Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego. Nie może być natomiast
81

wykorzystana w badaniach ekspresji genów, w których określana jest ilość mRNA, jak również do wykrywania wirusów, których materiałem genetycznym jest RNA. W tych przypadkach może być stosowana metoda RT-PCR, polegająca na tym, iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją, podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA). Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. SSCP (ang. single stranded conformation polymorphism). Polimorfizm konformacji jednoniciowych łańcuchów DNA; jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA, a następnie jego denaturacji i elektroforezie. Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA, które przyjmują określoną konformację przestrzenną. Konformacja ta zależy od sekwencji nukleotydów, bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością. Jeśli badany DNA pochodzi od nosiciela zmutowanego genu, to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to, że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA. Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod, np. RFLP lub sekwencjonowania, które jest oczywiście najbardziej precyzyjne. Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ.

4.5. Techniki hybrydyzacji i sondy molekularne
Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe. Jak wiadomo, między nićmi DNA:DNA, RNA: RNA i RNA: DNA istnieją wiązania wodorowe, które ułatwiają ten
82

proces. Zjawisko to stało się podstawą metod analizy kwasów nukleinowych, takich jak hybrydyzacja Southern blotting (DNA), northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). Ogromną zaletą hybrydyzacji jest to, że można ją stosować nawet wówczas, gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA. Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe, czyli cięższe fragmenty) lub poliakryloamidowym (krótsze, lżejsze, do 500 par zasad). By była możliwa hybrydyzacja sondy z badanym DNA, kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego). Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy, który przenikając przez żel zabiera ze sobą fragmenty DNA. Fragmenty te są następnie zatrzymywane na filtrze. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. wirusów lub organizmów wyższych), klonowane sekwencje lub syntetyczne oligomery stosowane w PCR. Technika northern blotting, stosowana w hybrydyzacji kwasu rybonukleinowego, który jest nicią pojedynczą, nie wymaga etapu denaturacji. Znakowanie sond. Sonda musi być odpowiednio wyznakowana, by było możliwe wykrycie powstałej hybrydy. Sposób znakowania sond można podzielić na dwie główne grupy: 1. Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy. Znakowanie izotopowe charakteryzuje się dużą czułością, jednak niewielką rozdzielczością. Wadą sond znakowanych izotopem jest również to, iż muszą być stosowane wkrótce po ich wyznakowaniu. Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P), który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1,71 MeV — megawoltów), czas półtrwania 14,3 dnia. Izotop ten jest stosowany do znakowania DNA i RNA, a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP, dCTP i UTP a 32P,
83

• izotop siarki (35S), emitujący promieniowanie β, które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0,167 MeV), okres półtrwania 87,1 dnia. Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych, głównie DNA. Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S, tak powstają pochodne nukleotydów, • tryt (3H), który emituje promieniowanie β (energia promieniowania E = 0,018 MeV), okres półtrwania 12,26 roku, używany jest do znakowania kwasów nukleinowych, głównie DNA. Podstawowym źródłem trytu jest trytowana tymidyna. 2. Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np. biotyny, digoksygeniny). Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego), w zależności od zastosowanego znacznika. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach. Znakowanie nieizotopowe zapewnia dobrą rozdzielczość, ale daje mniejszą czułość detekcji. Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). Znakowanie sond można przeprowadzać za pomocą kilku różnych metod. Hybrydyzacja na filtrach. Hybrydyzację z wyizolowanym DNA można przeprowadzać, gdy jest on unieruchomiony na filtrze. Zaletą tej metody jest to, iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji. Hybrydyzacja jest poprzedzona prehybrydyzacją, której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny, z wyjątkiem obecności sondy. Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę. Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura, w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą, w której przebiega hybrydyzacja. Przyjmuje się, że różnica ta powinna wynosić 20-25°C. Hybrydyzację przeprowadza się z reguły w temperaturze 68°C. Na wydajność hybrydyzacji wpływają także inne czynniki, jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg), stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+. Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C), a detekcja sygnału jest poprzez autoradiografię (ryć. 4-6).
84

Wykorzystanie metody hybrydyzacji. Metoda hybrydyzacji służy m.in. do wykrywania ściśle określonych fragmentów DNA (np. w diagnostyce chorób). W metodzie zwanej „odcisk palca" DNA (ang. fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. Podobnie jak metoda PCR, również hybrydyzacja może być przeprowadzana na preparatach chromosomowych. Metoda ta nosi nazwę hybrydyzacji in situ (ISH). Jej różne warianty są opisane w rozdziale: Mapy genomowe. Hybrydyzacja w zminiaturyzowanej postaci, określana jako technika mikromacierzy DNA, pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. Na niewielkiej płytce (ok. l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja). Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana.
85

4.6. Polimorfizm fragmentów restrykcyjnych DNA (RFLP)
Polimorfizm fragmentów restrykcyjnych DNA (ang. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego. Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu. Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP). Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych. Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze, czyli lżejsze, tym szybciej. Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału, natomiast dalej będą prążki o zmniejszającej się masie. Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus. Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'...ATAGCTT ...3' 3'...TTCGA,A-..5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości. Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll):

GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT
Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA:

GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA,ATCCAGTCCTCGCCTGATTTCGAA,AGGCTAT
86

Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz, 11 pz i 7 pz. Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów, których budowa molekularna jest znana; wśród nich są geny determinujące cechy jakościowe, a także ilościowe (ang. quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe, Geny o dużym efekcie, Interseksualizm.

4.7. Biblioteki genomowe i genowe
Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka, wprowadzonych za pomocą wektorów do bakterii. Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest, omówiona wcześniej, metoda rekombinacji molekularnej.
Tworzenie biblioteki genomowej

Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym. Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii. Proces ten jest opisany w części dotyczącej klonowania DNA. W zależności od wielkości fragmentów DNA używane są różne wektory. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe, natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory, jak kosmidy, sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe).
Tworzenie biblioteki genowej (cDNA)

Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. Materiałem wyjściowym w tym przypadku jest RNA. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA. Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA. Tak otrzymany cDNA zawiera tylko sekwencje kodujące, czyli eksony. Jest on amplifikowany 87

metodą PCR, a następnie rekombinowany z wektorem i wprowadzany do bakterii. W ten sposób każdy klon bakterii ma cały określony gen. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań. Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem, wykorzystuje się bibliotekę genomową. Biblioteka genomowa jest również przydatna w poszukiwaniu genu, o którym niewiele wiadomo. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. chromosome walking), której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda, która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący, nieznany jeszcze fragment. Postępujemy tak do momentu, gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej). Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej, czyli reakcji antygen-przeciwciało. W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen. Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki.

4.8. Sekwencjonowanie DNA
Sekwencjonowanie DNA, polegające na określeniu sekwencji nukleotydów, jest stosowane dość często w genetyce molekularnej, przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy. Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. Metoda enzymatyczna została opracowana w 1977 roku przez F. Sangera. Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą), przeprowadzane są cztery oddzielne reakcje syntezy DNA. Każda z czterech probówek zawiera matrycowy DNA, starter, mieszaninę deoksynukleotydów, bufor reakcyjny, polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP, ddCTP, ddGTP lub ddTTP (ryć. 4-7). Rolą tych dideoksynukleotydów (tzw. terminatorów) jest zakończenie syntezy nici
88

autoradiogram żelu sekwencyjnego

Ryć. 4-7. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera; kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp., Postępy Biologii Komórki, 25 supl. 10 :219-237, 1998)

komplementarnej w miejscu włączenia określonego dideoksynukleotydu. W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości, kończące się odpowiednim nukleozydem, zależnie od użytego w reakcji dideoksynukleotydu. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki, ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany, by tylko część syntetyzowanych fragmentów DNA uległa terminacji. Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm, grubości 0,2-0,6 mm). W celu detekcji prążków DNA, metodą autoradiografii, w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89

kleotydy lub wyznakowany starter. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. Enzymatyczna metoda sekwencjonowania ma tę zaletę, że jest szybka, ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów. Metoda chemiczna, opracowana w 1977 roku przez Maxama i Gilberta, polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów. Do rozszczepiania wykorzystywane są hydrazyna, siarczan dimetylu (DMS) i kwas mrówkowy, które mają zdolność modyfikacji zasad w cząsteczce DNA. Do mieszaniny reakcyjnej dodawana jest także piperydyna, która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. Sekwencjonowanie metodą chemiczną przeprowadza się, podobnie jak przy metodzie enzymatycznej, w czterech oddzielnych probówkach. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. 4-8):

autoradiogramżelusekwencyjnego

Ryć. 4-8. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta; kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp., Postępy Biologii Komórki, 25 supl. 10 :219-237, 1998)

90

W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca, których długość zależy od miejsca rozszczepienia łańcucha DNA. Następnym etapem, podobnie jak w metodzie enzymatycznej, jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym, autoradiografia i odczytanie sekwencji nukleotydów. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane, kilka firm oferuje specjalistyczną aparaturę. Najnowsza metoda sekwencjonowania, tzw. pyroseąuencing, znacznie różni się od powyższych metod. Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA, przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny. Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego, zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba).

4.9. Badanie ekspresji genów
Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek; northern blotting; RT-PCR) i translacji (western blotting). Jedna z wymienionych metod, hybrydyzacja in situ na skrawkach tkanek, pozwala także na wyróżnienie grup komórek, które morfologicznie nie różnią się od sąsiednich, ale są inne pod względem biochemicznym. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji. Różnią się one od innych komórek ekspresją pewnych genów, nieaktywnych w komórkach zdrowych.

4.10. Transgeneza
Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. Zwierzęta transgeniczne to takie, które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika. Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80. do zygoty myszy szczurzego genu hormonu wzrostu. Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. Samce transgeniczne przekazywały swojemu potomstwu obcy gen, natomiast samice były niepłodne. Podobne 91

rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza, najczęściej męskiego, zapłodnionej komórki jajowej. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich; • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. Wielkość fragmentu DNA, około 8 kpz, który może być wprowadzony tą metodą, ogranicza jej stosowanie. Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa, które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego; • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. embryonic steam cells). W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro. Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC, które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. blastocyst pozbawionych węzła zarodkowe go). Jak dotychczas opisana technika jest stosowana z sukcesem u myszy. Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. Na razie nie mamy żadnego wpływu na to, w którym miejscu genomu włączy się transgen. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne, nawet niekorzystne. Należy jednak zauważyć, że w procesie transgenezy wprowadzane są konstrukty genowe, które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu, umożliwiającej ukierunkowaną ekspresję transgenu (np. w gruczole mlecznym).
Wykorzystanie techniki transgenezy

1. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost, np. gen struktury hormonu wzrostu (ang. growth hormone — GH); 92

• modyfikacji składu mleka; duże nadzieje wiąże się z poprawą jakości białek mleka. W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy; • modyfikacji cech biochemicznych u zwierząt, na przykład poprawy jakości i tempa wzrostu wełny, poprzez wprowadzenie do genomu owiec genów białek keratynowych. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie. Odporność na choroby można uzyskać przez wprowadzenie do komórek
93

zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych, blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny, najlepiej dominujące, kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii, których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. 2. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek. Zaletą tej metody jest to, iż samice transgeniczne wytwarzają mleko zawierające obce białko. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc), krowy wytwarzające mleko z ludzką laktoferyną, świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię). Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu, których celem jest ocena jego wpływu na wzrost, laktację, metabolizm węglowodanów i lipidów. Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu, wykazujące karłowatość. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw. ksenotransplantów) dla ludzi. Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem, z powodu nadostrej reakcji układu immunologicznego biorcy, prowadzącej do odrzucenia przeszczepionego narządu. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. 3. Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych, które wykazują nadekspresję określonych genów, ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych.

Rozdział

Mutacje

Mutacje to nagłe i trwałe zmiany w informacji genetycznej. Dzieli się je na: genomowe, chromosomowe i genowe. Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. Mutacje chromosomowe, nazywane też aberracjami chromosomowymi, związane są z naruszeniem budowy chromosomu, a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. Wreszcie mutacje genowe dotyczą zmian w budowie genu, a poznanie ich podłoża wymaga zastosowania metod molekularnych. Mutacje mogą powstawać samoistnie, jako wynik błędów w przebiegu niektórych procesów komórkowych, takich jak replikacja DNA czy podział jądra komórkowego, a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych, czyli takich, które uszkadzają DNA lub strukturę chromosomu (np. promieniowanie jonizujące, niektóre związki chemiczne). W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu. Należałoby zatem rozróżnić proces przenoszenia mutacji, powstałych de novo, przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji, za pośrednictwem komórek płciowych, przez następne pokolenia. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas, gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi, obserwowanymi wśród organizmów żywych. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy, dlatego większość z nich jest niekorzystna dla organizmów. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji, które były korzystne lub obojętne dla organizmu. Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji, a ponadto, cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych
95

pokoleń. Dlatego można bez większych zastrzeżeń przyjąć, że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych, a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista, ponieważ obok mutacji szkodliwych (np. choroby genetyczne) znanych jest wiele przykładów pokazujących, że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej, pojawiające się od czasu do czasu na fermach zwierząt futerkowych. Znane są i inne mutacje, które wpływają korzystnie na cechy produkcyjne zwierząt, takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny), wysoka plenność u niektórych ras owiec (np. mutacja w genie BMPR-IB) itp. W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji, z jakimi spotykamy się w hodowli zwierząt gospodarskich.

5.1. Mutacje genomowe
Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. Na przykład, zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia, monoploidia). Jeżeli powstają układy o większej liczbie genomów niż dwa, to stan ten określa się jako poliploidalność. Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości, wśród których do najważniejszych zalicza się (ryć. 5-1): 1. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik, co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). Zdarzenia takie określa się mianem połispermii. 2. Zaburzenie przebiegu mejozy, głównie żeńskiej, prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego, a oocyt II rzędu ma diploidalną liczbę chromosomów. Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II, która odbywa się już po wniknięciu plemnika do oocytu. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna.
96

Ryć. 5-1. Niektóre mechanizmy powstawania mutacji genomowych typu euploidii

3. Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności, np. tetraploidalne oogonium, które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. 4. Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza), czego skutkiem jest rozwój haploidalnego zarodka. W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego, to znaczy takiego, gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności, np. 2n i 4n czy 2n i 3n itd. Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka, takich na przykład jak brak cytokinezy po podziale jądra komórkowego. Ponieważ komórki te wywodzą się z jednej zygoty, układ taki klasyfikowany jest jako mozaicyzm. Euploidie są mutacjami letalnymi, co oznacza, że prowadzą one do śmierci osobnika, zazwyczaj we wczesnym okresie rozwoju zarodkowego. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo). Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym. Mutacje te są jedną z przyczyn niepowodzeń 97

w rozrodzie zwierząt. Trudno jednak określić, jaka jest skala tego problemu. Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika, że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. Aneuploidia to druga kategoria mutacji genomowych, która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. Tak więc brak chromosomu nazywa się monosomią (2n — 1), a nadmiar chromosomów to trisomia (2n +1). Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów, to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). Jeśli natomiast występuje brak obu chromosomów w parze, to stan taki określany jest jako nullisomia (2n —2), a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. Nieprawidłowa segregacja w jednym biwalencie, gdy oba chromosomy zmierzają do jednego bieguna komórki, prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1. Jeżeli gamety takie będą uczestniczyły w zapłodnieniu, to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki, to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. zarodka) prowadzi do mozaicyzmu. Zdecydowana większość aneuploidii jest letalna. Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela, jednak powodują powstanie licznych wad rozwojowych. Wyjątek stanowią aneuploidie chromosomów płci, którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci. Zazwyczaj mutacje te stwierdzano w układzie mozaikowym, w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. Wskazuje to, że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. Równocześnie wynika z tego, że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. 5-2a). Klacz obarczona tą mutacją ma kariotyp 98

2n = 63,X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63,XO/64,XX. Zwierzęta takie mają zasadniczo normalny eksterier, zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników. W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy, dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego. Znane są również przypadki trisomii XXY u buhajów. Osobniki takie mają diploidalną liczbę chromosomów 61,XXY lub występuje u nich układ mozaikowy 60,XY/61,XXY.

99

Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością, z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder, co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć. 5-2b). W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza, że osobniki mające w swoim kariotypie trzy chromosomy X są płodne. W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. Jest to skutek segregacji chromosomów w anafazie I, w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią. Przedstawione wyżej prawidłowości wskazują, że aneuploidie ilekroć się pojawiają, to zazwyczaj mają pochodzenie de novo, gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela, albo głębokie zaburzenia rozwojowe lub bezpłodność. Dzięki temu, poza nielicznymi wyjątkami, nie ma ryzyka przeniesienia tej mutacji na następne pokolenia, a zatem i szerokiego rozprzestrzenienia w populacji. Niemniej jednak, niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy, wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni, ze względu na dość częste występowanie u klaczy monosomii chromosomu X, której zdiagnozowanie, bez zastosowania metod cytogenetycznych, jest niemożliwe.

5.2. Mutacje chromosomowe
Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). Jeżeli pęknięcie nie zostanie naprawione, przez odpowiedzialne za to systemy naprawy komórkowej, to nastąpi utrata fragmentu chromosomu (delecja). Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna, tandem fuzja, translokacja wzajemna). Mogą powstać także inne nietypowe struktury, takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu, podczas podziału komórkowego. Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu, a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu. Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd
100

niesiostrzanych podczas crossing over, prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. Mutacja chromosomowa może wystąpić w układzie zrównoważonym, jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej, lub też w układzie niezrównoważonym, gdy ilość informacji genetycznej w komórce została zmieniona. Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje, duplikacje, izochromosomy). Inne — tzn. translokacje wzajemne, tandem fuzje, fuzje centryczne, inwersje, występując pierwotnie w układzie zrównoważonym, mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych, a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas, gdy występuje ona w komórkach linii płciowej. Mutacje chromosomowe, których skutkiem jest przegrupowanie informacji genetycznej w kariotypie, prowadzą do zmiany sąsiedztwa genów. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. Zdarzyć się może, że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor, wzmacniacz, wyciszacz), jak i ze strukturą samego genu. Znane są liczne przykłady u ludzi, a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów, czego skutkiem jest uruchomienie procesu nowotworowego. U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. Wynika to przede wszystkim z tego, że mutacje chromosomowe niezrównoważone, podobnie jak aneuploidie, są letalne lub prowadzą do poważnych, zauważalnych zmian fenotypowych. Przypadki takie, odnotowywane jako martwe urodzenie, padnięcie po urodzeniu lub ubój z konieczności, bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć, że zdecydowana większość tych przypadków nie jest identyfikowana. Z kolei mutacje zrównoważone, nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych, mają najczęściej negatywny wpływ na płodność nosiciela mutacji. Jeżeli dotknie to osobnika o dużej wartości genetycznej, to szansa na wykrycie nosicielstwa mutacji jest znacznie większa, bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np. buhaje), ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych, które w momencie powstania mają charakter zrównoważony. Zaliczane są do nich: fuzje centryczne, inaczej centromerowe (translokacje robertsonowskie), fuzje tandemowe, translokacje wzajemne i inwersje, wśród których wyróżniane są inwersje peri- i paracentryczne. Szczególna
101

uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji. Fuzja centryczna (translokacja robertsonowska) powstaje wówczas, gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru, a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć. 5-3a,

102

5-4a). Duże fragmenty, reprezentujące prawie cale ramiona długie chromosomów, zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom, natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy). Utrata małych fragmentów z okolicy centromeru, który zawiera przede wszystkim niekodujące sekwencje powtarzalne, nie odbija się negatywnie na nosicielu.

Ryć. 5-4. Translokacje robertsonowskie: (a) rob(l;29), buhaj, barwienie roztworem Giemsy; chromosom translokacyjny oraz chromosomy pici są wskazane; (b) rob(5;7), kozioł, kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym; triwalent oraz biwalent X-Y są wskazane

103

Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden, z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych. Jeżeli fuzji uległy chromosomy homologiczne, to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent, natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom, podczas gdy na drugim biegunie zabraknie jednego chromosomu. Prowadzi to oczywiście do tego, że połowa gamet będzie typu n —l (układ powstający na biegunie, do którego nie przeszedł chromosom dwuramienny), a druga będzie miała n chromosomów, z tym jednak że wśród nich będzie chromosom dwuramienny, co w rzeczywistości odpowiada układowi n + 1. W przypadku zapłodnienia powstają zygoty aneuploidalne, które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego. Zupełnie inaczej przedstawia się sytuacja, gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych. Jeżeli komórka taka rozpocznie podział mejotyczny, to w pachytenie profazy I uformuje się triwalent, w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. 5-3b, 5-4b). W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji, podczas której chromosom dwuramienny przechodzi do jednego bieguna, a oba chromosomy akrocentryczne do drugiego bieguna komórki. W efekcie powstają gamety o zrównoważonej informacji genetycznej, mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety, a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych, czyli ukształtuje się układ aneuploidalny. Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. Należy zaznaczyć, że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób, jak poprzez badanie cytogenetyczne. Fuzje centryczne są często identyfikowane u bydła, szczególnie ras mięsnych. Opisano wiele różnych fuzji, w których uczestniczyły chromosomy z różnych par, ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. 5-4a). Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. Pięć lat później ten sam badacz wykazał, że jej nosiciele mają zmniejszoną płodność o około 5%. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła, na wszystkich kontynentach, a w tym również w Polsce. Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard, blonde d'Aquitaine itp.),
104

a niekiedy także w małych izolowanych rasach lokalnych (np. białe bydło rrytyjskie, włoskie bydło rasy podolian czy bydło korsykańskie). Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. Oprócz fuzji 1;29 zdiagnozowano wiele innych przypadków, w których zaangażowane były chromosomy z innych par. Przykładem może być fuzja między chromosomami z pary 5 i 22, którą opisano w Polsce. Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. Szwecja była pierwszym krajem, który wprowadził taką regulację. W Polsce, począwszy od 1989 roku, obowiązkowymi badaniami objęte są wszystkie młode buhaje, przed ich wprowadzeniem do stacji produkcji nasienia. Gatunkiem, u którego fuzja centryczna występuje bardzo często, jest lis polarny. W tym przypadku można wręcz mówić o polimorfizmie kariotypowym, bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona, jedynych w kariotypie lisa, dwóch par akrocentryków, nr 23 i 24), a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. Ciekawe, że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49, natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48.

Ryć. 5-5. Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. Chromosomy biorące udział w fuzji przedstawiono schematycznie

105

Należy podkreślić, że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela. Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej, to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60, 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję, 0 2n = 58 (ryć. 5-5). Przedstawione obserwacje wskazują, że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło, lisy polarne, a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia, a nie częstego powstawania de novo. Pokazuje to jedno cześnie, jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji, szczególnie wówczas, gdy rozród jest oparty na sztucznej inseminacji. Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych, pochodzących z dwóch różnych chromosomów. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów, to podczas mejozy dojdzie do powstania gamet, które będą obarczone bądź delecją, bądź duplikacją. Skutek takiej translokacji będzie zazwyczaj letalny, tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych. Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć. 5-6a, 5-7), to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. 5-6b, 5-8), który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2, tzn. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. Segregacja symetryczna (2:2) nie gwarantuje jeszcze, że powstaną gamety o zrównoważonej informacji genetycznej. Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. Jest to segregacja naprzeciwległa, w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par, a do drugiego przechodzą chromosomy, które uczestniczyły w trans lokacji. Należy zaznaczyć, że suma informacji genetycznej zawarta w dwóch chromosomach, które podlegały translokacji, jest taka sama jak w dwóch nie zmienionych chromosomach. W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. Dwa pozostałe rodzaje segregacji, określane jako sąsiednie, prowadzą do uformowania niezrównoważonej (delecje, duplikacje) ilości informacji genetycznej w gametach. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over, jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. Podobnie jak w przypadku fuzji centrycznej, także translokacją wzajemna jest mutacją dziedziczną, jeśli oczywiście wystąpi w linii komórek płciowych. Przyjmuje się, że około 50% gamet wytwarzanych przez
106

*Schemat nie uwzględnia segregacji tetrawalentu, w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany

Ryć. 5-6. Translokacja wzajemna: (a) schemat powstawania; (b) segregacja tetrawalentu podczas mejozy

nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu, to doprowadzą do powstania zygot, które będą ginęły zazwyczaj w życiu płodowym. Hodowca odnotuje
107

wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika. Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej, ale wśród nich połowa będzie miała układ, w którym wystąpią dwa translokowane chromosomy. Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo, w którym polowa będzie miała prawidłowy kariotyp, a połowa będzie nosicielami translokacji. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu. Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych, która prowadzi do bezpłodności samców nosicieli. Stan taki towarzyszy nosicielstwu translokacji wzajemnej, w którą zaangażowany jest chromosom X (translokacja typu X-autosom). Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). Przypuszcza się, że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy. U samic nosicielek stwierdza się jedynie zmniejszenie płodności, podobnie jak w przypadku translokacji typu autosom-autosom. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. 5-7). Do tej pory zidentyfikowano na świecie, w rozmaitych rasach, ponad 90 różnych translokacji wzajemnych, które były rozprzestrzenione w populacjach w różnym stopniu. Trzeba podkreślić, że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. Knury nosiciele mają prawidłowe libido, a obraz nasienia (koncentracja, morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie. Podobnie normalny fenotyp mają lochy nosicielki. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. Oczywiście stan taki może być spowodowany różnymi czynnikami. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów, po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie). Fuzja tandemowa jest mutacją podobną do fuzji centrycznej. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. Jedno z nich występuje w części końcowej ramienia w chromosomie jedno- lub dwuramiennym, a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego. W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim, a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione, podobnie jak w przypadku fuzji centrycznej. Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109

chromosomami akrocentrycznymi, to podczas mejozy, podobnie jak przy fuzji centrycznej, dojdzie do powstania aneuploidalnych gamet. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna, tzn. może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków, które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej. Mutacja ta jest dziedziczona przez połowę potomków nosiciela, analogicznie do schematu przedstawionego dla translokacji robertsonowskich. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. Znane są nieliczne przypadki tej mutacji u bydła, chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70. było dość duże. Oceniano wówczas, że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%. Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu, w którym wystąpiły dwa pęknięcia, a następnie zostały one niewłaściwie naprawione w taki sposób, że fragment pomiędzy punktami pęknięć został odwrócony o 180°. Jeżeli w obrębie odwróconego fragmentu występuje centromer, to wówczas inwersja jest określana jako pericentryczna. Jeżeli odwrócony fragment nie obejmuje centromeru, to nieprawidłowość jest określana jako inwersja paracentryczna. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu, z wyjątkiem sytuacji, gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. Przebieg koniugacji podczas pachytenu profazy I, w obrębie fragmentu objętego inwersją na jednym z chromosomów, może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną, która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu, 2) chromosomy częściowo pozostają nieskoniugowane — w części, gdzie na jednym z chromosomów występuje odwrócony fragment, oraz 3) pełna koniugacja, która częściowo jest niehomologiczna, tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym. Najmniej korzystny, z punktu widzenia skutków gametogenezy, jest pierwszy sposób koniugowania, podczas którego dochodzi do uformowania pętli inwersyjnej. Jeżeli w obrębie pętli zajdzie crossing over, to wówczas powstaną gamety obarczone delecją lub duplikacją, z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji, spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. Inwersje dość rzadko opisywano u zwierząt gospodarskich. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii, to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. Uwaga ta dotyczy
110

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

i protonów w cząsteczce zasady. W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH), zaś ketonowej na enolową (=C—OH), a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi, natomiast w formie enolowej łączy się trzema mostkami z cytozyną. Z kolei, guanina w normalnej formie (ketonowej) łączy się z cytozyną, a w formie tautomerycznej z tyminą. Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej, odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form. Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. Błąd włączania polega na tym, że enołowa forma tyminy łączy się z guanina. Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. Błąd replikacji zachodzi wówczas, gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina. Z kolei, w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. Skutkiem tego będzie pojawienie się pary G-C w miejscu, gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. Mutacje genowe mogą być także następstwem zakłóceń w splicingu, czyli tzw. obróbce mRNA, nazwanej dojrzewaniem. Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA), w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony). Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka, prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne. Dotychczas wykryto je u ludzi w 12 loci, z których 10 powoduje choroby genetyczne, między innymi chorobę Huntingtona, zespół kruchego chromosomu X, dystrofię miotoniczną. Mutacje te związane są z tzw. niestabilnymi sekwencjami DNA, należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym, iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. Im większy stopień zwielokrotnienia danej sekwencji, tym wcześniej rejestrowany jest początek objawów chorobowych. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę, zlokalizowanego w chromosomie 4. U ludzi zdrowych liczba powtórzeń wynosi 10-36, przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). Inną

117

cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw. piętno gametyczne. Jeśli allel zmutowany pochodzi od matki, różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4. Natomiast jeśli ojciec przekazuje zmutowany allel, różnica w długości sekwencji może dochodzić do 50%. Przypuszcza się, iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi.

5.4.2. Skutki mutacji genowych
Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. Taka sytuacja jest możliwa, gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów, trypletów). Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony. Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym, gdyż kodon AAC również koduje asparaginę. Należy podkreślić, iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym, dlatego nazywane są cichymi podstawieniami (ang. substitution at silent site). Są one wykorzystywane w analizie polimorfizmu DNA, identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. Jednym ze skutków mutacji genowych, polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie, mającym szczególne znaczenie dla molekularnej analizy DNA, jest polimorfizm fragmentów restrykcyjnych — RFLP (ang. restriction fragment length polymorphism). Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu, jak i intronu. Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu, ani kodowanego przez ten gen białka. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji:
118

1. Mutacje typu zmiany sensu - - na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. Na przykład, jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę, skutki tego mogą być dla organizmu letalne. Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. bovine leukocyte adhesion deficiency), przejawiająca się zmniejszeniem odporności cieląt, której następstwem jest śmierć przed ukończeniem 1. roku życia osobników homozygotycznych pod względem zmutowanego genu. Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. Jak już wcześniej wspomniano, mutacje genowe nie zawsze mają niekorzystny skutek. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła, warunkujący czarne umaszczenie. Mutacja ta jest przedstawiona na rycinie 5-10. Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+, która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. Innym przykładem mutacji typu zmiany sensu, odnoszącym się do polimorficznych białek, jest locus β-laktoglobuliny (białko mleka). Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G, w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy, oraz T→C (zapis dla DNA; w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi, mleka, nasienia i jaj zawiera rozdział: Markery genetyczne. 2. Mutacje typu nonsens (mutacja stop) - na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) -

Ryć. 5-10. Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła

119

amber (UAG), ochrę (UAA) lub opal (UGA), które nie kodują aminokwasów, lecz stanowią sygnał zakończenia translacji. Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen; powstaje krótszy N-końcowy fragment tego polipeptydu. Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna - cytrulinemia, występująca u bydła rasy holsztyńsko-fryzyjskiej. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. W jej konsekwencji, zamiast aktywnego enzymu składającego się z 412 aminokwasów, powstaje nieaktywny peptyd złożony z 85 aminokwasów. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. Cytrulinemia występuje również u ludzi, przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej, czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka, występuje u bydła. Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. Jest to schorzenie nazwane DUMPS (ang. deficiency uridine monophosphate synthase). Jest ono przyczyną zamierania zarodków, a w konsekwencji zmniejszenia płodności krów. 3. Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu, a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy. Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. Podobnie jak mutacje typu zmiany sensu, również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu. We wspomnianym już locus E u bydła allel recesywny e, kodujący u zwierząt homozygotycznych ee umaszczenie czerwone, powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady. Począwszy od kodonu 104 (GGT) dla glicyny, w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu, w procesie translacji przyłączane są inne aminokwasy. Schemat tej mutacji przedstawiono na rycinie 5-10. Bydło holsztyńskie ma umaszczenie z reguły czarno-białe, ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia, wykorzystujący to, iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl, natomiast allel dominujący ma takie miejsce. Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem, następnie roz120

dzielany elektrofor etycznie. Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego, dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. 4. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym, a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów); utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". Insercja trójki może spowodować: dodanie aminokwasu – w białku, jeśli trójka nukleotydów zostanie wstawiona między kodony; zamianę fazy odczytu, jeśli trójka „rozerwie" istniejący dotychczas kodon; możliwe jest także pojawienie się kodonu „stop". Mutacje te mogą prowadzić do poważnych zaburzeń, a nawet śmiertelnych chorób genetycznych. Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi, polegająca na zakłóceniu transportu jonów chlorkowych. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. Dotyczy to przede wszystkim trzustki, płuc i oskrzeli. Częstość występowania tej wady, prowadzącej do przedwczesnej śmierci, wynosi l: 2500 osób. Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego, zwanego CFTR (ang. cystic fibrosis transmembrane conductance regulator), pełniącego funkcję kanału chlorkowego. W obrębie tego genu wykryto wiele mutacji, przy czym najczęściej jest stwierdzana mutacja w eksonie 10, oznaczona symbolem ΔF508 (ryć. 5-11). Mutacja ta prowadzi

121

do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego. Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. i glicyna — 509 póz. łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny), a następnie sekwencja GGT dla glicyny. Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. Zwielokrotnienie powtarzającej się sekwencji CAG, kodującej aminokwas glutaminę, powoduje powstanie domeny glutaminowej, złożonej z takiej liczby glutamin, jaka jest zakodowana w sekwencji (CAG)n. 5. Mutacje zachodzące podczas obróbki potranskrypcyjnej, zwanej składaniem (ang. splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA, czego konsekwencją jest synteza zmienionego białka. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe, na przykład białko determinowane przez locus Albino (C). Gen C warunkuje wytwarzanie enzymu tyrozynazy. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. Częstość tych mutacji wynosi 10-40%. Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA, o czym pisano już wcześniej. W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów, natomiast w allelu F - 3 eksony kodujące 37 aminokwasów. Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika, na przykład wielopalczastość, skrócenie kręgosłupa u bydła i psów, oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. 5-12 wkładka kolorowa), a także umaszczenie zwierząt i inne, ale może być również rozpoznawalny w okresie późniejszym, na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka, najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. Często są to zaburzenia przebiegu szlaku metabolicznego (tzw. blok metaboliczny), w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. 5-13). Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej, przekształcającego fenyloalaninę w tyrozynę; powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny; 122

B. Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę), powodujący różny stopień nasilenia niedorozwoju umysłowego; C. Tyrozynoza -- niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego, biorącego udział w przemianie tego kwasu w kwas homogentyzynowy, nie powodujący wyraźnie złych skutków dla organizmu; D. Alkaptonuria -- brak oksydazy kwasu homogentyzynowego, prze kształcającego ten kwas w kwas maleiloacetooctowy; kwas homogen tyzynowy jest odkładany w stawach, chrząstkach i skórze wywołując stany zapalne, a jego nadmiar jest wydalany z moczem, powodując jego ciemnienie na powietrzu; E. Albinizm, czyli bielactwo - - brak enzymu tyrozynazy, przekształ cającego 3,4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę; osobniki albinotyczne mają bardzo jasną skórę, białe włosy, brwi i rzęsy, tęczówka oka nie jest zabarwiona, a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie. Albinizm występuje także u zwierząt. Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków, np. cukrów czy lipidów.

5.4.3. Mutacje genowe wpływające na cechy produkcyjne zwierząt
Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. Jednym z genów, którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich, jest gen hormonu wzrostu — somatotropiny (ang. growth hormone — GH).
123

Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw. kwaśne mięso (RN). U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2). U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych. U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang. estrogen receptor gene — ESR) a wielkością miotu. Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1,15 prosięcia u świń bardzo plennej rasy meishan i 0,42 prosięcia u wielkiej białej. Spośród wykrytych dotychczas mutacji, wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie, największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. Inne mutacje to: gen FecJ u owiec jawajskich, gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0,6 jagnięcia. Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią, wykryty u owiec rasy romney. Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie).

5.4.4. Mutacje genowe wywołujące choroby genetyczne
Mutacje genowe często prowadzą do powstania chorób genetycznych, które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu, np. metabolicznych, odpornościowych, endokrynologicznych, psychicznych itp. Należy jednak pamiętać, że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych. Stąd poznanie podłoża wielu chorób genetycznych, a szczególnie wrodzonych wad rozwojowych, sprawia dużo trudności. O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych.
5.4.4.1. Geny letalne, semiletalne i subwitalne

Wpływ szkodliwego działania zmutowanych genów jest różny. Zależnie od stopnia penetracji tych genów można je podzielić na:
124

• geny letalne, powodujące śmierć ponad 90% osobników, w których genotypach wystąpią w dawce aktywnej (np. homozygota recesywna), • geny semiletalne, powodujące w aktywnej dawce śmierć od 50 do 90% osobników, • geny subwitalne, które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych. Niektóre z nich, z nie wyjaśnionych dotąd przyczyn, powodują śmierć osobnika, w którego genotypie wystąpią. Również okres w życiu osobnika, w którym dany gen przejawia działanie letalne, może być różny. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego, inne zaś później, w okresie pourodzeniowym lub u dorosłych osobników. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym; powodując śmierć nie tylko homo-, ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce, nie ograniczając na ogół przeżywalności czy sprawności życiowej. Geny te działają letalnie w układzie homozygotycznym, natomiast u osobników heterozygotycznych nie są letalne, ale dają zauważalny efekt fenotypowy. Przykładem jest gen platynowego ubarwienia u lisów, gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w, warunkującego srebrzystą barwę włosa. Innym genem, będącym również wynikiem mutacji genu ω, jest gen W, warunkujący umaszczenie tzw. białopyskie. Oba zmutowane geny w układzie homozygotycznym (WpWp, WW) działają letalnie, również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia, uzyskamy wówczas lisy zdolne do życia, w stosunku l platynowy: l srebrzysty (ryć. 5-14 wkładka kolorowa). Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego, powodujących poważne zakłócenia procesu trawienia. Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry, który jest letalny w podwójnej dawce, w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). U kur gen achondroplazji (Cp) w układzie hetero-

125

zygotycznym (Cpcp) warunkuje krótkonożność. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31, warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. Zmienność tej cechy u krów jest duża. U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne, natomiast u homozygotycznych — bardzo wyraźne. Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie. Cecha ta występuje tylko u samic. U samców gen ten jest letalny. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się

W przypadku gdy matka jest heterozygotą, w potomstwie występuje stosunek samców do samic l: 2, co obrazuje schemat:

jedynie samice. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. Zakres działania tych genów jest różny, od niewielkich zmian (np. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń, jak achondroplazja recesywna. Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami, jak też od interakcji ze środowiskiem. Niektóre geny letalne mogą także powodować śmierć matki. Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec, bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. Geny semiletalne często jest trudno odróżnić od genów letalnych, gdyż ich działanie zależy między innymi od czynników środowiskowych. Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych, nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują, iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt, natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną.
126

Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych, a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe. Niektóre z tych genów są przyczyną zaburzeń metabolicznych, powodując tzw. bloki metaboliczne. Przykład takiego bloku podano już wcześniej. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego, powodując niepłodność czy utrudniając akt kopulacji. Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu. Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi, następny podrozdział dotyczy wad wrodzonych, ich rodzajów, sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich.
5.4.4.2. Choroby monogenowe wywołujące wrodzone wady rozwojowe

Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała, powstające w okresie płodowym. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika, inne ujawniają się w późniejszym okresie życia (np. epilepsja u bydła). Teratologia, nauka zajmująca się zaburzeniami rozwojowymi, wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała, obarczone nimi zwierzęta nazywane są potworkami, 2) wady — są to pewne zaburzenia w prawidłowej budowie, 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych, chromosomowych lub genomowych, 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód, wady te nie dziedziczą się. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. Zdarza się jednak, że niektóre anomalie, mimo że są pochodzenia pozagenetycznego, do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi. Wady takie, przypominające mutanty, a powstałe pod wpływem czynników środowiskowych, noszą nazwę fenokopii. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne. Można to uczynić biorąc pod uwagę:
127

1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie, 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich, jak i dalszych, 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika, 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka.
OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH

Wady układu kostnego

Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja, czyli zahamowanie rozwoju układu kostnego. Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii, dała początek nowej rasie bydła — dexter). Badania genetyczne wykazały, że płody dotknięte tą wadą, homozygotyczne pod względem genu niezupełnie dominującego, ulegają poronieniu zwykle przed ósmym miesiącem (ryć. 5-15 wkładka kolorowa). W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację, polegającą na insercji 4 nukleotydów w genie, którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany). Mutacja ta powoduje powstanie kodonu terminacyjnego, skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy, kodowany przez ten gen. Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. Nosicielstwo allelu achondroplazji, oznaczonego symbolem bd (ang. bulldog disease), stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej, charakteryzującego się wybitną wartością hodowlaną. Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy, skrócenie lub brak żuchwy, przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. creeper — pełzacz). Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. Do mutacji wpływających na cały kościec należy karłowatość. U bydła wada ta występuje u ras mięsnych (np. u herefordów). Jest to prosta cecha recesywna. Gen karłowatości u osobnika heterozygotycznego, powodując tylko nieznaczne skrócenie kończyn, wpływa pośrednio na zwięzłość budowy. U japońskiego bydła mięsnego, u którego występuje recesywna karłowatość chondrodysplastyczna (ang. chondrodysplastic dwarfism), cechująca się skróceniem kończyn, japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN).
128

Zaburzeniem, które występuje u większości ras bydła, a także u owiec, świń, a nawet ludzi jest tzw. amputacja kończyn (akroteriaza) (ryć. 5-16 wkładka kolorowa). Anomalia ta uwarunkowana jest genem recesywnym. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego, pęcinowego lub kolanowego. Wadzie tej często towarzyszą: skrócenie żuchwy, rozdwojenie podniebienia i brak większości zębów. U owiec niektórych ras mięsnych (suffolk, hampshire) w Stanach Zjednoczonych w latach 80. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. spider syndrome). Jest ona wynikiem mutacji (transwersja adeniny na tyminę, której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. fibroblast growth factor receptor 3 -- FGFR3). W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn, deformację grzbietu, żeber i mostka oraz części pyskowej (garbaty nos). Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka, a u tych, które przeżyły, stwierdza się osłabione zdolności rozrodcze, a nawet niepłodność. Anomalią układu kostnego, która zależnie od gatunku, a nawet płci wykazuje różny stopień letalności, jest autosomalna recesywna cecha skrócenie kręgosłupa. Jest ona letalna u bydła i indyków. U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. central vertebral malformation). U psów skrócenie kręgosłupa nie jest letalne dla suk, rozmnażają się one prawidłowo. Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi". Natomiast samce prawdopodobnie nie osiągają dojrzałości. Możliwe więc, że jest to cecha letalna dla jednej płci. Szczenięta obarczone tą wadą cechuje mniejsza żywotność, bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość. Ogólne zesztywnienie stawów notowane jest u bydła, świń i owiec. Genetycznym podłożem tej wady jest autosomalny gen recesywny. U jagniąt, cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. Wada ta, obserwowana głównie u bydła, polega na niezrośnięciu się kości czaszki, któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw. amputacji kończyn. Może ona natomiast towarzyszyć: wodogłowiu, przepuklinie mózgowej, brakowi gałek ocznych
129

lub zesztywnieniu stawów. U owiec obserwowana jest również cecha recesywna — brak żuchwy. W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. Anomalia ta polega na skróceniu dolnej części dzioba. Wyniki badań wskazują, że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. duck).
Wady układu powłokowego

Wady układu powłokowego odnoszą się nie tylko do skóry, ale i takich jej wytworów, jak włosy i pióra. Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła. Nienormalność ta jest prostą cechą recesywna, która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka. Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. Płytki te są porozdzielane rowkami, w których rosną włosy. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu. Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. Schorzenie to przybiera najostrzejszą formę, prowadzącą do śmierci płodów lub noworodków, u bydła rasy Jersey, natomiast najłagodniejszą, u bydła ayrshire. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu, a to z kolei może spowodować śmierć w pierwszych tygodniach życia. Inną wadą dziedziczną układu powłokowego jest brak owłosienia. U bydła, królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi, jak wodogłowie, skrócenie szczęki, niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). Cielęta dotknięte tą wadą w warunkach naturalnych giną. U psów brak owłosienia uwarunkowany jest genem dominującym. Na podstawie szczegółowych badań można sądzić, że wszystkie bezwłose psy (tzw. psy tureckie, chińskie, perskie lub meksykańskie) są heterozygotami, gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości, że osobniki homozygotyczne rodzą się martwe. U drobiu wadą układu powłokowego jest nagość, uwarunkowana recesywnym genem sprzężonym z płcią, oznaczonym symbolem n (ang. naked). Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. Ptaki, które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle, w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. 130

Wady układu pokarmowego

Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. Brak odbytu jest recesywną cechą letalną, powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. Niedrożność jelit zaś, to prosta autosomalna cecha recesywną występująca zarówno u bydła, jak i u koni. U bydła nienormalność ta dotyczy jelita biodrowego, u koni natomiast okrężnicy.
Wady układu nerwowego

Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). Obie nienormalności warunkowane są genem recesywnym. Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych. Niedorozwój móżdżku najlepiej został poznany u bydła i owiec, u których jest prostą cechą recesywną. Zwierzęta dotknięte tą wadą rodzą się żywe, ale nie mogą stać. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. U drobiu występuje również recesywne, sprzężone z płcią zaburzenie zwane paroksyzmem. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem, następnie upadkiem, usztywnieniem nóg oraz drżeniem ciała. Atak taki trwa około 10 sekund. Większość z tych kurcząt ginie przed 15 tygodniem życia. Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja, determinowana u bydła genem dominującym, natomiast u królików — recesywnym. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy. Prostą autosomalna cechą występującą u bydła, świń i drobiu jest wodogłowie wewnętrzne. Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe, wykazują powiększenie czaszki, nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. U świń gen warunkujący tę wadę wykazuje działanie plejotropowe, wpływa bowiem na umaszczenie, powodując jego rozjaśnienie. Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. crest), przy czym u kur gen ten nie jest letalny (np. rasy houdan i polskie czubatki), podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną, natomiast heterozygoty mają piękny czub, pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. U indyków i kur notowane jest wrodzone zaburzenie równowagi, warun131

kowane recesywnym genem letalnym lo (ang. loco). Pisklęta obarczone tą wadą kłują się dobrze, ale nie mogą jeść, pić i giną w ciągu kilku dni. Anomalią o dużej częstości występowania, szczególnie u buhajów, powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. Zaburzeniem układu nerwowego, związanym z niedorozwojem przodomózgowia, jest paraliż i przykurcz mięśni kończyn i szyi, występujący u bydła, świń i owiec. Jest to prosta, autosomalna cecha recesywna, której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych.
Wady układu rozrodczego

Dość często występujące, a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego, takie jak: niedorozwój (hipoplazja) jąder, nasieniowodów, jajników, macicy, niedrożność jajowodów czy wnętrostwo. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy. Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Niepłodność obserwowana jest także u buhajów. Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu, czyli szczytowej części główki, dlatego nazwano je „gałkowatymi". Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang. knurl). Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów, ale także u knurów, ogierów i samców innych ssaków jest wnętrostwo, czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny. Nienormalność tę można usunąć zabiegiem chirurgicznym. Obustronne wnętry są niepłodne również po takim zabiegu. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu. Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. 5.4.4.3. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne. Podłoże genetyczne zaburzeń natury biochemicznej, jak na przykład brak lub niedobór pewnych enzymów czy hormonów, jest trudne do identyfikacji. Trudność tę powiększa to, iż objawy pojawiają się u zwierząt w różnym wieku.
132

Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna, wytwarzany w nadmiernych ilościach i odkładany we krwi, kościach, zębach i innych częściach ciała. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu, składnika hemoglobiny. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne, reagują powstawaniem pęcherzy na skórze, a w skrajnych przypadkach — wrzodów. Genetycznym podłożem tej wady u bydła jest gen recesywny. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła, gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. Uczulenie na promienie słoneczne występuje również u owiec, lecz jest ono jednak innej natury niż porfiria u bydła. Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny, która jest produktem rozkładu chlorofilu. Fenotypowym obrazem tej wady jest egzema na pysku i uszach, powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. Schorzeniem notowanym u ludzi i psów, a także owiec, charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia, wywoływana działaniem genu recesywnego sprzężonego z płcią. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa), który przyspiesza przemianę protrombiny w trombinę, i hemofilia B, mająca łagodniejszy przebieg, a dotycząca czynnika IX (czynnik Christmas), niezbędnego do wytwarzania tromboplastyny osocza. U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych. Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Oprócz ogromnej liczby wrodzonych wad dziedzicznych, których podłoże genetyczne jest dobrze poznane, istnieje wiele anomalii, które są niewątpliwie dziedziczne, ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. Należą do nich przypadki wielokończynowości, zroślaki (zrośnięte dwa płody), wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej, a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II.
133

134

5.4.4.4. Ograniczanie występowania chorób genetycznych

Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania, częstość jest niewielka. W Polsce, niestety, kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana. Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń. Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli), ale jedynie te, które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji), są zauważalne i łatwe do eliminacji. Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli. Terminem nosiciel określamy osobnika, który jest fenotypowo normalny, ale w swoim genotypie 135

ma gen letalny (czy semiletalny) w układzie heterozygotycznym. Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza, że aż 18% osobników jest nosicielami niepożądanego allelu. Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności. Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice, u ptaków samce). Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią, skojarzonego z normalnymi kurami, będą pochodzić wszyscy synowie fenotypowo normalni, jednakże połowa z nich będzie homozygotami dominującymi, a połowa nosicielami niepożądanego genu. Natomiast wśród jego córek połowa będzie normalnych, a u połowy ujawni się wada dziedziczna. Jeśli będzie to gen letalny powodujący zamieranie zarodków, to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. Geny te, jak już wspomniano, fenotypowo ujawniają swą obecność wówczas, gdy występują w stanie homozygotycznym. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników, głównie wykorzystywanych w sztucznej inseminacji (np. buhaje). Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. Testowanie takie jest możliwe jedynie wtedy, gdy homozygoty recesywne wykazujące wadę żyją i są płodne. Schemat takiego kojarzenia jest następujący:

Jeżeli testowany osobnik jest nosicielem allelu recesywnego, to około 50% jego potomków będzie homozygotami recesywnymi. 2. Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic, wśród których można się spodziewać obecności nosicielek recesywnego allelu.

136

Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. 3. Dokładną metodą identyfikacji nosicielstwa recesywnego genu, lecz trudną do zaakceptowania ze względów hodowlanych, jest kojarzenie samca z jego własnymi córkami. Jeśli przyjmiemy, że samice matki tych córek są homozygotyczne (AA), a samiec jest heterozygotyczny, to wśród córek połowa będzie miała genotyp AA, a połowa Aa. Wówczas schemat kojarzenia testowego jest następujący:

Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. W hodowli bydła młode buhaje, zakupione przez Stacje Hodowli i Unasieniania Zwierząt, kojarzone są z losowo wybranymi samicami. Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw. test automatyczny). Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus, w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych. Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. Rejestracja ta z jednej strony daje obraz częstości występowania tych wad, z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich).
137

Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA, w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej. Zagadnienie to opisano niżej.

DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH

Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi, które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych. W diagnostyce tych chorób stosowane są techniki biologii molekularnej, głównie PCR-RFLP, która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy), a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu). Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt, spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych. Jest to choroba autosomalna recesywna, występująca również u ludzi pod nazwą LAD (ang. leukocyte adhesion deficiency). Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2, który koduje strukturalną podjednostkę CD18 p2-integryny. Białko to odgrywa istotną rolę w odporności organizmu. Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to, iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. Na początku lat 90. w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. U bydła zespół BLAD był znany od kilkunastu lat, po raz pierwszy opisano go w 1983 roku. Analiza rodowodowa wykazała, że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. W latach 70. rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego, tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. Ponieważ jest to gen recesywny, szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne, fenotypowo zdrowe). Stwierdzona w pozycji 383 nukleotydu mutacja, powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138

wego na glicynę, jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa. Za pomocą analizy fragmentów restrykcyjnych określa się, jaki allel występuje w badanym DNA. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. Z kolei, ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów, a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). Obraz elektroforetycznego rozdziału wygląda następująco:

W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację, tzw. ciche podstawienie 775 nukleotydu, które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia, opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA. Mutacja ta została już przedstawiona wcześniej. Jej podłożem genetycznym jest zmutowany, recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej, który bierze udział w cyklu mocznikowym. Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni, natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach, podejmowane są środki prewencyjne. Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to, iż zmutowany allel nie ma miejsca restrykcyj139

nego dla enzymu Avall w kodonie 86. Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz, dla heterozygotycznego trzy prążki: 194 pz, 118 pz i 72 pz, a dla normalnej homozygoty dwa prążki 118 pz i 72 pz. W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę, powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT), nie dającą żadnych skutków fenotypowych. Kolejną, również wcześniej przedstawioną mutacją letalną, występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego, jest recesywna mutacja genu syntazy urydynomonofosforanowej. Zmutowany allel genu UMPS, określony symbolem DUMPS (ang. deficiency uridine monophosphate synthase), powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży, dlatego nazwano go „genem zamieralności zarodków". Osobniki heterozygotyczne są fenotypowo normalne, ale wykazują obniżony poziom aktywności enzymu. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. Z drugiej jednak strony, krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku, natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu, których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych), konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). Podobnie jak w przypadku poprzednich mutacji, do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony, natomiast allel zmutowany (DUMPS) — nie będzie. Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz, 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym, niemożliwa jest analiza DNA osobników homozygotycznych. Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. Pierwsza z nich to okresowy paraliż, nazwany HYPP (ang. hyperkalemic periodic paralysis), pojawiający się u koni „ąuarter" w USA. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni, polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). Objawami tej choroby są ataki drżenia mięśni i paraliżu, występujące po zmianie diety, okresie głodzenia, za140

działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej, dobrze umięśnionych. Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. Mutacja HYPP dziedziczy się z niezupełną dominacją, u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP, z zastosowaniem enzymu restrykcyjnego Tagi. Podobna choroba od 50 lat znana jest u ludzi. Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang. severe combined immunodeficiency disease — SCID). Choroba ta charakteryzuje się brakiem limfocytów T oraz B, co powoduje załamanie się układu immunologicznego. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA, natomiast badania przeprowadzone w Polsce wykazały, że nie występuje ona w polskiej populacji koni arabskich. Omawiając choroby genetyczne nie sposób pominąć tzw. chorób prionowych. Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny, którym jest białko, jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową. Białkowe cząsteczki infekcyjne, nazwane prionami, namnażają się w ten sposób, iż przekształcają prawidłowe cząsteczki białka w szkodliwe, indukując zmiany ich konformacji. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. Z tego powodu określane są gąbczastymi encefalopatiami (ang. spongiform encephalopathies). Przypuszcza się, iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen, a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). Gen kodujący białko komórkowe oznaczono symbolem PrPc, jego zmutowany allel, warunkujący białko prionowe — symbolem PrPSc. Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20, na granicy prążka 12 i 13 (20pl2-pl3), natomiast u bydła i owiec w długim ramieniu chromosomu 13, przy czym u bydła w pozycji 13ql7, u owiec — 13ql7-ql8. Jedną z najdawniej, bo około 250 lat temu, poznanych chorób prionowych u zwierząt jest trzęsawka (ang. scrapie — drapać) u owiec. Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji, trwającym miesiące lub lata bez żadnych objawów. W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach, jak
P

141

śledziona czy węzły chłonne. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. Metoda ta okazała się jednak zbyt droga i długotrwała, a jej rezultaty nie były zadowalające. Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny; oznaczenia literowe V/A), 154 (arginina/histydyna; R/H) oraz 171 (arginina/glutamina; R/Q) (tab. 5-III). Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". Wydaje się, że najbardziej odporne są owce o genotypie AA136RR154RR171, a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). U bydła chorobą prionową jest rozmiękczenie mózgu (ang. bovine spongiform encephalopathy — BSE). Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii, rok później została opisana jej patologia. Jest to choroba ośrodkowego układu nerwowego. Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. Czynnikiem zakaźnym BSE jest to samo białko prionowe, które wywołuje scrapie u owiec. Białko to ma około 250 aminokwasów. W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm, związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. 5-17). Dotychczas stwierdzono, że częściej występuje 6 powtórzeń. Spośród trzech możliwych genotypów (6:6, 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. Ponadto tylko ten genotyp nie występował u krów z BSE. Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc, które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. Ostatnie badania wykazały, że w pobliżu genu białka prionowego znajduje się gen Prnd (ang. prion-doppel). Gen ten koduje białko określane jako Dpl (ang. downstream prion-like protein) lub doppel, które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym. Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. Wykryto już kilka mutacji w tym genie u owiec, kóz i bydła. 142

5.4.5. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny
Gen odporności na kleszcze

W niektórych krajach, głównie w północnej Australii i innych regionach tropikalnych, jak również w Europie, bydło jest szczególnie podatne na inwazje kleszczy. Z kolei, bydło indyjskie jest bardzo odporne na kleszcze. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi, ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie, determinujący odporność na kleszcze. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła.
Gen K88 i F18

U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen. Należą do nich biegunki okresu noworodkowego u prosiąt, w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli, powodujące rocznie padnięcie około 10 min prosiąt na świecie. Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt, umożliwiających adhezję bakterii i ich rozwój. Z kolei, występowanie tych 143

receptorów warunkowane jest genem głównym (o dużym efekcie). Loci receptorów dla E. coli K88 zlokalizowano w chromosomie 13, blisko locus Tf (transferyny). Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne, stwierdzono bowiem, iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg. U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa, której objawami są m.in. ataksja, konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa), schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E. coli (bakterie te mają fimbrie). Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. coli F18), znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. Podatność jest cechą dominującą (allel B), a odporność recesywną (allel b). Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l,2-fukozylotransferazy. W jednym z nich (FUT1) wykryto dwie mutacje, z których jedna, oznaczona symbolem M307, polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę), wykazuje ścisłe sprzężenie z genem ECF18R. Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany), trzech prążków (93, 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych. W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1', warunkującego odporność na infekcje E. coli F18, z ałlelem zmutowanym M307A, oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E. coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra.

5.5. Mutacje w mitochondrialnym DNA
Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA. Mutacje te mogą być dziedziczone po matce, mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym. Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika, a ich charakterystyczną cechą jest to, iż mogą
144

dotyczyć całych tkanek, pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. Miejsce i zasięg występowania danej mutacji powodują, iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną, drugi natomiast mutacją homoplazmatyczną. Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego. Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to, iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom, jak i synom, ale dalszym pokoleniom cechę tę przekazują tylko córki. Mutacje w mitochondrialnym DNA, podobnie jak w DNA jądrowym, polegają na substytucjach nukleotydów (głównie tranzycja), insercji bądź delecji nukleotydów. Skutkiem tranzycji są takie choroby u człowieka, jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP). Podstawienia nukleotydów w genach kodujących tRNA powodują m.in. mitochondrialną miopatię, padaczkę miokloniczną i tzw. poszarpane czerwone włókna (MERRF), dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną, kwasica mleczanowa i napady udaropodobne). Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np. chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona, polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki. Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. Przykładem pierwszej sytuacji jest wspomniana już choroba LHON, której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. Z kolei, mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. Wiadomo na przykład, że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka, wywoływaną przez wirus, inne natomiast u odpornych.

Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu, która jest łatwa do odróżnienia w zespole innych właściwości (np. barwa umaszczenia, posiadanie/brak rogów). Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym. W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen. Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy. Oznacza to, że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości. Ogólnie cechy można podzielić na jakościowe i ilościowe. Cechy jakościowe są warunkowane jedną, rzadziej kilkoma współdziałającymi ze sobą parami genów. Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone, bowiem na ich ekspresję wpływa kilkanaście, a nawet kilkadziesiąt par genów. Ponadto, w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. Do cech jakościowych zalicza się takie, jak: umaszczenie zwierząt, kolor upierzenia u drobiu; rogatość lub bezrożność bydła, owiec i kóz; układy grupowe krwi itd. Wspólną właściwością tych cech jest to, że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. Mechanizm dziedziczenia cech jakościowych jest zróżnicowany, a ich ujawnienie się zależy przede wszystkim od założeń genetycznych. Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków, np. umaszczenia. Znane są również przykłady, kiedy jeden gen wpływa na kształtowanie się kilku cech. Zjawisko to nazywa się plejotropią. 146

Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem, a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA. Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek). Jak już wspomniano, cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą. Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów), drugi natomiast — nieallelicznego (kilka par genów). Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. Geny te nazywane są parą alleli lub allelomorfów. Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. A-a). Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus. Zygota, która zawiera dwa jednakowe geny z danej pary alleli, nazywa się homozygotą (AA lub aa), natomiast mająca dwa różne geny — heterozygotą (Aa). Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech, dając wszystkie możliwe formy danej cechy. Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla. I prawo Mendla, zwane prawem czystości gamet, mówi o tym, że gameta zawiera tylko jeden gen z danej pary alleli. W procesie gametogenezy allele z danej pary rozchodzą się do gamet. Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary. Potomek dziedziczy zatem jeden allel z danej pary od ojca, drugi natomiast od matki.

6.1. Dziedziczenie cech warunkowanych jedną parą alleli
6.1.1. Współdziałanie alleli
Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu. Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie. 147

Przykładem całkowitej dominacji może być bezrożność u bydła. Stwierdzono, iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie), który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie, gdyż gen dominujący P maskuje jego ekspresję. Para rodziców, będących homozygotami alternatywnymi (PP i pp) pod względem locus polled, zawsze da potomstwo heterozygotyczne, wykazujące dominującą formę cechy. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire, kontrolowany przez allel dominujący Bew z locus Be. Z kolei u świń rasy cornwall, również czarno umaszczonych, w locus tym występuje allel be, jednolitego umaszczenia. Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz, jednolite umaszczenie (dominuje) i łaciatość u bydła, czarne umaszczenie u bydła, dominujące nad czerwonym i inne. Dominowanie niezupełne genów z jednej pary alleli polega na tym, że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. Ilustracją tego typu dziedziczenia, nazywanego również dziedziczeniem typu Zea, jest poniższy przykład. U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi, otrzymuje się potomstwo (pokolenie Fl) mroziate. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2), z którego część ma umaszczenie czerwone, część mroziate, część zaś białe. Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt, to stosunek liczbowy osobników czerwonych, mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. Charakterystyczną cechą tego typu dziedziczenia jest to, że fenotyp zwierzęcia odzwierciedla jego genotyp. Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane), upierzenie kur andaluzyjskich (czarne, białe i stalowoniebieskie), długość uszu u owiec rasy karakuł i inne. W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. Są one zatem w stosunku do siebie równorzędne. Przykładem tego typu współdziałania allelicznego jest grupa
148

krwi AB w układzie ABO u ludzi, w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu. Naddominowanie polega na tym, że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa). Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. W przypadku niektórych loci, w wyniku mutacji genowych (patrz rozdział: Mutacje), obok dotychczasowej pary alleli pojawia się allel trzeci, który warunkuje tę samą cechę co allele pierwotne, dając jedynie inną jej formę lub natężenie. Zdarzają się również takie loci, w których u różnych osobników znajdują się więcej niż trzy allele. Układ taki, w którym w jakiejś populacji
149

występują więcej niż dwa allele, nazywamy szeregiem (serią) alleli wielokrotnych. Allele wielokrotne charakteryzują się tym, iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu, jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. Jeśli szereg składa się z n liczby alleli, to liczba genotypów będzie się równała:

Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie, to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone).

6.1.2. Niezależne dziedziczenie cech (II prawo Mendla)
Niezależne dziedziczenie cech stwierdził Grzegorz Mendel, badając m.in. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla), mówiące o niezależnym dziedziczeniu się cech. Oznacza to, że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie, to ich segregacja jest praktycznie niezależna. Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne, czerwone), warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1). Wszystkie gamety osobnika aberdeen-angus (bydło czarne, bezrogie) zawierają dominujące geny Ed i P, natomiast gamety osobnika rasy shorthorn (czerwone, rogate) — allele recesywne e i p. Zwierzęta z pokolenia Fj będą mieć genotyp EdePp, czyli będą czarne, bezrogie. Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP, Edp, eP, ep. Dzieje się tak

150

151

dlatego, że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p, gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych. Ponieważ każdy osobnik wytwarza 4 rodzaje gamet, to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2, sporządzając szachownicę genetyczną Punneta. Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne, bezrogie): 3 (czarne, rogate): 3 (czerwone, bezrogie): l (czerwone, rogate) (ryć. 6-2). Najliczniejszą grupę potomstwa stanowią osobniki o genotypie, w którym występuje przynajmniej jeden gen dominujący z każdej pary, a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony, rogaty). Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy, gdy obie cechy dziedziczą się z dominowaniem całkowitym. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4, lecz 9 różnych fenotypów. Natomiast gdy jedna cecha dziedziczy się według typu Pisum, a druga według typu Zea, istnieje możliwość ujawnienia się 6 różnych fenotypów. Jeśli będzie rozpatrywana większa liczba cech równocześnie, zwiększy się liczba możliwych fenotypów. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli, liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n

6.1.3. Dziedziczenie cech sprzężonych
Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to, iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy. W tym przypadku można mówić o niezależnej segregacji chromosomów. Jednak organizmy żywe mają tysiące, dziesiątki tysięcy różnych genów, a tylko kilka do kilkudziesięciu chromosomów. Zatem każdy chromosom zawiera wiele genów. Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie, inaczej mówiąc, cechy kontrolowane przez te geny będą się dziedziczyć razem. Cechy takie nazywamy sprzężonymi. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może
152

być stosowany do tych cech. Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym, iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty, złożone z homologicznych chromosomów. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami, zwanej crossing over. W wyniku crossing over u części osobników potomnych, tzw. rekombinantów, pojawią się kombinacje cech w innym układzie niż u rodziców. Częstość tej wymiany jest tym większa, im dalej od siebie znajdują się geny. Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł, skrzydła szczątkowe (gen recesywny v — vestigal). Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna, normalne skrzydła są dłuższe od odwłoka. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. dzikiej) każdej cechy u muszki. Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). W odróżnieniu od cech segregujących niezależnie, genotyp dla cech sprzężonych jest zapisywany w postaci ułamka, w którym licznik oznacza jeden chromosom, mianownik drugi chromosom z tej pary. Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący:

Natomiast genotyp podwójnej homozygoty recesywnej:

W celu określenia, jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom, została przyjęta nazwa faza sprzężenia. Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy, że są one w fazie przyciągania (cis), bądź w różnych chromosomach i jest to faza odpychania (trans).

153

Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe.

Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu), natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami). W danym przykładzie rekombinanty stanowią około 18,5% całego potomstwa z tej krzyżówki. Procent rekombinacji przyjęto za jednostkę odległości między genami, której symbolem jest cM (centymorgan, od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana), czyli l cM = 1% rekombinacji. W naszym przykładzie odległość między loci B i V wynosi 18,5 cM. Doświadczalnie zostało udowodnione, że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów. Wynika to z tego, iż częstość, z jaką crossing over zachodzi między sprzężonymi loci, jest stała. W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over. Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy. Można jednak przewidzieć częstość występowania podwójnego crossing over, jest ona iloczynem częstości przypadków pojedynczych crossing over. Na przykład, jeśli pojedynczy
154

crossing over w obszarze I zachodzi z częstością 0,02 (2%), a w obszarze II — 0,05 (5%), to częstość występowania podwójnego crossing over wynosi 0,02x0,05 = 0,001, czyli 0,1%. Jest to jednak wartość przybliżona, gdyż w naturze jest ona niższa. Przyczynę stanowi to, iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka. Zjawisko to nosi nazwę interferencji. Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych. Jeśli jednak zajdzie podwójny crossing over, układ genów będzie taki, jak przed tą wymianą i nie będzie można odróżnić rekombinantów. Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi. By tego uniknąć, stosuje się tzw. krzyżówki trzypunktowe, umożliwiające dokładne ustalenie położenia loci względem siebie. Jeśli przyjmiemy, że kolejność ułożenia loci w chromosomie jest następująca: A-B-C, to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C. Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej. Trzecią cechą rozpatrywaną będzie kolor oczu. U muszki owocowej dominuje czerwony kolor oczu (dziki), a gen recesywny c (cinnabar), warunkuje kolor cynobrowy. Również w tej krzyżówce, w celu lepszego uwidocznienia efektu crossing over, allele dominujące będą oznaczone literami alfabetu, a nie za pomocą przyjętego dla nich symbolu „ + ". Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych, to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie. W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny:

Natomiast drugi rodzic ma genotyp:

W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv, natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV. Z kolei, podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. 155

W potomstwie uzyskano następujące genotypy i liczebności:

Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów, wyrażonym w procentach:

Analogicznie do tego odległość między loci C i V wynosi:

Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco:

Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie. W ten sposób tworzone są mapy genetyczne. Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane. W celu okreś156

lenia, w którym chromosomie znajduje się dana grupa genów sprzężonych, należy zastosować inne metody badania (cytogenetyczne). Powstaje wówczas mapa fizyczna. O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. W rozdziale tym pokazano m.in., że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego.

6.1.4. Cechy sprzężone z płcią
Cechy, których geny są umieszczone w chromosomach płci, nazywamy cechami sprzężonymi z płcią. Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. Dzieje się tak dlatego, że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki). Sposób ich dziedziczenia jest inny niż cech autosomalnych. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu, a nie — jak u płci homogametycznej — od pary genów. U ssaków samice są homogametyczne (XX), samce zaś heterogametyczne (XV). Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ), a heterogametyczną samice (ZW). Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład. Cecha zmniejszonej krzepliwości krwi (hemofilia), występująca u ludzi, psów i niektórych zwierząt gospodarskich, uwarunkowana jest recesywnym genem h. Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi. Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób:
Fenotyp Samice Samce Samice Samce

Jak wynika z tego zestawienia, samce nie mogą być heterozygotami (nosicielami genu hemofilii), ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. Układ genetyczny polegający na tym, iż u osobnika diploidalnego występuje tylko jeden gen z danej pary, nazywamy hemizygotycznym, a osobnika — hemizygotą. Gdy płeć heterogametyczną ma cechę dominującą, a pleć homogametyczną cechę recesywną, obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu, a synowie po matce). Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego), cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. 157

Ryć. 6-3. Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią, w pokoleniu F, „dziedziczenie na krzyż"

Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B, warunkujący cechę jastrzębiatości upierzenia, dominuje nad jego allelem b (gen czarnej barwy upierzenia). Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra. Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce. Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. 6-4 wkładka kolorowa). Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych, tj. takich, u których zaraz po

158

wykluciu można rozróżnić płeć. Rasą autoseksingową są polbary, wytworzone przez polską badaczkę Laurę Kaufman, mające gen jastrzębiatego upierzenia. Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. rasa sussex) i złocistości upierzenia (rhode island red), geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw, ang. dwarf — karłowaty). Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym. Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw- będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach. Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia. Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści, warunkowana przez locus O (ang. orange), zlokalizowany w chromosomie X. Samce mogą być tylko czarne (o-) lub rude (O-). U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych, inne — rude (genotyp Oo) (ryć. 6-5 wkładka kolorowa). Jest ono następstwem tego, iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie, co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego. U zwierząt domowych jest wiele cech sprzężonych z płcią, część z nich przedstawiono w rozdziale: Mutacje. Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone), B (niebieskie dzikie) i b (czekoladowe). Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X. Niektóre z nich to tzw. cechy związane z płcią. Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach), ale ich ekspresja jest uzależniona od płci. Osobniki męskie i żeńskie, mając taki sam genotyp, mogą się różnić fenotypowo. Przykładem takiej cechy jest rogatość owiec rasy dorset horn. Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci, natomiast osobniki homozygotyczne recesywne będą rogate. Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate, samice zaś bezrogie. Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech, których założenia genetyczne znajdują się u osobników obu płci, ale ujawniają się tylko u jednej płci. Cechy te nazywane są cechami 159

ograniczonymi płcią lub ograniczonymi do płci. Należą do nich: zdolność wydzielania mleka u samic ssaków, nieśność samic ptaków, wnętrostwo czy przepuklina mosznowa u samców.

6.1.5. Plejotropia
O plejotropii mówimy wówczas, kiedy jeden gen oddziałuje na powstanie kilku cech. Plejotropia może być właściwa lub rzekoma. Plejotropia właściwa występuje wtedy, gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. Przykładem jest gen warunkujący platynową barwę u lisów. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe. Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt", opisany w podrozdziale: Dziedziczenie umaszczenia. W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt. Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne. Na przykład gen warunkuje syntezę enzymu, który bierze udział w syntezie jakiegoś związku (np. hormonu). Z kolei ten związek ma różnorodne funkcje fizjologiczne, wpływa zatem na inne właściwości organizmu. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę, która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m.in. na tempo przemiany materii, pracę serca i aktywność procesów trawiennych. Zmiany te są jednak następstwem nieprawidłowego opierzenia, które nie chroni ptaka przed nadmierną utratą ciepła.

6.2. Współdziałanie genów z różnych loci w kształtowaniu fenotypu
W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. W przypadku wielu cech geny z różnych par alleli, w wyniku łącznego działania, powodują pojawienie się nowej formy cechy jakościowej.
160

Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. Jest kilka rodzajów tego współdziałania.

6.2.1. Komplementarność
Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć. 6-6a). W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p.

Ryć. 6-6a. Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161

Gen R warunkuje kształt różyczkowy grzebienia, a jego allel r — pojedynczy, natomiast gen P powoduje powstanie grzebienia groszkowego, jego allel p — grzebienia pojedynczego (ryć. 6-6b wkładka kolorowa). Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego, jak i różyczkowego, warunkujący go genotyp to podwójna homozygota recesywna — rrpp. W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy, której genotyp może mieć kilka różnych wariantów, gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_). Z krzyżowania osobników o ustalonej cesze kształtu grzebienia, tj. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP), w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy. Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym, że w pokoleniu Fl pojawia się nowy fenotyp, całkowicie różny od obojga rodziców, natomiast w pokoleniu F 2 , w którym wystąpią 4 fenotypy w stosunku 9:3:3:1, pojawia się również nowy typ — grzebień pojedynczy, którego nie było w dwóch pokoleniach przodków. Dwa dominujące geny z różnych par alleli, współdziałające razem i wytwarzające odmienną formę cechy niż ta, która powstaje w wyniku działania każdego z nich osobno, nazywamy genami komplementarnymi lub dopełniającymi się.

6.2.2. Epistaza
Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza, charakteryzująca się tym, że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. Gen, który hamuje ujawnienie się genu z innej pary, nazywany jest genem epistatycznym, natomiast gen hamowany to gen hipostatyczny. Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia. Zjawisko epistazy może wyjaśnić poniższy przykład. Kury niektórych ras (np. wyandotte, plymouth rock) mają upierzenie białe, gdyż brak w ich genotypach genu C, warunkującego wytwarzanie pigmentu (melaniny) w piórach. Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc), która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. U białych leghornów jest inna sytuacja, podobna do wspomnianej wyżej u świń. Ptaki te są również białe, ale mają
162

Ryć. 6-7. Różny stopień białej plamistości spowodowany działaniem genów modyfikujących

w swych genotypach gen C. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I, który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC. W potomstwie F2, którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc), oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP, natomiast czarno umaszczonych (np. rasy cornwall): aa ii EE. Allele z locus E i A są opisane w dalszej części tego rozdziału, dotyczącej dziedziczenia umaszczenia. Gen epistatyczny nie zawsze jest dominujący w swojej parze. W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne. Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary. Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów. Geny epistatyczne mogą tłumić działanie wielu innych par.

6.2.3. Geny modyfikujące
Istnieje pewna grupa genów, które modyfikują przejawianie się jakiejś prostej cechy, warunkowanej zwykle jedną parą genów. Geny te, zwane modyfikatorami, powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę. Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć. 6-7), psów i kotów, mimo iż cecha łaciatości warunkowana jest inną parą alleli.
163

6.2.4. Sumujące działanie genów
Inną formą współdziałania nieallelicznego genów jest polimeria. Zjawisko to polega na tym, iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę, powodując różne jej nasilenie, zależne od sumującego się ich działania. Geny te nazywane są genami polimerycznymi, addytywnymi lub poligenami. Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. wydajność mleczna, nieśność itd.). Należy pamiętać, że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych.

6.3. Dziedziczenie umaszczenia
Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach. Synteza, rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci, ale czynniki środowiskowe mogą modyfikować umaszczenie, wpływając na przykład na zmianę ilości wytwarzanego pigmentu. U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np. biała w zimie, a czarna lub brązowa w lecie). Zmiany te spowodowane są działaniem niektórych hormonów, takich jak gonadotropiny, kortykotropina i hormon melanotropowy — MSH (ang. melanocyte stimulating hormone). U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych, natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny), syntetyzowane z metabolitów DOPA-chromu, i feomelaniny (kolor czerwony lub żółty), wytwarzane z metabolitów cysteinylo-DOPA-chinonu. Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. 6-8): 1) hydroksylację tyrozyny do 3,4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5,6-dihydroksyindolu (DHI) do indolochinonu. Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny, natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. Do niedawna uważano, iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu. Ostatnie badania wykazały, że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację. 164

Ryć. 6-8. Schemat biosyntezy melaniny

Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. Hormon melanotropowy, zwany również intermedyną lub melanotropiną, jest wytwarzany przez część pośrednią części gruczołowej przysadki. Hormon ten stymuluje produkcję poszczególnych melanin na przemian. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti). Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. Receptor ten jest determinowany przez locus E (Extension). Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina), a hamowanie produkcji feomelaniny wewnątrz melanocytów. Melaniny są wytwarzane w melanocytach. Melanocyty pochodzą z rdzenia nerwowego, a podczas rozwoju embrionalnego wędrują do powstającej skóry. Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów. W determinację koloru jest włączonych wiele loci. Wiele genów, jeśli nie wszystkie związane z wytwarzaniem pigmentu, ma działanie plejotropowe na rozwój i różnicowanie organizmu. Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym, komórkowym i subkomórkowym.
REGULACJA NA POZIOMIE TKANKOWYM

Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. Jest wiele genów, które współdziałają ze sobą w sposób kompleksowy. Geny, które zostały już sklonowane, warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165

niesieniu do myszy. Do loci działających na poziomie tkankowym, zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) - plamisty, Dominant White Spotting (W) - - dominujący biały nakrapiany i Steel (Sl) - stalowy.
REGULACJA NA POZIOMIE KOMÓRKOWYM

Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów, co wpływa na koloryt (układ barw). Należą do nich geny z loci D (Dilute — rozjaśniony), E (Extension - - pełna barwa), A (Agouti — dziki), Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu). Mutacje w tych loci wpływają wyraźnie na kolor oczu, w jednolity typowy sposób, przez działanie na mechanizmy włączone w funkcję melanocytu. Większość z tych mutacji ma wpływ plejotropowy na rozwój. Locus D koduje strukturalne białko, które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów. U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego), a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. Locus E (Extension) koduje przede wszystkim receptor MSH, pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. Locus ten kontroluje ilość eumelaniny. Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora. Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. U osobników typu dzikiego, nazywanych agouti, melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę, oba typy melanin nie są więc syntetyzowane jednocześnie. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych, podczas gdy locus Extension działa w melanocytach.
REGULACJA NA POZIOMIE SUBKOMÓRKOWYM

Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym), gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów. Geny, które działają na pigmentację ssaków na poziomie subkomórkowym, wpływają bezpośrednio na ilość i typ wytwarzanej melaniny. W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np. brak syntezy melaniny w przypadku albinizmu), lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np. odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). 166

Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). Locus C kontroluje liczbę i intensywność ziaren pigmentu. Historycznie był on uważany za locus strukturalny dla tyrozynazy, gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza, której funkcja jest decydująca dla wytwarzania pigmentu. Tyrozynaza przejawia swą ekspresję w melanocytach. Mutacje w locus C powodują brak pigmentu we włosach, skórze i tęczówce oka, ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. Interesujące jest to, iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową, natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm, ale są to mutacje typu nonsens, zmiany sensu i mutacje zmiany fazy odczytu. Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu), czyli wycinania intronów, a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. Takie białka nie są kompetentne katalitycznie, ale dotychczas nie stwierdzono, czy pełnią one jakąś rolę (np. inhibitora) w melanocytach. Badania poszczególnych mutacji w locus Albino u królików, warunkujących umaszczenie himalajskie i szynszylowate, wykazały, że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji, która powoduje uwrażliwienie efektu fenotypowego na temperaturę. U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną, prowadząca do osłabienia funkcji enzymu. Geny z locus C u królików tworzą szereg alleli wielokrotnych, w którym występuje dominacja w następującej kolejności: C, cch, ch, c (ryć. 6-9 wkładka kolorowa). Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny, natomiast inne geny regulują typ formowanego pigmentu, jeszcze inne — sposób, w jaki pigment ma być formowany. Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino, a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. Specyficzna funkcja tego białka nie jest jeszcze poznana. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny, ale mechanizm działania tego genu dotąd nie jest znany. Wiadomo jednak, iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown, która prowadzi do wymiany cysteiny na tyrozynę. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka.
Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa

Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A, B i E. Warunkiem ekspresji genów z tych loci jest 167

oczywiście obecność odpowiednich genów z locus C. W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny, bez względu na to, jakie są geny z innych loci. Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny. Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. Natomiast u lisa polarnego zamiast allelu A jest allel A". Allel ten odpowiedzialny jest za eliminację eumelaniny. Feomelanina, która z reguły zajmuje miejsce eumelaniny, u lisa polarnego jest rozcieńczona lub usunięta w ogóle. Lis polarny o genotypie aa jest czarny, ale genotyp ten występuje bardzo rzadko (np. w populacji lisa polarnego w Islandii). W locus B również są dwa allele — dominujący B (czarny pigment) i b, w układzie homozygotycznym -- pigment czekoladowobrązowy. Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. W locus E, warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny, u obu gatunków są dwa allele — E i Ed. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie, w tym przypadku kolor jest determinowany allelami z locus A. U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci, jak G, P, S, R, W, warunkujących różne odmiany umaszczenia. We wszystkich tych loci, z wyjątkiem locus W, efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -- genotyp gg, u lisa

168

srebrzystego: genotyp pp - - perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. W locus W są następujące allele: w, W (białopyski), W (platynowy), W3 (biały Georgian) i W M (gen marble), przy czym genotyp ww występuje u lisa rudego i srebrzystego, natomiast gen marble daje inny efekt fenotypowy u tych odmian. Mutacje dominujące, takie jak W i W, w układzie homozygotycznym mają efekt letalny. Letalny jest także genotyp WW. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny, DD — niebieski), F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia), s (trzy allele: S, SJ i SH) i t (T). Mutacja w locus s (Shadow) charakteryzuje się heterochromią, której skutkiem może być różny kolor oczu u tego samego osobnika, np. jedno oko niebieskie, a drugie brązowe.
Genetyczne podłoże umaszczenia u bydła

Wyniki wielu badań sugerują, że u bydła umaszczenie czarne, brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). Locus E koduje syntezę białka MSH-R (ang. melanocyte stimulating hormon receptor), złożonego z około 350 aminokwasów. W locus tym, umiejscowionym w chromosomie 18, są 3 allele: Ed warunkujący umaszczenie czarne dominujące, recesywny allel e, który w układzie homozygotycznym warunkuje umaszczenie czerwone, oraz allel E+ umożliwiający ekspresję alleli z locus A. Allele te powstały w wyniku mutacji punktowych, opisanych w rozdziale: Mutacje. Allel dominujący Ed, kodujący czarny kolor, jest homologiczny do allelu ES0 u myszy. W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna, natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. Locus A koduje syntezę białka, będącego antagonistą białka MSH-R. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a. Allele z tego locus mogą wykazać ekspresję tylko wtedy, gdy w locus E jest genotyp E+_. U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe, natomiast allel a w układzie homozygotycznym — recesywne czarne. Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. Niestety dotychczas nie przeprowadzano badań molekularnych locus A. Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy, natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. 169

Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. Na przykład, cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie, recesywny s — łaciatość. U ras bydła (np. belgijskie błękitne), u których allel s jest utrwalony, obserwowana jest zmienność w ekspresji cechy łaciatości, niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. W tym samym locus u bydła tej rasy znajduje się allel Sc, warunkujący fenotyp nazwany colorsided — łaciaty, który dominuje nad s, ale jest recesywny w stosunku do allelu S. U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe, powodując różne zaburzenia. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę, mroziate), w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic, kora jest efektem plejotropowego oddziaływania allelu R na płodność. Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego, że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension, a mała allelu e (czerwone umaszczenie), natomiast u shorthornów jest odwrotnie.
Genetyczne podłoże umaszczenia u świń

U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti), locus E (Extension), locus I (biały dominujący) i locus Be (Belted opasany). W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a - - nieagouti. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica, ale recesywny w stosunku do białego (I). Większość ras świń udomowionych ma allel recesywny a — nieagouti. W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej, cornwall i hampshire, Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire, poland-china i pietrain, e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey. Kolejność dominowania tych alleli jest następująca: E-Ep-e. Badania, w których do analizy sprzężeń użyto ponad 230 markerów genetycznych, wskazują, iż locus ten jest umiejscowiony w chromosomie 6, blisko telomerowego regionu ramienia p. Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8), bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. Podobnie jak u myszy i bydła, także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. W locus I są dwa główne allele: 7 (inhibicja koloru), odpowiedzialny za umaszczenie dominujące białe, i allel i — recesywny (kolorowy). Wśród 170

świń domowych dominujący biały jest przeważający, występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace, natomiast inne rasy są homozygotami recesywnymi (ii). Locus I został zlokalizowany w chromosomie 8. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus, oznaczonych symbolem Id (deresz), I p (czarne łaty) oraz im (brudny szary). Biały pas, charakterystyczny dla niektórych ras, jak np. wessex saddleback, hampshire (ryć. 6-10 wkładka kolorowa), hannover-braunschweig, jest kodowany przez allel Be w z locus Be, dominujący w stosunku do jednolitego umaszczenia. Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). Genotyp tego knura jest następujący: aa U EE BewBew. Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony).
Genetyczne podłoże umaszczenia u koni

Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina), D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). Umaszczenie białe, siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały), G (Gray — siwy) i RN (Roan — deresz). Wzory umaszczenia, takie jak tobiano (TO), overo (O), sabino (SB) czy tarantowate (LP), są determinowane przez geny z innych loci. We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele, ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. trzeciego allelu w locus Extension — ED). Locus E warunkuje wytwarzanie określonego rodzaju melaniny, allel dominujący E determinuje syntezę eumelaniny, w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. Allele z tego locus wpływają na ekspresję genów z locus A. Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. W locus C u koni nie występuje allel recesywny c, który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"', wykazujący niepełną dominację. W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. cremello). Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita, zatem wystarczy jeden allel W, by było 171

umaszczenie białe), który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Wszystkie rodzaje umaszczenia, z wyjątkiem białego, w locus W mają genotyp homozygoty recesywnej (ww). Natomiast umaszczenie siwe kontroluje allel dominujący z locus G, który jest epistatyczny w stosunku do wszystkich alleli z innych loci, z wyjątkiem allelu W, wobec którego jest hipostatyczny. Allel G (w homo- i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny. Allel D z locus Dun wykazuje zupełną dominację, osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd). Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_). Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. Należą do nich allele dominujące z loci W, O i RN. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww). Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" - LWFS (ang. lethal white foal syndrome), polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub, znacznie rzadziej, na skutek braku części jelita. Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny. Genotypy w 7 loci, determinujące wybrane rodzaje umaszczenia koni, zestawiono w tabeli 6-II.

172

Genetyczne podłoże umaszczenia u owiec

U owiec stwierdzono trzy typy pigmentu: czarna eumelanina, czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina. Badania specjalistyczne wykazały, że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. Przykładem tego jest brązowoczerwony kolor wełny karakułów. Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu, wzór koloru i obecność lub brak białych znaków. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała, bądź mieszaniny jasnych i ciemnych włókien wełny. Owce biało umaszczone są zwykle prawie pozbawione pigmentu, ale mogą mieć pigment tan, który w fenotypie ujawnia się ze zmienną intensywnością, od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab. 6-III). Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała, inne wpływają na typ włókien, bądź też oba efekty występują łącznie. Allel A wh , będący pierwszym w kolejności dominowania z szeregu alleli z tego locus, warunkuje białe umaszczenie owiec. Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny, podczas gdy feomelanina może być syntetyzowana. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec, w których genotypach jest allel Awh. Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów, natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny, natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny. Niektóre allele z tego locus mają efekt plejotropowy, np. allel Awh zmniejsza płodność owiec o około 0,15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. Allel typu dzikiego, Bw, warunkuje wytwarzanie czarnej eumelaniny, natomiast recesywny allel, Brw — czekoladowobrązowej eumelaniny.
173

Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension. Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. Allel typu dzikiego, recesywny, Ew umożliwia normalną ekspresję alleli z locus Agouti. Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. Owce ras wełnistych, z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS), a także homozygotyczne białe, AwhAwh. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy), natomiast homozygoty SSSS są całkowicie białe. U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej, ale epistatyczny do dominującej brązowej (tan). Umaszczenie białe dominujące (białe perskie, łaciate afgańskie) jest kontrolowane przez allel W a z locus White. Allel ten jest epistatyczny 174

w stosunku do wszystkich innych genów umaszczenia. Inny allel z tego locus, Wrn, warunkuje dominującą szarość u karakułów, która w formie homozygotycznej jest letalna; również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny.

6.4. Penetracja i stopień ekspresji (ekspresywność) genów
Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika, współdziałania tych genów między sobą oraz współdziałania ze środowiskiem. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym, iż działanie genów może wywoływać różnorodne efekty. Często zdarzają się przypadki, kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy, inne zaś jej nie mają. Z drugiej strony, ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. Pierwsze z tych zjawisk określane jest jako penetracja genu, natomiast drugie jako ekspresywność genu, rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. Penetracja, inaczej określana jako przenikliwość, jest to częstość, z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. Penetracja może być całkowita lub niezupełna. O penetracji całkowitej mówimy wówczas, gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. Natomiast jeśli nie wszystkie osobniki, mające taki sam genotyp, wykazują charakterystyczny dla niego fenotyp, mówimy o penetracji niezupełnej. Na przykład, jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników, to mówimy, że jego penetracja wynosi 80%. Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. Natężenie drgań jest bardzo zróżnicowane. Stwierdzono to na podstawie wyników doświadczenia, w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą, zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów. Penetracja określonego genu może być różna zależnie od płci, a nawet, w przypadkach krańcowych, ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). 175

Pojęcie stopień ekspresji (ekspresywność, stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki, jak: wiek, w którym pojawiają się pierwsze objawy, czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne), które nie są dziedziczne. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. Należy jednak pamiętać o tym, że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu. Geny z różnych loci mogą dawać podobne fenotypy, ujawniające się w różnym stopniu. Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością. Pewność, iż mamy do czynienia ze zmiennością przejawiania się tego samego genu, możemy mieć wtedy, gdy jest ona obserwowana u osobników spokrewnionych ze sobą. Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. Z kolei, geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji. Zarówno stopień penetracji, jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony, sole mineralne oraz inne związki krążące we krwi, docierające przez łożysko do rozwijającego się płodu). Nie bez znaczenia jest stan zdrowotny matki, a także położenie zarodka w macicy i nawet obecność innych płodów.

6.5. Dziedziczenie pozajądrowe
Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym, a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. Już na początku naszego stulecia zauważono, że niektóre cechy nie podporządkowują się temu terminowi, dziedziczą się różnie, zależnie od kierunku krzyżowania. Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach, a także chloroplas176

tach roślin wyjaśniło podłoże tego zjawiska. Powstał nowy termin dziedziczenie pozachromosomowe, inaczej pozajądrowe lub cytoplazmatyczne. Mitochondrialny DNA, w przeciwieństwie do DNA jądrowego, jest przekazywany następnemu pokoleniu wyłącznie przez matki. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca, ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA. Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika). Jak dotąd, u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca. Przyczyną tego, w świetle wyników najnowszych badań, może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je. Plemnik zawiera od 50 do 100 mitochondriów, natomiast komórka jajowa ma ich około 100 tysięcy. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym. Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację, której wartość zawiera się w granicach od 0,3 do 0,4, między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały, że warunkuje on od 2 do 10% zmienności tych cech. W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA, analizowanego metodą RFLP. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką, średnią i niską wydajnością mleka. Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg, +26 ±99 kg, -879 ±114 kg mleka. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała, iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0,9. Natomiast allele charakteryzujące się niską frekwencją (^ 0,1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce, co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka.
tli

Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności. Stwierdzono bowiem istotny wpływ zamiany (tranzycji - - rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka. Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła. Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej. Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA. U owiec badania mitochondrialnego DNA, prowadzone za pomocą technik molekularnych (RFLP), wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu. Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe.

Rozdział

7.1. Rodzaje zmienności i czynniki ją wywołujące
Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza, czyli indywidualna. Istnieje także zmienność grupowa, występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa). W przypadku cech, które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np. wydajność mleczna w kolejnych laktacjach), mamy do czynienia ze zmiennością wewnątrzosobniczą. Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa). Na zmienność fenotypową, zwaną także ogólną, może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi, tzw. interakcja genotyp-środowisko. Zmienność oznaczamy symbolem S2, jeśli rozpatrujemy populację zwierząt, lub S2 w przypadku próby losowej pochodzącej z tej populacji.

179

Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. Mutacje prowadzą do powstawania nowych genów, innych układów w obrębie chromosomu lub między chromosomami. Natomiast rekombinacje, będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie, są przyczyną powstawania różnych genotypów. Głównymi składnikami zmienności genetycznej są: zmienność addytywna, odchylenie dominacyjne i odchylenie epistatyczne.

Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów, które kontrolują występowanie danej cechy. Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych. Zmienność dominacyjna jest to część zmienności genetycznej, która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym, w którego genotypie funkcjonuje jeden gen dominujący, i osobnikami homozygotycznymi — dominującym i recesywnym. Poniższy schemat krzyżowania bydła obrazuje to odchylenie. Osobniki fenotypowo identyczne (bezrogie), ale różniące się pod względem założeń genetycznych (homo- i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu, ale także fenotypu (bezrogie i rogate).

Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą. Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest
180

białe upierzenie kur rasy leghorn i whiterock. Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny, upierzenie biafe). Z krzyżowania osobników 0 białym upierzeniu, należących do tych ras, uzyskuje się mieszańce biało upierzone. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało, jak 1barwnie upierzone.

W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej, a zwłaszcza jej składnika — zmienności addytywnej, w zmienności fenotypowej danej cechy ilościowej. Do szacowania tego udziału stosowane są parametry genetyczne, do których należy odziedziczalność. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych. Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. czynniki klimatyczne) lub okresowo (żywienie, sposób utrzymania itp.). Do czynników środowiskowych, mających istotne znaczenie, należy także efekt matki pre-i postnatalny. Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. Zmienność skokowa odnosi się przede wszystkim do cech jakościowych, warunkowanych zwykle jedną parą alleli. Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży, dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów, genotypów i fenotypów w danej populacji (stadzie). Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. Zmienność skokowa występuje również w przypadku pewnych cech ilościowych, których wartość wyrażana jest za pomocą liczb naturalnych, np. liczba prosiąt w miocie. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału
181

charakterystycznego dla danej cechy, np. wydajność mleka w kilogramach, wysokość w kłębie w centymetrach, procentowa zawartość tłuszczu w mleku itp. Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej.

7.2. Miary zmienności
Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników, zwanej próbą. Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt, którego elementami są poszczególne osobniki. W celu określenia zmienności cechy musimy ją oznaczyć (np. zmierzyć) u wszystkich osobników stanowiących próbę. Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np. według wartości rosnących lub malejących (szereg statystyczny uporządkowany). Jeśli liczba obserwacji jest duża, a niektóre wartości powtarzają się, dane zestawia się w tzw. szereg rozdzielczy, w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy. Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych, które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji).

7.2.1. Miary skupienia
Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna, ważona, harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta). Średnia arytmetyczna nie odzwierciedla zmienności, ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru:

Średnia arytmetyczna charakteryzuje się następującymi właściwościami:

Przykład (dane z tab. 7-1):

Średnią ważoną obliczamy wówczas, gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. Wzór na jej obliczanie jest następujący:

Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu, np. do obliczania średniej prędkości. Wzór na obliczanie średniej harmonicznej jest następujący:

Przykład:

Ważono mleko oddawane przez krowę w kolejnych minutach doju. W pierwszej minucie uzyskano 4 kg mleka, w drugiej 2 kg, a w trzeciej l kg. Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący, jaka była średnia szybkość oddawania mleka:

183

Średnią geometryczną stosuje się wtedy, gdy rozkład zmienności cechy jest asymetryczny, tzn. odbiega od rozkładu normalnego. Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu. Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy. W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną:

Przykład:

Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych, a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie). Wartości zlogarytmowane tego współczynnika wyniosły: 0,3010; 0,1239; 0,0864; 0,0697; 0,0414; 0,0294, natomiast ich suma = 0,6518. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną:

Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1,28, czyli 128%. Wartość środkowa (mediana) jest to wartość cechy, która dzieli szereg uporządkowany malejąco lub rosnąco na połowę. Wartość modalna (średnia modalna) jest to wartość cechy, która najczęściej powtarza się w szeregu liczbowym.

7.2.2. Miary rozproszenia
Podstawowe miary rozproszenia to wariancja, standardowe odchylenie i współczynnik zmienności. Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej

Biorąc pod uwagę, że najczęściej średnia arytmetyczna nie jest liczbą całkowitą, w celu ułatwienia obliczeń stosuje się wzór roboczy, w którym licznik jest sumą kwadratów odchyleń:

Jeśli próbę stanowi mała liczba obserwacji, w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji, ale przez N—1.. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji. Wariancja nie może mieć wartości ujemnej. Ma ona miano takie jak analizowana cecha, ale podniesione do kwadratu.
185

Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji.

Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru:

gdzie:

Współczynnik zmienności wyraża zmienność w procentach, dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach, np. wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji, a także zmienności tej samej cechy w różnych populacjach (np. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt. Dobór zwierząt do grup doświadczalnych powinien być losowy, tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona. Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. Sposób obliczania miar rozproszenia przedstawiono niżej, wykorzystując dane liczbowe zawarte w tabeli 7-1, dotyczące masy ciała owiec w wieku 10 miesięcy. Wariancja:

7.3. Zmienność cech ilościowych
7.3.1. Dziedziczenie cech ilościowych
Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych. Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny). Poligeny, nazywane inaczej genami polimerycznymi, addytywnymi lub kumulatywnymi, specyficznie ze sobą współdziałają. Przyjmuje się, że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy. Liczba poligenów kontrolujących cechy ilościowe jest nieznana. Zakłada się, że każdy poligen ma dwa allele, pomiędzy którymi zachodzi dziedziczenie pośrednie, przy czym jeden z nich ma działanie pozytywne (tzn. zwiększające wartość cechy), a drugi neutralne, czyli obojętne dla wartości cechy. Kolejnym założeniem jest to, że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę. Najczęściej występują genotypy warunkujące wartości fenotypowe cechy, które skupiają się wokół wartości średniej, natomiast zmniejsza się częstość występowania form skrajnych. Zagadnienie to obrazuje przykład, w którym hipotetycznie przyjęto, że nieśność kur warunkowana jest trzema parami alleli z różnych loci. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie, natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. Założono również, że efekty genów A, B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. Koguty o genotypach AABBCC, mające założenia genetyczne warunkujące nieśność 240 jaj rocznie, skrzyżowano z kurami o genotypach aabbcc, niosącymi 120 jaj rocznie. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc), czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. U potomstwa w pokoleniu F2 nastąpiło rozszczepienie, uzyskano 64 genotypy, warunkujące 7 poziomów nieśności (fenotypów tej cechy). Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej, uzyskujemy przedstawiony niżej obraz graficzny: 187

Po zestawieniu wartości fenotypowych cechy, determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy:

W podanym przykładzie celowo pominięto wpływ czynników środowiskowych. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. Znaczenie tych czynników jest istotne, gdyż zacierają one różnice między fenotypami, co w przypadku cech ilościowych o zmienności ciągłej powoduje, że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego, zwana krzywą Gaussa. Rozkład normalny charakteryzuje się tym, iż: • jest to rozkład, w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej, a najmniej skrajne wartości, poniżej i powyżej średniej, • rozkład ten jest symetryczny, a oś symetrii przechodzi przez punkt, w którym jest średnia wartość cechy, 188

• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie, co wartość średniej arytmetycznej, • w przedziale x±S znajduje się ok. 68,2% wszystkich obserwacji, • w przedziale x ±2 S znajduje się ok. 95,4% wszystkich obserwacji, • w przedziale x±3 S znajduje się ok. 99,6% wszystkich obserwacji cechy. Jak już wspomniano, na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. Mogą one maskować oddziaływanie poligenów. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang. maternal effect). Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów, wpływ matki na potomstwo jest większy od wpływu ojcowskiego. Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw. dziedziczenie pozajądrowe, omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech), • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny). Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy, ilości substancji odżywczych dostarczanych płodowi (lub płodom), wielkości matki oraz jej stanu fizjologicznego i zdrowotnego. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym, jak i mitochondrialnym DNA. Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka, procent tłuszczu w mleku oraz wartość energetyczną mleka. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np. z innych ras). Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw. behawior matczyny). U trzody chlewnej, na przykład, stwierdzono, że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia, a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. Wielkość efektu matki prę- i postnatalnego zależy od gatunku, rasy, a także wielu czynników środowiskowych.

7.3.2. Zmienność transgresywna
Zwierzęta gospodarskie, nawet ras o ustalonym genotypie, są heterozygotyczne pod względem znacznej liczby loci. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189

wartości cechy takie, jakie obserwowano u rodziców, bądź wartości wyższe lub niższe niż u rodziców, czyli wykazujące większą zmienność cechy. Zjawisko to nosi nazwę transgresji. Ilustruje je przykład: Załóżmy, że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D, E i F. Efekty genów D, E i F są identyczne (D = E = F), a każdy z nich zwiększa produkcję mleka o 400 kg. Genotyp ddeeff warunkuje wydajność 2400 kg mleka, DDEEFF — 4800 kg, natomiast heterozygotyczny DdEeFf— 3600 kg mleka. W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot), warunkujące różną wydajność mleczną. Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy, równą wartości cechy u rodziców. Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np. genotyp DDEEFF, warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka). Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej, wykorzystywanej w pracy hodowlanej.

7.3.3. Geny o dużym efekcie
W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). Cechy takie charakteryzują się rozkładem normalnym. W przypadku niektórych cech zaobserwowano zmienność, której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty, spłaszczony albo nadmiernie uwypuklony. Jest to wynikiem dziedziczenia, w którym obok poligenów działa gen o dużym efekcie, zwany inaczej genem głównym. Gen o dużym efekcie jest identyfikowany wówczas, gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna. Niektóre geny o dużym efekcie zostały wykryte przypadkowo. Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang. quantitative trait locus). Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. growth hormone). U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25). Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. W badaniach prowadzonych na simentalerach stwierdzono, iż zwierzęta homozygotyczne pod względem allelu B hormonu
190

wzrostu charakteryzowały się o 382 + 18,5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. Hormon wzrostu reguluje rozwój mięśni, a IGF-1 wspomaga jego działanie. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej. Stwierdzono także, iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu. Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka, bydła i szczura. Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni, z równoczesnym zmniejszeniem otłuszczenia, a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. Dalsze badania zmierzają do ustalenia, które allele mają związek z użytkowością mięsną. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu. Dotychczas wykazano, iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe, jak karłowatość i akromegalia. Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt, a najnowsze osiągnięcia są omówione w rozdziale 12.3.5.
Świnie

U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie. Gen receptora rianodyny (KYR1). Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. Badania cytogenetyczne wykazały, iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe). W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. porcine stress syndrome), powodowane transportem, warunkami termicznymi i niektórymi czynnikami chemicznymi. Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie, prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena. Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną, jak zawartość mięsa w tuszy i powierzchnia oka polędwicy. Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych, będących nosicielami zmutowanego allelu. Zwierzęta takie są więc dobrym materiałem do tuczu. 191

Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan, początkowo oznaczono go symbolem Haln. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. Badania przeprowadzone przez naukowców kanadyjskich wykazały, że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1), jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. W obrębie genu RYR1 stwierdzono 18 mutacji punktowych, z których najistotniejsza jest mutacja w 1843 nukleotydzie, powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. Mutacja ta likwiduje miejsce trawienia niektórymi enzymami, co umożliwiło opracowanie molekularnych testów diagnostycznych. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI). W innym, opatentowanym przez badaczy kanadyjskich, fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. Procedurę tego testu przedstawiono na rycinie 7-1. Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T. W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki, natomiast w zmutowanym

192

allelu zmiana tej sekwencji powoduje, że enzym nie znajduje miejsca cięcia, czego wynikiem jest uzyskanie nie strawionego fragmentu genu. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz, dla homozygotycznego (nn) - - jeden prążek długości 81 pz, natomiast dla heterozygoty trzy prążki: 81 pz, 49 pz, 32 pz. Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych. W pracy hodowlanej należy prowadzić kojarzenia tak, by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19, u bydła w 18, a u koni w 10 chromosomie. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3). Pierwsze sugestie co do istnienia genu o dużym efekcie, wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). W genie tym stwierdzono siedem mutacji, ale tylko tranzycja G-»A w kodonie 200, powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym, warunkuje cechę kwaśnego mięsa. U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce). Test molekularny wykrywający mutację genu PRKAG3 został opatentowany. Gen wpływający na wielkość miotu (ESR). Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy. Wyniki tych badań wskazują, iż zlokalizowany w chromosomie l (1p2.5-2.4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang. estrogen receptor gene) może mieć istotny wpływ na wielkość miotu. Stwierdzono, że jeden z alleli tego genu, występujący w chińskiej plennej rasie meishan, wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę. Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1,4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu, prowadzone u świń innych ras (niemiecka landrace, yorkshire, duroc), pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie
193

1754). Gen ten nie wykazuje plejotropowego negatywnego działania na inne, ekonomicznie ważne cechy, jak wzrost i grubość słoniny na grzbiecie. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń, wyprowadzanych z udziałem rasy meishan.
Bydło

Geny białek mleka. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. Gen κ-kazeiny, zlokalizowany w chromosomie 6, ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka, białka i tłuszczu). Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC), podczas gdy w wariancie B — treonina (w DNA kodon ACC). Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT), wariant A alaninę (GCT). Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII, natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć. 7-2). Opracowana została metoda identyfikacji genotypów κ-kazeiny, wykorzystywanych jako dodatkowe kryterium selekcji buhajów, utrzymywanych w zakładach unasieniania. Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny, identyfikowanych w mleku córek, przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. Gen β-laktoglobuliny uważany jest za gen o dużym efekcie, gdyż określony wariant tego białka, podobnie jak κ-kazeiny, wpływa na wydajność mleka i jego składników. Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy, tłuszczu i kazein oraz lepszą przydatnością technologiczną. Gen β-laktoglobuliny ma długość około 7800 par zasad, zawiera 7 eksonów. Białko wariantu A różni się od B dwoma aminokwasami. Jest to konsekwencja różnic w sekwencji nukleo-

194

AB

AA

BB

Ryć. 7-2. Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. a — marker, b — produkt nie strawiony, l — trawienie enzymem restrykcyjnym Hinfi, 2 — trawienie enzymem restrykcyjnym Hindlll

tydowej obu alleli. Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. Gen hipertrofii mięśniowej (MH — ang. muscular hypertrophy). Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2, jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). Gen miostatyny należy do rodziny TGFβ (ang. transforming growth factor β). Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem, dlatego mutacja ta jest oznaczona jako nt821(del11). Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne, spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej. Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras, jak i ich mieszańców. Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa, należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci, zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi, mniejszy obwód i masa jąder, natomiast u krów dłuższa ciąża. Duża masa płodu stwarza wyraźne trudności naturalnego porodu. Rozwiązaniem

195

ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. Pomimo ujemnych następstw związanych z hipertrofią mięśni, cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. 7-3 wkładka kolorowa). Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji, które uszkadzają funkcję kodowanego białka. Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów, począwszy od pozycji 419 nukleotydu, b) tranzycja C→T w 610 nukleotydzie, c) transwersja G → T w nukleotydzie 676. Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938, która jest odpowiedzialna za substytucję cysteiny przez tyrozynę. Co ciekawe, mutacje te są charakterystyczne dla określonych ras bydła mięsnego. Mutacje a) i c) występują u bydła francuskiego maine-anjou, b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). Owce Gen hipertrofii mięśniowej (CLPG). U owiec występuje mutacja powodująca hipertrofię mięśniową, która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. Jest to pojedynczy autosomalny gen, nazwany callipyge (z greckiego calli — piękne, pyge -- pośladki) -- symbol CLPG. Prowadzone są badania w celu jego izolacji. Przypuszcza się, że istnieją dwa allele — CLPG i clpg, przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia, natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. Jak wykazały ostatnie badania, w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego, czy gen CLPG pochodzi od ojca, czy od matki. Gen CLPG pochodzący od matki jest nieaktywny. Hipertrofia ujawnia się u potomka wówczas, gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). Ostatnio ustalono, że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. Przypuszcza się, że locus ten podlega transkrypcji, a jego produkt to niekodujący RNA (ncRNA ang. noncoding RNA), który pełni nieznaną jeszcze funkcję regulacyjną. Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. U owiec wykryto geny główne, warunkujące zwiększony stopień owulacji, takie jak gen Inverdale (FecXI, zlokalizowany w chromosomie płci X) 196

u owiec rasy romney, „Thoka" u owiec islandskich, gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80. ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang. fecundity gene of booroola). W przeciwieństwie do owiec ras wysokopiennych (owca romanowska, owca fińska), u których zwiększona plenność jest cechą poligeniczną, uwarunkowaną genami o addytywnym efekcie, wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie), w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych, połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II), wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB, odpowiedzialnej za dużą plenność owiec rasy merynos booroola. W locus BMPR-IB wykryto mutację w 830 nukleotydzie, polegającą na tranzycji adeniny na guaninę, której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego. Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to, że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB, zawierającego miejsce mutacyjne, będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego, trzy prążki (110 pz, 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz; produkt PCR nie strawiony) dla homozygoty typu dzikiego.

Rozdział

Podstawy genetyki populacji

Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia, mimo iż dotyczyły nieraz grupy zwierząt, w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki. Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników, lecz zbiorowości określonej jako populacja. Hodowla jest działalnością genetyczno-populacyjną. Populację stanowią zwierzęta należące do jednego gatunku, mogące się rozmnażać i występować na danym obszarze. Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej. Podstawowym prawem genetyki populacji, opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów, jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G.H. Hardy'ego i niemieckego lekarza W. Weinberga. Ponieważ badacze ci działali niezależnie od siebie, prawo to nosi nazwę Hardy' ego-Weinberga.

8.1. Prawo równowagi genetycznej
Struktura genetyczna populacji

Populację tworzy określona, teoretycznie nieskończona liczba osobników. Rozpatrując daną cechę można powiedzieć, że każdy osobnik ma określony fenotyp, tak więc w populacji występuje określona liczba fenotypów,
198

z których każdy reprezentowany jest przez pewną liczbę osobników. Częstość występowania, inaczej frekwencja danego fenotypu, oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego. Suma frekwencji wszystkich fenotypów równa się l lub 100%. Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów. Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci, które ten allel mógłby zająć w badanej populacji. Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. Oba te elementy są od siebie zależne. Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów, natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu. Sposób postępowania obrazuje poniższy przykład. W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych, 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim). Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca:

Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków, każdy ma dwa allele). 250 ptaków czarnych ma w swych genotypach 500 genów A, ptaki niebieskie mają 500 genów A i 500 genów a. W genotypach 250 ptaków białych jest 500 alleli a. Zatem w stadzie tym jest 1000 alleli A i 1000 a. Częstość występowania (frekwencja) allelu A = 1000/2000 = 0,5 (50%), podobnie frekwencja allelu a = 1000/2000 = 0,5 (50%). Suma frekwencji obu alleli wynosi l (100%). Jeśli frekwencję allelu dominującego oznaczymy symbolem p, a allelu recesywnego symbolem q, to:

199

Rozpatrywana cecha dziedziczy się z niezupełną dominacją, zatem rozkład fenotypów i genotypów w tej populacji wynosi:

Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci, wówczas struktura genetyczna w pokoleniu potomnym będzie następująca:

czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga, które mówi o tym, że: w dużej, losowo kojarzącej się populacji, w której frekwencje genów u obu płci są jednakowe, a osobniki charakteryzują się równą płodnością i żywotnością, frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie, jeśli nie działają czynniki naruszające równowagę. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci, bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna, a' zdarzają się również migracje i mutacje, które wpływają na zmianę struktury genetycznej populacji. O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej. 200

8.2. Frekwencja genów i genotypów w przypadku dominowania
W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. Zatem obliczanie frekwencji zarówno tych genotypów, jak i genów stwarza pewne trudności. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych, gdyż w ich przypadku wiadomo na pewno, że zawierają jedynie allele recesywne. Wiedząc, że frekwencja homozygot recesywnych wynosi q2, łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych, a 90 czerwonych. W stadzie tym prowadzone są kojarzenia losowe. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0,09. Pozostałe 910 krów ma genotypy homo- (EdEd) lub heterozygotyczne (Ede). Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q, która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0,3 = 0,7. Wiedząc, że w przypadku losowych kojarzeń rozkład genotypów jest następujący:

łatwo jest obliczyć frekwencję pozostałych genotypów:

W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot. Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej.

8.3. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych
W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący:

201

przy czym p,q, r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli. U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C, himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc). W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa), 13 himalajskich i 2 albinosy. Frekwencja poszczególnych fenotypów wynosi zatem:

Frekwencję genów oznaczono symbolem p dla genu C, q dla genu dla genu c. W populacji tej, w której są kojarzenia losowe, fenotypy, genotypy i ich frekwencja są następujące (tab. 8-1):

202

Po dodaniu takich samych genotypów uzyska się rozkład:

Z zestawienia tego wynika, że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi:

Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego. Podstawiając dane liczbowe, (q + r) równa się:

Frekwencję genu c = r można obliczyć, znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc). W danym przykładzie r2 = 0,013, stąd r = = 0,114. Frekwencję genu można obliczyć następująco:

W badanej populacji królików frekwencja genów umaszczenia jest więc następująca:

203

ogółem = 1,000

8.4. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią
W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych, których liczba w genotypach jest jednakowa bez względu na płeć osobnika, geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej. Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu, który ją warunkuje). U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym, lecz przyjmie postać:

przy czym A jest genem dominującym, natomiast a — jego recesywnym allelem. Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych, czyli zgodna z rozkładem dwumianowym. U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0,08. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet, jak i u mężczyzn. U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi:

U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu:
204

D- = p = 0,92 d- = q = 0,08

Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64, 1472 kobiety będą rozróżniały barwy, ale będą nosicielkami genu daltonizmu (Dd), pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD). W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ), pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ).

8.5. Czynniki naruszające równowagę genetyczną
Do czynników naruszających równowagę genetyczną populacji należą: mutacje, migracje, selekcja, dobór par do kojarzeń i dryf genetyczny. O ile mutacje i dryf genetyczny nie zależą od hodowcy, o tyle pozostałe czynniki są związane z jego świadomą działalnością. Wszystkie te czynniki, z wyjątkiem doboru, wpływają na zmianę frekwencji genów i genotypów. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej).
Mutacje

Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus, ale także mogą się pojawić nowe allele. Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. Ekspresja fenotypowa mutacji, która może wpłynąć na zmianę struktury genetycznej populacji, zależy od genetycznego uwarunkowania danej cechy. Jeśli zmutuje jeden z genów addytywnych, kontrolujących cechę ilościową, mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji. Natomiast mutacja genu warunkującego cechę jakościową, np. umaszczenie zwierząt futerkowych, powodująca pojawienie się nowej barwy okrywy włosowej, może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji, w której mutacja wystąpiła. W rozdziale dotyczącym mutacji podano, iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u, natomiast częstość mutacji odwrotnej symbolem v. Jeśli zmutuje allel dominujący, jego frekwencja zmaleje o wartość równą up. Analogicznie, mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq. Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie:

205

Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0,7, allelu czerwonego umaszczenia e = q = 0,3. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia. W wyniku mutacji genowej, i wyniosła 0,66, natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0,1,14 alleli Ed zmutowało w kierunku allelu e, a 6 alleli e w kierunku allelu Ed. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0,34. Zmianie uległa także frekwencja genotypów. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0,49; Ede = 2pq = 0,42; ee = q2 = 0,09, po mutacji: EdEd = p2 = 0,4356; Ede = 2pq = 0,4488; ee = q = 0,1156.
Migracje

Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji. Przy krzyżowaniu różnych ras w zależności od tego, ile razy dokonywane jest to krzyżowanie, wielkość zmian frekwencji genów i genotypów jest różna. Jeśli jest to zabieg jednorazowy, po pewnym czasie populacja wróci do równowagi, czyli ustali się nowy układ genetyczny. Natomiast krzyżowanie uszlachetniające, które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną, powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. Może nawet, w przypadku wielokrotnego krzyżowania, doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw. krzyżowanie wypierające). W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja, zatem migracja nie zawsze wiąże się z wprowadzaniem osobników, może ona dotyczyć wprowadzania nasienia. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji)

206

oznaczymy literą m, to część osobników rodzimych będzie równa (1 —m). Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p, a frekwencję genu u osobników wprowadzonych do stada literą p', zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy, że do omawianego wcześniej stada liczącego 100 krów, w którym frekwencja allelu Ed wynosiła 0,7, wprowadzono 20 krów, z frekwencją allelu Ed wynoszącą 0,9. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0,49; Ede = 2pq = 0,42; ee = q= 0,09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0,81; E d e = 2pq = 0,18; ee = q = 0,01. Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0,2 • 0,9 + (l -0,2) • 0,7 = 0,74 czyli wzrosła o 0,4. Nowa frekwencja allelu e wynosi (1 — 0,74) = 0,26. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0,5476; E'e = 2pq = 0,3848; ee = q2 = 0,0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd, zmalała osobników heterozygotycznyh Ede i homozygotycznych ee. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej.
Selekcja

Wybór zwierząt, które hodowca zamierza pozostawić do hodowli, nazywany jest selekcją. Hodowca preferuje geny korzystne, a eliminuje z populacji zwierząt geny niepożądane. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku, stanu zdrowotnego, obniżenia płodności i produkcyjności lub niepożądanego genotypu. Zmiany w strukturze genetycznej populacji zależą od tego, jakie geny czy genotypy są preferowane. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji.
207

Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. Współczynnik ten może przybierać wartość od O do l, co oznacza, że wartość O jest wówczas, gdy nie ma w ogóle selekcji, wartość l współczynnik osiąga, gdy usuwane są wszystkie niepożądane genotypy. Zmiana frekwencji genu, będąca konsekwencją selekcji, zależy od rodzaju tej selekcji. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym, zmianę częstości genu recesywnego, będącą jej konsekwencją, można obliczyć ze

Jeśli natomiast selekcja preferuje genotyp recesywny, wówczas frekwencja genu tworzącego ten genotyp wyniesie:

wzoru:

Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną. Cecha ta dziedziczy się z dominacją zupełną, czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled). W pewnym stadzie, w którym frekwencja allelu bezrożności wynosi 0,8, prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. Jeśli współczynnik selekcji będzie wynosić 0,4, to oznacza, że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego:

Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0,013 i wyniesie 0,187. Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji, wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. Efekt selekcji zostanie zachowany.
Dobór par do kojarzeń

W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie, prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. Załóżmy, że w omawianym już wcześniej stadzie kur andaluzyjskich, złożonym z 1000 ptaków, zastosowano kojarzenia w obrębie takich samych
208

genotypów. Oznacza to, iż kojarzono koguty czarne z kurami czarnymi, koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi. W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0,5 (allel A) i q = 0,5 (allel a). W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0,25 AA + 0,5 Aa + 0,25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie

Frekwencja genów pozostała nie zmieniona, pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt. Aby się o tym przekonać, można przeprowadzić obliczenia:

Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji, stado powróci do stanu równowagi genetycznej. Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych, maleje natomiast częstość genotypów heterozygotycznych. Odwrotna sytuacja zaistniałaby, gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych. Niekiedy, na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji, stosowane są kojarzenia osobników spokrewnionych, np. ojca z córką czy matki z synem. Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej
209

brat x siostra) prowadzą do wytworzenia tzw. szczepów wsobnych, w których stopień homozygotyczności jest bliski 100%. Szczepy wsobne są wykorzystywane w badaniach biomedycznych.
Dryf genetyczny

Dryf genetyczny, zjawisko tak nazwane przez Wrighta w 1931 roku, polega na zmianie frekwencji genów i genotypów w małych populacjach, która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych. Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego, zwłaszcza w małych populacjach, w których działa on najsilniej. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej, jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. Biorąc pod uwagę, iż allele niekorzystne z reguły są recesywne, szczególnie niebezpieczny może być wzrost homozygot recesywnych, którego skutkiem będzie zmniejszenie płodności, żywotności czy ujawnienie się wad dziedzicznych. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać, iż w potomstwie uzyskamy 5 osobników homozygot dominujących, 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus. Może jednak się zdarzyć tak, że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. Jeśli było to jednorazowe zaburzenie, to w następnym pokoleniu ustali się nowa równowaga genetyczna, w której frekwencja genu dominującego wyraźnie wzrośnie. Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać, to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach.

8.6. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami
Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt. Im większa jest pula genów w jakiejś populacji, tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210

wych. Na skutek długotrwałej selekcji, zwłaszcza w małych populacjach, może dojść do znacznego ograniczenia puli genów, czego wynikiem będzie utrata zdolności adaptacyjnych. By temu niekorzystnemu zjawisku zapobiec, zalecane jest monitorowanie zmian w strukturze genetycznej populacji, które zachodzą w wyniku pracy hodowlanej. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych, na przykład warunkujących antygeny erytrocytarne, różne typy białek surowicy krwi czy enzymy erytrocytarne. Mogą to być loci kontrolujące syntezę transferyny, albuminy, esterazy, amylazy, ceruloplazminy czy anhydrazy węglanowej, należące do markerów genetycznych klasy I, opisanych w rozdziale: Markery genetyczne. Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini- i mikrosatelitarny, czyli markery genetyczne klasy II). Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności. Wartość tego parametru zawiera się w granicach od O do l, można także przedstawiać ją w procentach. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru:

211

Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. polymorphic Information content). Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci. O markerach genetycznych jest mowa w innym rozdziale. By obliczyć wartość PIĆ, należy znać frekwencję wszystkich alleli w danym locus:

Dystans genetyczny

Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw. dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi, a także między populacjami w obrębie gatunku. Szacowanie dystansu genetycznego i wybór ras, które cechuje duża zmienność genetyczna, służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Do szacowania dystansu genetycznego (Dr), tak na podstawie polimorfizmu sekwencji mikrosatelitarnych, jak i polimorfizmu białek i antygenów erytrocytarnych, najczęściej stosowany jest wzór:

Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów, obliczonych różnymi metodami, na przykład: najbliższego sąsiedztwa — SLM (ang. single linkage method), najdalszego sąsiedztwa — CLM (ang. complete linkage method) lub skupienia parami — UPGM (ang. unweighted pair group method).
212

Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp., Prace i Materiały Zootechniczne, 50:111-120, 1997).

Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych. Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III. Analizą objęto 141 koni z linii El Paso, 219 z linii Palasa, 146 z linii Celebesa, 150 z linii Banata, 369 z linii Probata, 146 z linii Partnera i 202 z linii Bandosa. Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM. Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa, najmniejszy między linią Celebesa a Probata, Palasa a Partnera, a także między linią Banata a Celebesa i Probata. Na przykład, wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0,32, Partnera a Banata 0,39 oraz Palasa a Partnera 0,37 (ryć. 8-1).
213

Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne), a także metodę RAPD, opisaną w rozdziale: Metody analizy i modyfikacji genomu. W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej. W wyniku analizy polimorfizmu minisatelitarnego (tzw. odcisk palca DNA, opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji). Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS - ang. band sharing), określający prawdopodobieństwo, że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA, wykorzystując wzór:

gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1. Im mniejsza zmienność genetyczna w danej populacji, tym większa wartość tego współczynnika.

Rozdział

9

Determinacja i różnicowanie płci oraz interseksualizm

Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów. Płeć może zależeć od warunków środowiska zewnętrznego, głównie temperatury, w jakich rozwijają się zarodki. Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie. Ten typ determinacji płci obserwuje się u wielu gatunków gadów, w tym u wszystkich krokodyli, wielu gatunków żółwi i niektórych gatunków jaszczurek. Z kolei u niektórych gatunków ryb zachodzi tzw. behawioralna determinacji płci. Zwierzęta takie są zazwyczaj obojnakami, tzn. mają gonady męskie i żeńskie. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. Wśród ryb spotyka się również gatunki, które są hermafrodytami sekwencyjnymi, czyli zmieniają one płeć w ciągu życia. U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci, a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. W przypadku ssaków wyróżnia się chromosomy X oraz Y, a w przypadku ptaków Z oraz W. U ssaków płcią heterogametyczną są samce (układ XY), a płcią homogametyczną są samice (układ XX). U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ), a samice heterogametyczne (układ Z W).

9.1. Determinacja płci ssaków
Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw. płeć chromosomowa, 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. płci gonadowej i 3) uformowanie się wewnętrznych
216

i zewnętrznych cech płciowych — powstanie tzw. pici fenotypowej (ryć. 9-1). Pleć fenotypowa obejmuje również zmiany powstające w mózgu, które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego. W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe. Pojawiają się one w endodermie pęcherzyka żółtkowego, a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym.
217

Dotychczasowe badania wykazały, że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów, a w tym: WT1, SF1, SOX9, SRY, Fgf9, ZFX i FOXL2. Gen WT2 (ang. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. Produktem tego genu jest białko zawierające tzw. palce cynkowe, które pełni rolę czynnika transkrypcyjnego, czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. Gen SF1 (ang. steroidogenic factor 1) koduje białko receptora jądrowego, regulującego ekspresję hydroksylaz steroidowych. Gen ten podlega ekspresji, oprócz kory nadnerczy, także w niezróżnicowanej gonadzie. W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi, w przeciwieństwie do jajnika, gdzie obserwuje się zanik jego ekspresji. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9, którego produkt należy, podobnie jak białko SRY, do grupy białek określanych skrótem HMG (ang. high mobility group). Wiadomo o nich, że pełnią funkcję czynników transkrypcyjnych. W rosnącej gonadzie wyróżnia się część korową i rdzeniową. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra, a część korowa w jajniku. W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). Od końca lat 50. wiadomo było, że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y. Badania cytogenetyczne prowadzone u ludzi dowiodły, że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. Przyjęto, że jest tam zlokalizowany gen TDF (ang. testis determining factor) — czynnik determinujący jądro. Produkt tego genu miał odpowiadać za tzw. przełączenie rozwojowe, polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej. Badania molekularne pokazały, że funkcja tego genu jest tożsama z funkcją genu SRY (ang. sex determining region Y), którego locus występuje w chromosomie Y. Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. Białko kodowane przez ten gen składa się z trzech regionów (ryć. 9-2).

218

Region środkowy, składający się z 79 aminokwasów, ma strukturę podobną do białek z grupy HMG, które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne, czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. Bardzo ciekawe jest również to, że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. wysepka CpG), w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1, omówiony wcześniej. Białko SRY, tak jak białka WT1 i SOX9, pełni funkcję czynnika transkrypcyjnego, odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej), w momencie kiedy rozpoczyna się proces formowania gonady męskiej. Bardziej szczegółowe dane wskazują, że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego. Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać, że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9, a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9). Kaskadowe włączanie tych genów, po pojawieniu się produktu genu SRY, odpowiada za prawidłowe różnicowanie się gonady męskiej. Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. Z przewodów Wolffa rozwinąć się mogą nasieniowody, a z przewodów Miillera — jajowody i macica. Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika, a drugi rozwija się. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. Miillerian inhibitor substance), określanego także jako hormon antymiillerowski (ang. anti-Mullerian hormone — AMH). Ekspresja tego genu zachodzi w komórkach Sertolego. Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron, który podtrzymuje rozwój przewodów Wolffa. Z testosteronu powstaje dihydrotestosteron, który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. Gdy gen SRY jest nieobecny, niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza, aniżeli w odniesieniu do jądra. Początkowo przypuszczano, że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. Wiadomo, że jego locus występuje w chromosomie X, a jego produktem jest jądrowy receptor dla hormonów. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. Obecnie większą rolę przypisuje się genowi ZFX (tzw. gen palca cynkowego), również położonemu w chromosomie X, oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu
219

kodującego testosteron. W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody, macicę i górną część pochwy. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa. Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY, w których genotypie występuje duplikacja locus DSS (DAX1). U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. Jeśli w genotypie wystąpi delecja tego locus, to rozwój w kierunku męskim nie jest zakłócony. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. Zakłada się, że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1), to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci, jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. samic biorczyń. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro), czy też klonowania. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). Gen ten umiejscowiony jest w obu chromosomach płci, z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. Należy również zwrócić uwagę, że w chromosomie Y poza genem SRY, który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej, występują także inne geny. Szczególnie istotną częścią chromosomu Y jest region AZF. Jego nazwa pochodzi od słów angielskich azoospermia factor, oznaczających czynnik odpowiedzialny za powstanie azoospermii, czyli brak plemników w ejakulacie. W regionie tym występują geny, których ekspresja związana jest z przebiegiem spermatogenezy. Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy, takich jak całkowity brak spermatogoniów, lub do zahamowania podziału mejotycznego. Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y, np. gen RBM (ang. RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. splicing) mRNA. Znane są też geny położone w innych częściach chromosomu Y, np. gen Ube1Y (ang.
220

ubiąuitin activating enzyme-1), który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach, co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników. Z przedstawionych wyżej informacji można wyciągnąć wniosek, że informacja genetyczna zawarta w chromosomie Y jest bogatsza, niż to wcześniej zakładano.

9.2. Interseksualizm
Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego, które określa się terminem interseksualizmu lub obojnactwa. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. frymartynizm). Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy, ze względu na bardzo duże zróżnicownie obserwowanych zmian. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian, często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy, kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski, kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych.
Frymartynizm

Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych, głównie przeżuwaczy. Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów. Jeśli połączenie łożysk dotyczy płodów różnopłciowych, to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony, co w konsekwencji prowadzi prawie zawsze do niepłodności. Połączenie krwiobiegów bliźniąt różnopłciowych sprawia, że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu, w którym powstały połączenia naczyniowe. W rozwoju embrionalnym różnicowanie się jąder poprzedza okres, w którym kształtują się jajniki. Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego, to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci
221

żeńskiej w takim stopniu, że rozwinie się nawet gonada męska, a w ślad za tym drogi płciowe będą miały charakter męski. Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany, to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. Możliwe jest również powstanie połączeń, w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę. Wówczas dihydrotestosteron, powstający z wydzielanego przez komórki Leydiga testosteronu, może zakłócić, w mniejszym lub większym zakresie, proces kształtowania się zewnętrznych narządów płciowych. Trzeba podkreślić, że prawie we wszystkich przypadkach, niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych, stwierdza się niepłodność samic frymartynów. Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo. Buhaje takie mogą być wykorzystywane w rozrodzie, chociaż parametry określające ich przydatność rozpłodową (np. obraz nasienia, wskaźnik niepowtarzalności rui itp.) są często obniżone. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych, a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. Okazuje się, że badania kliniczne samic są niewystarczające, szczególnie wówczas, gdy zewnętrzne narządy płciowe są prawidłowo uformowane. Bardzo pomocne okazało się badanie cytogenetyczne, polegające na ustaleniu zestawu chromosomów płci w leukocytach. Ze względu na wspólną cyrkulację krwi u płodów, których łożyska są połączone anastomozami, dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie. Z tego powodu we krwi frymartynów, a także samców będących bliźniętami frymartynów, stwierdza się obecność dwóch linii komórkowych — jednej własnej, a drugiej współbłiźniaka. Linie te różnią się układem chromosomów płci — w jednej występuje układ XX, a w drugiej układ XY. Ponieważ linie te pochodzą od dwóch różnych genotypów, dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. Chimeryzm dotyczy również erytrocytów, które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych, ale także molekularnych (np. sekwencje mikrosatelitarne). Identyfikacja sekwencji typowych dla chromosomu Y (np. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy, przy jednoczesnym ich braku np. w komórkach błony śluzowej, może być wskazówką, że badany osobnik jest frymartynem. Powstawanie anastomoz jest bardzo często stwierdzane u bydła. Szacuje się, że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy. Znacznie rzadziej zdarza się to u owiec (od l do 10%, zależnie od rasy). Biorąc jednak pod uwagę, że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż), a często u owiec (od 40 do blisko 100% ciąż, zależnie od
222

rasy), w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie, w zakresie od 0,5% (bydło) do kilku procent (niektóre rasy owiec, np. merynos booroola). Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. Z badań przeprowadzonych na owcach wynika, że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych.
Mutacje chromosomów płci

Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. Z jednej strony mogą to być aneuploidie, wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY, XYY lub XXX). U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera, a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. Z drugiej strony ważną rolę odgrywają mutacje strukturalne, w które są zaangażowane chromosomy płci. Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad. Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy, które są fenotypowo prawidłowo rozwinięte. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY. Kilkanaście takich przypadków opisano u buhajów. Charakteryzowały się one gorszym tempem wzrostu, miały niedorozwinięte jądra, a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników, co oczywiście prowadziło do bezpłodności. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych.
Zespół niewrażliwości na androgeny

Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie, niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. Konsekwencją występowania
223

nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu, co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim.
Zespół odwróconej płci u koni

W hodowli koni częstym typem interseksualizmu jest tzw. zespół odwróconej płci (ang. sex reversal), który polega na niezgodności między płcią fenotypową i chromosomową. Najczęściej zespół ten diagnozowany jest u fenotypowych samic, które mają układ chromosomów XY. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte, chociaż zdarzają się zwierzęta z powiększoną łechtaczką. Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie, a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. Badania molekularne genów położonych w chromosomie Y, z wykorzystaniem techniki PCR, ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL, ZFY, STS), przy jednoczesnym braku kluczowego genu SRY. Przyczyny takiego stanu mogą być różne, a wśród nich należy wymienić: mutację w locus SRY (np. częściowa lub całkowita delecja), przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem. U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX. Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane, od prawie typowo samczych do samiczych, ale z powiększoną łechtaczką. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder, w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego. W genotypie tych zwierząt nie ma genu SRY, który uznawany jest za niezbędny do rozwoju gonady męskiej. Taki typ odwrócenia płci spotykany jest również u kóz, świń i psów.
Interseksualizm bezrogich kóz

Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz. Bezrożność kóz uwarunkowana jest przez dominujący allel P, a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp. Okazało się, że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze, które mają układ chromosomów płci XX, a w ich genotypie nie stwierdza się genu SRY. Osobniki takie powinny być samicami, tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych, jak i wewnętrznych cech płciowych, a stopień
224

nasilenia tych zmian jest bardzo zróżnicowany. Gonady zazwyczaj mają strukturę jądra, a rzadko jajnikojądra. Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm. Wreszcie mogą występować również osobniki, które mają zdecydowanie samczy fenotyp. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej, czyli mających układ chromosomów płci XY, a w ich genotypie występuje gen SRY. W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono, że jest on położony w chromosomie l — w części dystalnej. Ciekawe jest, że locus genu bezrożności bydła został umiejscowiony również w chromosomie l, ale w części proksymalnej (w pobliżu centromeru). Z badań porównawczych wiadomo, że kariotypy obu gatunków są prawie identyczne, również w zakresie układu loci w chromosomach. Można z tego wyciągnąć wniosek, że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. Co więcej należy podkreślić, że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci. W 2001 r. ukończono wieloletnie badania, których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. gen PIS — ang. polledness and intersexuality syndrome). Okazało się, że odpowiedzialna za to jest delecja 11 700 par zasad, zlokalizowana w niekodującym fragmencie DNA, co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym).
Choroba białych jałowic

Innym przykładem genu o działaniu plejotropowym, który jest odpowiedzialny za rozwój interseksualny, jest allel R genu Roan (umaszczenie dereszowate) u bydła. Allel R odpowiada za powstanie białego umaszczenia, allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). Allele te prezentują typ dziedziczenia pośredniego, z tym jednak że genotyp Rr+ wykazuje niepełną penetrację, tzn. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. U obu ras bydła stwierdzono, że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek. Zaburzenia te polegają na braku lub niedorozwoju pochwy, szyjki macicy i macicy, natomiast jajniki są rozwinięte prawidłowo. Zespół tych zmian jest określany jako choroba białych jałowic
225

(ang. white heifer disease), bowiem ponad 90% chorych jałówek ma umaszczenie białe, a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny). Dotychczasowe obserwacje dowodzą, że choroba białych jałowic ma złożone podłoże, w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe. Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła. Przypuszcza się, że genem roan może być gen kodujący czynnik wzrostu komórek tucznych. Locus tego genu został wcześniej zmapowany w regionie, w którym ostatnio umiejscowiono locus genu Roan.
Interseksualizm u świń

Przypadki interseksualizmu u świń obserwuje się z częstością około 0,3%. Tło genetyczne tych przypadków jest słabo poznane. Badania chromosomowe wykazują, że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38,XX. Wśród nich niejednokrotnie zdarzają się przypadki, gdzie gonady mają strukturę jądra lub jajnikojądra, pomimo nieobecności genu SRY, a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. Sytuacja taka wskazuje, że powstanie gonady męskiej może nastąpić pomimo braku genu SRY. Zakłada się, że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego, który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym, że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej. W potomstwie jednego knura pojawiło się kilkanaście obojnaków, w których kariotypie występowały dwa chromosomy X. U zwierząt tych stwierdzano obecność jąder, pomimo braku genu SRY w ich genotypie, macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich, z tym jednak że łechtaczka była bardzo powiększona, a srom tworzył z odbytem wspólny otwór (ryć. 9-3 wkładka kolorowa). Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38,XX/38,XY. Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. Można natomiast przypuszczać, że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm, a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny.

Rozdział

10

Genetyczne podstawy odporności i oporności

Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. Ma on, podobnie jak układ nerwowy, zdolność uczenia się, zapamiętywania, reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm. Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna, której celem jest zwalczenie, usunięcie tych obcych białek. Zastanawiające jest, iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje, mimo że ma tylko pięć klas przeciwciał. Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał, ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego, jakim jest główny układ zgodności tkankowej.

10.1. Genetyczne podłoże różnorodności przeciwciał
Immunoglobuliny, czyli przeciwciała, wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato, są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). Są one elementem odporności swoistej (nabytej, adaptatywnej), ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np. bakterii czy wirusów). Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. heavy — H), po 50 kDa każdy, połączonych z dwoma łańcuchami lekkimi (ang. light — L), o masie po 25 kDa. Jest pięć typów łańcuchów ciężkich (gr. α - - alfa, δ - - delta, ε - - epsilon, γ - - gamma
227

i μ - - mi) i dwa typy lekkich (κ— kappa i λ. — lambda). Stosunek przeciwciał, które mają łańcuch lekki typu κ, do łańcucha λ zależy od gatunku (np. u ludzi wynosi on 70:30, u myszy l: 20, u koni l: 25). Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA, IgD, IgE, IgG i IgM. Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin, natomiast A, D, E, G i M od symboli łańcuchów ciężkich. Przeciwciało ma kształt litery Y (ryć. 10-1), utworzonej przez łańcuchy ciężkie, a wzdłuż jej ramion znajdują się łańcuchy lekkie. Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi, których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. Zarówno łańcuchy ciężkie, jak i lekkie mają części zmienne (ang. variable — V) oraz części stałe (ang. constant — C). W części zmiennej znajdują się trzy regiony hiperzmienne (ang. hypervariable), oznaczone HV1, HV2 i HV3. Ponieważ regiony te determinują swoistość przeciwciał, nazywane są także regionami determinującymi dopasowanie (ang. complementarity determining regions CDR). W części stałej łańcucha ciężkiego, między domeną CH1 i CH2, znajduje się tzw. region zawiasowy (ang. hinge region), w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie. Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku. Badacz ten odkrył, iż informacja genetyczna

228

immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów", które nazwał segmentami. Różnorodność przeciwciał, ich swoistość wynikają z tego, iż dziedziczone są nie całe geny immunogłobulinowe, ale ich segmenty. Proces syntezy przeciwciała następuje po skompletowaniu genów, czyli połączeniu się segmentów po jednym z każdej grupy minigenów. Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang. variable) i J (ang. joining), natomiast łańcucha ciężkiego przez trzy geny: V, D (ang. diversity) i J. Część stała obu rodzajów łańcuchów jest kodowana przez gen C. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie, natomiast geny łańcucha lekkiego typu κ w 2, typu λ w 22 chromosomie, u myszy natomiast odpowiednio w chromosomach 2, 6 i 16. Różnorodność przeciwciał wynika z wielu przyczyn, przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V, D, J i C, a łańcuchów lekkich z rekombinacji regionów V, ] i C. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen. Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. Przypuszczalnie jest wiele genów kodujących region V. Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt, może kilkaset), dla lekkiego — kilka. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D, 6 genów funkcjonalnych i 3 pseudogeny regionu J, natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A,. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V, kilkadziesiąt genów D i kilka genów J. Geny determinujące region C różnią się od pozostałych tym, że wpływają na funkcję przeciwciała, a nie na jego powinowactwo do antygenu. Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów, których kolejność łączenia się jest następująca: gen D z genem J, następnie z genem V; powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. 10-2). Rekombinacyjne łączenie się genów, zachodzące dzięki aktywności enzymu — rekombinazy, jest głównym źródłem różnorodności przeciwciał. 229

Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J, V-D i D-J) mogą być wstawiane nukleotydy (od l do 15), bądź też usuwane (do około 20 nukleotydów). Ponieważ są to nowo powstałe odcinki DNA, prowadzi to do zmienności na złączach i utworzenia nowego genu, tym samym liczba wariantów genu D] może być zwiększona około 10 razy, natomiast genu VDJ następne 10 razy. Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego, które razem stanowią przeciwciało, będące specyficznym receptorem tego limfocytu. Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu). Najczęściej są to mutacje punktowe, powodujące zmianę pojedynczego aminokwasu, rzadziej natomiast delecje, insercje lub konwersje. Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu.

10.2. Genetyczne podłoże różnorodności receptorów limfocytów J
W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B, przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego, atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T), oraz odpowiedzi typu humoralnego
230

(Th — pomocnicze limfocyty T), podobnie jak limfocyty B, które odpowiadają za syntezę przeciwciał. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi. Limfocyty pomocnicze mają receptory CD4, cytotoksyczne CD8. Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I. Proces rearanżacji elementów genów receptorowych, który następuje podczas dojrzewania komórek T w grasicy, zachodzi podobnie jak rekombinacja genów przeciwciał. Poprzez proces rearanżacji genów, jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ). Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V, D i J (łańcuchy p i §). Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. Podobnie, około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V, 2 regionów D i 12 genów dla łańcucha β-J. Oczywiście jest mało prawdopodobne, że wszystkie elementy genów są włączone w rearanżacje, ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2,5 x 106 α-β heterodimerów. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T, liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie.

10.3. Główny układ zgodności tkankowej — MHC
Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. Prowadzone w latach 30. przez Petera Gorera poszukiwania innych antygenów grupowych krwi, odpowiedzialnych za przyjęcie przeszczepu, doprowadziły do wykrycia grup (klas) antygenów oznaczonych I, II i III. Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej, który kontroluje ich syntezę. Badania polegające na przeszczepach skórnych 231

między tymi liniami, wykonywanych dla kilkunastu kolejnych pokoleń, wykazały, iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. major histocompatibility complex — MHC), a tylko w niewielkim stopniu od innych loci, nazwanych słabymi antygenami zgodności tkankowej (ang. minor histocompatibility loci). Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej, jak i ilościowej. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i, być może dlatego, często ich efekt jest niedoceniany. Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał, natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC, podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo, że większość z nich znajduje się w chromosomie 2. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców), H-l, H-3, H-5 i inne. Antygeny te są istotną barierą podczas transplantacji tkanek, zwłaszcza transplantacji szpiku kostnego. Nawet wówczas, gdy biorca i dawca są zgodni pod względem haplotypów MHC, słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska. Antygen H-Y występuje tylko u samców, gdyż gen kodujący go jest zlokalizowany w chromosomie Y. Zatem jest on przekazywany przez ojca męskim potomkom. Natomiast inny antygen, nazwany Mta (ang. maternally transmitted antigen), pochodzi tylko od matki, ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech).

Tabela 10-1

Lokalizacja MHC i nazwa u poszczególnych gatunków

232

Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. leukocyte antigens — LA), nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku, a drugim podstawową funkcję — LA (tab. 10-1). Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA, jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku.

10.3.1. Struktura i funkcje głównego układu zgodności tkankowej
U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I, II i III, będących glikoproteinami. U drobiu nie stwierdzono regionu klasy III. Wykryto natomiast specyficzny region klasy IV, kodujący białka zlokalizowane na krwinkach czerwonych. Z powodu powiązań tego układu z układem grupowym krwi B, MHC u drobiu nazwano kompleksem B. Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną, często są one nazywane antygenami MHC. Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka, jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych, a wraz z nim — haploidalny genotyp MHC (haplotyp). Ponieważ MHC zawiera wiele genów oraz, jak już wspomniano, układ ten cechuje ogromny polimorfizm, w populacji istnieje bardzo duża liczba różnych haplotypów. Zwłaszcza niektóre geny MHC, należące do klasy I i II (np. regionu K, D i L u myszy i B, C i A u ludzi), są wysoce polimorficzne. W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów, rzadziej mutacji punktowych, crossing over czy rekombinacji wewnątrzgenowych. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym, iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu, powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I); w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów
233

• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie, a więc w tych, które kodują miejsce wiązania peptydów; zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach, których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC, co zostało już udowodnione, wpływa na możliwość immunologicznego rozpoznania obcych białek. Mimo iż początkowo uważano, że MHC pełni funkcję tylko w odrzucaniu przeszczepu, obecnie wiadomo, że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego, w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T, biorąc tym samym udział w reakcji przeciwko infekcji wirusowej, a także w odrzucaniu przeszczepu. Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. 10-3). Łańcuch ciężki jest kodowany przez geny MHC, natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. Łańcuch ciężki składa się z trzech części: • Najdłuższy, N-końcowy fragment łańcucha ciężkiego, stanowi około 80% jego długości i znajduje się na zewnątrz komórki. Jest on kodowany przez geny MHC i ma trzy koliste domeny, oznaczone symbolami αl, α2 i α3, każda złożona z około 90 aminokwasów. Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny. Domeny αl i α2 odznaczają się polimorfizmem, który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. W domenach tych występują alloantygeniczne miejsca,
234

zawierające determinanty specyficzne dla osobników. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3, które są między nim a błoną komórkową. W rowku tym wiązane są antygeny, które następnie są prezentowane limfocytom T. • Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy, przechodzący przez błonę komórkową. • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy), który leży w cytoplazmie komórki. Cząsteczki MHC klasy II, stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi, komórki den-drytyczne i limfocyty B), regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie, oznaczonych symbolami α i β, kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. 10-4). Łańcuchy te, podobnie jak łańcuch ciężki cząsteczki klasy I, składają się z trzech części: zewnątrzkomórkowej N-końcowej, śródbłonowej i wewnątrzkomórkowej. Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I. Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β.

235

Zarówno białka MHC klasy I, jak i klasy II prezentują obcy peptyd (antygen) limfocytom T. Jednak cząsteczki klasy I mogą wiązać jedynie krótki, złożony z kilku aminokwasów peptyd, ponieważ mają zamknięte miejsce wiążące. Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości, od kilkunastu do ponad 20 aminokwasów, gdyż ich miejsce wiążące pozostaje otwarte z obu stron. Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu. W jego skład wchodzą białka surowicy i płynów tkankowych, których jest łącznie z czynnikami regulującymi około 30. Białka te są oznaczane literą C (ang. complement) i liczbą. Białka C2, C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III, u myszy natomiast przez loci regionu S w obrębie H-2.

10.3.1.1. Główny układ zgodności tkankowej myszy

Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy, a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka, a potem również zwierząt gospodarskich. Pierwotnie w MHC u myszy zidentyfikowano regiony K, I, S i D, które określono symbolem H-2 (ryć. 10-5). Późniejsze badania ujawniły, że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC. Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. klasyczne cząsteczki klasy I, oznaczane symbolem la). Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I, z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib), niektóre z nich też biorą udział w odpowiedzi immunologicznej. Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. Dotychczas wykryto co najmniej 15 genów klasy la, kontrolujących syntezę klasycznych białek MHC klasy I. Badania sekwencji genu Qa-2,3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. Natomiast produkty genów kompleksu Tlą i Qa wyka-

236

żują wiele różnic w porównaniu z antygenami transplantacyjnymi. W regionie Qa-2,3 i Tla zmapowano dotychczas 31 genów. Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I, bardzo istotny dla ekspresji produktów genów klasy I, znajduje się poza MHC, u myszy w 2, u człowieka w 15 chromosomie, w grupie sprzężeniowej z locus dehydrogenazy sorbitolu. Gen ten u ludzi składa się z ośmiu eksonów, natomiast u myszy z trzech eksonów. Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E, -P, -O/N oraz -M. Każda podklasa ma co najmniej jeden gen łańcucha α i β, z wyjątkiem H2-P, który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny. Białka klasy III są kontrolowane przez geny regionu S. Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S), w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom), oznaczone symbolem Ir (ang. immune response).

10.3.1.2. Główny układ zgodności tkankowej człowieka

U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6, zajmuje łącznie około 4 mpz DNA (4 miliony par zasad), czyli ponad 0,1% całego genomu. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%. Struktura HLA przedstawiona jest na liniowym diagramie (ryć. 10-6). Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A, -B i -C, natomiast cząsteczki kontrolowane przez loci HLA-E, -F i -G należą do nieklasycznych cząsteczek klasy I. Geny klasy II HLA znajdują się w pięciu podklasach: DQ, DR, DP, DOB/DNA i DM, przy czym trzy pierwsze

kodują klasyczne cząsteczki klasy II, podczas gdy czwarta podklasa, DOB/DNA, determinuje syntezę nieklasycznych cząsteczek klasy II. Odkryty niedawno locus DM jest nieco inny niż pozostałe, bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I, jak i do genów klasy II. Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów, co potwierdza fakt, iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. Podobnie jak u myszy, region klasy II HLA zawiera także geny, które strukturalnie nie należą do genów klasy II. Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych. Biorą one udział w proteolizie białek, m.in. białek transkrypcyjnych oraz białek nieprawidłowych. Są to geny TAP1 i TAP2 kodujące peptydowe transportery, przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC. Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". Dotychczas wykryto 267 allełi klasy I HLA, 314 alleli klasy II i 40 alłeli klasy III. Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC. Stwierdzono na przykład, że geny HLA-A, -B, -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. 10-11). Nieliczne z genów MHC, na przykład DRA, mają tylko 2 allele. Jest pewnym paradoksem, iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów, nie podlegających transkrypcji (np. HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka, m.in. geny dla 21-hydroksylazy (CYP21), białek szoku

238

cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB). Jak wspomniano na początku tego podrozdziału, główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt. Na przykład homologia genów klasy II u ludzi i myszy jest następująca:

myszy: ludzie:

Aa Aβ DQα DQβ

Eα Eβ DKα DRβ

P O/N DP DOB/DNA

M DM

10.3.1.3. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany. Wiadomo jednak, iż homologia między poszczególnymi gatunkami i człowiekiem jest duża. Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111.
Główny układ zgodności tkankowej bydła

Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie, w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych. Jest to najlepiej poznany chromosom bydła. Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa. Struktura BoLA przedstawiona jest na rycinie 10-7. Produkty genów klasy I są to klasyczne cząsteczki MHC. Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami. Geny klasy I należą do dwóch grup — A i B, różniących się delecją 6 par zasad w eksonie 5, który koduje krótki fragment transbłonowy łańcucha cząsteczki

239

MHC. W obrębie klasy II obserwowany jest duży polimorfizm genów. Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB, 26 DQB i 31 DQA. W locus DRB wykryto pseudogen (DRB1), różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC. Homologia między genami BoLA i HLA jest stosunkowo duża. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1, natomiast DQA bydła i człowieka — 75% homologii.
Główny układ zgodności tkankowej świni

Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. Regiony klasy I i II znajdują się blisko siebie, odległość między nimi wynosi 0,4 cM. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś. par zasad mniejsza niż w MHC u ludzi. Nie jest znana dokładna liczba genów klasy I SLA, szacuje się, że jest ich około 7-10. Tylko kilka genów regionu klasy I wykazuje ekspresję. Są to PD1, PD7 i PD14, których homologia wynosi około 80-85%, i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. Wydaje się, że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. Region klasy II zawiera wiele genów, spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. Niektóre geny, DQA, DQB, DRĄ i DRB, mają dużą homologię, w granicach 75-87%, z odpowiadającymi im genami HLA. Podobnie jak u innych gatunków, w SLA
240

Ryć. 10-8. Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont, 1996, zmodyfikowano)

znajdują się także pseudogeny. Jest nim na przykład gen DRB2, w którym stwierdzono delecję nukleotydu w kodonie 53. W regionie klasy III, w przeciwieństwie do innych gatunków, znajdują się po jednym genie CYP22, C2 i C4. W regionie tym są także inne geny typowe dla tego układu (ryć. 10-8).
Główny układ zgodności tkankowej owcy

Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA, ale można również spotkać określenie Ovar (ang. ovine aries). Dotąd nie sporządzono mapy fizycznej tego układu, ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. Mapa sprzężeniowa owczego chromosomu 20, w którym znajduje się główny układ zgodności tkankowej, ma długość 5,6 cM. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B, a częstość rekombinacji między nimi wynosi 0,6%. W regionie klasy II, podobnie jak u bydła, obok genów MHC znajdują się pseudogeny. Najlepiej poznany jest pseudogen DRB2. W wyniku mutacji, które wykryto w tym pseudogenie, w eksonach 3 i 4 znajdują się kodony „stop", powodujące, iż nie jest on funkcjonalny. Geny klasy II wykazują duży polimorfizm, przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ.
241

Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. Długość tego regionu u owiec wynosi około 150 tyś. par zasad. Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21).
Główny układ zgodności tkankowej kury

U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y, które są klasyfikowane niezależnie. Kompleks B znajduje się w 16 mikrochromosomie, natomiast w odniesieniu do Rfp-Y większość badaczy uważa, że jest on zlokalizowany również w tym chromosomie (ryć. 10-9). Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). Za typowy MHC uważany jest kompleks B, przypuszcza się natomiast, że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców. Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz, częstość rekombinacji między skrajnymi loci tego układu -- około 0,5%. Z kolei, częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. Badania MHC u drobiu koncentrują się na kompleksie B. Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. Region klasy I oznaczony jest symbolem B-F, klasy II — B-L, a klasy IV — B-G. O ile funkcje regionów B-F i B-L są znane, o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. U drobiu nie ma regionu klasy III, chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA. Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. Jak już wspomniano przy omawianiu budowy cząsteczki klasy I, gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem

242

zgodności tkankowej. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości).

10.3.2. Identyfikacja cząsteczek głównego układu zgodności tkankowej
Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych, pozwalających na identyfikację określonej cząsteczki (białka, antygenu) MHC, 2) poprzez analizę molekularną DNA, dzięki której możliwe jest wykrycie obecności danego allelu MHC. Do badań serologicznych wykorzystywane są surowice lub, od pewnego czasu, przeciwciała monoklonalne. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej, jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. allele specific oligonucleotides — ASO), poprzedzona amplifikacją danego frag mentu DNA (PCR), • metoda RFLP. Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC). Udoskonaleniem tej techniki jest test HTC, w którym używane są homozygotyczne komórki stymulujące. Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii.

10.3.3. Znaczenie głównego układu zgodności tkankowej
10.3.3.1. Związek MHC z odpornością na choroby

Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe. Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej. Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań. Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane, ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby. Na przykład, badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis, białaczkę, tuberkulozę, inwazję kleszczy i pasożytów oraz trypanosomatozę (tab. 10-IV).
243

U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany, ale stwierdzono już jego związek z odpornością na raka skóry. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka, kokcydiozę, mięsaka Rousa i cholerę ptasią. Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje. Na przykład, haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3.2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3.2*8 — podatność 10.3.3.2. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej, oprócz szczególnej roli w reakcji immunologicznej, oddziałuje także na inne cechy (produkcyjne i reprodukcyjne). U bydła mlecznego stwierdzono istotne oddziaływanie niektórych
244

cząsteczek MHC klasy I na cechy związane z użytkowością mleczną, natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń, przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. Dotyczyły one wpływu MHC na stopień owulacji, przeżywalność zarodków i płodów oraz liczebność miotu. Wykazano wyraźny wpływ haplotypu rodziców na te cechy. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków, obniżać stopień przeżywalności i masę ciała cieląt. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. U koni natomiast stwierdzono, iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością, reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech.

10.4. Zarys przebiegu reakcji odpornościowej
W odpowiedzi na wniknięcie patogenów (wirusy, bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób, zależnie od rodzaju patogenu i miejsca infekcji. Zasadniczą rolę w ich rozpoznaniu, bez względu na to, czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe, odgrywają cząsteczki głównego układu zgodności tkankowej. Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i, jak dotychczas, nie do końca został poznany. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji, zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu), czyli są degradowane do peptydów. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. Tutaj też następuje związanie cząsteczki MHC z peptydem, po czym powstały kompleks transportowany jest na powierzchnię komórki, gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne,
245

nazywane inaczej zabijającymi, mające na powierzchni cząsteczkę CD8. Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny, które zabijają zakażoną komórkę (ryć. 10-10a). Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej, prezentując przede wszystkim obce antygeny, które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne, makrofagi lub limfocyty B. Podczas infekcji bakteryjnej, jeśli bakterie zostaną pochłonięte przez makrofagi, są rozkładane na peptydy w wakuolach (endosomach). Peptydy te wiążą się z cząsteczkami MHC klasy II, przedostającymi się z siateczki śródplazmatycznej. Powstały

Ryc. 10-10. Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I; (b) prezentacja antygenu przez cząsteczki MHC klasy II

246

kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8), ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć. 10-10b). W określonych przypadkach, gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów, makrofagi mogą pełnić rolę pośrednią, prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. Makrofagi wchłaniają, degradują i prezentują wszystkie antygeny (ryć. 10-10b). Jeśli bakterie zostaną pochłonięte przez limfocyty B, w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze, określane jako Th2. Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD, które służą jako receptory antygenów. Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. Następnie peptydy te są wiązane przez cząsteczki klasy II, które dotarły tu z siateczki śródplazmatycznej. Utworzony kompleks, po przedostaniu się na powierzchnię komórki, jest rozpoznawany przez limfocyt pomocniczy T. Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG, IgE lub IgA), które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć. 10-10b). Zdolność cząsteczek MHC do wiązania peptydów, a raczej ich pojemność jest różna. Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów, natomiast cząsteczka klasy II może ich związać dwa razy więcej. Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek, które uległy apoptozie. Apoptoza (gr. apoptosis opadanie) jest to programowana śmierć komórki, czyli jej fizjologiczna śmierć. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek, chromatyna ulega kondensacji na obrzeżach jądra, wkrótce potem jądro, a następnie cała komórka pęka, a jej fragmenty są trawione przez sąsiadujące komórki.

10.5. Genetyczna oporność na choroby
Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność, nieśność itd.), ale także oporności/podatności na choroby zakaźne i inwazyjne. Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247

kowanej oporności na choroby. Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. Na ogół jest to cecha poligeniczna, chociaż w przypadku niektórych schorzeń stwierdzono, iż oporność na nie zależy od pojedynczego genu o dużym efekcie, np. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania, których celem jest znalezienie takich genów. Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć. 10-11). Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów. Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną; może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów. Gdy cecha — wskaźnik oporności jest już wybrana, należy oszacować jej zmienność genetyczną. Umożliwi to poznanie sposobu jej dziedziczenia. W przypadku gdy oporność na chorobę jest cechą poligeniczna, następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. Jeśli okaże się, iż cecha oporności jest warunkowana pojedynczym genem, celowe jest zmapowanie tego genu, czyli określenie jego położenia w chromosomie, następnie sklonowanie go i poznanie sekwencji nukleotydów.

248

Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością, warunkowaną wieloma lub jednym genem, a markerami genetycznymi, takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). Sprzężenia takie są szczególnie korzystne w selekcji, gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne, jak i techniki inżynierii genetycznej. Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech, jak: • cechy eksterierowe (widoczne gołym okiem), • cechy, które są określane za pomocą testów serologicznych lub elektroforezy, • cechy ustalane za pomocą badań molekularnych DNA. Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową), związana z opornością na raka oczu, i barwne upierzenie drobiu, wskazujące na większą niż u osobników białych oporność na choroby wirusowe. Znajomość cech określanych metodami serologicznymi, które mogą być wskaźnikami oporności na choroby, umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus. Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB. Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi. Na przykład, u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B, Y2/ D' i P'. Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów, jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka, co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu. Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze, jak i rasowe. Na przykład, rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei, która prowadzi do śpiączki afrykańskiej (trypanosomatoza). Choroba ta dziesiątkuje populacje bydła 249

afrykańskiego. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę. Zmienność podatności zwierząt na choroby najlepiej poznano u kur. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie, z zachowaniem ich wysokiej produkcyjności. Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków, nie zabezpieczając ich przed infekcją. Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. Kokcydioza powoduje obniżony stopień wzrostu, zmniejszone wykorzystanie paszy, a także, zwłaszcza u młodych kurcząt, śmiertelność. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. Kokcydioza jest równocześnie przykładem choroby, której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych, w tym przypadku jest to temperatura otoczenia. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. Wyniki badań wrażliwości kur na bakterie Salmonella (S. typhimurium, S. pullorum, S. gallinarum, S. enteritidis) sugerują, że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby. Ponadto świadczą one, iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. Należą do nich stany zapalne gruczołu mlecznego (mastitis), które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. Obserwowane są zarówno różnice rasowe, jak i indywidualne. Na przykład, krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej, simentalery czy szwyce. Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach). Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). W Norwegii od 1978 roku mastitis jest już włączone jako cecha
250

selekcyjna w programach hodowlanych. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. Ta metoda selekcji jest zalecana na przykład w Szwecji. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. Można zatem przypuszczać, iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. Wydaje się, iż byłoby celowe prowadzenie selekcji pośredniej, opartej na wskaźnikach fenotypowych oporności. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków, która w znacznym stopniu jest uwarunkowana genetycznie. Stwierdzono na przykład, że mastitis najczęściej występuje u krów, których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy, takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek, zbyt duża wielkość i niskie zawieszenie, za duże lub za małe strzyki. Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów, w celu ograniczania występowania mastitis poprzez selekcję. Podstawowymi kryteriami tej selekcji są, oprócz wydajności, kształt i wielkość wymienia oraz strzyków, ustawienie strzyków, wysokość zawieszenia wymienia i szybkość oddawania mleka. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia, charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. Innym schorzeniem u bydła, którego leczenie jest bezskuteczne, jest białaczka limfatyczna. Jej występowanie stwierdzono na wszystkich kontynentach, ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników, coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia, jak również niekorzystnym warunkom środowiska (np. niedobór niektórych pierwiastków, jak: magnez, wapń, kobalt i mangan). Na podstawie licznych badań można sądzić, że skłonność do białaczki jest przekazywana przez rodziców, a zwłaszcza przez chore matki. Wydaje się, że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby, ale także zakażenia przez łożysko, siarę i mleko oraz, co zostało udowodnione, przez uprzednio zarażoną wirusem białaczki komórkę jajową. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. Wiadomo, iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. Z drugiej 251

jednak strony wielu badaczy stwierdzało, że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę, co może być dowodem na dziedziczenie podatności na białaczkę. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt, ale także innych schorzeń, na przykład schorzeń kończyn. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. coli i F18 E. coli jest opisane w podrozdziale: Mutacje genowe. W tym miejscu należy podkreślić, że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie. Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta, przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. resistance), lub też jako zdolność do współżycia z pasożytem (ang. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem, w odróżnieniu od genetycznej zmienności oporności, cieszy się mniejszym zainteresowniem wśród badaczy, przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. Stwierdzono, iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np. Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna, której wartość waha się w granicach 0,5-0,6. Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem.

Rozdział

W klasycznym ujęciu marker genetyczny to cecha jakościowa, uwarunkowana w sposób prosty — tzn. przez jedną parę alleli, przydatna do celów analizy genetycznej. Przydatność markera zależy od tego, czy jest on polimorficzny, co zachodzi wówczas, gdy w populacji występują przynajmniej dwa allele w locus tego markera. Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych, wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. Metody serologiczne wymagają stosowania surowic testowych, zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka, a dokładniej — rozpoznające konkretną determinantę antygenową. W ten sposób badane są antygeny erytrocytarne (grupy krwi), antygenowe determinanty białek surowicy krwi (allotypy), antygeny głównego układu zgodności tkankowej, umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością, która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej, a z drugiej strony od parametrów fizycznych rozdziału (napięcie, temperatura, stężenie nośnika — żelu itp.). W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych, które nie kodują informacji genetycznej. Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA, uzyskanych metodą PCR, pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253

mentu DNA genu (metoda SSCP — ang. single stranded conformation polymorphism). Objęcie badaniami niekodujących sekwencji DNA spowodowało, że markery zostały podzielone na dwie klasy. Klasa I obejmuje klasyczne markery, czyli sekwencje kodujące -- geny. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP, SSCP). Klasa II markerów to sekwencje niekodujące; wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne, a w mniejszym stopniu sekwencje minisatelitarne. W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym, który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I, czyli Ag-NOR).

11.1. Antygeny erytrocytarne (grupy krwi)
Grupy krwi były najwcześniej wykorzystane w analizie genetycznej, np. dotyczącej kontroli pochodzenia. Do pionierów tych badań należy zaliczyć m.in. polskiego badacza Ludwika Hirszfelda. Przez grupę krwi należy rozumieć typ krwi, cechujący się obecnością charakterystycznych białek, o właściwościach antygenowych, na powierzchni erytrocytów. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych, które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50. i 60. Ich efektem było wykrycie wielu układów grupowych. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus), który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych). Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. Z badań prowadzonych u człowieka wynika, że mogą one być enzymami, receptorami, cząsteczkami adhezyjnymi czy białkami strukturalnymi. Wspólną ich właściwością jest to, że są związane z błoną plazmatyczną erytrocytów, a ich obecność można wykryć metodami serologicznymi. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. Jeśli białko ma tylko jedną determinantę antygenową, wówczas jest rozpoznawane
254

za pomocą jednej surowicy testowej. Jeśli białko ma kilka determinant antygenowych, to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. Wreszcie może być taka sytuacja, że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych. Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów, a to z kolei może wpłynąć na zmianę struktury białka, a w tym jego determinanty antygenowej. Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny. Jeśli takie geny mają wiele alleli, może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej, a przez to do utworzenia (lub zlikwidowania)

255

nowej determinanty w antygenie erytrocytarnym. Gdyby dla uproszczenia przyjąć, że białko ma tylko jedną determinantę antygenową, to wówczas każda mutacja genu, prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć. 11-1). Sytuacja staje się bardziej złożona, gdy białko ma więcej determinant antygenowych. Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. Mówi się wówczas o fenogrupach, czyli zespole antygenów, które dziedziczą się jak jednostka, a więc są uwarunkowane przez jeden allel. W takiej sytuacji mutacja genu zmienia jedną

Ryć. 11-2. Mechanizm powstawania zróżnicowania antygenów erytrocytarnych; przykład dla białka mającego kilka determinant antygenowych, które pojawiają się w trzech fenogrupach: abc, ab oraz a’bc). Schemat opiera się na założeniu, że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256

z determinant, ale nie narusza struktury pozostałych (ryć. 11-2). Badania prowadzone u zwierząt wykazały, że występują obie sytuacje. Należy jednak zaznaczyć, że istnieje także druga teoria tłumacząca fenomen fenogrup. Przyjmuje ona, że każdy antygen warunkowany jest przez jeden gen. Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów, a w konsekwencji do nietypowego dziedzi-

257

czenia antygenów krwinkowych. Przykłady takie opisano u bydła, głównie w odniesieniu do układu grupowego B. Należy pamiętać, że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. Zatem możliwe jest, że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A, C, D, K, P, Q, U) oraz owcy (układy: A, B, C, D, M, R, X), 11 w genomie bydła (układy: A, B, C, F, J, L, M, S, Z, T', R'), 13 w genomie kury (układy: A, B, C, D, E, F, G, H, J, K, M, O, P) oraz 15 w genomie świni (układy: A, B, C, D, E, F, G, H, I, J, K, L, M, N, O). Biologiczna funkcja powyższych białek nie została jeszcze poznana. Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. 11-1). W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. Wśród poznanych układów są takie, w których wykryto dotąd tylko dwa allele (np. układ L bydła czy układ C świni), przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową, a drugi allel (allel „ —") koduje białko, które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. Układ grupowy, w którym występuje allel „ — " określany jest jako otwarty. Na drugim biegunie są układy o olbrzymim polimorfizmie, jak np. układ grupowy B bydła, w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). Można przypuszczać, że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. Ponadto determinanty mogą

258

mieć wiele wariantów, a każdy z nich jest rozpoznawany przez odrębną surowicę testową. W efekcie wśród alleli będą takie, które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę), oraz takie, które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe, w których zidentyfikowano kilka czy kilkanaście alleli. W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. Na uwagę zasługuje układ grupowy A świni. Jego ekspresja zależna jest od dodatkowego locus S, który ma działanie epistatyczne w stosunku do locus układu A. Gen S ma dwa allele: S oraz s. W układzie grupowym A występują dwa antygeny A oraz O. Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S, przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss. Jak to już wcześniej wspomniano, badanie grup krwi wymaga stosowania surowic testowych, które powinny spełniać warunek swoistości. Surowice takie są produkowane przez laboratoria, które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt. Procedura produkcji oparta jest na immunizacji zwierząt, pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej, czyli zawierającej wiele różnych przeciwciał), a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej), to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. Niezmiernie istotne jest, aby surowice testowe, wyprodukowane w różnych laboratoriach, charakteryzowały się identyczną swoistością. Cel ten osiąga się poprzez cykliczne przeprowadzanie, pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang. International Society for Animal Genetics — ISAG), międzynarodowych testów porównawczych (ang. comparison test). Polegają one na tym, że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt. Za pomocą dostępnych surowic testowych należy ustalić, jakie antygeny występują na erytrocytach w poszczególnych próbkach. Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło, świnie, konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie).

11.2. Białka surowicy krwi, erytrocytów i leukocytów
Białka surowicy krwi, erytrocytów i leukocytów są drugą, po grupach krwi, pod względem liczebności grupą markerów genetycznych klasy I. Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np. elektroforeza w żelu poliakryloamidowym lub elektroforeza
259

dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. elektrofokusing). Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt). Na przykład u koni testy takie wykonywane są dla 16 systemów białek. Polimorfizm białek leukocytów, nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC), i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych, będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną. Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III. Spośród ponad 25 białek najbardziej polimorficzne

260

są albumina, inhibitor α-proteaz i transferyna. Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych. Najwięcej wariantów tego białka zidentyfikowano u bydła. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D, przy czym jeden z alleli (ALBS) występuje u większości ras. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków, jak świnia, koń i koza. U świń są one determinowane przez ściśle sprzężone loci (Pi1, PO1A, PO1B, PIZ, P/3, PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). Ze względu na to, że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz), są one cennymi markerami genetycznymi. Tak więc, w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. Z drugiej strony, niektóre allele są charakterystyczne dla danych ras, jak np. PO1AB i PO1BY dla wielkiej białej polskiej. U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli, z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci, charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). Transferyna jest β-globuliną, mającą dwa aktywne centra wiązania żelaza. Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. U koni jest ono determinowane przez 13 alleli, przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich, podczas gdy allel TfA występuje przede wszystkim u yorkshire, hampshire i duroc. Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). Locus transferyny u świń znajduje się w chromosomie 13 (13q31), u bydła w chromosomie l, u owiec także w chromosomie l (Iq42q45). Spośród białek i enzymów erytrocytarnych (tab. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej, owiec (chromosom 15), kur i bydła, przy czym u bydła jest to enzym leukocytarny. U świń w locus ADA znanych jest sześć alleli. Polimorficzne warianty są związane z różną aktywnością tego enzymu. U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach, natomiast jest ona aktywna w leukocytach i innych tkankach. Allel ten, określany jako zerowy, występuje szczególnie często u zwierząt podatnych na stres, które mają skłonność do wytwarzania mięsa typu DFD (ciemne, twarde i suche).
261

Hemoglobina wykazuje największy polimorfizm u owiec, bydła i kóz. Warianty tego białka różnią się tylko budową łańcucha β. Na przykład u bydła w trzech pozycjach tego łańcucha, kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27, są różne aminokwasy. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła, jak np. u rasy Jersey i niektórych ras mięsnych. Większość ras bydła, wśród nich bydło czarno-białe i czerwono-białe, jest monomorficzna. U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15
262

chromosom). Ciekawe jest, iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA, a wielkość tego wytwarzania zależy od nasilenia anemii. Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu.

11.3. Allotypy immunoglobulin i lipoprotein
Antygenowe właściwości surowicy krwi, określane terminem allotypy, są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku. U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-, β- i γ-globulinach. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku. U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin, 14 allotypów dla γ-globulin i 3 dla α-globulin. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin, 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. W przypadku antygenów immunoglobulin u bydła, dotychczas zidentyfikowano 3 allotypy, kontrolowane przez allele bval, bva2 oraz bvb. Również lipoproteiny, biorące udział w transporcie cholesterolu, wykazują właściwości antygenowe. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek, od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). Największe zróżnicowanie allotypów lipoprotein, oznaczonych symbolem Lp, stwierdzono dotychczas u świń, u których najbardziej polimorficzny, bo liczący ponad 21 allotypów, jest układ Lpb. Większość tych allotypów jest determinowana przez kodominujące allele. W następnych układach (Lpr, Lpt i Lpu) znane są po dwa allele, a w piątym układzie (Lps) tylko jeden allel. U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki. U bydła zidentyfikowano 3 allotypy, u owiec 1.

11.4. Białka mleka
Głównymi białkami mleka są kazeiny αs1, αs2, β i κ oraz białko serwatkowe — P-laktoglobulina. U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad). Ze względu na ścisłe sprzężenie loci kazein, układ sprzężonych alleli nazywany jest haplotypem. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy), jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). Określenie genotypu na podstawie
263

badania białka jest możliwe tylko u samic będących w okresie laktacji. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP, opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. U bydła w locus kazeiny αsl wykryto pięć alleli: A, B, C, D i E, przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B, a u bydła indyjskiego — alleł C. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny, składają się one bowiem odpowiednio z 207 i 199 aminokwasów. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A, B, C i D, z których jedynie A i D są obecne w genotypie bydła ras europejskich. β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2, albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. U bydła europejskiego najczęściej występuje wariant β-kazeiny A, bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB). Dotychczas u bydła wykryto 6 typów κ-kazeiny, determinowanych allelami: A, B, C, E, F i G. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu, będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną). Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA, które powodują zmianę aminokwasu. W pozycji 136 łańcucha polipeptydowego B jest treonina, a w wariancie A — izoleucyna, natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy, a wariant A — alaninę. Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). Allel F powstał w wyniku mutacji punktowej w allelu A, polegającej na tranzycji G→A, której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. Podobnie allel G powstał wskutek tranzycji C→T w allelu A, powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII, co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. Białko serwatkowe mleka bydła, β-laktoglobulina, występuje w dwóch wariantach A i B. β-Laktoglobulina odgrywa rolę w odporności organizmu, pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy, tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów. Podobnie jak w przypadku κkazeiny, znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny, wynikające z polimorfizmu genu kodującego to białko. Białko β-laktoglobuliny składa się z 162 aminokwasów. Różnica między
264

wariantem A i B polega na tym, że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT), natomiast wariant B — glicynę (GGT). Z kolei w pozycji 118 w wariancie A jest walina (GTC), zaś w B -- alanina (GCC). Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B. Zostało to wykorzystane w opracowanym teście PCR-RFLP, który także jest już rutynowo stosowany. W mleku kóz i owiec, podobnie jak bydła, są cztery frakcje białek. Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A, B, C, D, E, F, O). O ile allele A, B, C i E różnią się między sobą kilkoma podstawieniami aminokwasów, o tyle allele D i F wykazują znacznie większe różnice, polegające na delecji odpowiednio 11 i 37 aminokwasów. W pozostałych loci wykryto po 2 allele. Podobnie u owiec, z wyjątkiem locus P-laktoglobuliny (chromosom 3p28), w którym są 3 allele, w loci kontrolującym główne białka mleka występują po 2 allele.

11.5. Polimorfizm DNA
W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące, wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo. W połowie lat 80. opisano po raz pierwszy sekwencje minisatelitarne. Ich cechą charakterystyczną jest to, że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. Do najbardziej znanych sekwencji minisatelitarnych należą: 33.5 (motyw podstawowy: GGGAGGTGGGCAGGAGG), 33.6 (motyw podstawowy: AGGGCTGGAGG) i 33.15 (motyw podstawowy: AGAGGTGGGCAGGTGG). Sekwencje te występują w wielu miejscach (loci) genomu, a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną, to na błonie radiograficznej pojawia się układ prążków, który reprezentuje fragmenty DNA o różnej długości. Fragmenty te pochodzą z wielu loci, a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości, jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. Uzyskany układ prążków, nazywany niekiedy „odciskiem palca" DNA (ang. DNA fingerprint), przedstawia wysoce charakterystyczny obraz osobniczego DNA, który może być wykorzystany m.in. do kontroli pochodzenia i identyfikacji śladów biologicznych. Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus. Badanie takie wymaga zastosowania sond o dużej specyficzności, to znaczy zawierających nie tylko sekwencję minisatelitarną, ale także sekwencje ją otaczające, oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265

durą (ang. high stringency). Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika, że ich loci są położone głównie w częściach telomerowych chromosomów. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji, bo zawierających motyw podstawowy długości kilku nukleotydów, także powtarzających się tandemowo. Zostały one określone terminem sekwencji mikrosatelitarnych. Do tej pory najczęściej opisywano dwu- (np. CA) lub czteronukleotydowe (np. CATA) motywy podstawowe. Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony, polegający na tym, że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. (GT)nGAT(AG)m. Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych, tzn. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili, gdy za pomocą techniki PCR, po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną, możliwe stało się analizowanie pojedynczych loci. Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów, pochodzących z DNA wyizolowanego od danego osobnika, a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu, w przypadku homozygoty, lub dwóch fragmentów — u heterozygoty (ryć. 11-3 wkładka kolorowa). Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych, dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. Szacuje się, że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. Warto zaznaczyć, że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas, gdy nie są znane ani sondy molekularne, ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego, polimorficznego fragmentu DNA. Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. random amplified polymorphic DNA — RAPD). Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA, za pomocą sekwencji starterowej o losowej
266

kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów), w której dominują nukleotydy C i G. Zamplifikowane fragmenty, reprezentujące zazwyczaj różne loci w genomie, są poddawane elektroforezie, w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). Badając grupę osobników można stwierdzić różnice w układzie prążków, które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę, w tym sekwencjonowanie. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. W ten sposób identyfikuje się markery określane skrótem SCAR (ang. seauence characterized amplified region). Jeśli amplifikowany fragment jest wystarczająco duży, to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne). Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD, amplifikowanego przez starter 5'-AGAATAGGC-3', charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. progressive rod-cone degeneration). Polimorficzny fragment, wykryty za pomocą techniki RAPD, został następnie molekularnie opisany, co doprowadziło do identyfikacji markera specyficznego SCAR, który zlokalizowano w chromosomie 9 u psa. Należy zaznaczyć, że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna. Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP), a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu. Dynamiczny rozwój badań, których celem jest sekwencjonowanie genomów różnych gatunków, zaowocował identyfikacją nowej klasy markerów genetycznych, określanych symbolem SNP (ang. single nucleotide polymorphism). Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach, np. allel l - AATCGGC oraz allel 2 — AATGGGC. Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP, jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%. Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli. Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. Na przykład, prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1,4 mln miejsc SNP, spośród których większość występuje poza strukturą genów. Wynika z tego, że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw. cichego podstawienia, czyli nie wpływa na budowę polipetydu, ale może od267

działywać na ekspresję genu. Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP. Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik, w tym sekwencjonowania DNA. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np. następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT).

11.6. Wykorzystanie markerów genetycznych w hodowli zwierząt
Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia, ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej, tzw. MAS (ang. marker assisted selection), ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego. Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek, czyli markerów genetycznych klasy I. Podstawą tej kontroli jest to, że potomek dziedziczy jeden allel z każdego locus od ojca, drugi od matki. Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego, którego nie stwierdzono u jednego z rodziców. Do kontroli pochodzenia najlepsze są układy grupowe, w których występuje wiele antygenów, u bydła są to układy B (40 antygenów), C (12 antygenów) oraz S (8 antygenów), u świń układy M (12 antygenów), E (17 antygenów) i L (12 antygenów), natomiast u koni układy A (7 antygenów), D (17 antygenów), P (4 antygeny) i Q (3 antygeny). Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to, że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a, D-cgm, P-ad i Q-b oraz typy białek TF-O, ALB-A, ES-I, PHI-I. Warunków tych nie spełnia ogier l, można wykluczyć jego ojcostwo. Spełnia je ogier 2, on zatem może być ojcem źrebięcia. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej, 268

ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia; jedna jest oparta na polimorfizmie minisatelitarnym, druga na polimorfizmie mikrosatelitarnym. Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą, którą jest np. sekwencja minisatelitarna. Uzyskany obraz prążków jest charakterystyczny dla danego osobnika, ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć. 11-4). Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne. Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory. W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru:

Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka, prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269

Jak już wspomniano, analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia. W takim przypadku określa się tzw. łączne prawdopodobieństwo wykluczenia dla wszystkich
270

badanych loci. Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków, dostępności informacji zarówno o jednym, jak i obojgu rodzicach:

Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki, drugi od ojca, dokładnie tak, jak to jest przy cechach monogenowych — jakościowych. Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks, w której stosuje się kilka markerów równocześnie. Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów, której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora, przedstawiono na rycinie 11-5 (wkładka kolorowa). Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2). Ojciec jest homozygotą pod względem allelu długości 235 pz, matka natomiast heterozygotą (jeden allel - 243 pz, drugi — 263 pz). Wszystkie szczenięta są heterozygotami, przy czym allel długości 235 pz odziedziczyły po ojcu. Dwa z nich otrzymały od matki allel długości 243 pz, natomiast trzeci — allel 263 pz. Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA, dodawany do każdej próby DNA analizowanej za pomocą sekwenatora. W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów, określanego symbolem SNPs (ang. single nucleotide polymorphisms). Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje, których częstość szacuje się na 10-2-10-5 na pokolenie. Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. 1300 par zasad). Również to, że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych, sprawia, iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia, ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia, szacowaniu zmienności genetycznej i dystansu genetycznego. 271

Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego, brunatnego szwajcarskiego i simentali. Identyfikacji genotypu w loci tych markerów daje 99,99% prawdopodobieństwa wykluczenia. Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych. Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich, dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. Prowadzone są badania w celu znalezienia takich genów, które mają znaczący wpływ na kształtowanie się cech użytkowych. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych", czyli istotnych z hodowlanego punktu widzenia. Znając sprzężenie między określonym markerem genetycznym a np. wydajnością białka w mleku, można dla młodej jałówki określić, jaka będzie wartość tej cechy w przyszłości. Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach, warunkujących cechy użytkowości mlecznej (tab. 11-VI). U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. 11-VII). Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. marker assisted selection). W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. cechy użytkowości mlecznej). W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną, a postęp genetyczny jest uzyskiwany w krótszym czasie. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych, o istotnym wpływie na cechy użytkowe. Okazało się, że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. Geny takie nazwano głównymi lub genami o dużym efekcie. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec, zwiększoną plenność świń, zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech). W przypadku tych cech jest już możliwa selekcja bezpośrednia, której kryteriami są genotypy zwierząt w danych loci. Markery genetyczne, głównie klasy II, są również pomocne w doskonaleniu niektórych cech jakościowych. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła. Jest to cecha dziedzicząca
272

się z dominacją całkowitą, której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego. Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich, w których coraz więcej uwagi poświęca się dobrostanowi zwierząt. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała), jak również intensywnej hodowli (zasiniaczenia i ukryte
273

uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów, ponadto jest zabiegiem kłopotliwym. Aby tego uniknąć, coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. Dotychczas wiadomo jedynie, że locus polled, kontrolujący bezrożność/rogatość u bydła, występuje w l chromosomie. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. Znane są już dwie sekwencje mikrosatelitarne, sprzężone z locus polled, które mogą być wykorzystane do tego celu. Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne, dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani, zanim wystąpią objawy chorobowe. Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób, zwłaszcza infekcyjnych. Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I, jak i klasy II. Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to, że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources), w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych, przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii), w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi. Szacowanie dystansu genetycznego i wybór ras, które cechuje duża zmienność genetyczna, służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania, a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji, ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji, jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia.
274

Rozdział

12

Mapy genomowe

Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów, dlatego pojęcie genomu odnoszone jest do DNA jądrowego. Genom może być opisany za pomocą kilku parametrów. Po pierwsze, jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów. Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów. Przyjmuje się, że w genomie ssaków występuje około 35 tysięcy genów. Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM), która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów. Całkowita długość genomu u ssaków, wyrażona w cM, mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM. Rozmieszczenie loci genów w genomie jest nierównomierne. Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. Tam też znacznie częściej zachodzi crossing over. Miejsca te można wybarwić metodą barwienia prążkowego typu T.

12.1. Organizacja DNA jądrowego
W obrębie genomu występują zarówno sekwencje kodujące, czyli geny, jak i sekwencje niekodujące. Zdecydowanie przeważają sekwencje niekodujące, które stanowią około 97% całego DNA (ryć. 12-1). Sekwencje powtarzalne
275

dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to, że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu, ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim). Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów). W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej, którą uwidocznia się metodą barwienia prążkami C. Niezależnie od tego, sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych. Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. Szacuje się, że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad. Oznacza to, że genom jest bardzo silnie nimi nasycony. Szczególnie cenne, z punktu widzenia przydatności tych sekwencji do analizy genetycznej, jest to, że liczba powtórzeń danego układu podstawowego wykazuje w obrębie
276

populacji silne zróżnicowanie. Inaczej mówiąc, dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych, które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną, jest sekwencja telomerowa (TTAGGG/AATCCC), która stanowi zakończenia ramion chromosomowych. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. Skróceniu ulegają właśnie sekwencje telomerowe. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. w pobliżu końców ramion chromosomów. Elementy nukleotydowe to takie sekwencje, które również są rozproszone w wielu miejscach genomu, ale w danym miejscu występuje tylko jedna kopia sekwencji. Podobnie jak poprzednio, sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element), których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element), których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz. Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu, której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. Funkcja sekwencji powtarzalnych, z wyjątkiem sekwencji telomerowych, jest do tej pory słabo rozpoznana. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się, że sekwencje te, podobnie jak elementy nukleotydowe, leżą w pobliżu białkowych struktur kompleksów. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego. Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. Wiadomo, że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny, przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów, w których asocjuje heterochromatyna z kilku chromosomów.

12.2. Organizacja DNA mitochondrialnego
Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin).
277

Mitochondria należą do organelli komórkowych przekształcających energię. W nich odbywa się większość reakcji oddychania komórkowego. Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli, zatem muszą być syntetyzowane wewnątrz mitochondriów. Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. Wiadomo już, że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang. oxidative phosphorylation — OXPHOS), poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. Całkowita liczba genów w ludzkim mtDNA wynosi 37. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA. Białka będące podjednostkami enzymów łańcucha oddechowego (np. ubichinon/koenzym Q, cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V, przy czym kompleks V jest to syntaza ATP. Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy, a tylko część przez mtDNA. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie.

Struktura mtDNA jest inna niż DNA jądrowego, mtDNA jest bowiem kolisty. Jego długość wynosi około 16 tysięcy par zasad. Większość komórek zawiera od tysiąca do 10 tyś. kopii mtDNA. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka, w których być może replikacja mtDNA nie zachodzi.

278

DNA występujący w mitochondriach nie jest powiązany z białkami, w odróżnieniu od DNA jądrowego. Prawie cały mtDNA zawiera sekwencje kodujące, a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. Kolejną cechą charakterystyczną mtDNA jest to, że geny mitochondrialne nie zawierają intronów, co więcej, transkrypcji podlegają obie nici kolistego DNA, a niektóre geny nawet nakładają się na siebie. Łańcuchy komplementarne, wchodzące w skład cząsteczki mtDNA, różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H), który ma większy udział nukleotydów guanylowych — G i tymidylowych - T niż łańcuch lekki (L). Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA, a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D, w której obrębie występuje potrójna struktura DNA, uformowana przez krótki fragment nowego łańcucha H, pozostający w asocjacji z cząsteczką macierzystą. W mtDNA występuje jedno miejsce inicjujące transkrypcję, która przebiega równocześnie, ale w przeciwnych kierunkach, na obu łańcuchach. Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech.

12.3. Markerowa mapa genomu
Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego, który stanowi dominującą część genomu. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących, tzn. genów (markery klasy I), i niekodujących, czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach, b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli), c) odległościach genetycznych, wyrażonych w cM, pomiędzy sprzężo nymi loci oraz ich uszeregowaniu. Mapa, która wskazuje położenia loci w chromosomach, nazywa się cytogenetyczną lub fizyczną mapą genomu. Z kolei mapa opisująca sprzężenia, uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych, dlatego niejednokrotnie mówi się o markerowej mapie genomu.
279

12.3.1. Fizyczna mapa genomu
Podstawową, ale nie jedyną, metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa, reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję, na przykład mikrosatelitę — marker klasy II. Często sondę stanowi tzw. cDNA (komplementarny DNA) genu. Jest to taka sekwencja nukleotydowa, która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany. Różnica między DNA genu a jego cDNA polega na tym, że w cDNA nie występują introny, ponieważ w mRNA, na bazie którego syntetyzowano cDNA, sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang.

280

Ryć. 12-3. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. FISH) na chromosomie 3 psa; (a) chromosomy barwione metodą prążków Q; (b) ta sama metafaza po hybrydyzacji; jasne punkty wskazują miejsce, gdzie sonda hybrydyzowała z DNA chromosomu

splicing). Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. Trzeba podkreślić, że do identyfikacji chromosomu, zgodnie z przyjętym wzorcem kariotypu, wykorzystuje się techniki prążkowego barwienia (G, Q lub R), które stosuje się albo przed hybrydyzacją, albo po hybrydyzacji. Miejsce, w którym sonda połączy się z DNA chromosomu, jest rozpoznawane przez obserwację mikroskopową, dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów, związanego z barwnikiem fluorescencyjnym (ryć. 12-3). Hybrydyzacją in situ ma wiele odmian, które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt. Warto wspomnieć o dwóch: tzw. malowaniu chromosomów (ang. chromosome painting) i mapowaniu na chromatynie jąder interfazowych. Malowanie chromosomów polega na zastosowaniu sondy, która zawiera unikatowe sekwencje DNA wybranego chromosomu. Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu. W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu. Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. 12-4 wkładka kolorowa). Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych. Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. Ponadto, technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków. Analizę taką określa się terminem porównawczego malowania chromosomów (ang. comparative chromosome 281

painting) i polega ona na tym, że sondę chromosomowo specyficzną, utworzoną dla jednego gatunku (np. człowieka), stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. bydła). W ten sposób można wskazać, które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. Przeprowadzone eksperymenty ujawniły, że w genomach bydła, konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych, które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. 12-1). Dowodzi to, że zmiany na poziomie chromosomowym, jakie zaszły podczas ewolucji, są bardzo złożone. Należy jednak

282

zaznaczyć, że metoda malowania chromosomów ma ograniczoną dokładność, przyjmuje się bowiem, że sonda chromosomowo specyficzna da widoczny sygnał, jeżeli obejmuje segment długości co najmniej kilku milionów par zasad. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. Polega ona na tym, że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków, np. mysich komórek nowotworowych, utrzymywanych w hodowli, z fibroblastami pochodzącymi z mięśni czy skóry bydła. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków, czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów. Okazuje się jednak, że jeżeli takie komórki są hodowane w warunkach in vitro, to stopniowo „gubione" są chromosomy, które nie pochodzą z komórek nowotworowych. W tym przypadku są to chromosomy bydła. W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki), które będą się między sobą różniły liczbą zachowanych chromosomów bydła. Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku, ale czasami może się zdarzyć tak, że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. Tak wyprowadzone klony poddawane są analizie elektroforetycznej, której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku, którego genom jest badany — w tym przykładzie są to komórki bydlęce. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci, które zawsze pojawiają się razem. Sytuacja taka świadczy o tym, że grupa tych loci jest położona w tym samym chromosomie. Loci takie nazywa się syntenicznymi. 0 ich umiejscowieniu wiadomo jedynie tyle, że są położone w jednym chromosomie. Nie można natomiast wskazać, który jest to chromosom 1 w jakim regionie mieszczą się badane loci, nieznana pozostaje również wzajemna odległość między nimi. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych, których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym. Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. Polega ona na poddawaniu komórek gatunku mapowanego, przed hybrydyzowaniem z komórkami nośnikowymi (np. komórki nowotworowe myszy), naświetlaniu promieniami jonizującymi. Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA, a zatem fragmentacja chromosomów. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji, podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego. Na przykład, naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16,6 milionów par zasad, a w każdej
283

z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa. Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego. Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie, na tyle blisko, że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej, ze względu na zbyt małe prawdopodobieństwo zajścia crossing over. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu, w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. Dawki promieniowania jonizującego, wykorzystywane w mapowaniu radiacyjnym, wynoszą zazwyczaj 5 tyś., 7 tyś. lub 12 tyś. radów. Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka, tym mniejsze fragmenty. Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania, przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia.

12.3.2. Genetyczna mapa genomu
Analiza segregacji alleli w loci markerowych, u potomstwa osobników o znanych genotypach, służy tworzeniu genetycznej mapy genomu. Kolejność postępowania jest następująca. Najpierw poszukuje się sprzężeń pomiędzy loci. Dalej, na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci, które odzwierciedlają częstość, z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania, w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. krzyżówka trójpunktowa). Jednostką odległości genetycznej jest l cM. Odległość taka oznacza, że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang. loci).

L - - funkcja wiarogodności, obliczana jako prawdopodobieństwo wystąpienia określonych genotypów, przy założonym współczynniku rekombinacji (r), względem hipotezy alternatywnej, przyjmującej niezależne dziedziczenie (r = 0,5) r - - współczynnik rekombinacji, zawierający się w przedziale (0; 0,5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci. W tym celu korzysta się z wiedzy o genotypach osobników
284

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

situ, analizy hybrydowych komórek somatycznych, a w tym także mapowania radiacyjnego) i sprzężeniowego. Tak opracowane mapy określane są terminem map zintegrowanych (ang. comprehensive map). Szczegółowe dane dotyczące map poszczególnych genomów, a w tym i konkretnych chromosomów, są zamieszczone w internetowych bazach danych (tab. 12-111). Warto zwrócić uwagę, że również mapy genomów innych gatunków zwierząt gospodarskich, obok wymienionych w tabeli 12-11, są coraz lepiej poznane. Coraz więcej informacji pojawia się o mapach: kota, królika, bawoła, a także łososia i pstrąga tęczowego. Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe, takie jak: lis pospolity, lis polarny oraz jenot. W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r.) i domowych. Wśród tych ostatnich pierwszym genomem, dla którego ustalono sekwencję nukleotydów, jest genom psa. Opublikowano ją we wrześniu 2003 r. Przewiduje się, że do 2005 r. zostanie ustalona sekwencja genomu bydła, świni i kury. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt.
291

12.3.5. Wykorzystanie markerowych map genomowych w hodowli
Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów, które z hodowlanego punktu widzenia mają istotne znaczenie. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. Hodowca wskazuje cechę, która ma istotne znaczenie gospodarcze, np. wydajność białka w mleku, wydajność rzeźna, marmurkowatość mięsa, odporność na infekcje specyficznymi patogenami, bezrożność, choroby genetyczne itp. Mogą to być zatem zarówno cechy ilościowe, jak i jakościowe. Punktem wyjścia jest precyzyjne opisanie zmienności cechy, tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali. Następnie podejmowana jest żmudna analiza, polegająca na klasyfikacji fenotypów dla interesującej cechy, jak i genotypów w jak największej liczbie loci markerowych, zlokalizowanych w różnych miejscach genomu. Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych), dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. Stwierdzenie, że allele któregoś z markerów kosegregują z określonymi fenotypami cechy, wskazuje, że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. gen główny w przypadku cech ilościowych). Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu, które polega na opisie struktury genu, a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych, odpowiedzialnych za występowanie różnych alleli. Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP), który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA. Ogólny schemat postępowania, którego celem jest identyfikacja nieznanego genu, jest pokazany na rycinie 12-6. Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw. mięso blade, miękkie i wodniste, ang. pale, soft, exudative — PSE). Najpierw ustalono, że cecha ta warunkowana jest monogenowo, a konkretnie przez allel recesywny. Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres, tzn. homozygot recesywnych
292

Ryć. 12-6. Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym, np. genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych

(nn). Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu. Kilka lat później zidentyfikowano pierwsze markery genetyczne (m.in. locus układu grupowego krwi H oraz loci polimorficznych białek krwi - GP7, PGD i A1BG), które okazały się ściśle sprzężone z locus HAL. Loci tych markerów umiejscowiono, za pomocą hybrydyzacji in situ, w chromosomie 6 świni (ryć. 12-7a). Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang. candidate gene). Był nim gen receptora rianodyny (RYR1), którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. Badania molekularne tego genu u osobników wrażliwych na stres wykazały, że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym, która polega na zamianie argininy na cysteinę w pozycji 615. Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI, który nie rozpoznaje 293

Ryć. 12-7. Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1, (b) MSTN, (c) BMPR-IB, (d) PRKAG3 oraz regionów chromosomowych, w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy

sekwencji zawierającej mutację. W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech), który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot. Od połowy lat 80. wiadomo było, że hipertrofia mięśniowa (tzw. podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. muscular hyperthrophy). Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić, że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła. Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN), jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. 12-7b). Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową, wywodzących się z rasy belgijskiej
294

błękitnej i asturiana, wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). Okazało się, że mutacja polegała na braku (delecji) 11 nukleotydów. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop"), który jest biologicznie nieaktywny, co fenotypowo objawia się hipertrofią mięśniową. Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech, różnych mutacji uszkadzających funkcję białka miostatyny. Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi, które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. Co więcej, nie udało się jeszcze wskazać genów kandydujących. Przykładem może być gen FecB, wpływający na plenność owiec rasy merynos booroola, a konkretnie kontrolujący liczbę owulujących oocytów podczas rui. Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101, które umiejscowione są w chromosomie 6 (ryć. 12-7c). W 2001 r. ustalono, że gen FecB to zmutowana postać genu BMPR-IB. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. Innym przykładem jest gen RN, który odpowiada za zawartość glikogenu w mięśniach. Dominujący gen RN~ powoduje większą, a allel recesywny rn+ mniejszą zawartość glikogenu. Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. kwaśnego mięsa, które ma mniejszą wartość technologiczną. Locus genu RN umiejscowiono w chromosomie 15, dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. 12-7d). W 2000 r. zakończyły się wieloletnie poszukiwania genu RN. Okazało się, że jest nim zmutowany allel genu PRKAG3, który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. Badania zmierzające do identyfikacji genów głównych, które w znaczący sposób wpływają na cechy użytkowe, są prowadzone w licznych ośrodkach naukowych. W początkowym stadium badań zakłada się, że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania, czyli genu głównego. Analiza segregacji licznych markerów genetycznych, pokrywających w miarę równomiernie większość genomu, oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego, w którym prawdopodobnie występuje locus genu głównego. W 1994 roku ukazała się praca dowodząca, że w chromosomie 4 świni, 295

między markerami S0001 i S0067, występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. 12-7e). Sugestia ta została potwierdzona także w innych badaniach. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego, który odpowiadałby za kształtowanie tych cech ilościowych. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują, że w chromosomie 12, między markerami mikrosatelitarnymi S0083 i S0090, występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. 12-7f). Z kolei w październiku 2003 r. doniesiono, że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym, czego efektem jest 3-krotny wzrost ekspresji genu IGF2. Trzeba zaznaczyć, że gen ten podlega piętnowaniu gametycznemu. W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca, czyli duży efekt fenotypowy pojawia się tylko wtedy, gdy zmutowany allel jest odziedziczony od ojca. Odnotowano też znaczące osiągnięcie dotyczące bydła. Z badań prowadzonych w rodzinach referencyjnych wynikało, że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka. W 2001 r. wykazano, że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę, a to upośledza funkcję kodowanego enzymu. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku. Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. Jednym z przykładów może być letalna wada rozwojowa — achondroplazja, określana symbolem bd (ang. bulldog disease), ze względu na wywoływane zmiany m.in. w budowie czaszki. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja, charakteryzującego się wybitną wartością hodowlaną. W początkowym okresie jego użytkowania stwierdzono, że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. Oznaczało to, że również wiele krów było nosicielkami zmutowanego genu bd. Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel, krowa nosicielka, chore cielę — homozygota recesywna), w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela, którzy również byli nosicielami tego niepożądanego genu. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu, w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. Można się spodziewać, że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej.
296

W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową, polegającą na zniekształceniu kręgów (ang. CVM — central vertebral malformation). Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne, a ostatnio scharakteryzowano gen oraz mutację w nim występującą. Niestety badań tych nie opublikowano, a opracowany test molekularny skomercjalizowano. Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów. U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów. Wiele z tych mutacji występuje w ściśle określonych rasach. Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej. Wśród nich są geny wywołujące takie schorzenia, jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów), narkolepsja u dobermanów i labradorów, ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli. W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. dziedziczny zanik siatkówki u owczarków francuskich). Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują, że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt.

Literatura uzupełniająca

Podręczniki Biochemia (1997), L. Stryer (tłum. z j. ang. pod red. J. Augustyniaka i J. Michejdy), Wydawnictwo Naukowe PWN. Biologia molekularna w medycynie. Elementy genetyki klinicznej (2001), pod red. J. Bala, Wydawnictwo Naukowe PWN. Biotechnologia zwierząt (1997), pod red. L. Zwierzchowskiego, K. Jaszczaka i J. Modlińskiego, Wydawnictwo Naukowe PWN. Cytobiochemia (1995), L. Kłyszejko-Stefanowicz, Wydawnictwo Naukowe PWN. Genetyka człowieka. Rozwiązywanie problemów medycznych (2003), B.R. Korf (przekład pod red. A. Pawlaka), Wydawnictwo Naukowe PWN. Genetyka molekularna (1995), pod red. P. Węgleńskiego, Wydawnictwo Naukowe PWN. Genom człowieka. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997), pod red. W. Krzyżosiaka, Wydawnictwo Naukowe PWN. Genomy (2001), T.A. Brown (przekład pod red. P. Węgleńskiego), Wydawnictwo Naukowe PWN. Immunologia (1996), I. Roitt, J. Brostoff, D. Małe (tłum. z j. ang. pod red. J. Żeromskiego), Wydawnictwo Medyczne Słotwiński Yerlag, Brema. Jeżyk genów. Poznawanie zasad dziedziczenia (1997), P. Berg i M. Singer (tłum. z j. ang. M. Waśniewska-Brzeska i J. Brzeski), Prószyński i S-ka, Warszawa. Karty z Dziejów Zootechniki Polskiej. Cz. II— lata 1972^-1997 (1997), pod red. A. Filistowicza, J. Juszczaka i S. Wężyka, Wydawnictwo Polskiego Towarzystwa Zootechnicznego, Warszawa. Leksykon biologiczny (1992), pod red. Cz. Jury i H. Krzanowskiej, Wiedza Powszechna. Leksykon rozrodu zwierząt (1996), pod red. K. Rosłanowskiego, Wydawnictwo Akademii Rolniczej w Poznaniu. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994), B. Nowicki i wsp., Wydawnictwo Polskiego Towarzystwa Zootechnicznego, Warszawa. Słownik terminów genetycznych (2002), R.C. King, W.D. Stansfield (przekład zbiorowy pod red. W. Prus-Głowackiego), Ośrodek Wydawnictw Naukowych PAN, Poznań. The Major Histocompatibility Complex Region of Domestic Animal Species (1996), pod red. L.B. Schook i S.J. Lamont, CRC Press Inc., USA.

298

Artykuły przeglądowe
Barsh G. (1996). The genetics of pigmentation: from fancy genes to complex traits. Trends in Genetics 12 (8): 299-305. Bartnik E. (1997). Ludzki genom mitochondrialny — mutacje, polimorfizmy i choroby. Postępy Biologii Komórki 24 (8): 69-75. Charon K.M. (1998). Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej. Postępy Nauk Rolniczych 7 (nr 5): 87-97. Charon K.M. (1998). Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt. Medycyna Weterynaryjna 54 (2): 92-96. Cotinot C. i wsp. (2002). Molecular genetics of sex determination. Seminars in Reproductwe Medicine 20: 157-167. De Gortari M.J., Freking B.A., Cuthbertson R.P., Kappes S.M., Keele J.W., Stone R.T., Leymaster K.A., Dodds K.G., Crawford A.M., Beattie C.W. (1998). A second-generation linkage map of the sheep genome. Mammalian Genome 9: 204-209. Ellis S.A. (1994). Minireview — MHC studies in domestic animals. European Journal of Immunogenetics 21: 209-215. Friend S.H., Stoughton R.B. (2002). Magiczne mikromacierze. Świat Nauki 4 (128): 36-43. Grzybowski G. (1997). Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich. Prace i Materiały Zootechniczne 50: 69-78. Grzybowski G., Dymnicki E. (1997). Metody oraz znaczenie sterowania proporcją płci u bydła. Biotechnologia 3 (38): 38-50. International Human Genome Seąuencing Consortium (2001). Initial seąuencing and analysis of the human genome. Naturę 409: 860-921. Kamiński S. (1996). Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding. Journal of Applied Genetics 37: 179-196. Kamiński S. (2002). DNA microarrays — a methodological breakthrough in genetics. Journal of Applied Genetics 43: 123-130. Kappes S.M., Keele J.W., Stone R.T., McGraw R.A., Sonstegard T.S., Smith T.P.L., Lopez-Corrales N.L., Beattie C.W. (1997). A second-generation linkage map of bovine genome. Genome Research 7: 235-249. Kirkness E.F. i wsp. (2003). The dog genome: survey seąuencing and comparative analysis. Science 301: 1898-1903. Krzanowska H. (1999). Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Postępy Biologii Komórki 26 (supl. 12): 53-58. Kurył J. (1998). Geny oddziałujące na jakość tuszy i mięsa świń. Prace i Materialy Zootechniczne. Zeszyt specjalny 8: 9-18. Lechniak D. (1996). Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych. Medycyna Weterynaryjna 52 (2): 89-93. Long S.E. (1997). Chromosome abnormalities in domestic sheep (Ovis aries). Journal of Applied Genetics 38: 65-76. Pareek Ch.S., Kamiński S. (1996). Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence. Journal of Applied Genetics 37 (3): 299-312. Parham P., Ohta T. (1996). Population biology of antigen presentation by MHC class I molecules. Science 272: 67-74. Pierzchała M. (1996). Mapa genomu świni (Sus scrofa domestica). Prace i Materialy Zootechniczne 49: 7-28. Ramikssoon Y., Goodfellow P. (1996). Early steps in mammalian sex determination. Current Opinion in Genetics & Development 6: 316-321.

299

Rejduch B., Świtoński M., Słota E., Danielak B., Kozubska-Sobocińska A. (1994). Aberracje chromosomowe u bydła o użytkowości mięsnej. Medycyna Weterynaryjna 50 (8): 379-382. Rohrer G.A., Alexander L.J., Hu Z., Smith T.P.L., Keele J.W., Beattie C.W. (1996). A comprehensive map of the porcine genome. Genome Research 6: 371-391. Ruvinsky A. (1999). Basics of gametic imprinting. Journal of Dairy Science 82 (suppl. 2):288-237. Słomski R., Napierała D., Kwiatkowska J. (1998). Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej. Postępy Biologii Komórki 25 (supl. 10): 195-217. Stachurska A. (1997). Inheritance of colours in horses. Journal of Applied Genetics 38:195-204. Sysa P.S. (1997). Krajowy system kontroli cytogenetycznej buhajów. Medycyna Weterynaryjna 53 (10): 581-584. Szatkowska L, Zych S., Kulig H. (2003). Determinacja płci u ssaków. Medycyna Weterynaryjna 59: 847-852. Szwaczkowski T. (1993). Identyfication of animal major genes in field collected data by use of statystical methods. Journal of Animal and Feed Sciences 2/3: 91-103. Szydłowski M. (1994). Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt. Prace i Materiały Zootechniczne 46: 29-40. Szymański M., Barciszewska M.Z., Żywiecki M., Barciszewski J. (2003). Noncoding RNA transcripts. Journal of Applied Genetics 44: 1-20. Świtoński M. (1998). Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt. Postępy Biologii Komórki 25 (supl. 10): 113-122. Świtoński M., Kurył J. (1998). Poszukiwanie genów kontrolujących cechy tuczne, opasowe i rzeźne — najnowsze osiągnięcia. Prace i Materiały Zootechniczne 52: 37-42. Świtoński M., Stranzinger G. (1998). Synaptonemal complexes in domestic mammals — a review. Journal of Heredity 89 (6): 473-480. Walawski K. (1999). Genetic aspects of mastitis resistance in cattle. Journal of Applied Genetics 40 (2): 117-128. Waterston R.H. i wsp. (2002). Initial seąuencing and comparative analysis of the mouse genome. Naturę 420: 520-562. Węgrzyn J., Skiba E. (1997). Antigenic markers of protein genes and their nomenclature in cattle. Journal of Applied Genetics 38 (3): 319-328. Wierzbicki H. (1998). Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus). Prace i Materiały Zootechniczne 53: 35-48. Yenter C. i wsp. — Celera Genomics (2001). The seąuence of the human genome. Science 291: 1304-1351. Zwierzchowski L., Rosochacki S.J. (1998). Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej. Prace i Materiały Zootechniczne 50: 11-39. Zwierzchowski L. (1998). Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka. Biotechnologia 2 (41): 33-56.

Skorowidz
Opracowali: Krystyna M. Charon, Marek Świtoński

Numery stron, na których znajduje się główny opis, są pogrubione. Gwiazdką oznaczono numery stron, na których hasła znajdują się na rysunku lub w jego podpisie.

Sign up to vote on this title
UsefulNot useful