Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

........................... Budowa kwasów nukleinowych ............................................... DNA .................7......................................... Kariotyp ...........................................................................1...... 3............................... Transkrypcja ...........6............ Metylacja DNA .2......................................................... 3......................................... 4............. Translacja ........................... 4......................... 2..................7.............. Replikacja DNA ....... Wektory............. .......................................... ...3.....Spis treści 1 2 Wstęp — zarys historii genetyki ...................................................7............................................................................ 3.7. 3....... 3.................................................... Budowa genu .................................................................... RNA .........................4......... Czynniki transkrypcyjne .................................................... 2............1............1............. 3.........................................2.............................. 69 69 72 ................ 3........ 3. 2........................................................ 3................4.............................. Endonukleazy restrykcyjne .......1.............. Chromosomy i podziały jądra komórkowego ..........1..............................................2................. Mejoza .................................................................5..............3... 2...... 2............................ 3................ Inaktywacja chromosomu X w zarodkach żeńskich ............................ 3.......... 48 48 49 50 52 53 54 56 57 60 61 62 63 64 66 4 Metody analizy i modyfikacji genomu ..6...2..5................................... Barwienie prążkowe chromosomów ..... 3.................................................1........ 2..........2.................................... Gametogeneza .............7..........7............... 3....................... Geny homeotyczne ............4...........................................3............. 3................. Kod genetyczny ................................................. Budowa chromosomu .................... Piętno gametyczne .............1....... n 1 5 16 23 31 33 37 43 3 Gen i jego ekspresja ..........................................5...................... Mitoza................................................ Regulacja ekspresji genu ..............................

.4......4................................................................. 146 147 147 150 152 157 160 160 161 162 163 164 164 175 176 7 Zmienność cech....... . Miary skupienia ........... 6......3...............2. Mutacje genowe wywołujące choroby genetyczne ..................... Penetracja i stopień ekspresji (ekspresywność) genów ....................2..............1.......2........ .................. 5.................... 6....4.......................... Biblioteki genomowe i genowe ..2...................2.............. 6............ Dziedziczenie cech sprzężonych .........................5.................. Komplementarność .........4........................... 6.............. 5.....................................3........1...4...... Mutacje genomowe .....4..............................................................2. semiletalne i subwitalne ................................1............... Rekombinacja molekularna i klonowanie ............. Mutacje w mitochondrialnym DNA ............................... .... Współdziałanie alleli .................................. 7........................4....................... Mutacje chromosomowe ...4...........2....................... 179 179 182 182 8 ...................1....................................... Miary zmienności .................... 5..1.................2....................... Mutacje genowe .... 4........4......................7....................... Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce ...... Niezależne dziedziczenie cech (II prawo Mendla) .... 5........ Techniki hybrydyzacji i sondy molekularne ...... 76 78 82 86 87 88 91 91 5 Mutacje ....1.........10................................................................ 5............................... 6..... Choroby monogenowe wywołujące wrodzone wady rozwojowe 5.....4......... 5.......................................2.................................. Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) ....... 5........... Transgeneza ................ Skutki mutacji genowych .............. Sekwencjonowanie DNA ........ Polimorfizm fragmentów restrykcyjnych DNA (RFLP) ............. Epistaza ...... 4....................... 4....... 6...... Mutacje genowe wpływające na cechy produkcyjne zwierząt .2.............................. ......................9........................ 4........2..............4................. 5.......... 95 96 100 111 112 112 118 123 124 124 127 132 135 143 144 6 Podstawowe mechanizmy dziedziczenia cech ............................ 6...4................................ Współdziałanie genów z różnych lód w kształtowaniu fenotypu ......5..8........1...... Cechy sprzężone z płcią .........4........... 4.......4...5.................. 6...................................... 5....1..........................................................3....... 5.... 7....4.............. Ograniczanie występowania chorób genetycznych............................. Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych ...6........... Geny modyfikujące .............4.... 7...............3................. Geny letalne..................................... 6........................ Dziedziczenie umaszczenia......................1............... 5. 5.......................... 5..3..............5.......................4............3........... .................................................... Badanie ekspresji genów ......................................2..................4.................. Dziedziczenie cech warunkowanych jedną parą alleli ....... 6.4.................4.............. 4.............1............ 6....... Plejotropia .1.................. 6.........1....................................... Rodzaje zmienności i czynniki ją wywołujące ........1............. 6...5................................ 6........ 4.......... Przyczyny i rodzaje mutacji genowych ............................................ Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny ................................. Dziedziczenie pozajądrowe ..3.............. Sumujące działanie genów ...4.....

............. Antygeny erytrocytarne (grupy krwi) ................. 7...... Główny układ zgodności tkankowej człowieka ....................... 10...................3........... Główny układ zgodności tkankowej zwierząt gospodarskich 10............................3..........7............. Frekwencja genów i genotypów w przypadku dominowania ...... 10..... .......... 7....................... 10....1. 8............ Identyfikacja cząsteczek głównego układu zgodności tkankowej 10............. .... ...............................1........2......... Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych ...... Główny układ zgodności tkankowej — MHC ...........1.................. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami ..3..........................................3... 11. 7..... 227 227 230 231 233 236 237 239 243 243 243 244 245 247 11 Markery genetyczne ....................3................ Allotypy immunoglobulin i lipoprotein ................................................. Genetyczne podłoże różnorodności receptorów limfocytów T ................... 9...........3...... 8.................3............... 10.................6. 11............................. 10...................1.... Geny o dużym efekcie .. 11.2................. Struktura i funkcje głównego układu zgodności tkankowej ....................................................... 253 254 259 263 263 265 268 9 ............6....3................................ Główny układ zgodności tkankowej myszy ................3........................... Prawo równowagi genetycznej . 11..... 10...5............................... 210 216 221 10 Genetyczne podstawy odporności i oporności ........... ... Genetyczna oporność na choroby ..........2......4....... Zarys przebiegu reakcji odpornościowej .............2............ 185 187 187 189 190 8 Podstawy genetyki populacji ......3...................3........................2............................1.............. Wykorzystanie markerów genetycznych w hodowli zwierząt.................................4....3. 8..................... 10.................. ................... .... Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8............. Polimorfizm DNA .................... 9.1...... 7............. 10... 11....................... Związek MHC z odpornością na choroby ....2..........3.......4... Miary rozproszenia ...........................1... Genetyczne podłoże różnorodności przeciwciał .. Czynniki naruszające równowagę genetyczną ..... Białka mleka ....2..........1.. 8..........................3............ erytrocytów i leukocytów ..... Dziedziczenie cech ilościowych ...3...........................5....................2......... Znaczenie głównego układu zgodności tkankowej ... Białka surowicy krwi....1..... 10....3. 198 198 201 201 204 205 210 9 Determinacja i różnicowanie płci oraz interseksualizm ....... 10.................... Interseksualizm ............1.....2.. 11..5............1....2...... 8..3..........................3..........3........... Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10................... Zmienność cech ilościowych .. Zmienność transgresywna ........................3......... Determinacja płci ssaków ........

..... Organizacja DNA jądrowego .1 2 Mapy genomowe ....... .............................. 12.. 12.......................................................... Organizacja DNA mitochondrialnego .. 12...3...........3...................... Artykuły przeglądowe .......................... ..........1.... 12.................................... ....................... Markerowa mapa genomu ......4.............................. Strategia mapowania genomu.................................... Wykorzystanie markerowych map genomowych w hodowli ..................................... Podręczniki ..... 293 298 298 Skorowidz ................ 12.............................................3...... Genetyczna mapa genomu ....5..............3................................. 301 ............3..............................................2...........3..........1.......................................... Fizyczna mapa genomu ...... 12.....................3.... 275 275 277 279 280 284 287 289 292 Literatura uzupełniająca ... ...................................... 12.......................... .................. Aktualny stan map genomowych zwierząt gospodarskich ........2.. 12...

Zgodnie z teorią Darwina. W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. a z drugiej formułowaniem przełomowych hipotez i teorii. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. byli Schwann i Schleiden. podstawą ewolucji organizmów żywych jest dobór naturalny. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty 11 . chemików. Główną tezą tej teorii było twierdzenie. konstruktorów. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum). Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów.Rozdział 1 Wstęp . Okazało się to niezwykle stymulujące dla rozwoju cytologii. ale także przekazanie tych korzystnych właściwości potomstwu. stanowiącą zaczątek genetyki. O powstawaniu gatunków drogą doboru naturalnego. rośliny samopylnej. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków. Autorami pierwszej z nich — teorii komórkowej budowy organizmów. a ostatnio również informatyków. czyli nauki o budowie i funkcji komórek. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych. korę mogą powstawać jedynie przez podział innych komórek. że wszystkie rośliny i zwierzęta są zbudowane z komórek. umożliwiając im nie tylko przeżycie. ogłoszonej w 1838 roku. tkanek. której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. które stało się początkiem nauki o ewolucji.zarys historii genetyki Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych. Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX. który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania. komórek i ich organelli. Badania nad mieszańcami roślin.

Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. Wright i Haldane wprowadzili do genetyki metody statystyczne. MacLeod i McCarty wykazali. Przełom nastąpił w 1944 roku. którzy niezależnie od siebie doszli do wniosków. kiedy to trzej badacze: Avery. za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. Mendel uzyskał pierwsze pokolenie mieszańców (F1). Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. Stało się to za sprawą trzech badaczy: Corrensa. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi. że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet. de Yriesa i Tschermacka. które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2).czerwone lub białe. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. przy czym jedna gameta zawiera tylko jeden taki element. Fischer. których celem było poznanie praw rządzących dziedziczeniem cech. Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. zostały podane przez polskiego botanika Strasburgera w 1880 roku. Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. Niektórzy autorzy uważają. nasiona żółte lub zielone itd. Ten dział genetyki określa się często jako genetykę cech ilościowych. którą można uważać za początek cytogenetyki. nasiona gładkie lub pomarszczone. Pierwsze doniesienia o „pałeczkowatych" strukturach. Na początku XX wieku podjęto wiele badań. że 12 . Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne. że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie. które okazały się bardzo istotnymi narzędziami badawczymi. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. cech ilościowych. że nośnikiem informacji genetycznej są białka. nazwanych w 1888 roku przez Waldeyera chromosomami. W latach 20. że można je określać tylko jednym terminem — genetyka populacji. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. w tym struktur związanych z dziedziczeniem. a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. Przez wiele lat przypuszczano. do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. Dopiero wówczas zrozumiano genialność odkryć Mendla. Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków. które kilkadziesiąt lat wcześniej podał Mendel. Rok później Morgan ogłosił chromosomową teorię dziedziczenia. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki. o których różnorodności wiedziano już wówczas dość dużo. Opis mitozy przedstawił w 1882 roku Flemming.

Warto podkreślić. Warto zaznaczyć. Human Genome Organisation Project) 13 . przetwórstwem żywności. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. W doświadczeniu tym można upatrywać początku genetyki molekularnej. W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości. koń. roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych. a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań. Do wniosku tego doszli na podstawie wyników eksperymentu. opracowanie techniki rekombinacji i klonowania DNA (1972 r. która wyjaśniała mechanizm ekspresji genów u bakterii. tzn. bydło. Odkrycie enzymów restrykcyjnych (1962 r. Nirenberg i Ochoa. a wiodącą rolę w tych badaniach odegrali między innymi Khorana.). kura czy pies. W przypadku człowieka celem jest nie tylko mapowanie genomu. że molekularne poznanie genomów człowieka.nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA). których celem było poznanie struktury chemicznej DNA. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego. to czas usilnych badań. Początek lat 50.) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r. teorii operonu. W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów. Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie.). ustalenie kolejności par nukleotydów w całym DNA ludzkim. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów.) oraz enzymu odwrotnej transkryptazy (1970 r. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków. owca. zwierząt. sekwencjonowania DNA (1975 r. że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang. w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. hodowlą zwierząt i roślin. liczącym ponad trzy miliardy par nukleotydów. Zostały one zakończone w pierwszej połowie lat 60. ochroną środowiska itp. ale również jego sekwencjonowanie. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw.) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. jak świnia. Program ten został urucho miony w 1987 roku. wykrywaniem 1 zwalczaniem patogenów.. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna.

Wydaje się. wysoką plenność owiec rasy boorola i inverdale. Ustalono. świni i kury. wysoką mięsność świń czy wydajność tłuszczu w mleku krów. . Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji. Pierwsze osiągnięcia zostały już opublikowane. a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa. dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. W grudniu 2002 roku ustalono sekwencję genomu myszy. roślin. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów. zwierząt. a także człowieka powinna wywołać głębokie zastanowienie się nad tym. a w przypadku mutacji genowych — metod genetyki molekularnej. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt. Przewiduje się. Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji. czego jednym z licznych przykładów jest hodowla zwierząt. jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła.oraz 2) prywatną firmę CELERA. a ostatnio także polimorfizmu DNA. że do 2005 roku zostaną zsekwencjonowane genomy bydła. której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć. Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek. że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. gdzie jest granica. Głównymi metodami hodowlanymi są selekcja i krzyżowanie. Istotnym elementem pracy hodowlanej jest kontrola pochodzenia. bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych.

oprócz bakterii i sinic. W jądrze komórkowym występują chromosomy. 2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie. które podlegają podziałom (mitoza. Do eukariontów zalicza się wszystkie organizmy komórkowe. zdolnego do podziałów (kariokinezy). Tym samym organizmy te zawierają pojedynczy zestaw genów. że: 1) geny zlokalizowane są w chromosomach. biorąc pod uwagę organizację informacji genetycznej i budowę komórki. Prokarionty nie mają wyodrębnionego jądra komórkowego. dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota). Głównymi tezami tej teorii było twierdzenie. które są zbudowane z kwasów nukleinowych i białek. Odpowiednikiem jądra komórkowego jest nukleoid.Rozdział 2 Chromosomy i podziały jądra komórkowego W podziale systematycznym organizmów żywych wyróżnia się. Do prokariontów zalicza się bakterie i sinice. który w 1910 roku ogłosił chromosomową teorię dziedziczenia. a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. mejoza). Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. Eukarionty zbudowane są z komórek mających jądra komórkowe. że nie 15 . Należy jednak podkreślić. Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. czyli są haploidalne. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana. zbudowany z „nagiej" kolistej cząsteczki DNA. Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu.

która następuje za pomocą białek histonowych i niehistonowych. M — metafaza. Gl. S. 2-1. Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego. chromosom Ryć. G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu.1.wiedziano wówczas. Budowa chromosomu Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA). białek histonowych i niehistonowych. z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu. Dzięki kondensacji cząsteczki DNA. A — anafaza i T — telofaza 16 . kwasów rybonukleinowych (RNA). Oznaczenia: P — profaza. 2. Fazy (GO.

Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu. 2-1).00-1. Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym. Część końcowa ramienia chromosomowego nazywana jest telomerem. Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC.osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej. nucleolar organizer region). subtelo-i akro-(telocentryczny) (ryć. oprócz przewężenia pierwotnego. który jest odpowiedzialny za uformowanie jąderek podczas interfazy.8S. określane inaczej jako obszar jąderkotwórczy — NOR (ang. (3. także przewężenie wtórne. Wówczas to chromosom ma długość rzędu kilku mikrometrów. że są siostrzane. ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. która obejmuje nie tylko ustalenie liczby chromosomów. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej. W jąderkach budowane są podjednostki rybosomów.71-3. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17 . W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5. określanym jako centromer. 2-2. ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć. submeta-. (1. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1. 2-2). Niektóre chromosomy mają.01-7.70). O chromatydach mówi się. a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną.00) i (7. Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-.01-oo). Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną. 18S i 28S. Czwarta chromarydy siostrzane Ryć.00).

Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego. W każdej parze jeden chromosom pochodzi od matki. morfologii. 2-3). Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm.frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. jak i żeńskiej. W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy. Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć. występują w układzie XX u samic oraz XY u samców. Podczas fazy S następuje replikacja — 18 . Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y. Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). oznaczane u ssaków symbolami X oraz Y. W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej. Fragment ramienia chromosomu. która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny. układu prążków poprzecznych oraz. podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X. Oznacza to. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału. która z kolei zawiera jedną cząsteczkę DNA. który występuje za przewężeniem wtórnym. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y). które są w nich położone. Heterochromosomy. że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację. a drugi od ojca danego osobnika. nazywa się satelitą. co najważniejsze — zestawu loci genów.

charakteryzują się niezwykłą precyzją (ryć. Przyjmuje się. Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom. Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz. Fragment DNA owinięty na oktamerze histonowym (1.8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz.Ryć. zawierający po dwie cząsteczki histonów: H2A. Jest on zbudowany z rdzenia białkowego (oktamer histonowy. ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo. a procesy te. H2B. w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. w zakresie od 0 do 80 pz. Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu. na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów. która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. 1997. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt. 2-4. 19 . H3 i H4). że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. PWN) samoodtworzenie DNA. 2-4). inaczej par zasad (pz).

high mobility group). Chromosomy interfazowe zachowują strukturę nukleosomowa. która może ulec trwałej kondensacji. Solenoid podlega dalszej spiralizacji. Dlatego te sekwencje DNA określane są terminem S AR (ang. która zawsze występuje w stanie skondensowanym. głównie powtarzalnych sekwencji DNA. Heterochromatyna fakultatywna jest częścią chromatyny. należącymi do rodziny białek HMG (ang. ciałka Barra. Wiadomo jednak. czyli regionami wiążącymi się ze szkieletem chromosomu. Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. sekwencji nukleotydowych. przykładem jest jeden z chromosomów X u osobników żeńskich. Podlega ona replikacji w początkowym okresie fazy S. które są zakotwiczone w rdzeniu białkowym chromatydy. Pojawia się ona podczas zapłodnienia. scaffold attachment region). Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. które odpowiadają za zbliżenie się sąsiednich nukleosomów. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną. Heterochromatyna konstytutywna jest frakcją chromatyny. Jej replikacja występuje w późnym okresie fazy S. czyli geny. zbudowanym z białek niehistonowych. że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów. Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu. domeny. a jej ostatecznym etapem jest utworzenie domen pętlo wych. Zbudowana jest z niekodującycK. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20 . Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości. W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl. które tworzą większe chromocentra. z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. W niej zlokalizowane są kodujące sekwencje DNA. Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów. który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw. rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego.Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid.

W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych.w oocycie drugiego rzędu (komórce jajowej). w których jeden chromosom jest pochodzenia ojcowskiego. ale mogą zawierać w nich różne allele 21 . Chromosomy homologiczne mają loci tych samych genów. a drugi matczynego.

2-5 i 2-6). od 30 u norki do 78 u psa (tab. ryć. 2-1. Chromosomy B. czyli nadliczbowe względem podstawowego ze- 22 . Należy podkreślić.Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale. że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota.

wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T.2. Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej. 2.49 lub 48 chromosomów. fuzji centrycznej u lisów polarnych. iż są nieaktywne genetycznie. że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii. że często są zbudowane z heterochromatyny konstytutywnej. Okazało się. Prążki mają identycz23 .stawu A. może być uwidocznione za pomocą technik barwienia różnicującego. Konsekwencją tego jest występowanie u lisów osobników. chociaż wiadomo. które mogą mieć 50. charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych. jak i pomiędzy komórkami w obrębie jednego osobnika. np. Do tej pory nie poznano funkcji tych chromosomów. Barwienie prążkowe chromosomów Zróżnicowanie wewnętrzne chromosomu. ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. czyli można przypuszczać. Efektem tego jest zmienność ich liczby zarówno między osobnikami.

Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące 24 .ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku. Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym. że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów. Wynika z tego. ale także układ prążków na chromosomach. po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole.

gdzie dominują pary zasad A-T. W efekcie na chromosomach 25 . 2-7a). Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. a następnie barwienia roztworem Giemsy. Silne wiązanie barwnika kwinakryny następuje w miejscach. Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny).(ryć.

Oprócz opisanych wyżej metod prążkowych. Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze. 2-7b).pojawiają się prążki ciemne i jasne (ryć. a prążki jasne odpowiadają nie świecącym prążkom Q. po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. Zależność ta jest szczególnie interesująca. znane są metody. silnie skondensowane obszary heterochromatynowe. że prążki R są głównymi regionami. ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach. a miejscami szczególnie bogatymi w loci genów są prążki T. Heterochromatyna konstytutywna 26 . są one niezbędne przy mapowaniu fizycznym genów. w których zlokalizowane są geny. Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG). które zaszły w kariotypach zwierząt. Ponadto. które pozwalają na uwidocznienie charakterystycznych regionów chromosomu. gdzie przy barwieniu QFQ występuje prążek nie świecący. Największe zagęszczenie genów występuje w obrębie izochor H3. które się wybarwiają roztworem Giemsy. które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. Wskazuje to zatem. Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. Prążki R. H2 i H3. gdzie przy barwieniu QFQ obserwowane są prążki świecące. wysepki CpG). Oznacza to na przykład. 2-8). wykorzystywanych do identyfikacji chromosomów homologicznych. Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych. w których jest też najwięcej wysepek CpG. Prążki ciemne występują w tych samych miejscach. że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. a przy barwieniu GTG prążek jasny. a pozostają trudne do usunięcia. są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl. W takich warunkach znaczna część euchromatyny zostaje usunięta.

to barwienie azotanem srebra. W miejscach tych następuje wytrącenie metalicznego srebra. 2-9a). 2-10).jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona. które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć. np. a rzadziej na końcach. 2-9b). czy też w częściach środkowych ramion. 27 . które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). Znane są również takie gatunki zwierząt. ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć. inaczej Ag-NOR. Prążki Ag-I.

28 . Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych.Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków.

w chromosomie X widoczne są krótkie ramiona. Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych. a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X. a chromosom Y jest akrocentrykiem. 2-5b). a chromosom Y jest małym metacentrykiem. 2-10a). Podobnie jak w przypadku bydła. 2n = 54 (ryć. Owca. 2-6b). w części telomerowej ramion długich pięciu par autosomów. także koza ma wszystkie autosomy akrocentryczne. który ma dodatkowy prążek 29 . Chromosomy płci są łatwe do identyfikacji.i submetacentrycznych) oraz 6 par akrocentrycznych. w ramionach krótkich.Bydło. Koń. 2n = 60. 2-9a). 2n = 64 (ryć. Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta. w którym nie jest jeszcze zakończona kondensacja chromosomów. Wszystkie autosomy są akrocentryczne. Chromosom X jest dużym chromosomem metacentrycznym. Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków. W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. Chromosom Y jest najmniejszym chromosomem metacentrycznym. trudnym do odróżnienia na podstawie morfologii od autosomów. Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X. a chromosom Y jest małym metacentrykiem. Również akrocentryczny jest chromosom X. 2n . natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim. a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. podobnie jak u bydła. Chromosom X jest średniej wielkości metacentrykiem. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów. w pobliżu centromeru (ryć. W stadium prometafazy. Chromosom X jest dużym akrocentrykiem. Koza. 2n = 38 (ryć. 2-6a). Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. W chromosomie X brak jest centromerowego prążka C. natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków. Obszary jąderkotwórcze występują. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach. a chromosom Y jest małym metacentrykiem. Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. co odróżnia go od autosomów akrocentrycznych o podobnej wielkości.60 (ryć. ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem. Układ prążków C. 2-5a). Świnia.

Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną. 2n = 50. W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. 30 . W kariotypie kury. z grupy mikrochromosomów. w okolicach centromeru. którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów. łącznie z chromosomami płci. Chromosom Y jest w znacznej części heterochromatynowy. którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B. 2n = 34 +B (ryć. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. 2n = 78. Ponadto. Lis polarny. mają bloki heterochromatynowe w okolicy centromeru. Wszystkie autosomy z grupy A są chromosomami dwuramiennymi. Obszar jąderkotwórczy występuje tylko w jednej parze autosomów. Liczba chromosomów B waha się od O do 7. Wszystkie chromosomy. dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe. 2-7a). U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. Lis pospolity. Kura. a chromosom Y bardzo małym akrocentrykiem. a chromosomy z grupy B są akroćentryczne lub subtelocentryczne. podobnie jak u innych ptaków. nazywanych mikrochromosomami. 2-10b). Chromosom Z jest dużym metacentrykiem. Chromosom X jest dużym metacentrykiem. wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne. oraz w chromosomie Y. 49 lub 48. przy czym najczęściej obserwowano l. występuje liczna grupa bardzo małych chromosomów.interstycjalny w ramieniu długim. a chromosom Y bardzo małym akrocentrykiem. a chromosom W jest małym metacentrykiem. Chromosom X jest dużym metacentrykiem. 2-9b). W grupie dużych autosomów analizuje się najczęściej 8 par. 2 lub 3 chromosomy B. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych.

3. 2-8b).Pies. Jeżeli ilość DNA wyrazimy za 31 . a faza S jest związana z procesem samoodtworzenia się DNA (replikacja). który prowadzi do powstania dwóch komórek potomnych. Chromosom X jest dużym metacentrykiem. W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. a chromosom Y jest małym metacentrykiem. W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki. Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu. Komórki potomne mają nie tylko taką samą liczbę chromosomów. Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y. 2n = 78 (ryć. a czwartą fazą jest podział. Rozpoczęcie fazy S oznacza. chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. jaki miała komórka rodzicielska. komórki krwi. w części terminalnej ramion długich. a także z pierwszymi etapami gametogenezy. nabłonka). proliferacją limfocytów przy reakcji odpornościowej organizmu. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów. że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. ale także identyczną sekwencję nukleotydów w DNA. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki. mających genotyp identyczny z tym. Mitoza Mitoza to proces podziału jądra komórkowego. 2. odnawianiem niektórych komórek u dorosłych organizmów (np. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. Wszystkie autosomy są akrocentryczne. Fazy Gl. S i G2 tworzą okres międzypodziałowy — interfazę.

a centriole dzielą się na dwie parzyste struktury. które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. metafazy. Chromosomy ulegają dekondensacji. Mitoza składa się z czterech faz: profazy. że najmniejszą zawartość DNA (1C) mają gamety (ryć. którego włókienka. wychodzące z centrosomu (obszar wokół centrioli). rozchodzą się do przeciwległych biegunów komórki. W końcu. Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. Centriołe. jakie występują w profazie. odbudowuje się błona jądrowa oraz jąderka. Kariotyp Uszeregowanie chromosomów.pomocą umownych wartości C. W wyniku kariokinezy w komórce powstają dwa jądra potomne. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. to w jądrze komórkowym po replikacji jest 4C. W profazie rozpoczyna się proces kondensacji chromosomów. Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32 . w pary homologiczne określane jest terminem kariotyp. występujących w jądrze komórki somatycznej. a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. W obrębie jądra komórkowego zanikają jąderka. Następuje formowanie się wrzeciona podziałowego. Po zakończeniu podziału jądra komórkowego następuje cytokineza. W tej fazie chromosomy są rozprzestrzenione w całej komórce. w których każdy z chromosomów jest zbudowany z jednej chromatydy. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych. dezintegracji ulega błona jądrowa. Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi. mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska. W telofazie zachodzą procesy odwrotne do tych. 2-12). odpowiedzialne za powstanie wrzeciona podziałowego. Istotnym zmianom podlegają również inne organelle komórkowe. Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. czyli podział cytoplazmy i rozdział organelli komórkowych. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. W trakcie omawiania podziału mej etycznego pokazane zostanie. 2-11). Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. łączą się z centromerami chromosomów w taki sposób.4. anafazy i telofazy (ryć. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. 2. organelle komórkowe odpowiedzialne za wytwarzanie rybosomów.

Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów. 2-12. Wydawnictwo AR. a — centriole. Oznaczenia: P — profaza. PM — prometafaza. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. A — anafaza.spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce. c — dezintegrująca błona jądrowa. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. b— zanikające jaderko. M — metafaza. d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt. Poznań 1988) 33 . Być. C — cytokineza. T — telofaza. Schemat przebiegu podziału mitotycznego.

do których zalicza się: długość chromosomu.Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć. subtelo. G lub R. w których wszystkie Ryć. Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu. Jest to spowodowane tym. 2-8a 34 .lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q. ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. kozy i psa. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła. submeta-. położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds. że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny. Standaryzacji Kariotypu Świni. 2-13.

2-14.1988) 35 . Standaryzacji Kariotypu Świni (Hereditas 109:151-157. Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds. Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy Ryć.chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości. przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne.

Q. R Źródło Cytogenetics and Celi Genetks 92:283-299. Opracowanie kariotypu. C. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni. R G.zróżnicowane pod względem morfologicznym. przyjętym dla danego gatunku. R G. Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. Q. Przykładem może być kariotyp świni (2n = 38). 2-14). Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej. wielkość oraz wzór prążkowy (najczęściej prążki G lub R). dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem. Brytania). świni. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery. 1999 . kozy i kota. Ag-I G. 2001 jw. które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. Ponadto. W latach 80. w zakresie wyznaczonym przez liczbę par dla danego gatunku. czasami określanego kariogramem. dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang. dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G. 1999 J w- Hereditas 109:151-157. 1996 Cytogenetics and Celi Genetks 86:271-276. C. owcy. precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe. W obrębie regionów numerowane są także kolejne prążki. Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła. Natomiast w drugiej połowie lat 90. kozy i konia. Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony. i 85:317-324. 2-14). 1988 Chromosome Research 5:433-443. landmarks). 2-13). nazywa się idiogramem (ryć. która odbyła się w 1976 roku w Reading (W. opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11 Wykaz gatunków. R G. owcy. 1985 Hereditas 103:171-176. Graficzne przedstawienie kariotypu. w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. bydła. które są numerowane (ryć. Każda para homologiczna ma opisaną morfologię. R R G. obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków. konia. Ag-I G G G. 1997 Hereditas 103:33-38. 1981 Chromosome Research 4:306-309. 1985 Cytogenetics and Celi Genetks 31:240-248.

diploten i diakinezę. anafaza i telofaza (ryć. który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych.: profaza. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych. zygoten. w których występują takie same fazy jak w mitozie.5. W tabeli 2-II zestawione są gatunki. komórki te mają zmniejszoną do poziomu 1C zawartość DNA. 2. dla których opracowano wzorce.szych par spośród 39) oraz poprawiono wzorzec kariotypu konia. która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten. tzn. tzn. replikacją DNA w fazie S. Każdy element lateralny zakończony jest tarczką przylegającą. która mocuje chromosom do wewnętrznej strony błony jądrowej. synaptonemal complex — SC). Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej. Należą do nich: kondensacja chromosomów. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. Wejście komórki w podział mejotyczny poprzedzone jest. z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów. pachyten. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. Elementy lateralne 37 . metafaza. dezintegracja błony jądrowej. Strukturą tą jest kompleks synaptonemalny (ang. Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu. Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną. w których liczba chromosomów jest zredukowana o połowę. a element centralny powstaje w miejscu. Ponadto. pojawiającej się w zygotenie i pachytenie profazy I. które występują również w mitozie. 2-16 i 2-17). podobnie jak w przypadku podziałów mitotycznych. czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. Mejoza Podział mejotyczny prowadzi do powstania komórek. zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału. Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym. Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne. Mejoza składa się z dwóch podziałów. 2-15).

Ali — anafaza II. Pil — profaza II. Z — zygoten. Oznaczenia: PI — profaza I. DK — diakineza. TI — telofaza I. d — guzek rekombinacyjny. L — leptoten. a — tarczka przylegająca. MI — metafaza I. AI — anafaza I. b — centromer. Wydawnictwo AR. Schemat przebiegu podziału mejotycznego. Poznań 1988) . Tli — telofaza II. MII — metafaza II. DL — diploten. P — pachyten. 2-15. c — początek budowania kompleksu synaptonemalnego. e — chiazma (wg: Genetyka zwierząt.Tli Ryć.

Badania białek SC pokazały. Wiele wskazuje na to. występującymi w tej części domen pętlo wy ch. Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. Ponieważ koniugacja ma charakter homologiczny. synaptonemal complex protein): SCP1. U ssaków dobrze poznano strukturę trzech białek SCP (ang. sekwencjami DNA. że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. że crossing over może zajść. zanim dojdzie do koniugacji za pośrednictwem SC. Ostatnio przeprowadzone badania pokazały jednak. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej. Wynika z tego. że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego. która z kolei miała umożliwiać zajście crossing over na początku pachytenu. Koniugacja chromosomów 39 . Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. których długość. Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. domen pętlowych. że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE). mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz). to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi.łączą się tylko z niewielką częścią DNA chromosomów (około 1%). chociaż jeszcze nie poznanymi. SCP2 i SCP3. które są zakotwiczone w rdzeniu białkowym chromatydy. zależnie od gatunku.

2-17b). Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów. na okładce). dzięki 40 .zostaje zakończona na początku pachytenu (ryć. Biwalent jest także formowany przez heterochromosomy X i Y (ryć.

niewielkim regionom pseudoautosomalnym (ang. gdzie wystąpiło crossing over. pseudoautosomal region — PAR). które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. składające się z maksymalnie skondensowanych chromosomów homologicznych. a tym samym i jego chromatydy. Przyjmuje się. które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. Potencjalnie mogłoby istnieć niebezpieczeństwo. gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I. ich zanikania. zmierzają do płaszczyzny równikowej 41 . a w świetle ostatnich badań można przypuszczać. tzn. że na jednych chromosomach liczba ta byłaby znaczna. w przeciwieństwie do sytuacji. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm. zachodzi w przypadkowym miejscu biwalentu. poza miejscami. miał zestaw alleli tylko jednego z rodziców. co wynika z zasady. Chromatyda. a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T. następuje rozkład kompleksów synaptonemalnych. Należy podkreślić. które są podklasą prążków R. W metafazie I biwalenty. Należy jednak pamiętać. że SC jest w to istotnie zaangażowany. że pierwotnym źródłem zmienności są mutacje. a na innych brak byłoby takich wymian. Na początku pachytenu występuje zjawisko crossing over. że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. Wiadomo. jaka była przed crossing over. ponieważ brak crossing over pociąga za sobą brak chiazm. że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca. że zachodzi ono rzadziej w pobliżu centromeru. Losowość crossing over naruszona jest również przez to. stanowiące cytologiczny dowód zajścia crossing over. Po zakończeniu pachytenu — w diplotenie. że crossing over jest zjawiskiem obligatoryjnym. a drugi od matki. Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału). której efektem jest zmienność w świecie ożywionym. Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji. tzn. przy czym liczba tych zdarzeń waha się od l do 5. Zjawisko to określane jest terminem interferencji. że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. która uczestniczyła w wymianie. Zasadniczo crossing over jest zdarzeniem losowym. Losowość zachodzenia crossing over jest jednak ograniczona. które uruchamiają homologiczną koniugację. Zasada ta dotyczy także biwalentu X-Y. czyli musi zajść w obrębie każdego biwalentu. w których powstają chiazmy. Ponieważ tak się nie dzieje. uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego. Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. Wówczas to chromosom. dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over.

2-18c).komórki (ryć. Oznacza to. w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć. Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA. Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób. W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. 2-18a). 2-18b). Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I. który nie jest poprzedzony replikacją DNA. czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym. że do centromeru przyłączają się włókna tylko z jednego bieguna. że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej. Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział. 42 . natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego.

że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice. jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów.Drugi podział ma przebieg zgodny z mitozą. Rekombinacje genetyczne zachodzące podczas mejozy. Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd. 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. 2. w której zachodzą procesy odwrotne do tych. a ich chromatydy mają zrekombinowane układy alleli. Trzystopniowa rekombinacja sprawia. Przebieg mejozy. obok mutacji.6. Po ustawieniu się chromosomów podczas metafazy II (ryć. inne matczynego. jakie występują w profazie mitotycznej. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego. 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43 . Gametogeneza Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym. wśród których jedne są pochodzenia ojcowskiego. przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa. a niektóre mają zrekombinowany układ alleli. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza). które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. Ten typ określany jest jako rekombinacja chromatydowa. z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C. Ten fenomen. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). rozpoczyna się telofaza. W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. chromatydowe i wewnątrzchromatydowe. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy. można podzielić na: chromosomowe. że wśród gamet nie występują dwie o tym samym zestawie alleli. a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. rozumiane w szerokim sensie. Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki.

podlegają głębokim przeobrażeniom podczas procesu spermiogenezy. nie kończą się cytokinezą. który jest nazywany diktiotenem. Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych. Oocyty przechodzą w stan spoczynkowy. polegają na: 1) przekształceniu aparatu Golgiego w akrosom. powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi. który okrywa górną część jądra komórkowego znajdującego się w główce plemnika. jako komórki niezróżnicowane. zostają przekształcone w oocyty I rzędu. Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. Podziały te są zsynchronizowane. które rozpoczynają podział mejotyczny. 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach. jakie zachodzą podczas spermiogenezy. 3) wykształceniu na bazie centrioli włókna osiowego witki. stem cells). 2-20). Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu. czyli komórek nie w pełni zróżnicowanych. 44 .geneza. 2-19). W ten sposób wszystkie oogonia. w której jest umiejscowione jądro komórkowe i akrosom. w wyniku którego powstają plemniki. Pierwszy podział prowadzi do powstania dwóch spermatogoniów. Dojrzały plemnik zbudowany jest z główki. Główne zmiany. Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki. w której zgrupowane są mitochondria. z których jedna komórka zajmuje miejsce pierwotnego spermatogonium. Następne podziały mitotyczne spermatogoniów. które są umiejscowione po przeciwnej. a jest ich najczęściej sześć. w stosunku do akrosomu. które niezwłocznie rozpoczynają podział mejotyczny. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. Spermatydy. a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. która stanowi przedłużenie wstawki. po zakończeniu mejozy. Ostatecznie. które wykazują zdolność do samoodnawiania. w których komórki linii płciowej lokują się w części korowej gonad. a druga podlega dalszym podziałom. która jest określana jako syncytium. czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika. Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. będące w stadium diktiotenu. 2) zgrupowaniu mitochondriów w pobliżu centrioli. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu. która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. które występowały w jajniku. wstawki znajdującej się u podstawy główki. oraz witki. stronie jądra komórkowego.

Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. to może nastąpić dokończenie oogenezy. pewna część pęcherzyków rozpoczyna wzrost. Oocyt I rzędu kończy pierwszy podział mejotyczny. przed owulacją następuje ponowne uruchomienie podziału mejotycznego. W kolejnych cyklach płciowych. W pęcherzykach. w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. Oocyt znajduje się w stadium metafazy II. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji. których wzrost był wystarczająco intensywny. Dzieje się to na drodze wyrzucenia przez oocyt zawartości 45 . a w nich rozrasta się również oocyt. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej. który jest wspomagany przez otaczające komórki pęcherzykowe. regulowanych hormonalnie. przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu.

które pozostały w oocycie 46 . Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny. która staje się barierą nie do pokonania dla plemników. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie. który zapłodnił oocyt.ziaren korowych. do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego. Zapłodniony oocyt II rzędu przekształca się w zygotę. Powoduje to „utwardzenie" osłonki przejrzystej. a drugie reprezentujące zestaw chromosomów żeńskich. po czym następuje telofaza II. znajdujących się pod powierzchnią oocytu. podlega dekondensacji i powstaje przedjądrze męskie. a chromatyna plemnika. w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika.

a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów). W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja).po zakończeniu drugiego podziału mejotycznego. że zygota jest gotowa do rozpoczęcia podziału mitotycznego. Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu. które są określane jako enukleowane. z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II). Zawartość DNA wzrasta do poziomu 4C. zarodkach. . Warto zauważyć. samic dawczyń do rogów macicy tzw. Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii). Do takich oocytów. zygotach. inseminacja. z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. które umożliwiają uzyskiwanie potomstwa pożądanej płci. profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki. co powoduje. pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich. Na przykład. W taki właśnie sposób sklonowano słynną owcę Doiły. kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro). a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne). do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy. który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. można wprowadzić techniką elektrofuzji komórkę somatyczną. Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu. samic biorczyń.

transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. które są niezbędne do pełnienia funkcji nośnika informacji genetycznej. DNA może podlegać mutacjom. MacLeod i M. 3. Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości. Po drugie.D. Crick przedstawili model budowy DNA. czyli procesowi generującemu pierwotną zmienność genetyczną. Watson i F. przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy. informacja o pierwszorzędowej strukturze białek.1. które z kolei podlegają rekombinacjom podczas mejozy. Po pierwsze. który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. Avery. Badania te przeprowadzili badacze amerykańscy O. Z kolei proces ekspresji 48 . W ślad za tym odkryciem nastąpiły następne. DNA ma zdolność do samoodtwarzania się. McCarty. DNA charakteryzuje się trzema właściwościami.T. za pomocą kodu genetycznego. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA). C. a także o strukturze cząsteczek rybosomowego (rRNA).Rozdział 3 Gen i jego ekspresja Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi. a przez następne lata rozszyfrowywano kod genetyczny.M. Po trzecie. Budowa kwasów nukleinowych Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych. w sekwencji nukleotydów zapisana jest. W 1953 roku J. czyli replikacji. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA.

a rzadziej podwójny heliks. który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów. 3. 3-1). cukier deoksyryboza i reszta kwasu fosforowego (ryć. w którego skład wchodzą: zasada azotowa. W DNA występują cztery zasady azotowe.1. które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji. rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów. i tRNA (transportujący RNA). DNA Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu. Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi 49 . które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C). W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy.1. Struktura ta określana jest w języku polskim terminem podwójna helisa (ang.genu jest nierozerwalnie związany z RNA. Podstawową jednostką struktury DNA jest deoksyrybonukleotyd. helix).

Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji. bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha. W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA). a w parze GC trzy takie wiązania. a w przypadku mRNA także dla procesu translacji. Przyjmuje się. tak więc w parze AT są dwa wiązania wodorowe. określaną wielkością S — stała sedymentacji. inaczej nazywanych przewężeniami wtórnymi. Przeciwna polaryzacja polega na tym. który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. polskim lub bp od słów angielskich base pairs). Pomiędzy zasadami powstają słabe wiązania wodorowe. Taka organizacja podwójnej helisy DNA sprawia. którego długość wynosi około 14 000 pz. naprzeciw adeniny zawsze występuje tymina. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności. że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA.1. z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA.z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą. Podczas transkrypcji. nucleolar organizer region — NOR). Trzy rodzaje rRNA: 5. że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. tzn. czyli każdy łańcuch ma koniec 3' i 5'. W jąderku zlokalizowane są cztery rodzaje rRNA. 3. prowadzonej przez polimerazę I RNA. Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku. a naprzeciw guaniny znajduje się cytozyna. Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. powstaje pre-rRNA o stałej sedymentacji 45S. lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. RNA Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych. Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla. Długość cząsteczki DNA wyraża się liczbą par nukleotydów. Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane.8S. natomiast liczba aktyw50 .2. które są wyróżniane ze względu na wielkość cząsteczki. w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang.

Na końcu 3' cząsteczki tRNA występuje sekwencja CCA. W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową. które podlegają transkrypcji. a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć.nych obszarów. Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60. zawiera układ trzech nukleotydów. Wymienione rodzaje rRNA uczestniczą w budowie rybosomu. która katalizuje związanie tRNA z. że przekracza liczbę znanych aminokwasów. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. a trzy pozostałe rodzaje.8S i 28S. które są komplementarne do kodonu aminokwasu transportowanego przez tRNA. 51 .właściwym aminokwasem. 5S. tzn. Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA). w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas. występujący w wielu powtórzeniach w innej części genomu. o mało poznanej funkcji. W nici takiej mogą jednak występować fragmenty komplementarne. 3) pętla III — dodatkowa. co oznacza. Geny 5S rRNA są transkrybowane przez polimerazę III RNA. 5. 3-2). zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu. Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów. które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem. Czwarty rodzaj — 5S rRNA jest kodowany przez gen. zlokalizowane są w podjednostce dużej (60S). jest zmienna. 2) pętla II — antykodonowa. który jest zaangażowany w dostarczanie aminokwasów do rybosomów. czyli takich.

czyli mitozy. Każdy podział mitotyczny musi być poprzedzony replikacją. Ostatnie badania wykazują. Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach. że jest to bardzo ważna grupa RNA. 3. Na przykład. Replikacja DNA Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego.2. noncoding RNA). z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji. Na uwagę zasługuje jeszcze jedna klasa RNA. 52 . które określane są jako replikony. bądź mejozy. Podobnie jest w przypadku mejozy.Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych. a także regulacji ekspresji genów. liczba replikonów w genomie ssaków szacowana jest na około 25 000. modyfikacji nukleotydów. Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji. określana terminem niekodujący RNA (ncRNA — ang. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. która bierze udział w procesie wycinania intronów z pre-mRNA. a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów.

jest on uniwersalny. Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). tzn. Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. Tryplet AUG. trzy kolejne nukleotydy (kodon. że sekwencje nukleotydów w tych łańcuchach. tzn. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą. Po drugie.Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. Od tej zasady są tylko nieliczne wyjątki. 3. Po pierwsze. Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. o czym była już mowa wyżej. Wynika z tego. które następnie są łączone przez enzym ligazę w ciągłą nić. W ten sposób powstają tzw. Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA. Drugi. to ogółem możliwe jest utworzenie 64 trójek (tab. Kod genetyczny Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego. Rozplecione łańcuchy polinukleotydowe stanowią matryce. tryplet) w DNA zawierają informację o aminokwasie. kodon UGA w kodzie uniwersalnym jest 53 .3. są różne. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia. Oznacza to. komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. np. Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym. 3-3). które nie kodują żadnego aminokwasu. 3-1). widełki replikacyjne (ryć. w obrębie danego odcinka DNA. na których w sposób komplementarny syntetyzowane są drugie łańcuchy. kod ma charakter trójkowy. fragmenty Okazaki). Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów. takie. że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego. mającego charakter trójkowy. który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). które dotyczą niektórych kodonów w mitochondrialnym DNA. który ma być wbudowany w procesie biosyntezy białka. a nić powstająca w sposób nieciągły opóźnioną. a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). rozpoczyna część kodującą genu. tzn.

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

którego całościowe poznanie wymaga jeszcze wielu lat badań. obejmuje także inne procesy. Jest to bardzo złożony proces. w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. budowa struktur komórkowych itp. Warto pamiętać. Mechanizm ten nazywa się alternatywnym składaniem mRNA. jest włączana i wyłączana ekspresja różnych genów. która wskazuje. Regulacja ekspresji genu W genomie ssaków występuje około 35 tysięcy genów. czyli dobudowa60 . że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA. w skład którego będą wchodziły różne kombinacje eksonów. badania serologiczne — grupy krwi. elektroforeza białek. umaszczenie. że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu. Wśród nich znaczną grupę stanowią geny pełniące tzw. Z drugiej strony. które mogą występować w układzie homo. housekeeping genes). że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele. Podczas rozwoju ontogenetycznego. obecność rogów.7. W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw. oprócz zmian opisanych w podrozdziale poświęconym transkrypcji. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji.lub heterozygotycznym.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. Modyfikacja mRNA. potranskrypcyjnej modyfikacji mRNA. w jakim kierunku różnicuje się dana komórka. hybrydyzacja ze znakowanym przeciwciałem itp. które są zaangażowane w kontrolę ekspresji genów.).3. funkcje gospodarza komórki (ang. Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. Niemniej znanych jest już wiele mechanizmów. poligeny. Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. takie jak: przemiany energetyczne. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. co ma oczywiście związek z ekspresją genów. zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu. translacji i potranslacyjnej modyfikacji białka. Ekspresja genu obejmuje procesy: transkrypcji. obok genów ulegających powszechnej ekspresji. czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. replikacja DNA. Zakończenie transkrypcji związane jest z sekwencją AAUAAA. podatność na stres itp. zależnie od tego. regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek. wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych. Należy jednak pamiętać.

zinc finger). a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. Proces ten nazywa się redagowaniem mRNA. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie.nie sekwencji poliA (tzw. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik 61 . Efektem tego może być na przykład pojawianie się w transkryptach. zależnie od ich struktury trzeciorzędowej. Wymienione struktury wchodzą w kontakt z nicią DNA. Czynniki transkrypcyjne. Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć. powstających w niektórych tkankach.7. są zaliczane do następujących grup: białka zawierające tzw. przed przejściem do cytoplazmy. Okazuje się. Wreszcie mRNA powstały podczas transkrypcji może ulegać. Taką formę modyfikowania mRNA opisano m. 3. Czynniki transkrypcyjne Czynnikami transkrypcyjnymi nazywane są białka. Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. powstałe na bazie tego samego matrycowego DNA. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang. Funkcjonują wówczas dwa rodzaje mRNA. dodatkowego kodonu stop. które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji. palce cynkowe (ang. Forma rozpuszczalna tego białka powstaje na matrycy mRNA. Białka te w swojej strukturze zawierają dwa istotne obszary. który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. odpowiedzialne za syntezę polipeptydów o różnej długości. 3-7). modyfikacjom polegającym na zmianie sekwencji nukleotydów. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych. leucine zipper). takich jak hormony. czyli od jego stabilności.1. w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA).in. że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty. ogonek poliA) na końcu 3' mRNA. białka o strukturze typu heliks-skręt-heliks (ang.

lub też z udziałem przekaźników modyfikujących białka w cytoplazmie. a z drugiej strony od różnicowania się komórek. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników. gdy do receptora jest przyłączony hormon steroidowy. RS — receptor hormonu steroidowego. 3. Oznaczenia: HP — hormon peptydowy. Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. T1 T2 — przekaźniki wewnątrzkomórkowe. hormon wzrostu. których mechanizm działania jest jeszcze słabo rozpoznany. co można uznać za regulację ekspresji genów na etapie potranslacyjnym. G2 — części strukturalne genów transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu.Ryć. 3-7.) nie wnikają do wnętrza komórki. a jedynie wiążą się z receptorami błonowymi. Wiązanie takie wywołuje wiele reakcji. Hormony peptydowe (np. HS — hormon steroidowy. R — receptor hormonu peptydowego. Schemat regulacji ekspresji genów za pomocą hormonów.7. Domena wiążąca DNA jest aktywna tylko wówczas. insulina itp.2. Geny homeotyczne Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych. Pl P2 — promotory genów. Poznanie genów od62 . Gj.

a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie. Geny te funkcjonują w układzie hierarchicznym. Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks. które w genomie muszki owocowej występują w dwóch kompleksach.7. Obok wielu genów. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne.3. że około 56% genów zawiera te sekwencje. Prawie cały DNA zawiera zmetylowaną cytozynę. homeoboks). Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. czego skutkiem jest przejście DNA w stan nieaktywny. 3. że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów. Wynika z tego. że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się. Struktura tych genów wykazuje zaskakujące podobieństwo. Trzeba jednak podkreślić. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. U ssaków geny te. Oznacza to. w liczbie około 30. ANT-C i BX-C. HOX2. a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu.powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. zgrupowane są w czterech kompleksach: HOX1. która koduje fragment białka (tzw. Okazało się. że mają one sekwencję o długości około 180 pz (tzw. których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących 63 . tzn. Metylacja DNA Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA. ich ekspresja następuje w ściśle określonej kolejności. które odpowiadają za poszczególne etapy morfogenezy. domena białkowa) o długości 60 aminokwasów. Rozwój muszki owocowej przebiega pod kontrolą genów. Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. położonych w jednym chromosomie. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną. która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. HOX3 i HOX4.

rozwijały się dość dobrze. tzn. gametic imprinting). czyli nie wpływa na prawidłowość replikacji wysepek CpG. Jeden z nich -— HpaII przecina sekwencję CCGG. znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. typowy dla danej płci (ryć. czy cytozyna jest metylowana. czyli nieistotne jest. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca. Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego. wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. czy niemetylowana. a od którego allel a. dobrze rozwijały struktury trofoblastu. 3-8). a drugi — MspI przecina tę sekwencję niezależnie od tego. dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. czy allel pochodzi od ojca. jak i męski rozwijały się prawidłowo. 3. od którego z rodziców pochodzi allel A. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych. a nie tylko diploidalna liczba chromosomów. tzn. Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. niedorozwinięty zaś był sam zarodek. Piętno gametyczne W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze. czyli uczestniczące w formowaniu łożyska. Powstałe na drodze manipulacji zarodki ginogenetyczne. mające dwa genomy męskie. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna. jeśli pochodzą od ojca. w której cytozyny nie są metylowane. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji. Dowód na to. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną. genotyp Aa jest równoważny genotypowi aA. były zdecydowanie niedorozwinięte. zawierające dwa genomy żeńskie. czyli ze strony końca 5'. a także w komórkach somatycznych organizmu dorosłego. Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych. Natomiast zarodki androgenetyczne. z tym jednak że struktury wywodzące się z trofoblastu. tzn. od matki. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję. lub aktywne. że do rozwoju osobniczego niezbędny jest zarówno genom ojca. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. Zjawisko to niekiedy dotyczy całych regionów chromosomowych. znane są liczne geny.w części poprzedzającej gen. w które zaangażowane są fragmenty podlegające piętnowaniu. zależną od tego. które mogą być nieaktywne. jak i genom matki.4. to 64 . czy od matki. Jedynie zarodki zawierające zarówno genom żeński. gdy pochodzą np.7. W obu przypadkach dochodziło do obumarcia zarodka.

Wiadomo. podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. głębokie upośledzenie umysłowe. a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska). ubiquitin protein ligase E3) pochodzenia matczynego. smali nuclear ribonucleoprotein polypep65 . a inny w gametogenezie żeńskiej. Wynika z tego. gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. gen SNRPN — ang. a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca. a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym.in. P — chromosom pochodzący od ojca. który nosi nazwę zespołu Pradera-Willego. że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej. otyłość i niedorozwój umysłowy). W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego. Przyjmuje się.in. drgawki) określanych jako zespół Angelmana. M — chromosom pochodzący od matki wówczas rozwija się zespół zmian fenotypowych (m.in. tylko jeden gen — UBE3A nie podlega ekspresji. brak mowy. 3-8. Piętnowanie gametyczne. Podobna sytuacja powstaje. że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego. jeśli pochodzi od ojca. Tak więc. natomiast kilka genów (m. że fragment chromosomu 15 podlega piętnowaniu gametycznemu. Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m.M r ZYGOTA 2ENSKA M P ZYGOT-A MĘSKA Ryć.

W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. Obecnie znane są 34 geny. Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX). jeśli są położone w chromosomie pochodzącym od matki. które podlegają metylacji. które podlegają piętnowaniu gametycznemu u myszy. W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X. Inaktywacja chromosomu X w zarodkach żeńskich Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. insulin growth factor type 2) u myszy. który podlega piętnowaniu podczas gametogenezy żeńskiej. co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych. 3. do którego nie może się przyłączyć białko (represor).5. Sytuacja ta jest spowodowana tym. W genie tym występują dwa regiony. Przykładem może być gen Igf2 (ang. Na przykład. 66 . które zachodzi podczas wczesnego rozwoju zarodkowego.tide N). albo matczynego. nie ulega ekspresji. a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego. W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji. że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca. Okazało się. a także 11 i 12 podlegają piętnowaniu. W komórkach żeńskich występują dwa chromosomy X. wywołujące zahamowanie transkrypcji. że inaktywacją chromosomu X jest formą piętnowania. Stan taki określany jest terminem hemizygotyczności. niezbędnych do podjęcia transkrypcji. Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego. duże fragmenty chromosomu 7.7. Może się jednak zdarzyć. że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. W komórkach męskich występuje tylko jeden chromosom X. W efekcie oba allele są transkrybowane. ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. obok chromosomu Y. które są objęte zjawiskiem piętnowania gametycznego.

.

że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3. Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X. które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. w której część komórek ma aktywny chromosom pochodzenia ojcowskiego. który to stan jest utrzymywany w komórkach potomnych. W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu. albo w chromosomie ojcowskim.Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. Inaktywacja jest związana z metylacją DNA danego chromosomu. W konsekwencji organizm żeński jest swoistą mozaiką. W centrum inaktywacji zidentyfikowano locus Xist (ang. Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X. a część pochodzenia matczynego (ryć. . że produktem locus Xist jest niekodujący RNA (ncRNA). a jego obecność ujawnia się w postaci tzw. 3-9). Barwienie to pokazuje. W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X. ciałka Barra. Później. albo matczynym. Spełnia on funkcję regulacyjną. Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R. że nieaktywny chromosom X jest replikowany w późnym okresie fazy S. który pełni główną rolę w uruchomieniu inaktywacji. Warto zaznaczyć. Wiadomo. ekspresja genu Xist pojawia się losowo. Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym. X inactive specific transcript).

niszcząc niepożądane. enzym HindIII pochodzi z bakterii Haemophilus influenzae. Endonukleazy dzieli się na trzy klasy. co umożliwia np. że bakterie wytwarzają dwa rodzaje enzymów. że pierwsza litera stanowi skrót nazwy rodzaju bakterii. niszczony jest przez endonukleazy bakterii. drugi to metylotransferazy (zwane też metylazami). Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz. a także kofaktorów. Jeden to endonukleazy. wirusowy.Rozdział 4 4. Większość metod wymaga fragmentacji (pocięcia. Ponieważ obcy. substratów i produktów. rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów. Do klasy I enzymów 69 . Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów. następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii. Endonukleazy restrykcyjne Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. W celu ochrony własnego DNA przed działaniem restryktaz. serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. druga i trzecia — gatunku.1. strawienia) DNA. w zależności od ich mechanizmu działania. nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. obce cząsteczki DNA. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne. DNA nie jest odpowiednio oznaczony (zmetylowany). ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii. bakterie wykształciły system restrykcji-modyfikacji. by nie zostały przecięte przez endonukleazy. Nazewnictwo endonukleaz tworzone jest w ten sposób. które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak. System ten polega na tym. metody in situ) bądź w wyizolowanym DNA lub RNA. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. Na przykład. np.

Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1. czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna. Różnica między tymi dwiema klasami polega na tym. jest to. Tabela 4-1 Przykłady enzymów restrykcyjnych 70 .zaliczane są te restryktazy. ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. ale wzmacnia ich aktywność). utrudniającą ich wykorzystywanie w analizie DNA. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I. a ich działanie zależy od obecności takich kofaktorów. które wykazują aktywność nukleazy. iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów. Cechą tych enzymów. jony magnezu (Mg2+) i S-adenozylometionina. że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. jak ATP.

tępe końce. Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie. mogą być różne. Są to izoschizomery. 4-1). Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję: Niektóre enzymy. lepkich końcach. charakteryzujące się dwustronną symetrią (tzw. czego konsekwencją jest powstawanie fragmentów DNA o tzw. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej. Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6. rozpoznają te same sekwencje DNA. Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach. dając fragmenty mające tzw.Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum) przecinają rozpoznaną sekwencję w różnych miejscach: . Jednak miejsca. mimo że pochodzą z różnych szczepów bakterii. w których enzymy przecinają te sekwencje. rzadziej 8 nukleotydów. sekwencje palindromowe).

Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'... sekwencjonowania DNA.CCTAC(N)13. • powinny mieć jeden lub kilka silnych promotorów tak. Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą.. W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii). mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza. Wektor (np... klonowania molekularnego i rekombinacji genów czy fragmentów genomu.. aby wstawiając 72 . Niektóre enzymy potrzebują takich samych buforów.2. fagowy.. plazmidowy. Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA. a tylko nieliczne enzymy (np. • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców).CTTCT(N)7.. w której mieszanina DNA z enzymem jest inkubowana... Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora.. do sporządzania map genomowych. 4. izolacji i identyfikacji genów.GGATG(N)9'..5' podobnie enzym FokI (Flavobacterium okeanokoites): 5'. opisane pod względem fizycznym i genetycznym.3' 3'. do którego fragment ten został uprzednio włączony (rekombinacja molekularna).. oraz składem buforu.. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych. drożdżowy) jest zdolny do autonomicznej replikacji. wykorzystywanym m...5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA. którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji. HinPI) tną jednoniciowy DNA.GAAGA(N)8'. diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP).in. Wektory Wektory są podstawowym narzędziem klonowania DNA. Są one podstawowym narzędziem. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne.3' 3'.od rozpoznawanej sekwencji. • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki.

korę mogą stanowić zagrożenie ekologiczne. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd. „polilinker" (miejsce wielokrotnego klonowania). Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. np. • zawierają znaczniki (markery). Wektory fagowe Spośród wektorów fagowych największe znaczenie ma fag λ. • ze względów etycznych wektor nie powinien mieć genów. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych. którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. RODZAJE WEKTORÓW Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi). plazmidy i kosmidy.w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów. np. przedstawiony jest na rycinie 4-1. Wektory plazmidowe Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. gen oporności na antybiotyk. eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. Za pomocą modyfikacji molekularnych (np. Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori. umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. Kosmidy Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. za pomocą których można je ziden tyfikować. rozkładający barwny substrat. gen β-galaktozydazy oznaczony symbolem lacZ. który ma długość 2686 par zasad. Podobnie jak 73 . Przykładowy wektor plazmidowy pUC19. Najczęściej jest to gen kodujący enzym. Kosmidy służą do klonowania większych cząsteczek DNA. • nie są zdolne do przeżycia poza komórką gospodarza. Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie. i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych. długości 10-40 kpz. geny oporności na antybiotyki.

drożdżach. Sztuczny chromosom bakteryjny (BAC) Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang. W przypadku komórek zwierzęcych są to pochodne wirusów SV40. wadą natomiast organiczona długość wbudowanego obcego DNA.Ryć. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. coli. geny markerowe i silne promotory. Są one również stosowane w somatycznej terapii różnych schorzeń. Schemat wektora plazmidowego pUC19. Do klonowania fragmentów DNA w organizmach eukariotycznych (np. ale efektywność tego działania jest większa. jak 74 . Wektory drożdżowe Wektory te wykazują zdolność replikacji tak w komórkach drożdży. komórkach ssaków) stosowane są: Wektory — pochodne wirusów Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych. którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu. 4-1. Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz w przypadku wektorów plazmidowych. bakulowirusów. Najwcześniej był stosowany wirus SV40. Papilloma. krowianki. do wektorów fagowych wprowadzono polilinkery. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych. adenowirusów i retrowirusów.

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

np. Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. z zastosowaniem biotyny. amplifikując badany gen (odcinek DNA). gdy są one zhybrydyzowane z komplementarną matrycą. wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji. a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach. Te dwa etapy są powtarzane. Odwrotna transkrypcja-PCR. Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami). W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C). mutacja punktowa). Enzymem używanym do tej reakcji jest termostabilna ligaza. Reakcja ta stosowana jest do wykrywania mutacji punktowych. wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego.przerwa. Nie może być natomiast 81 . że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. RT-PCR (ang. Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje. reverse transcription-polymerase chain reaction). Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego. która łączy specyficznie dwa przyległe oligonukleotydy. co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych).

które ułatwiają ten 82 . Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. SSCP (ang. 4. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA. W tych przypadkach może być stosowana metoda RT-PCR. Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA. Jak wiadomo. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością. a następnie jego denaturacji i elektroforezie. Techniki hybrydyzacji i sondy molekularne Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe. że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA. to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany. bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej. które przyjmują określoną konformację przestrzenną. polegająca na tym. podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA). Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ. Polimorfizm konformacji jednoniciowych łańcuchów DNA. które jest oczywiście najbardziej precyzyjne. Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to. single stranded conformation polymorphism). np. iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją. jak również do wykrywania wirusów. Konformacja ta zależy od sekwencji nukleotydów. których materiałem genetycznym jest RNA.5. RNA: RNA i RNA: DNA istnieją wiązania wodorowe. Jeśli badany DNA pochodzi od nosiciela zmutowanego genu. Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod. między nićmi DNA:DNA. jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. RFLP lub sekwencjonowania.wykorzystana w badaniach ekspresji genów. w których określana jest ilość mRNA.

Sonda musi być odpowiednio wyznakowana. jednak niewielką rozdzielczością. Fragmenty te są następnie zatrzymywane na filtrze. Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P). Znakowanie izotopowe charakteryzuje się dużą czułością. lżejsze. czas półtrwania 14.3 dnia. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego). Izotop ten jest stosowany do znakowania DNA i RNA. dCTP i UTP a 32P. który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1. stosowana w hybrydyzacji kwasu rybonukleinowego. iż muszą być stosowane wkrótce po ich wyznakowaniu. Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej. Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy. Ogromną zaletą hybrydyzacji jest to. który jest nicią pojedynczą. wirusów lub organizmów wyższych). Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. nie wymaga etapu denaturacji. gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA. takich jak hybrydyzacja Southern blotting (DNA). Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. By była możliwa hybrydyzacja sondy z badanym DNA. który przenikając przez żel zabiera ze sobą fragmenty DNA. a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP.proces. czyli cięższe fragmenty) lub poliakryloamidowym (krótsze. Technika northern blotting. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. 83 .71 MeV — megawoltów). Znakowanie sond. Wadą sond znakowanych izotopem jest również to. by było możliwe wykrycie powstałej hybrydy. że można ją stosować nawet wówczas. do 500 par zasad). Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe. Zjawisko to stało się podstawą metod analizy kwasów nukleinowych. Sposób znakowania sond można podzielić na dwie główne grupy: 1. northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). klonowane sekwencje lub syntetyczne oligomery stosowane w PCR.

a detekcja sygnału jest poprzez autoradiografię (ryć. Na wydajność hybrydyzacji wpływają także inne czynniki. Przyjmuje się. Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). Hybrydyzacja na filtrach. Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np. biotyny. Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę.167 MeV). Podstawowym źródłem trytu jest trytowana tymidyna. okres półtrwania 87. emitujący promieniowanie β. jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg). które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0. 84 . w zależności od zastosowanego znacznika. której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji. • tryt (3H). Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny. w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą. gdy jest on unieruchomiony na filtrze. Hybrydyzację przeprowadza się z reguły w temperaturze 68°C. Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S. z wyjątkiem obecności sondy. że różnica ta powinna wynosić 20-25°C. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach. ale daje mniejszą czułość detekcji. Znakowanie nieizotopowe zapewnia dobrą rozdzielczość. Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. okres półtrwania 12. który emituje promieniowanie β (energia promieniowania E = 0. w której przebiega hybrydyzacja. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura. Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych. używany jest do znakowania kwasów nukleinowych. iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. tak powstają pochodne nukleotydów. Znakowanie sond można przeprowadzać za pomocą kilku różnych metod. 2. Zaletą tej metody jest to. głównie DNA.• izotop siarki (35S). stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+.26 roku. digoksygeniny). 4-6).1 dnia. Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego). Hybrydyzacja jest poprzedzona prehybrydyzacją. Hybrydyzację z wyizolowanym DNA można przeprowadzać.018 MeV). Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C). głównie DNA.

określana jako technika mikromacierzy DNA. fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). 85 . w diagnostyce chorób). Metoda ta nosi nazwę hybrydyzacji in situ (ISH). do wykrywania ściśle określonych fragmentów DNA (np. Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. również hybrydyzacja może być przeprowadzana na preparatach chromosomowych. l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja). Podobnie jak metoda PCR.in. pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. Hybrydyzacja w zminiaturyzowanej postaci. W metodzie zwanej „odcisk palca" DNA (ang.Wykorzystanie metody hybrydyzacji. Na niewielkiej płytce (ok. Jej różne warianty są opisane w rozdziale: Mapy genomowe. Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana. Metoda hybrydyzacji służy m.

Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'.4. Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll): GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA: GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze. Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału....5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu. Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus.ATAGCTT ..ATCCAGTCCTCGCCTGATTTCGAA.3' 3'.AGGCTAT 86 . Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym.6.A-. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) Polimorfizm fragmentów restrykcyjnych DNA (ang. Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu...TTCGA. Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP). natomiast dalej będą prążki o zmniejszającej się masie. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego. Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych.. tym szybciej. czyli lżejsze.

quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest. Proces ten jest opisany w części dotyczącej klonowania DNA. wśród nich są geny determinujące cechy jakościowe. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka. metoda rekombinacji molekularnej. Tworzenie biblioteki genomowej Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym. sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). wprowadzonych za pomocą wektorów do bakterii. W zależności od wielkości fragmentów DNA używane są różne wektory. jak kosmidy. Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe). Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów. natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory. Tworzenie biblioteki genowej (cDNA) Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. omówiona wcześniej. Tak otrzymany cDNA zawiera tylko sekwencje kodujące. czyli eksony. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA.7. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe. Geny o dużym efekcie. a także ilościowe (ang. Jest on amplifikowany 87 . Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA. Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii. 11 pz i 7 pz. Materiałem wyjściowym w tym przypadku jest RNA. Biblioteki genomowe i genowe Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. Interseksualizm. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. 4.Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz. Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe. których budowa molekularna jest znana.

Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem. Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. W ten sposób każdy klon bakterii ma cały określony gen. mieszaninę deoksynukleotydów. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. chromosome walking).8. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. ddCTP. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda. Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. Metoda enzymatyczna została opracowana w 1977 roku przez F. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań. Każda z czterech probówek zawiera matrycowy DNA. ddGTP lub ddTTP (ryć.metodą PCR. gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen. Rolą tych dideoksynukleotydów (tzw. a następnie rekombinowany z wektorem i wprowadzany do bakterii. przeprowadzane są cztery oddzielne reakcje syntezy DNA. która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący. 4. wykorzystuje się bibliotekę genomową. Sangera. Sekwencjonowanie DNA Sekwencjonowanie DNA. Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej. jest stosowane dość często w genetyce molekularnej. polegające na określeniu sekwencji nukleotydów. starter. W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen. 4-7). o którym niewiele wiadomo. której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. Biblioteka genomowa jest również przydatna w poszukiwaniu genu. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą). nieznany jeszcze fragment. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej). Postępujemy tak do momentu. czyli reakcji antygen-przeciwciało. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki. bufor reakcyjny. przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy. polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP. terminatorów) jest zakończenie syntezy nici 88 .

zależnie od użytego w reakcji dideoksynukleotydu. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki.6 mm).autoradiogram żelu sekwencyjnego Ryć. W celu detekcji prążków DNA. ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany. Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm. 25 supl. 1998) komplementarnej w miejscu włączenia określonego dideoksynukleotydu.2-0. by tylko część syntetyzowanych fragmentów DNA uległa terminacji. kończące się odpowiednim nukleozydem. grubości 0.. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera. 4-7. w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89 . W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości. Postępy Biologii Komórki. metodą autoradiografii. kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp. 10 :219-237.

w czterech oddzielnych probówkach. opracowana w 1977 roku przez Maxama i Gilberta.. 4-8. Metoda chemiczna.kleotydy lub wyznakowany starter. ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów. która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. Do mieszaniny reakcyjnej dodawana jest także piperydyna. Postępy Biologii Komórki. 4-8): autoradiogramżelusekwencyjnego Ryć. które mają zdolność modyfikacji zasad w cząsteczce DNA. że jest szybka. Do rozszczepiania wykorzystywane są hydrazyna. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. 25 supl. 10 :219-237. podobnie jak przy metodzie enzymatycznej. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. Sekwencjonowanie metodą chemiczną przeprowadza się. kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp. siarczan dimetylu (DMS) i kwas mrówkowy. Enzymatyczna metoda sekwencjonowania ma tę zaletę. 1998) 90 . polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów.

przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny. ale są inne pod względem biochemicznym. Zwierzęta transgeniczne to takie.9. Podobne 91 .W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca. northern blotting.10. jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym. Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA. Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80. pyroseąuencing. Transgeneza Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. Najnowsza metoda sekwencjonowania. Samce transgeniczne przekazywały swojemu potomstwu obcy gen. 4. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego. tzw. hybrydyzacja in situ na skrawkach tkanek. do zygoty myszy szczurzego genu hormonu wzrostu. Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika. zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba). Jedna z wymienionych metod. znacznie różni się od powyższych metod. Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA. których długość zależy od miejsca rozszczepienia łańcucha DNA. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji. Następnym etapem. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane. RT-PCR) i translacji (western blotting). Różnią się one od innych komórek ekspresją pewnych genów. 4. podobnie jak w metodzie enzymatycznej. natomiast samice były niepłodne. autoradiografia i odczytanie sekwencji nukleotydów. Badanie ekspresji genów Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek. które morfologicznie nie różnią się od sąsiednich. nieaktywnych w komórkach zdrowych. pozwala także na wyróżnienie grup komórek. kilka firm oferuje specjalistyczną aparaturę.

Jak dotychczas opisana technika jest stosowana z sukcesem u myszy.rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu. najczęściej męskiego. np. zapłodnionej komórki jajowej. Na razie nie mamy żadnego wpływu na to. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne. które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu. ogranicza jej stosowanie. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich. 92 . nawet niekorzystne. Wykorzystanie techniki transgenezy 1. w gruczole mlecznym). które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego. Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC. Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa. który może być wprowadzony tą metodą. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza. umożliwiającej ukierunkowaną ekspresję transgenu (np. Wielkość fragmentu DNA. które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro. • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. growth hormone — GH). blastocyst pozbawionych węzła zarodkowe go). Należy jednak zauważyć. w którym miejscu genomu włączy się transgen. że w procesie transgenezy wprowadzane są konstrukty genowe. gen struktury hormonu wzrostu (ang. embryonic steam cells). Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost. • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. około 8 kpz.

na przykład poprawy jakości i tempa wzrostu wełny. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie. Odporność na choroby można uzyskać przez wprowadzenie do komórek 93 . poprzez wprowadzenie do genomu owiec genów białek keratynowych.• modyfikacji składu mleka. W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy. • modyfikacji cech biochemicznych u zwierząt. duże nadzieje wiąże się z poprawą jakości białek mleka.

świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. ksenotransplantów) dla ludzi. których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. wykazujące karłowatość. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych. Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym. Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. . Zaletą tej metody jest to. krowy wytwarzające mleko z ludzką laktoferyną. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc). Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny. Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu. świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię). których celem jest ocena jego wpływu na wzrost. najlepiej dominujące. kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii. które wykazują nadekspresję określonych genów. z powodu nadostrej reakcji układu immunologicznego biorcy. iż samice transgeniczne wytwarzają mleko zawierające obce białko. W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek. prowadzącej do odrzucenia przeszczepionego narządu. metabolizm węglowodanów i lipidów. Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych. 2. laktację. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. 3.zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw.

Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. przez następne pokolenia. takich jak replikacja DNA czy podział jądra komórkowego. Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji. Wreszcie mutacje genowe dotyczą zmian w budowie genu. gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. które były korzystne lub obojętne dla organizmu. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji. nazywane też aberracjami chromosomowymi. za pośrednictwem komórek płciowych. związane są z naruszeniem budowy chromosomu. obserwowanymi wśród organizmów żywych. Mutacje mogą powstawać samoistnie. przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji. niektóre związki chemiczne).Rozdział Mutacje Mutacje to nagłe i trwałe zmiany w informacji genetycznej. Dzieli się je na: genomowe. Mutacje chromosomowe. a poznanie ich podłoża wymaga zastosowania metod molekularnych. jako wynik błędów w przebiegu niektórych procesów komórkowych. powstałych de novo. cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych 95 . promieniowanie jonizujące. chromosomowe i genowe. a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu. a ponadto. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas. a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi. dlatego większość z nich jest niekorzystna dla organizmów. Należałoby zatem rozróżnić proces przenoszenia mutacji. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy. które uszkadzają DNA lub strukturę chromosomu (np. czyli takich.

Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej.pokoleń. Dlatego można bez większych zastrzeżeń przyjąć. wśród których do najważniejszych zalicza się (ryć. a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny). co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). monoploidia). choroby genetyczne) znanych jest wiele przykładów pokazujących. to stan ten określa się jako poliploidalność. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik. Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego. Mutacje genomowe Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie. 5-1): 1. Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. Na przykład. 5. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów.1. zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia. Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II. że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. wysoka plenność u niektórych ras owiec (np. 96 . prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych. W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji. która odbywa się już po wniknięciu plemnika do oocytu. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. które wpływają korzystnie na cechy produkcyjne zwierząt. Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości. a oocyt II rzędu ma diploidalną liczbę chromosomów. 2. Zdarzenia takie określa się mianem połispermii. głównie żeńskiej. Znane są i inne mutacje. pojawiające się od czasu do czasu na fermach zwierząt futerkowych. z jakimi spotykamy się w hodowli zwierząt gospodarskich. mutacja w genie BMPR-IB) itp. ponieważ obok mutacji szkodliwych (np. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista. Jeżeli powstają układy o większej liczbie genomów niż dwa. Zaburzenie przebiegu mejozy.

Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo). zazwyczaj we wczesnym okresie rozwoju zarodkowego. W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego. Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza). gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. 2n i 4n czy 2n i 3n itd. to znaczy takiego. Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym. które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego.Ryć. Mutacje te są jedną z przyczyn niepowodzeń 97 . np. czego skutkiem jest rozwój haploidalnego zarodka. Ponieważ komórki te wywodzą się z jednej zygoty. Niektóre mechanizmy powstawania mutacji genomowych typu euploidii 3. takich na przykład jak brak cytokinezy po podziale jądra komórkowego. tetraploidalne oogonium. 4. układ taki klasyfikowany jest jako mozaicyzm. np. że prowadzą one do śmierci osobnika. co oznacza. 5-1. Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności. Euploidie są mutacjami letalnymi.

Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela. 5-2a). Wskazuje to. Zdecydowana większość aneuploidii jest letalna. którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. a nadmiar chromosomów to trisomia (2n +1). Nieprawidłowa segregacja w jednym biwalencie. jaka jest skala tego problemu. Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. Jeżeli gamety takie będą uczestniczyły w zapłodnieniu. jednak powodują powstanie licznych wad rozwojowych. zarodka) prowadzi do mozaicyzmu. gdy oba chromosomy zmierzają do jednego bieguna komórki. że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych. Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika. Trudno jednak określić. Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. Równocześnie wynika z tego. Wyjątek stanowią aneuploidie chromosomów płci. prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1. to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. Zazwyczaj mutacje te stwierdzano w układzie mozaikowym. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki. W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. Tak więc brak chromosomu nazywa się monosomią (2n — 1). że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). Klacz obarczona tą mutacją ma kariotyp 98 . Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. Jeśli natomiast występuje brak obu chromosomów w parze. Aneuploidia to druga kategoria mutacji genomowych. to stan taki określany jest jako nullisomia (2n —2). Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów.w rozrodzie zwierząt. to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci.

XY/61. Znane są również przypadki trisomii XXY u buhajów. Zwierzęta takie mają zasadniczo normalny eksterier.X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63.XXY. 99 . zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników. W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy.2n = 63. dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego. Osobniki takie mają diploidalną liczbę chromosomów 61.XX.XO/64.XXY lub występuje u nich układ mozaikowy 60.

5. a zatem i szerokiego rozprzestrzenienia w populacji. translokacja wzajemna). Mogą powstać także inne nietypowe struktury. to zazwyczaj mają pochodzenie de novo. Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna. Mutacje chromosomowe Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). to nastąpi utrata fragmentu chromosomu (delecja). Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu. podczas podziału komórkowego. takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy. Jest to skutek segregacji chromosomów w anafazie I. 5-2b). jest niemożliwe. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika.Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością. wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych. Dzięki temu. że osobniki mające w swoim kariotypie trzy chromosomy X są płodne.2. Przedstawione wyżej prawidłowości wskazują. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni. co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. Niemniej jednak. Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu. poza nielicznymi wyjątkami. ze względu na dość częste występowanie u klaczy monosomii chromosomu X. a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu. Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd 100 . bez zastosowania metod cytogenetycznych. W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. Jeżeli pęknięcie nie zostanie naprawione. przez odpowiedzialne za to systemy naprawy komórkowej. której zdiagnozowanie. nie ma ryzyka przeniesienia tej mutacji na następne pokolenia. tandem fuzja. W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza. gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela. że aneuploidie ilekroć się pojawiają. Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć. z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią. albo głębokie zaburzenia rozwojowe lub bezpłodność.

izochromosomy). duplikacje. że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. gdy występuje ona w komórkach linii płciowej. mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych. ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. Znane są liczne przykłady u ludzi. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych. translokacje wzajemne. bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np. Inne — tzn. wśród których wyróżniane są inwersje peri. Przypadki takie. czego skutkiem jest uruchomienie procesu nowotworowego. nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych. Z kolei mutacje zrównoważone. odnotowywane jako martwe urodzenie. Szczególna 101 . podobnie jak aneuploidie. fuzje tandemowe. inaczej centromerowe (translokacje robertsonowskie). tandem fuzje. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas. że mutacje chromosomowe niezrównoważone. Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje. Zdarzyć się może.i paracentryczne. padnięcie po urodzeniu lub ubój z konieczności. mają najczęściej negatywny wpływ na płodność nosiciela mutacji. których skutkiem jest przegrupowanie informacji genetycznej w kariotypie. bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć. prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. są letalne lub prowadzą do poważnych. Jeżeli dotknie to osobnika o dużej wartości genetycznej. gdy ilość informacji genetycznej w komórce została zmieniona. występując pierwotnie w układzie zrównoważonym. które w momencie powstania mają charakter zrównoważony. a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. translokacje wzajemne i inwersje. jak i ze strukturą samego genu. a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów. jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej. że zdecydowana większość tych przypadków nie jest identyfikowana. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. lub też w układzie niezrównoważonym. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor. inwersje. to szansa na wykrycie nosicielstwa mutacji jest znacznie większa. zauważalnych zmian fenotypowych. prowadzą do zmiany sąsiedztwa genów. Mutacje chromosomowe. buhaje). Zaliczane są do nich: fuzje centryczne. fuzje centryczne. Wynika to przede wszystkim z tego. wzmacniacz.niesiostrzanych podczas crossing over. Mutacja chromosomowa może wystąpić w układzie zrównoważonym. wyciszacz).

Fuzja centryczna (translokacja robertsonowska) powstaje wówczas. 102 . gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru. 5-3a.uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji. a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć.

nie odbija się negatywnie na nosicielu. Ryć. kozioł.5-4a). reprezentujące prawie cale ramiona długie chromosomów. natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy). kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym. Utrata małych fragmentów z okolicy centromeru. 5-4. (b) rob(5. chromosom translokacyjny oraz chromosomy pici są wskazane. barwienie roztworem Giemsy. Duże fragmenty.7). buhaj. triwalent oraz biwalent X-Y są wskazane 103 . zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom. który zawiera przede wszystkim niekodujące sekwencje powtarzalne.29). Translokacje robertsonowskie: (a) rob(l.

W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety. że połowa gamet będzie typu n —l (układ powstający na biegunie. czyli ukształtuje się układ aneuploidalny. a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych. W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent. W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji. Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. Fuzje centryczne są często identyfikowane u bydła. natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom. W efekcie powstają gamety o zrównoważonej informacji genetycznej. a oba chromosomy akrocentryczne do drugiego bieguna komórki. podczas gdy na drugim biegunie zabraknie jednego chromosomu. podczas której chromosom dwuramienny przechodzi do jednego bieguna. w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. jak poprzez badanie cytogenetyczne. 104 . 5-3b. blonde d'Aquitaine itp. w których uczestniczyły chromosomy z różnych par. na wszystkich kontynentach. a druga będzie miała n chromosomów. że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób. Jeżeli komórka taka rozpocznie podział mejotyczny. do którego nie przeszedł chromosom dwuramienny). Należy zaznaczyć. że jej nosiciele mają zmniejszoną płodność o około 5%. Jeżeli fuzji uległy chromosomy homologiczne. gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. Prowadzi to oczywiście do tego. szczególnie ras mięsnych. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła.Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden. to w pachytenie profazy I uformuje się triwalent. które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego. Pięć lat później ten sam badacz wykazał.). W przypadku zapłodnienia powstają zygoty aneuploidalne. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard. ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. Zupełnie inaczej przedstawia się sytuacja. mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. 5-4a). z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych. 5-4b). Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych. a w tym również w Polsce. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. Opisano wiele różnych fuzji. z tym jednak że wśród nich będzie chromosom dwuramienny. co w rzeczywistości odpowiada układowi n + 1.

Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. którą opisano w Polsce. Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. Przykładem może być fuzja między chromosomami z pary 5 i 22. przed ich wprowadzeniem do stacji produkcji nasienia. obowiązkowymi badaniami objęte są wszystkie młode buhaje. u którego fuzja centryczna występuje bardzo często. włoskie bydło rasy podolian czy bydło korsykańskie). a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. W Polsce.a niekiedy także w małych izolowanych rasach lokalnych (np.29 zdiagnozowano wiele innych przypadków. Szwecja była pierwszym krajem. jest lis polarny. białe bydło rrytyjskie. że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49. nr 23 i 24). począwszy od 1989 roku. 5-5. Gatunkiem. jedynych w kariotypie lisa. w których zaangażowane były chromosomy z innych par. W tym przypadku można wręcz mówić o polimorfizmie kariotypowym. Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. Ryć. natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48. Ciekawe. dwóch par akrocentryków. Oprócz fuzji 1. który wprowadził taką regulację. bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona. Chromosomy biorące udział w fuzji przedstawiono schematycznie 105 .

W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji. także translokacją wzajemna jest mutacją dziedziczną. jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. a do drugiego przechodzą chromosomy. że suma informacji genetycznej zawarta w dwóch chromosomach.Należy podkreślić. Segregacja symetryczna (2:2) nie gwarantuje jeszcze. Jest to segregacja naprzeciwległa. Pokazuje to jedno cześnie. że powstaną gamety o zrównoważonej informacji genetycznej. który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2. Przedstawione obserwacje wskazują. a nie częstego powstawania de novo. że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło. szczególnie wówczas. 5-7). Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych. Należy zaznaczyć. Dwa pozostałe rodzaje segregacji. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów. w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par. że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela. Podobnie jak w przypadku fuzji centrycznej. 5-5). prowadzą do uformowania niezrównoważonej (delecje. jeśli oczywiście wystąpi w linii komórek płciowych. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over. które będą obarczone bądź delecją. tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60. które podlegały translokacji. bądź duplikacją. lisy polarne. Skutek takiej translokacji będzie zazwyczaj letalny. gdy rozród jest oparty na sztucznej inseminacji. tzn. określane jako sąsiednie. 0 2n = 58 (ryć. 5-8). pochodzących z dwóch różnych chromosomów. 5-6b. duplikacje) ilości informacji genetycznej w gametach. 5-6a. Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć. Przyjmuje się. że około 50% gamet wytwarzanych przez 106 . Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej. 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję. a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia. to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. to podczas mejozy dojdzie do powstania gamet. które uczestniczyły w trans lokacji. jest taka sama jak w dwóch nie zmienionych chromosomach.

to doprowadzą do powstania zygot. (b) segregacja tetrawalentu podczas mejozy nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu. Hodowca odnotuje 107 . 5-6.*Schemat nie uwzględnia segregacji tetrawalentu. które będą ginęły zazwyczaj w życiu płodowym. w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany Ryć. Translokacja wzajemna: (a) schemat powstawania.

.

a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego. która prowadzi do bezpłodności samców nosicieli. Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu. w którym wystąpią dwa translokowane chromosomy. Knury nosiciele mają prawidłowe libido. po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie). 5-7). Podobnie normalny fenotyp mają lochy nosicielki. a połowa będzie nosicielami translokacji. Fuzja tandemowa jest mutacją podobną do fuzji centrycznej. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. podobnie jak w przypadku fuzji centrycznej. morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie. ale wśród nich połowa będzie miała układ. Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych. Stan taki towarzyszy nosicielstwu translokacji wzajemnej. a obraz nasienia (koncentracja. które były rozprzestrzenione w populacjach w różnym stopniu. w którym polowa będzie miała prawidłowy kariotyp. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo. Przypuszcza się. Oczywiście stan taki może być spowodowany różnymi czynnikami. podobnie jak w przypadku translokacji typu autosom-autosom. W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim. Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia. Do tej pory zidentyfikowano na świecie.lub dwuramiennym. że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. U samic nosicielek stwierdza się jedynie zmniejszenie płodności. w którą zaangażowany jest chromosom X (translokacja typu X-autosom). że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy.wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika. w rozmaitych rasach. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109 . Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). ponad 90 różnych translokacji wzajemnych. a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione. Trzeba podkreślić. Jedno z nich występuje w części końcowej ramienia w chromosomie jedno.

oraz 3) pełna koniugacja. w którym wystąpiły dwa pęknięcia. tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii. jest pierwszy sposób koniugowania. że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%. 2) chromosomy częściowo pozostają nieskoniugowane — w części. Najmniej korzystny. to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu. Mutacja ta jest dziedziczona przez połowę potomków nosiciela. może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków. a następnie zostały one niewłaściwie naprawione w taki sposób. Przebieg koniugacji podczas pachytenu profazy I. która częściowo jest niehomologiczna. gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. Jeżeli w obrębie odwróconego fragmentu występuje centromer. Jeżeli w obrębie pętli zajdzie crossing over. że fragment pomiędzy punktami pęknięć został odwrócony o 180°. to nieprawidłowość jest określana jako inwersja paracentryczna. tzn. podobnie jak przy fuzji centrycznej. analogicznie do schematu przedstawionego dla translokacji robertsonowskich. Oceniano wówczas. z wyjątkiem sytuacji. Znane są nieliczne przypadki tej mutacji u bydła. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna. to podczas mejozy. chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70. które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej.chromosomami akrocentrycznymi. gdzie na jednym z chromosomów występuje odwrócony fragment. może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną. podczas którego dochodzi do uformowania pętli inwersyjnej. to wówczas powstaną gamety obarczone delecją lub duplikacją. Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji. Uwaga ta dotyczy 110 . z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). dojdzie do powstania aneuploidalnych gamet. z punktu widzenia skutków gametogenezy. w obrębie fragmentu objętego inwersją na jednym z chromosomów. to wówczas inwersja jest określana jako pericentryczna. Jeżeli odwrócony fragment nie obejmuje centromeru. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu. było dość duże. spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. Inwersje dość rzadko opisywano u zwierząt gospodarskich.

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

Błąd włączania polega na tym.i protonów w cząsteczce zasady. zespół kruchego chromosomu X. między innymi chorobę Huntingtona. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę. Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. Mutacje genowe mogą być także następstwem zakłóceń w splicingu. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. Błąd replikacji zachodzi wówczas. gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. zlokalizowanego w chromosomie 4. przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. z których 10 powoduje choroby genetyczne. Dotychczas wykryto je u ludzi w 12 loci. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi. czyli tzw. Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej. Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH). w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. tym wcześniej rejestrowany jest początek objawów chorobowych. Z kolei. a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. dystrofię miotoniczną. natomiast w formie enolowej łączy się trzema mostkami z cytozyną. Z kolei. gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina. Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka. w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony). Mutacje te związane są z tzw. Skutkiem tego będzie pojawienie się pary G-C w miejscu. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form. zaś ketonowej na enolową (=C—OH). że enołowa forma tyminy łączy się z guanina. niestabilnymi sekwencjami DNA. nazwanej dojrzewaniem. a w formie tautomerycznej z tyminą. W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym. Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne. guanina w normalnej formie (ketonowej) łączy się z cytozyną. U ludzi zdrowych liczba powtórzeń wynosi 10-36. iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. Im większy stopień zwielokrotnienia danej sekwencji. Inną 117 . Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA). prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). obróbce mRNA.

ani kodowanego przez ten gen białka. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym. Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji: 118 . Przypuszcza się. Skutki mutacji genowych Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. mającym szczególne znaczenie dla molekularnej analizy DNA. iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np. Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym. iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA. jak i intronu. Natomiast jeśli ojciec przekazuje zmutowany allel. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. 5. Jednym ze skutków mutacji genowych. trypletów). Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi. różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4.4.cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw. Jeśli allel zmutowany pochodzi od matki. Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. różnica w długości sekwencji może dochodzić do 50%. Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu. Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu. piętno gametyczne. Są one wykorzystywane w analizie polimorfizmu DNA. dlatego nazywane są cichymi podstawieniami (ang. Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony. identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. Taka sytuacja jest możliwa.2. gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów. Należy podkreślić. polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie. substitution at silent site). jest polimorfizm fragmentów restrykcyjnych — RFLP (ang. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. restriction fragment length polymorphism). gdyż kodon AAC również koduje asparaginę.

Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. mleka. której następstwem jest śmierć przed ukończeniem 1. Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G. w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi. Jak już wcześniej wspomniano.. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła. Mutacje typu nonsens (mutacja stop) . Na przykład. nasienia i jaj zawiera rozdział: Markery genetyczne. roku życia osobników homozygotycznych pod względem zmutowanego genu. 5-10. Mutacje typu zmiany sensu . Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła 119 . przejawiająca się zmniejszeniem odporności cieląt. Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. warunkujący czarne umaszczenie. odnoszącym się do polimorficznych białek. jest locus β-laktoglobuliny (białko mleka). mutacje genowe nie zawsze mają niekorzystny skutek. Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+.1. Mutacja ta jest przedstawiona na rycinie 5-10. w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy. skutki tego mogą być dla organizmu letalne.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka. jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) - Ryć. 2. Innym przykładem mutacji typu zmiany sensu. bovine leukocyte adhesion deficiency). oraz T→C (zapis dla DNA.

Podobnie jak mutacje typu zmiany sensu. deficiency uridine monophosphate synthase). powstaje krótszy N-końcowy fragment tego polipeptydu. ochrę (UAA) lub opal (UGA). Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej. Schemat tej mutacji przedstawiono na rycinie 5-10. czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka. Jest ono przyczyną zamierania zarodków. Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem. w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu. występuje u bydła. lecz stanowią sygnał zakończenia translacji. iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl. w procesie translacji przyłączane są inne aminokwasy. powstaje nieaktywny peptyd złożony z 85 aminokwasów. Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna . Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. Cytrulinemia występuje również u ludzi. Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu.cytrulinemia. Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen. ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. Począwszy od kodonu 104 (GGT) dla glicyny. a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy. następnie roz120 . a w konsekwencji zmniejszenia płodności krów. wykorzystujący to.amber (UAG). również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu. Jest to schorzenie nazwane DUMPS (ang. W jej konsekwencji. kodujący u zwierząt homozygotycznych ee umaszczenie czerwone. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. natomiast allel dominujący ma takie miejsce. zamiast aktywnego enzymu składającego się z 412 aminokwasów. 3. przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. We wspomnianym już locus E u bydła allel recesywny e. występująca u bydła rasy holsztyńsko-fryzyjskiej. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. które nie kodują aminokwasów. Bydło holsztyńskie ma umaszczenie z reguły czarno-białe. Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady.

zwanego CFTR (ang. a nawet śmiertelnych chorób genetycznych. a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów). pełniącego funkcję kanału chlorkowego. Mutacje te mogą prowadzić do poważnych zaburzeń. zamianę fazy odczytu. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. prowadzącej do przedwczesnej śmierci. wynosi l: 2500 osób. jeśli trójka nukleotydów zostanie wstawiona między kodony. Dotyczy to przede wszystkim trzustki. oznaczona symbolem ΔF508 (ryć. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. 4. możliwe jest także pojawienie się kodonu „stop". 5-11). jeśli trójka „rozerwie" istniejący dotychczas kodon. Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym. przy czym najczęściej jest stwierdzana mutacja w eksonie 10. polegająca na zakłóceniu transportu jonów chlorkowych. Insercja trójki może spowodować: dodanie aminokwasu – w białku. Mutacja ta prowadzi 121 . Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego.dzielany elektrofor etycznie. cystic fibrosis transmembrane conductance regulator). płuc i oskrzeli. dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. Częstość występowania tej wady. W obrębie tego genu wykryto wiele mutacji. utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego.

Zwielokrotnienie powtarzającej się sekwencji CAG. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe. i glicyna — 509 póz. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. Mutacje zachodzące podczas obróbki potranskrypcyjnej. na przykład białko determinowane przez locus Albino (C). W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka. przekształcającego fenyloalaninę w tyrozynę. Gen C warunkuje wytwarzanie enzymu tyrozynazy. złożonej z takiej liczby glutamin. czego konsekwencją jest synteza zmienionego białka. powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny. Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. 5. na przykład wielopalczastość. o czym pisano już wcześniej. na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej. a następnie sekwencja GGT dla glicyny. skrócenie kręgosłupa u bydła i psów. Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. zwanej składaniem (ang.3 eksony kodujące 37 aminokwasów. Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. blok metaboliczny). 5-13). jaka jest zakodowana w sekwencji (CAG)n. powoduje powstanie domeny glutaminowej. kodującej aminokwas glutaminę. W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów.do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego. Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA. Częstość tych mutacji wynosi 10-40%. natomiast w allelu F . Często są to zaburzenia przebiegu szlaku metabolicznego (tzw. oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. 5-12 wkładka kolorowa). a także umaszczenie zwierząt i inne. łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny). Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika. 122 . ale może być również rozpoznawalny w okresie późniejszym. w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA.

a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie. brwi i rzęsy.B. przekształ cającego 3. chrząstkach i skórze wywołując stany zapalne.. np. osobniki albinotyczne mają bardzo jasną skórę. jest gen hormonu wzrostu — somatotropiny (ang. prze kształcającego ten kwas w kwas maleiloacetooctowy. biorącego udział w przemianie tego kwasu w kwas homogentyzynowy. a jego nadmiar jest wydalany z moczem. Tyrozynoza -. powodujący różny stopień nasilenia niedorozwoju umysłowego. growth hormone — GH).niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego. E.brak oksydazy kwasu homogentyzynowego. 123 . Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę).4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę. Jednym z genów. którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich. nie powodujący wyraźnie złych skutków dla organizmu. tęczówka oka nie jest zabarwiona. białe włosy. Albinizm. kwas homogen tyzynowy jest odkładany w stawach. czyli bielactwo .3. powodując jego ciemnienie na powietrzu. Mutacje genowe wpływające na cechy produkcyjne zwierząt Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. Alkaptonuria -.4. C. D. Albinizm występuje także u zwierząt. cukrów czy lipidów. Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków.brak enzymu tyrozynazy. 5.

Inne mutacje to: gen FecJ u owiec jawajskich. Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw.6 jagnięcia. U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang. Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie). Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1. Spośród wykrytych dotychczas mutacji. O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych.15 prosięcia u świń bardzo plennej rasy meishan i 0. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. Mutacje genowe wywołujące choroby genetyczne Mutacje genowe często prowadzą do powstania chorób genetycznych. 5. Zależnie od stopnia penetracji tych genów można je podzielić na: 124 . np. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych. największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie.1. gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji.42 prosięcia u wielkiej białej. które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu. kwaśne mięso (RN). że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych. semiletalne i subwitalne Wpływ szkodliwego działania zmutowanych genów jest różny. U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA. estrogen receptor gene — ESR) a wielkością miotu. 5. Stąd poznanie podłoża wielu chorób genetycznych.4.4. metabolicznych.Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. psychicznych itp.4. a szczególnie wrodzonych wad rozwojowych. endokrynologicznych. Geny letalne. Należy jednak pamiętać. sprawia dużo trudności. U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową. wykryty u owiec rasy romney. odpornościowych. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2).4. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0.

5-14 wkładka kolorowa). warunkującego srebrzystą barwę włosa. w których genotypach wystąpią w dawce aktywnej (np. natomiast u osobników heterozygotycznych nie są letalne. U kur gen achondroplazji (Cp) w układzie hetero- 125 . Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego. powodujące w aktywnej dawce śmierć od 50 do 90% osobników. w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). Innym genem. również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. warunkujący umaszczenie tzw. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w. nie ograniczając na ogół przeżywalności czy sprawności życiowej. w stosunku l platynowy: l srebrzysty (ryć. może być różny. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia. które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. w którego genotypie wystąpią. • geny subwitalne. WW) działają letalnie. w okresie pourodzeniowym lub u dorosłych osobników. Również okres w życiu osobnika. • geny semiletalne. powodują śmierć osobnika. ale dają zauważalny efekt fenotypowy. Przykładem jest gen platynowego ubarwienia u lisów. ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. powodując śmierć nie tylko homo-. homozygota recesywna). białopyskie. będącym również wynikiem mutacji genu ω. Oba zmutowane geny w układzie homozygotycznym (WpWp. jest gen W. uzyskamy wówczas lisy zdolne do życia. inne zaś później. z nie wyjaśnionych dotąd przyczyn. w którym dany gen przejawia działanie letalne. Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry. Niektóre z nich. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce. Geny te działają letalnie w układzie homozygotycznym. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych. który jest letalny w podwójnej dawce. powodujące śmierć ponad 90% osobników. gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym.• geny letalne. powodujących poważne zakłócenia procesu trawienia.

Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami. Zakres działania tych genów jest różny. U samców gen ten jest letalny. Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie. Geny semiletalne często jest trudno odróżnić od genów letalnych. natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną. jak też od interakcji ze środowiskiem. od niewielkich zmian (np. natomiast u homozygotycznych — bardzo wyraźne. Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych. bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się W przypadku gdy matka jest heterozygotą. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji. Zmienność tej cechy u krów jest duża. iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców.zygotycznym (Cpcp) warunkuje krótkonożność. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. w potomstwie występuje stosunek samców do samic l: 2. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt. jak achondroplazja recesywna. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. 126 . warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują. gdyż ich działanie zależy między innymi od czynników środowiskowych. co obrazuje schemat: jedynie samice. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń. Cecha ta występuje tylko u samic. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31. Niektóre geny letalne mogą także powodować śmierć matki. U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne. Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec.

5. Wady takie.Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych. powstające w okresie płodowym. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych. Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu. epilepsja u bydła). nauka zajmująca się zaburzeniami rozwojowymi. wady te nie dziedziczą się. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne.2. bloki metaboliczne. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego. Przykład takiego bloku podano już wcześniej. ich rodzajów. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne. następny podrozdział dotyczy wad wrodzonych. Choroby monogenowe wywołujące wrodzone wady rozwojowe Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała. wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała. Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. obarczone nimi zwierzęta nazywane są potworkami. Niektóre z tych genów są przyczyną zaburzeń metabolicznych. przypominające mutanty. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika. a powstałe pod wpływem czynników środowiskowych. Teratologia. 2) wady — są to pewne zaburzenia w prawidłowej budowie. powodując niepłodność czy utrudniając akt kopulacji. a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe. noszą nazwę fenokopii. sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich. chromosomowych lub genomowych. Zdarza się jednak. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. mimo że są pochodzenia pozagenetycznego. inne ujawniają się w późniejszym okresie życia (np. powodując tzw.4. że niektóre anomalie. 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód. 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia.4. Można to uczynić biorąc pod uwagę: 127 . do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi.

Badania genetyczne wykazały. 5-15 wkładka kolorowa). Gen karłowatości u osobnika heterozygotycznego. powodując tylko nieznaczne skrócenie kończyn. u którego występuje recesywna karłowatość chondrodysplastyczna (ang. W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację. 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich. czyli zahamowanie rozwoju układu kostnego. 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika. wpływa pośrednio na zwięzłość budowy. bulldog disease). Do mutacji wpływających na cały kościec należy karłowatość. którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany). chondrodysplastic dwarfism). u herefordów). stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej. Nosicielstwo allelu achondroplazji. OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH Wady układu kostnego Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja. charakteryzującego się wybitną wartością hodowlaną. skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy. creeper — pełzacz). Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy. że płody dotknięte tą wadą. Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. 128 . japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN). Jest to prosta cecha recesywna. przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. U bydła wada ta występuje u ras mięsnych (np. polegającą na insercji 4 nukleotydów w genie.1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie. U japońskiego bydła mięsnego. dała początek nowej rasie bydła — dexter). ulegają poronieniu zwykle przed ósmym miesiącem (ryć. homozygotyczne pod względem genu niezupełnie dominującego. kodowany przez ten gen. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka. Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. cechująca się skróceniem kończyn. Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii. jak i dalszych. Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. skrócenie lub brak żuchwy. Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. Mutacja ta powoduje powstanie kodonu terminacyjnego. oznaczonego symbolem bd (ang.

że jest to cecha letalna dla jednej płci. Anomalia ta uwarunkowana jest genem recesywnym. Anomalią układu kostnego. Wadzie tej często towarzyszą: skrócenie żuchwy. obserwowana głównie u bydła. któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. która zależnie od gatunku. fibroblast growth factor receptor 3 -. świń. Genetycznym podłożem tej wady jest autosomalny gen recesywny. jest autosomalna recesywna cecha skrócenie kręgosłupa. której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. Szczenięta obarczone tą wadą cechuje mniejsza żywotność. spider syndrome). Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość. Ogólne zesztywnienie stawów notowane jest u bydła. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego. amputacji kończyn. polega na niezrośnięciu się kości czaszki. rozdwojenie podniebienia i brak większości zębów. brakowi gałek ocznych 129 . U psów skrócenie kręgosłupa nie jest letalne dla suk. U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. które występuje u większości ras bydła. Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw. deformację grzbietu. Natomiast samce prawdopodobnie nie osiągają dojrzałości. które przeżyły.FGFR3). a także u owiec. Jest ona wynikiem mutacji (transwersja adeniny na tyminę. a u tych. a nawet niepłodność. Możliwe więc. central vertebral malformation). a nawet płci wykazuje różny stopień letalności. 5-16 wkładka kolorowa). świń i owiec. cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. Może ona natomiast towarzyszyć: wodogłowiu. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego.Zaburzeniem. U jagniąt. żeber i mostka oraz części pyskowej (garbaty nos). rozmnażają się one prawidłowo. amputacja kończyn (akroteriaza) (ryć. stwierdza się osłabione zdolności rozrodcze. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. przepuklinie mózgowej. pęcinowego lub kolanowego. Wada ta. a nawet ludzi jest tzw. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. hampshire) w Stanach Zjednoczonych w latach 80. Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi". Jest ona letalna u bydła i indyków. U owiec niektórych ras mięsnych (suffolk. bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie.

U psów brak owłosienia uwarunkowany jest genem dominującym. natomiast najłagodniejszą. Cielęta dotknięte tą wadą w warunkach naturalnych giną. Nienormalność ta jest prostą cechą recesywna. Wyniki badań wskazują. Inną wadą dziedziczną układu powłokowego jest brak owłosienia. uwarunkowana recesywnym genem sprzężonym z płcią. królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. jak wodogłowie. jak włosy i pióra. a to z kolei może spowodować śmierć w pierwszych tygodniach życia. Na podstawie szczegółowych badań można sądzić. że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. ale i takich jej wytworów. skrócenie szczęki. które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle. chińskie. że osobniki homozygotyczne rodzą się martwe. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu. U drobiu wadą układu powłokowego jest nagość. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu. U owiec obserwowana jest również cecha recesywna — brak żuchwy. 130 . Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. Wady układu powłokowego Wady układu powłokowego odnoszą się nie tylko do skóry. Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła. Płytki te są porozdzielane rowkami. naked). Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. prowadzącą do śmierci płodów lub noworodków. gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości.lub zesztywnieniu stawów. Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. u bydła rasy Jersey. w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. Anomalia ta polega na skróceniu dolnej części dzioba. oznaczonym symbolem n (ang. że wszystkie bezwłose psy (tzw. w których rosną włosy. Schorzenie to przybiera najostrzejszą formę. psy tureckie. U bydła. perskie lub meksykańskie) są heterozygotami. Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. Ptaki. duck). W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi. u bydła ayrshire. która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka.

Brak odbytu jest recesywną cechą letalną. Atak taki trwa około 10 sekund. powodując jego rozjaśnienie.Wady układu pokarmowego Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. crest). Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy. Niedorozwój móżdżku najlepiej został poznany u bydła i owiec. ale nie mogą stać. jak i u koni. natomiast heterozygoty mają piękny czub. Zwierzęta dotknięte tą wadą rodzą się żywe. przy czym u kur gen ten nie jest letalny (np. świń i drobiu jest wodogłowie wewnętrzne. U bydła nienormalność ta dotyczy jelita biodrowego. Niedrożność jelit zaś. pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe. natomiast u królików — recesywnym. Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych. wpływa bowiem na umaszczenie. Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. Prostą autosomalna cechą występującą u bydła. sprzężone z płcią zaburzenie zwane paroksyzmem. powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. determinowana u bydła genem dominującym. wykazują powiększenie czaszki. U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. Większość z tych kurcząt ginie przed 15 tygodniem życia. U indyków i kur notowane jest wrodzone zaburzenie równowagi. usztywnieniem nóg oraz drżeniem ciała. to prosta autosomalna cecha recesywną występująca zarówno u bydła. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. u koni natomiast okrężnicy. Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja. Wady układu nerwowego Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). U świń gen warunkujący tę wadę wykazuje działanie plejotropowe. warun131 . następnie upadkiem. u których jest prostą cechą recesywną. Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. U drobiu występuje również recesywne. Obie nienormalności warunkowane są genem recesywnym. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem. Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną. rasy houdan i polskie czubatki).

4. Trudność tę powiększa to. Niepłodność obserwowana jest także u buhajów. ogierów i samców innych ssaków jest wnętrostwo. Pisklęta obarczone tą wadą kłują się dobrze. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. świń i owiec. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne. 5. Anomalią o dużej częstości występowania. występujący u bydła. związanym z niedorozwojem przodomózgowia.kowane recesywnym genem letalnym lo (ang. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. knurl). Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang. a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego. Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem. iż objawy pojawiają się u zwierząt w różnym wieku. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu. pić i giną w ciągu kilku dni. jak na przykład brak lub niedobór pewnych enzymów czy hormonów. ale także u knurów. Jest to prosta. jest trudne do identyfikacji. 132 . której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych. ale nie mogą jeść. loco). Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu. powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych. Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Wady układu rozrodczego Dość często występujące. Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów. jest paraliż i przykurcz mięśni kończyn i szyi. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy.4. nasieniowodów. Podłoże genetyczne zaburzeń natury biochemicznej. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. szczególnie u buhajów. Zaburzeniem układu nerwowego. czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny.3. macicy. dlatego nazwano je „gałkowatymi". czyli szczytowej części główki. Nienormalność tę można usunąć zabiegiem chirurgicznym. takie jak: niedorozwój (hipoplazja) jąder. autosomalna cecha recesywna. Obustronne wnętry są niepłodne również po takim zabiegu. jajników. niedrożność jajowodów czy wnętrostwo.

który przyspiesza przemianę protrombiny w trombinę. U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna. mająca łagodniejszy przebieg. wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej. lecz jest ono jednak innej natury niż porfiria u bydła. a w skrajnych przypadkach — wrzodów.Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne. Należą do nich przypadki wielokończynowości. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa). zębach i innych częściach ciała. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu. charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia. zroślaki (zrośnięte dwa płody). Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła. składnika hemoglobiny. U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. których podłoże genetyczne jest dobrze poznane. która jest produktem rozkładu chlorofilu. Uczulenie na promienie słoneczne występuje również u owiec. powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów. Fenotypowym obrazem tej wady jest egzema na pysku i uszach. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II. Oprócz ogromnej liczby wrodzonych wad dziedzicznych. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. a także owiec. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. kościach. 133 . wytwarzany w nadmiernych ilościach i odkładany we krwi. Genetycznym podłożem tej wady u bydła jest gen recesywny. Schorzeniem notowanym u ludzi i psów. reagują powstawaniem pęcherzy na skórze. wywoływana działaniem genu recesywnego sprzężonego z płcią. i hemofilia B. a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. które są niewątpliwie dziedziczne. ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. niezbędnego do wytwarzania tromboplastyny osocza. istnieje wiele anomalii. a dotycząca czynnika IX (czynnik Christmas). Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny. gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych.

134 .

Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli). Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli.4. są zauważalne i łatwe do eliminacji. niestety. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania. Ograniczanie występowania chorób genetycznych Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach. częstość jest niewielka. które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji). Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych.4. kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana. który jest fenotypowo normalny.4. ale w swoim genotypie 135 . W Polsce. Terminem nosiciel określamy osobnika.5. ale jedynie te.

Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników. będą pochodzić wszyscy synowie fenotypowo normalni. fenotypowo ujawniają swą obecność wówczas. a u połowy ujawni się wada dziedziczna. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią. jednakże połowa z nich będzie homozygotami dominującymi. Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza. skojarzonego z normalnymi kurami. gdy występują w stanie homozygotycznym. Natomiast wśród jego córek połowa będzie normalnych. Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic. 136 . Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice.ma gen letalny (czy semiletalny) w układzie heterozygotycznym. Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. a połowa nosicielami niepożądanego genu. głównie wykorzystywanych w sztucznej inseminacji (np. 2. Jeśli będzie to gen letalny powodujący zamieranie zarodków. Schemat takiego kojarzenia jest następujący: Jeżeli testowany osobnik jest nosicielem allelu recesywnego. to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. Testowanie takie jest możliwe jedynie wtedy. buhaje). Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. u ptaków samce). Geny te. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności. Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. wśród których można się spodziewać obecności nosicielek recesywnego allelu. to około 50% jego potomków będzie homozygotami recesywnymi. że aż 18% osobników jest nosicielami niepożądanego allelu. jak już wspomniano. gdy homozygoty recesywne wykazujące wadę żyją i są płodne.

w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. Dokładną metodą identyfikacji nosicielstwa recesywnego genu. Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw. zakupione przez Stacje Hodowli i Unasieniania Zwierząt. lecz trudną do zaakceptowania ze względów hodowlanych. Jeśli przyjmiemy. 137 . to wśród córek połowa będzie miała genotyp AA. Wówczas schemat kojarzenia testowego jest następujący: Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. jest kojarzenie samca z jego własnymi córkami. Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus. Rejestracja ta z jednej strony daje obraz częstości występowania tych wad. test automatyczny). Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych. Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. kojarzone są z losowo wybranymi samicami. 3. a połowa Aa. z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich). Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). a samiec jest heterozygotyczny.Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. W hodowli bydła młode buhaje. że samice matki tych córek są homozygotyczne (AA).

leukocyte adhesion deficiency). w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt. w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej. że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. Analiza rodowodowa wykazała. szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne. występująca również u ludzi pod nazwą LAD (ang. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. Ponieważ jest to gen recesywny. Jest to choroba autosomalna recesywna. Stwierdzona w pozycji 383 nukleotydu mutacja. W latach 70. fenotypowo zdrowe). Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2. rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego. Białko to odgrywa istotną rolę w odporności organizmu. U bydła zespół BLAD był znany od kilkunastu lat. a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu). Zagadnienie to opisano niżej. spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych.Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA. Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to. Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. po raz pierwszy opisano go w 1983 roku. Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych. powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138 . tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. W diagnostyce tych chorób stosowane są techniki biologii molekularnej. DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi. która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy). które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. który koduje strukturalną podjednostkę CD18 p2-integryny. Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. Na początku lat 90. głównie PCR-RFLP.

Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni. ciche podstawienie 775 nukleotydu. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów. opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach. recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej. jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa.wego na glicynę. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA. Z kolei. Jej podłożem genetycznym jest zmutowany. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych. natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to. jaki allel występuje w badanym DNA. ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. tzw. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia. podejmowane są środki prewencyjne. a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. Mutacja ta została już przedstawiona wcześniej. Za pomocą analizy fragmentów restrykcyjnych określa się. Obraz elektroforetycznego rozdziału wygląda następująco: W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację. iż zmutowany allel nie ma miejsca restrykcyj139 . który bierze udział w cyklu mocznikowym.

Pierwsza z nich to okresowy paraliż. pojawiający się u koni „ąuarter" w USA. Osobniki heterozygotyczne są fenotypowo normalne.nego dla enzymu Avall w kodonie 86. ale wykazują obniżony poziom aktywności enzymu. również wcześniej przedstawioną mutacją letalną. jest recesywna mutacja genu syntazy urydynomonofosforanowej. dlatego nazwano go „genem zamieralności zarodków". za140 . a dla normalnej homozygoty dwa prążki 118 pz i 72 pz. deficiency uridine monophosphate synthase). Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. Podobnie jak w przypadku poprzednich mutacji. Kolejną. polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku. Zmutowany allel genu UMPS. konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). hyperkalemic periodic paralysis). nazwany HYPP (ang. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym. Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu. okresie głodzenia. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony. do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. dla heterozygotycznego trzy prążki: 194 pz. Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz. niemożliwa jest analiza DNA osobników homozygotycznych. Objawami tej choroby są ataki drżenia mięśni i paraliżu. określony symbolem DUMPS (ang. Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz. W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni. powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT). 118 pz i 72 pz. nie dającą żadnych skutków fenotypowych. Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego. których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych). Z drugiej jednak strony. natomiast allel zmutowany (DUMPS) — nie będzie. natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży. występujące po zmianie diety.

Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. u owiec — 13ql7-ql8. Choroba ta charakteryzuje się brakiem limfocytów T oraz B. natomiast u bydła i owiec w długim ramieniu chromosomu 13. indukując zmiany ich konformacji. jak P 141 . Omawiając choroby genetyczne nie sposób pominąć tzw. Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA. Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej. poznanych chorób prionowych u zwierząt jest trzęsawka (ang. W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach. Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang. jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową. natomiast badania przeprowadzone w Polsce wykazały. Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. nazwane prionami. co powoduje załamanie się układu immunologicznego. severe combined immunodeficiency disease — SCID). na granicy prążka 12 i 13 (20pl2-pl3). Przypuszcza się. bo około 250 lat temu. a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). iż przekształcają prawidłowe cząsteczki białka w szkodliwe. chorób prionowych. z zastosowaniem enzymu restrykcyjnego Tagi. spongiform encephalopathies). namnażają się w ten sposób. dobrze umięśnionych. Białkowe cząsteczki infekcyjne. Podobna choroba od 50 lat znana jest u ludzi. jego zmutowany allel. którym jest białko. Mutacja HYPP dziedziczy się z niezupełną dominacją. iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen. Jedną z najdawniej. Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20. trwającym miesiące lub lata bez żadnych objawów. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). że nie występuje ona w polskiej populacji koni arabskich. Z tego powodu określane są gąbczastymi encefalopatiami (ang. Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny. warunkujący białko prionowe — symbolem PrPSc. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. Gen kodujący białko komórkowe oznaczono symbolem PrPc. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP. u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. przy czym u bydła w pozycji 13ql7.działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. scrapie — drapać) u owiec.

a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". Gen ten koduje białko określane jako Dpl (ang. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. prion-doppel). Ponadto tylko ten genotyp nie występował u krów z BSE. Ostatnie badania wykazały. Białko to ma około 250 aminokwasów. 142 . 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. które wywołuje scrapie u owiec. R/H) oraz 171 (arginina/glutamina. 5-III). Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej. U bydła chorobą prionową jest rozmiękczenie mózgu (ang. że częściej występuje 6 powtórzeń. Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. Wykryto już kilka mutacji w tym genie u owiec. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny. kóz i bydła. Czynnikiem zakaźnym BSE jest to samo białko prionowe. downstream prion-like protein) lub doppel. Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii. które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. oznaczenia literowe V/A). 5-17). Wydaje się.śledziona czy węzły chłonne. Spośród trzech możliwych genotypów (6:6. 154 (arginina/histydyna. które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym. Metoda ta okazała się jednak zbyt droga i długotrwała. rok później została opisana jej patologia. związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm. Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc. że w pobliżu genu białka prionowego znajduje się gen Prnd (ang. Dotychczas stwierdzono. Jest to choroba ośrodkowego układu nerwowego. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. że najbardziej odporne są owce o genotypie AA136RR154RR171. bovine spongiform encephalopathy — BSE). a jej rezultaty nie były zadowalające. R/Q) (tab.

Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny Gen odporności na kleszcze W niektórych krajach. jak również w Europie. Z kolei.5. powodujące rocznie padnięcie około 10 min prosiąt na świecie.4. Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt. umożliwiających adhezję bakterii i ich rozwój. determinujący odporność na kleszcze. występowanie tych 143 . Z kolei. ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. Należą do nich biegunki okresu noworodkowego u prosiąt. Gen K88 i F18 U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen. głównie w północnej Australii i innych regionach tropikalnych. bydło jest szczególnie podatne na inwazje kleszczy. bydło indyjskie jest bardzo odporne na kleszcze.5. w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła.

iż mogą 144 . a odporność recesywną (allel b). Loci receptorów dla E. konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa). 5. W jednym z nich (FUT1) wykryto dwie mutacje. coli F18. coli F18). oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. coli K88 zlokalizowano w chromosomie 13. Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne. trzech prążków (93. stwierdzono bowiem. Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l. Podatność jest cechą dominującą (allel B). Mutacje te mogą być dziedziczone po matce.2-fukozylotransferazy. Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA. Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. ataksja. W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1'. której objawami są m. wykazuje ścisłe sprzężenie z genem ECF18R. coli (bakterie te mają fimbrie). coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika. polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę). U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa. z których jedna. Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany). iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg. a ich charakterystyczną cechą jest to. blisko locus Tf (transferyny). oznaczona symbolem M307.5. mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym. 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych. znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E.in. z ałlelem zmutowanym M307A. warunkującego odporność na infekcje E. Mutacje w mitochondrialnym DNA Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra.receptorów warunkowane jest genem głównym (o dużym efekcie). schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E.

inne natomiast u odpornych. ale dalszym pokoleniom cechę tę przekazują tylko córki. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. Podstawienia nukleotydów w genach kodujących tRNA powodują m. Miejsce i zasięg występowania danej mutacji powodują. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną. padaczkę miokloniczną i tzw. Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np. podobnie jak w DNA jądrowym. pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki. dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną. jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP). Z kolei. Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona. Skutkiem tranzycji są takie choroby u człowieka. Przykładem pierwszej sytuacji jest wspomniana już choroba LHON.dotyczyć całych tkanek. Wiadomo na przykład. drugi natomiast mutacją homoplazmatyczną. Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi. Mutacje w mitochondrialnym DNA. iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom.in. iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach. jak i synom. polegają na substytucjach nukleotydów (głównie tranzycja). mitochondrialną miopatię. Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to. której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. wywoływaną przez wirus. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego. mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka. insercji bądź delecji nukleotydów. . poszarpane czerwone włókna (MERRF). kwasica mleczanowa i napady udaropodobne).

Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone. że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. umaszczenia. Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. 146 . kolor upierzenia u drobiu. W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen. barwa umaszczenia. Oznacza to. Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym. Cechy jakościowe są warunkowane jedną. Wspólną właściwością tych cech jest to. bowiem na ich ekspresję wpływa kilkanaście. układy grupowe krwi itd. rzadziej kilkoma współdziałającymi ze sobą parami genów. Do cech jakościowych zalicza się takie. w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. a ich ujawnienie się zależy przede wszystkim od założeń genetycznych. rogatość lub bezrożność bydła. kiedy jeden gen wpływa na kształtowanie się kilku cech. jak: umaszczenie zwierząt. Ogólnie cechy można podzielić na jakościowe i ilościowe. że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. Znane są również przykłady. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości.Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu. która jest łatwa do odróżnienia w zespole innych właściwości (np. owiec i kóz. Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy. a nawet kilkadziesiąt par genów. Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków. np. Zjawisko to nazywa się plejotropią. Ponadto. Mechanizm dziedziczenia cech jakościowych jest zróżnicowany. posiadanie/brak rogów).

która zawiera dwa jednakowe geny z danej pary alleli. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA. Potomek dziedziczy zatem jeden allel z danej pary od ojca. Dziedziczenie cech warunkowanych jedną parą alleli 6. drugi natomiast — nieallelicznego (kilka par genów).1. I prawo Mendla. Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek). Współdziałanie alleli Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu. 147 . W procesie gametogenezy allele z danej pary rozchodzą się do gamet. a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus. Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla.1. nazywa się homozygotą (AA lub aa). Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. Geny te nazywane są parą alleli lub allelomorfów. dając wszystkie możliwe formy danej cechy. Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. drugi natomiast od matki. mówi o tym. W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech. A-a). Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary.Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem. natomiast mająca dwa różne geny — heterozygotą (Aa). 6. Jak już wspomniano.1. Zygota. cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą. Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. zwane prawem czystości gamet. że gameta zawiera tylko jeden gen z danej pary alleli. Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie. Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów).

w locus tym występuje allel be. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). Są one zatem w stosunku do siebie równorzędne. również czarno umaszczonych. Z kolei u świń rasy cornwall. Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. Ilustracją tego typu dziedziczenia. zawsze da potomstwo heterozygotyczne.Przykładem całkowitej dominacji może być bezrożność u bydła. jednolitego umaszczenia. część zaś białe. nazywanego również dziedziczeniem typu Zea. jest poniższy przykład. upierzenie kur andaluzyjskich (czarne. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane). gdyż gen dominujący P maskuje jego ekspresję. białe i stalowoniebieskie). Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi. Para rodziców. to stosunek liczbowy osobników czerwonych. dominujące nad czerwonym i inne. Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. czarne umaszczenie u bydła. będących homozygotami alternatywnymi (PP i pp) pod względem locus polled. że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2). Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie. część mroziate. wykazujące dominującą formę cechy. z którego część ma umaszczenie czerwone. Przykładem tego typu współdziałania allelicznego jest grupa 148 . że fenotyp zwierzęcia odzwierciedla jego genotyp. Charakterystyczną cechą tego typu dziedziczenia jest to. Dominowanie niezupełne genów z jednej pary alleli polega na tym. otrzymuje się potomstwo (pokolenie Fl) mroziate. jednolite umaszczenie (dominuje) i łaciatość u bydła. Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire. długość uszu u owiec rasy karakuł i inne. Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. kontrolowany przez allel dominujący Bew z locus Be. Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz. iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie). W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. Stwierdzono.

w których u różnych osobników znajdują się więcej niż trzy allele.krwi AB w układzie ABO u ludzi. Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. w którym w jakiejś populacji 149 . Naddominowanie polega na tym. który warunkuje tę samą cechę co allele pierwotne. że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa). dając jedynie inną jej formę lub natężenie. W przypadku niektórych loci. obok dotychczasowej pary alleli pojawia się allel trzeci. w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu. w wyniku mutacji genowych (patrz rozdział: Mutacje). Układ taki. Zdarzają się również takie loci.

jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne. 6. Wszystkie gamety osobnika aberdeen-angus (bydło czarne. czerwone).występują więcej niż dwa allele. czyli będą czarne. eP.1.in. Edp. to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone). Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie. Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. badając m. bezrogie. ep. Dzieje się tak 150 . to ich segregacja jest praktycznie niezależna. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla). Oznacza to. warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1). że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. Jeśli szereg składa się z n liczby alleli. bezrogie) zawierają dominujące geny Ed i P. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku.2. to liczba genotypów będzie się równała: Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. natomiast gamety osobnika rasy shorthorn (czerwone. Zwierzęta z pokolenia Fj będą mieć genotyp EdePp. mówiące o niezależnym dziedziczeniu się cech. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie. Niezależne dziedziczenie cech (II prawo Mendla) Niezależne dziedziczenie cech stwierdził Grzegorz Mendel. Allele wielokrotne charakteryzują się tym. nazywamy szeregiem (serią) alleli wielokrotnych. iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu. rogate) — allele recesywne e i p.

151 .

inaczej mówiąc. bezrogie): l (czerwone. Natomiast gdy jedna cecha dziedziczy się według typu Pisum. a druga według typu Zea. Jednak organizmy żywe mają tysiące. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może 152 . lecz 9 różnych fenotypów. istnieje możliwość ujawnienia się 6 różnych fenotypów. rogaty). iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy. zwiększy się liczba możliwych fenotypów. że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p. dziesiątki tysięcy różnych genów.3.dlatego. sporządzając szachownicę genetyczną Punneta. liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n 6. rogate): 3 (czerwone. 6-2). w którym występuje przynajmniej jeden gen dominujący z każdej pary. rogate) (ryć. gdy obie cechy dziedziczą się z dominowaniem całkowitym.1. Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie. Cechy takie nazywamy sprzężonymi. Zatem każdy chromosom zawiera wiele genów. Dziedziczenie cech sprzężonych Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to. cechy kontrolowane przez te geny będą się dziedziczyć razem. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4. to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. Najliczniejszą grupę potomstwa stanowią osobniki o genotypie. Ponieważ każdy osobnik wytwarza 4 rodzaje gamet. Jeśli będzie rozpatrywana większa liczba cech równocześnie. bezrogie): 3 (czarne. gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych. Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne. a tylko kilka do kilkudziesięciu chromosomów. Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli. Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2. a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony. W tym przypadku można mówić o niezależnej segregacji chromosomów.

Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący: Natomiast genotyp podwójnej homozygoty recesywnej: W celu określenia. iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty. genotyp dla cech sprzężonych jest zapisywany w postaci ułamka. skrzydła szczątkowe (gen recesywny v — vestigal).być stosowany do tych cech. im dalej od siebie znajdują się geny. normalne skrzydła są dłuższe od odwłoka. 153 . rekombinantów. że są one w fazie przyciągania (cis). Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami. została przyjęta nazwa faza sprzężenia. mianownik drugi chromosom z tej pary. w którym licznik oznacza jeden chromosom. Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. zwanej crossing over. tzw. pojawią się kombinacje cech w innym układzie niż u rodziców. W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym. W wyniku crossing over u części osobników potomnych. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. dzikiej) każdej cechy u muszki. jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom. Częstość tej wymiany jest tym większa. bądź w różnych chromosomach i jest to faza odpychania (trans). Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł. W odróżnieniu od cech segregujących niezależnie. Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna. złożone z homologicznych chromosomów.

której symbolem jest cM (centymorgan. W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over. Na przykład. natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami). Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy. Wynika to z tego.Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe. jeśli pojedynczy 154 . W naszym przykładzie odległość między loci B i V wynosi 18. z jaką crossing over zachodzi między sprzężonymi loci. Procent rekombinacji przyjęto za jednostkę odległości między genami. że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów.5 cM. od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana).5% całego potomstwa z tej krzyżówki. Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu). Można jednak przewidzieć częstość występowania podwójnego crossing over. czyli l cM = 1% rekombinacji. W danym przykładzie rekombinanty stanowią około 18. iż częstość. jest stała. Doświadczalnie zostało udowodnione. jest ona iloczynem częstości przypadków pojedynczych crossing over.

iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka. natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV. że kolejność ułożenia loci w chromosomie jest następująca: A-B-C. to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C. Jest to jednak wartość przybliżona. czyli 0. 155 . umożliwiające dokładne ustalenie położenia loci względem siebie. a nie za pomocą przyjętego dla nich symbolu „ + ". Również w tej krzyżówce. jak przed tą wymianą i nie będzie można odróżnić rekombinantów. Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie. w celu lepszego uwidocznienia efektu crossing over. stosuje się tzw.1%.001. układ genów będzie taki. krzyżówki trzypunktowe. to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci.05 = 0. gdyż w naturze jest ona niższa. Z kolei. Trzecią cechą rozpatrywaną będzie kolor oczu. podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. a gen recesywny c (cinnabar). to częstość występowania podwójnego crossing over wynosi 0. By tego uniknąć. Przyczynę stanowi to.02x0. warunkuje kolor cynobrowy. W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny: Natomiast drugi rodzic ma genotyp: W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv.crossing over w obszarze I zachodzi z częstością 0. a w obszarze II — 0. Zjawisko to nosi nazwę interferencji. Jeśli przyjmiemy. Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych. Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych.02 (2%). Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi.05 (5%). U muszki owocowej dominuje czerwony kolor oczu (dziki). Jeśli jednak zajdzie podwójny crossing over. allele dominujące będą oznaczone literami alfabetu.

W ten sposób tworzone są mapy genetyczne. wyrażonym w procentach: Analogicznie do tego odległość między loci C i V wynosi: Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco: Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie. W celu okreś156 .W potomstwie uzyskano następujące genotypy i liczebności: Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów. Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane.

Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. Powstaje wówczas mapa fizyczna. Dzieje się tak dlatego. 6. występująca u ludzi. cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi.lenia. psów i niektórych zwierząt gospodarskich. iż u osobnika diploidalnego występuje tylko jeden gen z danej pary. których geny są umieszczone w chromosomach płci.1. Cecha zmniejszonej krzepliwości krwi (hemofilia). a osobnika — hemizygotą. Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób: Fenotyp Samice Samce Samice Samce Jak wynika z tego zestawienia. Układ genetyczny polegający na tym. samce nie mogą być heterozygotami (nosicielami genu hemofilii). że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego. Sposób ich dziedziczenia jest inny niż cech autosomalnych.. obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu. Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ). Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład. że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki). Cechy sprzężone z płcią Cechy. a heterogametyczną samice (ZW).4. nazywamy cechami sprzężonymi z płcią. Gdy płeć heterogametyczną ma cechę dominującą. w którym chromosomie znajduje się dana grupa genów sprzężonych. ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. a synowie po matce). a pleć homogametyczną cechę recesywną. samce zaś heterogametyczne (XV). a nie — jak u płci homogametycznej — od pary genów. U ssaków samice są homogametyczne (XX). uwarunkowana jest recesywnym genem h. nazywamy hemizygotycznym. należy zastosować inne metody badania (cytogenetyczne). 157 . O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu. Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego).in. W rozdziale tym pokazano m.

„dziedziczenie na krzyż" Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B. w pokoleniu F. 6-4 wkładka kolorowa). Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych. tj. dominuje nad jego allelem b (gen czarnej barwy upierzenia).Ryć. takich. Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią. 6-3. warunkujący cechę jastrzębiatości upierzenia. Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce. u których zaraz po 158 . Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra.

6-5 wkładka kolorowa). Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach). część z nich przedstawiono w rozdziale: Mutacje. U zwierząt domowych jest wiele cech sprzężonych z płcią. Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści. iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie. których założenia genetyczne znajdują się u osobników obu płci. rasa sussex) i złocistości upierzenia (rhode island red). mając taki sam genotyp. Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate. Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw. Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci. U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych.wykluciu można rozróżnić płeć. mogą się różnić fenotypowo. zlokalizowany w chromosomie X. cechy związane z płcią. Samce mogą być tylko czarne (o-) lub rude (O-). Rasą autoseksingową są polbary. Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym. co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego. B (niebieskie dzikie) i b (czekoladowe). dwarf — karłowaty). Osobniki męskie i żeńskie. warunkowana przez locus O (ang. Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia. orange). Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. ale ujawniają się tylko u jednej płci. Jest ono następstwem tego. Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. Cechy te nazywane są cechami 159 . Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech. geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw. samice zaś bezrogie. mające gen jastrzębiatego upierzenia. wytworzone przez polską badaczkę Laurę Kaufman. Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone). ang. ale ich ekspresja jest uzależniona od płci. inne — rude (genotyp Oo) (ryć. Niektóre z nich to tzw. Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X.będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach. Przykładem takiej cechy jest rogatość owiec rasy dorset horn. natomiast osobniki homozygotyczne recesywne będą rogate.

na tempo przemiany materii. Plejotropia właściwa występuje wtedy. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę. opisany w podrozdziale: Dziedziczenie umaszczenia. Należą do nich: zdolność wydzielania mleka u samic ssaków. powodują pojawienie się nowej formy cechy jakościowej. w wyniku łącznego działania. nieśność samic ptaków. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe. Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne. hormonu).5. gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. Z kolei ten związek ma różnorodne funkcje fizjologiczne. 6. które nie chroni ptaka przed nadmierną utratą ciepła. Plejotropia może być właściwa lub rzekoma. 160 . 6. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt". Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. który bierze udział w syntezie jakiegoś związku (np. wnętrostwo czy przepuklina mosznowa u samców. W przypadku wielu cech geny z różnych par alleli.ograniczonymi płcią lub ograniczonymi do płci. Zmiany te są jednak następstwem nieprawidłowego opierzenia. Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy. W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m.1.2. kiedy jeden gen oddziałuje na powstanie kilku cech. która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech. Plejotropia O plejotropii mówimy wówczas.in. Na przykład gen warunkuje syntezę enzymu. wpływa zatem na inne właściwości organizmu. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. Przykładem jest gen warunkujący platynową barwę u lisów. pracę serca i aktywność procesów trawiennych. Współdziałanie genów z różnych loci w kształtowaniu fenotypu W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy.

Komplementarność Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć. Jest kilka rodzajów tego współdziałania. 6-6a). 6.1. 6-6a.Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. Ryć.2. W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p. Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161 .

Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego. która powstaje w wyniku działania każdego z nich osobno. która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. Dwa dominujące geny z różnych par alleli. warunkujący go genotyp to podwójna homozygota recesywna — rrpp. że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. podobna do wspomnianej wyżej u świń. natomiast gen P powoduje powstanie grzebienia groszkowego. a jego allel r — pojedynczy.2. W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy. ale mają 162 . gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_). w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy.2. jak i różyczkowego. nazywany jest genem epistatycznym. Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc). gdyż brak w ich genotypach genu C. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia. Gen. Kury niektórych ras (np. tj. jego allel p — grzebienia pojedynczego (ryć. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP). nazywamy genami komplementarnymi lub dopełniającymi się. której genotyp może mieć kilka różnych wariantów. który hamuje ujawnienie się genu z innej pary. 6-6b wkładka kolorowa). Zjawisko epistazy może wyjaśnić poniższy przykład. Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. natomiast gen hamowany to gen hipostatyczny. natomiast w pokoleniu F 2 . całkowicie różny od obojga rodziców. Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym. plymouth rock) mają upierzenie białe. współdziałające razem i wytwarzające odmienną formę cechy niż ta. pojawia się również nowy typ — grzebień pojedynczy. charakteryzująca się tym. U białych leghornów jest inna sytuacja. w którym wystąpią 4 fenotypy w stosunku 9:3:3:1. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy.Gen R warunkuje kształt różyczkowy grzebienia. wyandotte. 6. Ptaki te są również białe. którego nie było w dwóch pokoleniach przodków. Z krzyżowania osobników o ustalonej cesze kształtu grzebienia. że w pokoleniu Fl pojawia się nowy fenotyp. warunkującego wytwarzanie pigmentu (melaniny) w piórach. Epistaza Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza.

3. Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. mimo iż cecha łaciatości warunkowana jest inną parą alleli. Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne. W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). natomiast czarno umaszczonych (np. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I. Geny modyfikujące Istnieje pewna grupa genów. Geny epistatyczne mogą tłumić działanie wielu innych par. Allele z locus E i A są opisane w dalszej części tego rozdziału. powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę.Ryć. psów i kotów. którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc). Różny stopień białej plamistości spowodowany działaniem genów modyfikujących w swych genotypach gen C. rasy cornwall): aa ii EE. Geny te. które modyfikują przejawianie się jakiejś prostej cechy. W potomstwie F2. Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć. Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów. Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC. 163 . rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP. który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. 6-7). dotyczącej dziedziczenia umaszczenia. Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary. Gen epistatyczny nie zawsze jest dominujący w swojej parze. 6-7. zwane modyfikatorami. 6.2. warunkowanej zwykle jedną parą genów.

U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np. biała w zimie. takich jak gonadotropiny. natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej.). Ostatnie badania wykazały. Należy pamiętać. wpływając na przykład na zmianę ilości wytwarzanego pigmentu. 164 . Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. Geny te nazywane są genami polimerycznymi. Dziedziczenie umaszczenia Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach. nieśność itd. wydajność mleczna. i feomelaniny (kolor czerwony lub żółty). iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych. że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację. powodując różne jej nasilenie. Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny. Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. 6-8): 1) hydroksylację tyrozyny do 3.2. 6. Zmiany te spowodowane są działaniem niektórych hormonów. ale czynniki środowiskowe mogą modyfikować umaszczenie. Do niedawna uważano. Zjawisko to polega na tym. syntetyzowane z metabolitów DOPA-chromu. Sumujące działanie genów Inną formą współdziałania nieallelicznego genów jest polimeria. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny).6-dihydroksyindolu (DHI) do indolochinonu.6. kortykotropina i hormon melanotropowy — MSH (ang. melanocyte stimulating hormone). że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. wytwarzane z metabolitów cysteinylo-DOPA-chinonu. a czarna lub brązowa w lecie).3. addytywnymi lub poligenami. U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych. Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. Synteza.4. iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę. rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci. natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. zależne od sumującego się ich działania.4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5.

Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. Schemat biosyntezy melaniny Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. jest wytwarzany przez część pośrednią części gruczołowej przysadki. 6-8. Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym. Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165 . Geny. Wiele genów. Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów. warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). a podczas rozwoju embrionalnego wędrują do powstającej skóry. ma działanie plejotropowe na rozwój i różnicowanie organizmu. Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. zwany również intermedyną lub melanotropiną. Jest wiele genów. a hamowanie produkcji feomelaniny wewnątrz melanocytów. Melaniny są wytwarzane w melanocytach. komórkowym i subkomórkowym. REGULACJA NA POZIOMIE TKANKOWYM Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. Receptor ten jest determinowany przez locus E (Extension).Ryć. Melanocyty pochodzą z rdzenia nerwowego. jeśli nie wszystkie związane z wytwarzaniem pigmentu. Hormon ten stymuluje produkcję poszczególnych melanin na przemian. W determinację koloru jest włączonych wiele loci. które zostały już sklonowane. Hormon melanotropowy. które współdziałają ze sobą w sposób kompleksowy. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti). Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina).

. Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora. A (Agouti — dziki). podczas gdy locus Extension działa w melanocytach. przez działanie na mechanizmy włączone w funkcję melanocytu.plamisty. Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych. Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu). lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np. Locus E (Extension) koduje przede wszystkim receptor MSH.niesieniu do myszy. REGULACJA NA POZIOMIE SUBKOMÓRKOWYM Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym). U osobników typu dzikiego. brak syntezy melaniny w przypadku albinizmu). oba typy melanin nie są więc syntetyzowane jednocześnie.dominujący biały nakrapiany i Steel (Sl) .. w jednolity typowy sposób. odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). Geny. melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę.pełna barwa). gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów. Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. Większość z tych mutacji ma wpływ plejotropowy na rozwój. pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. nazywanych agouti. Locus ten kontroluje ilość eumelaniny. wpływają bezpośrednio na ilość i typ wytwarzanej melaniny. które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów. które działają na pigmentację ssaków na poziomie subkomórkowym. REGULACJA NA POZIOMIE KOMÓRKOWYM Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów. Do loci działających na poziomie tkankowym. a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) .stalowy. 166 . W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np. U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego). Dominant White Spotting (W) . E (Extension . co wpływa na koloryt (układ barw). Locus D koduje strukturalne białko. Należą do nich geny z loci D (Dilute — rozjaśniony). Mutacje w tych loci wpływają wyraźnie na kolor oczu.

Badania poszczególnych mutacji w locus Albino u królików. Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu). Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). czy pełnią one jakąś rolę (np. że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. w którym występuje dominacja w następującej kolejności: C. Specyficzna funkcja tego białka nie jest jeszcze poznana. gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza. c (ryć. 6-9 wkładka kolorowa). prowadząca do osłabienia funkcji enzymu. ale dotychczas nie stwierdzono. ale są to mutacje typu nonsens. Takie białka nie są kompetentne katalitycznie. której funkcja jest decydująca dla wytwarzania pigmentu. Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji. Locus C kontroluje liczbę i intensywność ziaren pigmentu. inhibitora) w melanocytach. wykazały.Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). ch. Wiadomo jednak. ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. natomiast inne geny regulują typ formowanego pigmentu. Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny. Historycznie był on uważany za locus strukturalny dla tyrozynazy. B i E. która prowadzi do wymiany cysteiny na tyrozynę. która powoduje uwrażliwienie efektu fenotypowego na temperaturę. iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown. Tyrozynaza przejawia swą ekspresję w melanocytach. skórze i tęczówce oka. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. jeszcze inne — sposób. Geny z locus C u królików tworzą szereg alleli wielokrotnych. warunkujących umaszczenie himalajskie i szynszylowate. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny. zmiany sensu i mutacje zmiany fazy odczytu. Warunkiem ekspresji genów z tych loci jest 167 . a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. Interesujące jest to. iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową. Mutacje w locus C powodują brak pigmentu we włosach. Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino. cch. natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm. U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną. czyli wycinania intronów. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka. a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. ale mechanizm działania tego genu dotąd nie jest znany. Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A. w jaki pigment ma być formowany.

W locus E. u obu gatunków są dwa allele — E i Ed. Feomelanina. w układzie homozygotycznym -. z wyjątkiem locus W. We wszystkich tych loci. w populacji lisa polarnego w Islandii). jak G. w tym przypadku kolor jest determinowany allelami z locus A. efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -. S. warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny. P. Allel ten odpowiedzialny jest za eliminację eumelaniny. warunkujących różne odmiany umaszczenia. która z reguły zajmuje miejsce eumelaniny. Lis polarny o genotypie aa jest czarny. Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. W. Natomiast u lisa polarnego zamiast allelu A jest allel A". W locus B również są dwa allele — dominujący B (czarny pigment) i b.oczywiście obecność odpowiednich genów z locus C. Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie. bez względu na to. Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci. u lisa 168 . W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny. U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. u lisa polarnego jest rozcieńczona lub usunięta w ogóle. jakie są geny z innych loci. ale genotyp ten występuje bardzo rzadko (np. R.pigment czekoladowobrązowy. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny.genotyp gg.

W (platynowy). Genetyczne podłoże umaszczenia u bydła Wyniki wielu badań sugerują. jest homologiczny do allelu ES0 u myszy. będącego antagonistą białka MSH-R. jedno oko niebieskie. natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. złożonego z około 350 aminokwasów. np. Mutacja w locus s (Shadow) charakteryzuje się heterochromią. recesywny allel e. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a. Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. natomiast gen marble daje inny efekt fenotypowy u tych odmian. który w układzie homozygotycznym warunkuje umaszczenie czerwone. Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. gdy w locus E jest genotyp E+_. W (białopyski). W3 (biały Georgian) i W M (gen marble).perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. Letalny jest także genotyp WW. natomiast allel a w układzie homozygotycznym — recesywne czarne. a drugie brązowe. opisanych w rozdziale: Mutacje. że u bydła umaszczenie czarne. w układzie homozygotycznym mają efekt letalny. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy. 169 . kodujący czarny kolor. Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. Mutacje dominujące. U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe.. W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna. SJ i SH) i t (T). Allele z tego locus mogą wykazać ekspresję tylko wtedy. W locus W są następujące allele: w. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny. s (trzy allele: S. są 3 allele: Ed warunkujący umaszczenie czarne dominujące. W locus tym. DD — niebieski). Allele te powstały w wyniku mutacji punktowych. Niestety dotychczas nie przeprowadzano badań molekularnych locus A. Allel dominujący Ed. takie jak W i W. F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia). oraz allel E+ umożliwiający ekspresję alleli z locus A. Locus A koduje syntezę białka. brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). melanocyte stimulating hormon receptor). umiejscowionym w chromosomie 18. natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. której skutkiem może być różny kolor oczu u tego samego osobnika. przy czym genotyp ww występuje u lisa rudego i srebrzystego.srebrzystego: genotyp pp . Locus E koduje syntezę białka MSH-R (ang.

U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic. Większość ras świń udomowionych ma allel recesywny a — nieagouti. Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. obserwowana jest zmienność w ekspresji cechy łaciatości. Genetyczne podłoże umaszczenia u świń U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti). w których do analizy sprzężeń użyto ponad 230 markerów genetycznych. iż locus ten jest umiejscowiony w chromosomie 6. Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8). powodując różne zaburzenia. recesywny s — łaciatość. niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. kora jest efektem plejotropowego oddziaływania allelu R na płodność.Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. blisko telomerowego regionu ramienia p. U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe. W tym samym locus u bydła tej rasy znajduje się allel Sc. ale recesywny w stosunku do białego (I). Wśród 170 . W locus I są dwa główne allele: 7 (inhibicja koloru). locus I (biały dominujący) i locus Be (Belted opasany). że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension. u których allel s jest utrwalony. mroziate). wskazują. natomiast u shorthornów jest odwrotnie. i allel i — recesywny (kolorowy). bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. który dominuje nad s. cornwall i hampshire. W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej. cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie. e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey. Badania.nieagouti. warunkujący fenotyp nazwany colorsided — łaciaty. belgijskie błękitne). poland-china i pietrain. Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego. odpowiedzialny za umaszczenie dominujące białe. Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę. także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. a mała allelu e (czerwone umaszczenie). W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a . ale jest recesywny w stosunku do allelu S. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica. Na przykład. Podobnie jak u myszy i bydła.. Kolejność dominowania tych alleli jest następująca: E-Ep-e. U ras bydła (np. locus E (Extension).

oznaczonych symbolem Id (deresz). siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały). Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. Genetyczne podłoże umaszczenia u koni Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). natomiast inne rasy są homozygotami recesywnymi (ii). allel dominujący E determinuje syntezę eumelaniny. Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"'. który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. trzeciego allelu w locus Extension — ED). występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace. Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita. G (Gray — siwy) i RN (Roan — deresz). W locus C u koni nie występuje allel recesywny c. hampshire (ryć. Allele z tego locus wpływają na ekspresję genów z locus A. hannover-braunschweig. takie jak tobiano (TO). overo (O). sabino (SB) czy tarantowate (LP). są determinowane przez geny z innych loci. Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele. wessex saddleback. W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. dominujący w stosunku do jednolitego umaszczenia. ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. jak np. Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus. Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony). charakterystyczny dla niektórych ras. Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina). Biały pas. Locus I został zlokalizowany w chromosomie 8. Wzory umaszczenia. jest kodowany przez allel Be w z locus Be. by było 171 . Umaszczenie białe. Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). Locus E warunkuje wytwarzanie określonego rodzaju melaniny. cremello).świń domowych dominujący biały jest przeważający. Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. 6-10 wkładka kolorowa). wykazujący niepełną dominację. I p (czarne łaty) oraz im (brudny szary). Genotyp tego knura jest następujący: aa U EE BewBew. zatem wystarczy jeden allel W.

Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww).umaszczenie białe). wobec którego jest hipostatyczny.i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. z wyjątkiem allelu W. Wszystkie rodzaje umaszczenia. na skutek braku części jelita. z wyjątkiem białego. Allel D z locus Dun wykazuje zupełną dominację. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_). lethal white foal syndrome). Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny.LWFS (ang. w locus W mają genotyp homozygoty recesywnej (ww). zestawiono w tabeli 6-II. Natomiast umaszczenie siwe kontroluje allel dominujący z locus G. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. który jest epistatyczny w stosunku do wszystkich alleli z innych loci. O i RN. polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub. Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny. znacznie rzadziej. Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" . Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina. 172 . Należą do nich allele dominujące z loci W. osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd). który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Genotypy w 7 loci. determinujące wybrane rodzaje umaszczenia koni. Allel G (w homo.

Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab.15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. warunkuje wytwarzanie czarnej eumelaniny. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec. wzór koloru i obecność lub brak białych znaków. warunkuje białe umaszczenie owiec. Badania specjalistyczne wykazały. inne wpływają na typ włókien. że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. Owce biało umaszczone są zwykle prawie pozbawione pigmentu. od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała. Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny. natomiast recesywny allel. bądź też oba efekty występują łącznie. ale mogą mieć pigment tan. Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. będący pierwszym w kolejności dominowania z szeregu alleli z tego locus. allel Awh zmniejsza płodność owiec o około 0. w których genotypach jest allel Awh. Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia.Genetyczne podłoże umaszczenia u owiec U owiec stwierdzono trzy typy pigmentu: czarna eumelanina. Przykładem tego jest brązowoczerwony kolor wełny karakułów. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. 173 . który w fenotypie ujawnia się ze zmienną intensywnością. Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów. Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała. Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu. Bw. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. Brw — czekoladowobrązowej eumelaniny. Niektóre allele z tego locus mają efekt plejotropowy. Allel A wh . czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina. natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny. 6-III). Allel typu dzikiego. natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. np. bądź mieszaniny jasnych i ciemnych włókien wełny. podczas gdy feomelanina może być syntetyzowana. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny.

Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. recesywny. Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej. Owce ras wełnistych. Umaszczenie białe dominujące (białe perskie. łaciate afgańskie) jest kontrolowane przez allel W a z locus White. a także homozygotyczne białe. AwhAwh. Allel typu dzikiego. natomiast homozygoty SSSS są całkowicie białe. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy). ale epistatyczny do dominującej brązowej (tan).Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. Ew umożliwia normalną ekspresję alleli z locus Agouti. Allel ten jest epistatyczny 174 . U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS).

jest to częstość. warunkuje dominującą szarość u karakułów. 175 . a nawet. mówimy o penetracji niezupełnej.4. inaczej określana jako przenikliwość. Z drugiej strony. gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów. również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny.w stosunku do wszystkich innych genów umaszczenia. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym. Pierwsze z tych zjawisk określane jest jako penetracja genu. Penetracja. 6. w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą. jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników. wykazują charakterystyczny dla niego fenotyp. rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość. Penetracja może być całkowita lub niezupełna. kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy. Wrn. że jego penetracja wynosi 80%. to mówimy. w przypadkach krańcowych. ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. mające taki sam genotyp. z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. inne zaś jej nie mają. Natomiast jeśli nie wszystkie osobniki. Penetracja określonego genu może być różna zależnie od płci. Inny allel z tego locus. ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). która w formie homozygotycznej jest letalna. Na przykład. Penetracja i stopień ekspresji (ekspresywność) genów Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika. O penetracji całkowitej mówimy wówczas. Często zdarzają się przypadki. Stwierdzono to na podstawie wyników doświadczenia. Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. Natężenie drgań jest bardzo zróżnicowane. współdziałania tych genów między sobą oraz współdziałania ze środowiskiem. iż działanie genów może wywoływać różnorodne efekty. natomiast drugie jako ekspresywność genu.

dziedziczą się różnie. gdy jest ona obserwowana u osobników spokrewnionych ze sobą. Zarówno stopień penetracji. że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu. Geny z różnych loci mogą dawać podobne fenotypy. geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji.5. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony. jak: wiek. w którym pojawiają się pierwsze objawy. Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. które nie są dziedziczne. docierające przez łożysko do rozwijającego się płodu). że niektóre cechy nie podporządkowują się temu terminowi. Już na początku naszego stulecia zauważono. Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością. Pewność. czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne). Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych. możemy mieć wtedy. Z kolei. Dziedziczenie pozajądrowe Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym. a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. iż mamy do czynienia ze zmiennością przejawiania się tego samego genu. Nie bez znaczenia jest stan zdrowotny matki. a także chloroplas176 . stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. a także położenie zarodka w macicy i nawet obecność innych płodów. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach. zależnie od kierunku krzyżowania. 6. W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki. sole mineralne oraz inne związki krążące we krwi. ujawniające się w różnym stopniu. Należy jednak pamiętać o tym.Pojęcie stopień ekspresji (ekspresywność.

w przeciwieństwie do DNA jądrowego. Powstał nowy termin dziedziczenie pozachromosomowe. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. -879 ±114 kg mleka. Natomiast allele charakteryzujące się niską frekwencją (^ 0. między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. Przyczyną tego. analizowanego metodą RFLP. ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA. W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA.1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce.tach roślin wyjaśniło podłoże tego zjawiska. inaczej pozajądrowe lub cytoplazmatyczne. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca. że warunkuje on od 2 do 10% zmienności tych cech. Mitochondrialny DNA.4. +26 ±99 kg. w świetle wyników najnowszych badań. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. Jak dotąd. Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg. co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka. tli .3 do 0. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację. u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca. może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. Plemnik zawiera od 50 do 100 mitochondriów. natomiast komórka jajowa ma ich około 100 tysięcy. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała. iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0. jest przekazywany następnemu pokoleniu wyłącznie przez matki. średnią i niską wydajnością mleka. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką. Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika). O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje. której wartość zawiera się w granicach od 0.9. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je.

Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła. Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej. Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe. Stwierdzono bowiem istotny wpływ zamiany (tranzycji . U owiec badania mitochondrialnego DNA. .rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka. wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu. Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA..Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności. prowadzone za pomocą technik molekularnych (RFLP).

Istnieje także zmienność grupowa. tzw.1. 179 . Zmienność oznaczamy symbolem S2.Rozdział 7. W przypadku cech. może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi. lub S2 w przypadku próby losowej pochodzącej z tej populacji. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa). czyli indywidualna. Rodzaje zmienności i czynniki ją wywołujące Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników. Na zmienność fenotypową. które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np. zwaną także ogólną. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza. jeśli rozpatrujemy populację zwierząt. mamy do czynienia ze zmiennością wewnątrzosobniczą. Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej. wydajność mleczna w kolejnych laktacjach). interakcja genotyp-środowisko. występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa).

Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym. Zmienność dominacyjna jest to część zmienności genetycznej.i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu. są przyczyną powstawania różnych genotypów. Mutacje prowadzą do powstawania nowych genów. Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów. ale różniące się pod względem założeń genetycznych (homo. Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą. i osobnikami homozygotycznymi — dominującym i recesywnym. które kontrolują występowanie danej cechy. ale także fenotypu (bezrogie i rogate). odchylenie dominacyjne i odchylenie epistatyczne. w którego genotypie funkcjonuje jeden gen dominujący. Poniższy schemat krzyżowania bydła obrazuje to odchylenie. Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. Natomiast rekombinacje. innych układów w obrębie chromosomu lub między chromosomami. będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie. Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych.Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. Osobniki fenotypowo identyczne (bezrogie). Głównymi składnikami zmienności genetycznej są: zmienność addytywna. Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest 180 .

upierzenie biafe). Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. należy także efekt matki pre-i postnatalny. np. a zwłaszcza jej składnika — zmienności addytywnej. Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału 181 . których wartość wyrażana jest za pomocą liczb naturalnych. w zmienności fenotypowej danej cechy ilościowej. warunkowanych zwykle jedną parą alleli. Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami. sposób utrzymania itp. do których należy odziedziczalność. Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych. Do szacowania tego udziału stosowane są parametry genetyczne. Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży. Do czynników środowiskowych. Zmienność skokowa występuje również w przypadku pewnych cech ilościowych. Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. liczba prosiąt w miocie. należących do tych ras. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów. jak 1barwnie upierzone.białe upierzenie kur rasy leghorn i whiterock. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. Z krzyżowania osobników 0 białym upierzeniu.). W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało. genotypów i fenotypów w danej populacji (stadzie). Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny. uzyskuje się mieszańce biało upierzone. mających istotne znaczenie. Zmienność skokowa odnosi się przede wszystkim do cech jakościowych. czynniki klimatyczne) lub okresowo (żywienie.

ważona. wysokość w kłębie w centymetrach. w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. którego elementami są poszczególne osobniki. dane zestawia się w tzw. Średnia arytmetyczna nie odzwierciedla zmienności.1. wydajność mleka w kilogramach. harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta). Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej. Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych. procentowa zawartość tłuszczu w mleku itp.charakterystycznego dla danej cechy. Jeśli liczba obserwacji jest duża. które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji). ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru: . Miary skupienia Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna. zmierzyć) u wszystkich osobników stanowiących próbę. Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt. 7. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy. Miary zmienności Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników. 7.2. np. według wartości rosnących lub malejących (szereg statystyczny uporządkowany).2. W celu określenia zmienności cechy musimy ją oznaczyć (np. Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np. a niektóre wartości powtarzają się. szereg rozdzielczy. zwanej próbą.

do obliczania średniej prędkości. jaka była średnia szybkość oddawania mleka: 183 . Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący. gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. W pierwszej minucie uzyskano 4 kg mleka.Średnia arytmetyczna charakteryzuje się następującymi właściwościami: Przykład (dane z tab. Wzór na obliczanie średniej harmonicznej jest następujący: Przykład: Ważono mleko oddawane przez krowę w kolejnych minutach doju. w drugiej 2 kg. np. a w trzeciej l kg. Wzór na jej obliczanie jest następujący: Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu. 7-1): Średnią ważoną obliczamy wówczas.

W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną: . Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu. Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy.Średnią geometryczną stosuje się wtedy. odbiega od rozkładu normalnego. gdy rozkład zmienności cechy jest asymetryczny. tzn.

ale przez N—1.0414.3010. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji. Wartość środkowa (mediana) jest to wartość cechy. 7. 0. w celu ułatwienia obliczeń stosuje się wzór roboczy.0294.28.6518. a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie). w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji. 0. natomiast ich suma = 0. Wartości zlogarytmowane tego współczynnika wyniosły: 0.0697. standardowe odchylenie i współczynnik zmienności. że najczęściej średnia arytmetyczna nie jest liczbą całkowitą. która dzieli szereg uporządkowany malejąco lub rosnąco na połowę. Miary rozproszenia Podstawowe miary rozproszenia to wariancja. Wariancja nie może mieć wartości ujemnej.1239. Ma ona miano takie jak analizowana cecha. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną: Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1. 0. Wartość modalna (średnia modalna) jest to wartość cechy.0864. która najczęściej powtarza się w szeregu liczbowym. ale podniesione do kwadratu. 185 .. 0.Przykład: Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych.2. w którym licznik jest sumą kwadratów odchyleń: Jeśli próbę stanowi mała liczba obserwacji. 0.2. czyli 128%. Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej Biorąc pod uwagę.

Wariancja: . Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. np. Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru: gdzie: Współczynnik zmienności wyraża zmienność w procentach. tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona.Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji. wykorzystując dane liczbowe zawarte w tabeli 7-1. Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji. Dobór zwierząt do grup doświadczalnych powinien być losowy. Sposób obliczania miar rozproszenia przedstawiono niżej. dotyczące masy ciała owiec w wieku 10 miesięcy. dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach. a także zmienności tej samej cechy w różnych populacjach (np. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt.

Kolejnym założeniem jest to. że efekty genów A. Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny). niosącymi 120 jaj rocznie. Zmienność cech ilościowych 7. nazywane inaczej genami polimerycznymi. skrzyżowano z kurami o genotypach aabbcc. w którym hipotetycznie przyjęto. które skupiają się wokół wartości średniej. Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej. Przyjmuje się. natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. Zakłada się. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. Założono również. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc). zwiększające wartość cechy). Poligeny. B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. pomiędzy którymi zachodzi dziedziczenie pośrednie. Dziedziczenie cech ilościowych Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. że każdy poligen ma dwa allele. uzyskano 64 genotypy. Zagadnienie to obrazuje przykład. warunkujące 7 poziomów nieśności (fenotypów tej cechy). przy czym jeden z nich ma działanie pozytywne (tzn.3.7. Najczęściej występują genotypy warunkujące wartości fenotypowe cechy.1. że nieśność kur warunkowana jest trzema parami alleli z różnych loci. że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy. Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych. addytywnymi lub kumulatywnymi. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie. uzyskujemy przedstawiony niżej obraz graficzny: 187 . natomiast zmniejsza się częstość występowania form skrajnych. specyficznie ze sobą współdziałają.3. Liczba poligenów kontrolujących cechy ilościowe jest nieznana. a drugi neutralne. czyli obojętne dla wartości cechy. Koguty o genotypach AABBCC. mające założenia genetyczne warunkujące nieśność 240 jaj rocznie. U potomstwa w pokoleniu F2 nastąpiło rozszczepienie. czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę.

a najmniej skrajne wartości. determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy: W podanym przykładzie celowo pominięto wpływ czynników środowiskowych.Po zestawieniu wartości fenotypowych cechy. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. zwana krzywą Gaussa. a oś symetrii przechodzi przez punkt. Znaczenie tych czynników jest istotne. w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej. w którym jest średnia wartość cechy. co w przypadku cech ilościowych o zmienności ciągłej powoduje. poniżej i powyżej średniej. gdyż zacierają one różnice między fenotypami. 188 . że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego. iż: • jest to rozkład. • rozkład ten jest symetryczny. Rozkład normalny charakteryzuje się tym.

Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów. stwierdzono. 7. wpływ matki na potomstwo jest większy od wpływu ojcowskiego.i postnatalnego zależy od gatunku. 68. że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia. 99. co wartość średniej arytmetycznej. na przykład. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np. a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym. behawior matczyny). dziedziczenie pozajądrowe. ilości substancji odżywczych dostarczanych płodowi (lub płodom). na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka.3. są heterozygotyczne pod względem znacznej liczby loci. Zmienność transgresywna Zwierzęta gospodarskie. jak i mitochondrialnym DNA. • w przedziale x ±2 S znajduje się ok. Jak już wspomniano. omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech). U trzody chlewnej. maternal effect). Wielkość efektu matki prę. • w przedziale x±S znajduje się ok. procent tłuszczu w mleku oraz wartość energetyczną mleka. Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw. • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny). Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw. rasy. Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189 .2.2% wszystkich obserwacji.6% wszystkich obserwacji cechy. z innych ras). wielkości matki oraz jej stanu fizjologicznego i zdrowotnego. Mogą one maskować oddziaływanie poligenów. 95.4% wszystkich obserwacji. a także wielu czynników środowiskowych.• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy. • w przedziale x±3 S znajduje się ok. nawet ras o ustalonym genotypie.

zwany inaczej genem głównym. Zjawisko to nosi nazwę transgresji. E i F są identyczne (D = E = F). Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. Efekty genów D. jakie obserwowano u rodziców. W badaniach prowadzonych na simentalerach stwierdzono.wartości cechy takie. Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np. której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty. gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie. czyli wykazujące większą zmienność cechy. w którym obok poligenów działa gen o dużym efekcie. Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. Gen o dużym efekcie jest identyfikowany wówczas. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna. Cechy takie charakteryzują się rozkładem normalnym. U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25).3. E i F. growth hormone). że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D. W przypadku niektórych cech zaobserwowano zmienność. warunkujące różną wydajność mleczną. równą wartości cechy u rodziców. Geny o dużym efekcie W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). 7. iż zwierzęta homozygotyczne pod względem allelu B hormonu 190 . Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy. spłaszczony albo nadmiernie uwypuklony. Genotyp ddeeff warunkuje wydajność 2400 kg mleka.3. quantitative trait locus). Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej. DDEEFF — 4800 kg. warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka). natomiast heterozygotyczny DdEeFf— 3600 kg mleka. Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang. bądź wartości wyższe lub niższe niż u rodziców. W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot). a każdy z nich zwiększa produkcję mleka o 400 kg. genotyp DDEEFF. Niektóre geny o dużym efekcie zostały wykryte przypadkowo. wykorzystywanej w pracy hodowlanej. Ilustruje je przykład: Załóżmy. Jest to wynikiem dziedziczenia.

191 .wzrostu charakteryzowały się o 382 + 18. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej. Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie. porcine stress syndrome). Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych. jak karłowatość i akromegalia. Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną. a najnowsze osiągnięcia są omówione w rozdziale 12. które allele mają związek z użytkowością mięsną. Dotychczas wykazano. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. Zwierzęta takie są więc dobrym materiałem do tuczu. Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena. Stwierdzono także. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. a IGF-1 wspomaga jego działanie. Gen receptora rianodyny (KYR1). Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka. Badania cytogenetyczne wykazały. iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe). Świnie U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie.3. Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu. powodowane transportem. Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni. W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. jak zawartość mięsa w tuszy i powierzchnia oka polędwicy. warunkami termicznymi i niektórymi czynnikami chemicznymi. Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt. Hormon wzrostu reguluje rozwój mięśni. a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu.5. Dalsze badania zmierzają do ustalenia. z równoczesnym zmniejszeniem otłuszczenia.5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA. będących nosicielami zmutowanego allelu. bydła i szczura. iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe.

W obrębie genu RYR1 stwierdzono 18 mutacji punktowych. W innym. początkowo oznaczono go symbolem Haln. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI). co umożliwiło opracowanie molekularnych testów diagnostycznych. jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. Mutacja ta likwiduje miejsce trawienia niektórymi enzymami. Badania przeprowadzone przez naukowców kanadyjskich wykazały. Procedurę tego testu przedstawiono na rycinie 7-1.Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan. fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. natomiast w zmutowanym 192 . że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1). Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T. z których najistotniejsza jest mutacja w 1843 nukleotydzie. opatentowanym przez badaczy kanadyjskich. W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki.

a u koni w 10 chromosomie. Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością. Pierwsze sugestie co do istnienia genu o dużym efekcie. powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym.jeden prążek długości 81 pz. iż zlokalizowany w chromosomie l (1p2. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19. dla homozygotycznego (nn) . że jeden z alleli tego genu. Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu.5-2. estrogen receptor gene) może mieć istotny wpływ na wielkość miotu. wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę. duroc). że enzym nie znajduje miejsca cięcia. czego wynikiem jest uzyskanie nie strawionego fragmentu genu. Stwierdzono. pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie 193 . Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych. ale tylko tranzycja G-»A w kodonie 200. Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz. Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). u bydła w 18. W pracy hodowlanej należy prowadzić kojarzenia tak. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3). warunkuje cechę kwaśnego mięsa. by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. 32 pz. występujący w chińskiej plennej rasie meishan. Test molekularny wykrywający mutację genu PRKAG3 został opatentowany.. Wyniki tych badań wskazują. natomiast dla heterozygoty trzy prążki: 81 pz. yorkshire. U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce). Gen wpływający na wielkość miotu (ESR).4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang.allelu zmiana tej sekwencji powoduje.4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy. prowadzone u świń innych ras (niemiecka landrace. 49 pz. W genie tym stwierdzono siedem mutacji.

W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. Bydło Geny białek mleka. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka. Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII. Gen β-laktoglobuliny ma długość około 7800 par zasad. Jest to konsekwencja różnic w sekwencji nukleo- 194 . Gen ten nie wykazuje plejotropowego negatywnego działania na inne. Białko wariantu A różni się od B dwoma aminokwasami. Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy. identyfikowanych w mleku córek. W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC). wpływa na wydajność mleka i jego składników. ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. Opracowana została metoda identyfikacji genotypów κ-kazeiny. jak wzrost i grubość słoniny na grzbiecie. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń. tłuszczu i kazein oraz lepszą przydatnością technologiczną. przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. utrzymywanych w zakładach unasieniania. wariant A alaninę (GCT). wyprowadzanych z udziałem rasy meishan. wykorzystywanych jako dodatkowe kryterium selekcji buhajów. zlokalizowany w chromosomie 6. gdyż określony wariant tego białka. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT). podczas gdy w wariancie B — treonina (w DNA kodon ACC). podobnie jak κ-kazeiny. natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć. Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. białka i tłuszczu). Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. Gen β-laktoglobuliny uważany jest za gen o dużym efekcie. Gen κ-kazeiny. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. ekonomicznie ważne cechy. zawiera 7 eksonów.1754). 7-2). Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny.

Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa. Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras. a — marker. Duża masa płodu stwarza wyraźne trudności naturalnego porodu. Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem. Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej.AB AA BB Ryć. zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi. należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci. Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. muscular hypertrophy). jak i ich mieszańców. 7-2. Rozwiązaniem 195 . dlatego mutacja ta jest oznaczona jako nt821(del11). jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). 2 — trawienie enzymem restrykcyjnym Hindlll tydowej obu alleli. mniejszy obwód i masa jąder. Gen miostatyny należy do rodziny TGFβ (ang. Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2. l — trawienie enzymem restrykcyjnym Hinfi. transforming growth factor β). Gen hipertrofii mięśniowej (MH — ang. b — produkt nie strawiony. natomiast u krów dłuższa ciąża. Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne.

która jest odpowiedzialna za substytucję cysteiny przez tyrozynę. Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. Prowadzone są badania w celu jego izolacji. Hipertrofia ujawnia się u potomka wówczas. U owiec występuje mutacja powodująca hipertrofię mięśniową.symbol CLPG. że istnieją dwa allele — CLPG i clpg. Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. czy od matki. czy gen CLPG pochodzi od ojca. gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). pyge -. począwszy od pozycji 419 nukleotydu. Gen CLPG pochodzący od matki jest nieaktywny. takie jak gen Inverdale (FecXI. w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego. Mutacje a) i c) występują u bydła francuskiego maine-anjou.pośladki) -. c) transwersja G → T w nukleotydzie 676. nazwany callipyge (z greckiego calli — piękne. przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia. Ostatnio ustalono. Jest to pojedynczy autosomalny gen. natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. że locus ten podlega transkrypcji. Pomimo ujemnych następstw związanych z hipertrofią mięśni. Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji. b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. warunkujące zwiększony stopień owulacji. Przypuszcza się. b) tranzycja C→T w 610 nukleotydzie. Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. zlokalizowany w chromosomie płci X) 196 . który pełni nieznaną jeszcze funkcję regulacyjną. cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. noncoding RNA). a jego produkt to niekodujący RNA (ncRNA ang. Owce Gen hipertrofii mięśniowej (CLPG). która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy. mutacje te są charakterystyczne dla określonych ras bydła mięsnego.ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. U owiec wykryto geny główne. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów. 7-3 wkładka kolorowa). Przypuszcza się. Co ciekawe. które uszkadzają funkcję kodowanego białka. Jak wykazały ostatnie badania.

połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II). Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB. u których zwiększona plenność jest cechą poligeniczną. zawierającego miejsce mutacyjne.u owiec rasy romney. produkt PCR nie strawiony) dla homozygoty typu dzikiego. „Thoka" u owiec islandskich. gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. fecundity gene of booroola). Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego. . trzy prążki (110 pz. Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB. w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. W locus BMPR-IB wykryto mutację w 830 nukleotydzie. wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80. Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie). polegającą na tranzycji adeniny na guaninę. ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang. Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych. której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego. W przeciwieństwie do owiec ras wysokopiennych (owca romanowska. odpowiedzialnej za dużą plenność owiec rasy merynos booroola. uwarunkowaną genami o addytywnym efekcie. owca fińska). 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz. Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to.

198 . Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników. tak więc w populacji występuje określona liczba fenotypów. Weinberga. mimo iż dotyczyły nieraz grupy zwierząt. jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej. Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową.Rozdział Podstawy genetyki populacji Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia. Prawo równowagi genetycznej Struktura genetyczna populacji Populację tworzy określona. prawo to nosi nazwę Hardy' ego-Weinberga. Populację stanowią zwierzęta należące do jednego gatunku. mogące się rozmnażać i występować na danym obszarze. Rozpatrując daną cechę można powiedzieć. w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki. że każdy osobnik ma określony fenotyp.1. Hardy'ego i niemieckego lekarza W.H. Podstawowym prawem genetyki populacji. teoretycznie nieskończona liczba osobników. lecz zbiorowości określonej jako populacja. opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. Hodowla jest działalnością genetyczno-populacyjną. Ponieważ badacze ci działali niezależnie od siebie. 8.

Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci.5 (50%). W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych. które ten allel mógłby zająć w badanej populacji. a allelu recesywnego symbolem q. Częstość występowania. to: 199 . W genotypach 250 ptaków białych jest 500 alleli a. Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów. Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. Zatem w stadzie tym jest 1000 alleli A i 1000 a. Sposób postępowania obrazuje poniższy przykład. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego. Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu. Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca: Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków. Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów. podobnie frekwencja allelu a = 1000/2000 = 0. 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim). Częstość występowania (frekwencja) allelu A = 1000/2000 = 0. Jeśli frekwencję allelu dominującego oznaczymy symbolem p. ptaki niebieskie mają 500 genów A i 500 genów a. 250 ptaków czarnych ma w swych genotypach 500 genów A. Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). Oba te elementy są od siebie zależne. każdy ma dwa allele). Suma frekwencji obu alleli wynosi l (100%).5 (50%).z których każdy reprezentowany jest przez pewną liczbę osobników. Suma frekwencji wszystkich fenotypów równa się l lub 100%. oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). inaczej frekwencja danego fenotypu.

jeśli nie działają czynniki naruszające równowagę. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci. że: w dużej. zatem rozkład fenotypów i genotypów w tej populacji wynosi: Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga. losowo kojarzącej się populacji. a osobniki charakteryzują się równą płodnością i żywotnością.Rozpatrywana cecha dziedziczy się z niezupełną dominacją. bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna. frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie. Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci. wówczas struktura genetyczna w pokoleniu potomnym będzie następująca: czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. które mówi o tym. które wpływają na zmianę struktury genetycznej populacji. w której frekwencje genów u obu płci są jednakowe. a' zdarzają się również migracje i mutacje. 200 . O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej.

że frekwencja homozygot recesywnych wynosi q2. 8. jak i genów stwarza pewne trudności. W stadzie tym prowadzone są kojarzenia losowe. Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q. Frekwencja genów i genotypów w przypadku dominowania W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. Wiedząc.(EdEd) lub heterozygotyczne (Ede).3. która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0.2. Zatem obliczanie frekwencji zarówno tych genotypów. że zawierają jedynie allele recesywne. a 90 czerwonych. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych. Wiedząc. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych.09.3 = 0. łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q. gdyż w ich przypadku wiadomo na pewno. Pozostałe 910 krów ma genotypy homo. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący: 201 . Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej.7.8. że w przypadku losowych kojarzeń rozkład genotypów jest następujący: łatwo jest obliczyć frekwencję pozostałych genotypów: W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot.

przy czym p. 13 himalajskich i 2 albinosy. W populacji tej. r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. q dla genu dla genu c. genotypy i ich frekwencja są następujące (tab.q. Frekwencja poszczególnych fenotypów wynosi zatem: Frekwencję genów oznaczono symbolem p dla genu C. W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa). U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C. Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli. himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc). Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). 8-1): 202 . w której są kojarzenia losowe. fenotypy.

W danym przykładzie r2 = 0. znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc). Frekwencję genu można obliczyć następująco: W badanej populacji królików frekwencja genów umaszczenia jest więc następująca: 203 . że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi: Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego.013.Po dodaniu takich samych genotypów uzyska się rozkład: Z zestawienia tego wynika. stąd r = = 0. Podstawiając dane liczbowe.114. (q + r) równa się: Frekwencję genu c = r można obliczyć.

który ją warunkuje). Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu. Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0. lecz przyjmie postać: przy czym A jest genem dominującym. jak i u mężczyzn. U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm. których liczba w genotypach jest jednakowa bez względu na płeć osobnika.08. natomiast a — jego recesywnym allelem. geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej. Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym. U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi: U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu: 204 . czyli zgodna z rozkładem dwumianowym.000 8. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet.ogółem = 1. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych.4.

1472 kobiety będą rozróżniały barwy. O ile mutacje i dryf genetyczny nie zależą od hodowcy.= q = 0. umaszczenie zwierząt futerkowych. o tyle pozostałe czynniki są związane z jego świadomą działalnością. jego frekwencja zmaleje o wartość równą up. pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD). dobór par do kojarzeń i dryf genetyczny.= p = 0.08 Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64. natomiast częstość mutacji odwrotnej symbolem v. Natomiast mutacja genu warunkującego cechę jakościową. w której mutacja wystąpiła. powodująca pojawienie się nowej barwy okrywy włosowej. Jeśli zmutuje allel dominujący.5. zależy od genetycznego uwarunkowania danej cechy. W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ). Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie: 205 . 8. Analogicznie. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus. kontrolujących cechę ilościową. iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u. migracje.92 d. Wszystkie te czynniki. może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji. Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. np. mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji.D. selekcja. Czynniki naruszające równowagę genetyczną Do czynników naruszających równowagę genetyczną populacji należą: mutacje. Mutacje Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. Jeśli zmutuje jeden z genów addytywnych. która może wpłynąć na zmianę struktury genetycznej populacji. ale będą nosicielkami genu daltonizmu (Dd). W rozdziale dotyczącym mutacji podano. z wyjątkiem doboru. ale także mogą się pojawić nowe allele. Ekspresja fenotypowa mutacji. pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ). mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq. wpływają na zmianę frekwencji genów i genotypów. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej).

Ede = 2pq = 0.14 alleli Ed zmutowało w kierunku allelu e. po mutacji: EdEd = p2 = 0. Migracje Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu. natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0. w przypadku wielokrotnego krzyżowania.49. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0. Może nawet. allelu czerwonego umaszczenia e = q = 0.7. doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw.4488.09. które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną.4356. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów.34. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji. Ede = 2pq = 0. powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. i wyniosła 0. Zmianie uległa także frekwencja genotypów. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0. Natomiast krzyżowanie uszlachetniające. krzyżowanie wypierające).3. Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji) 206 . Jeśli jest to zabieg jednorazowy. po pewnym czasie populacja wróci do równowagi. ile razy dokonywane jest to krzyżowanie. W wyniku mutacji genowej.1. a 6 alleli e w kierunku allelu Ed. ee = q = 0.Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0. czyli ustali się nowy układ genetyczny. wielkość zmian frekwencji genów i genotypów jest różna.66. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. ee = q2 = 0. W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja. może ona dotyczyć wprowadzania nasienia. zatem migracja nie zawsze wiąże się z wprowadzaniem osobników. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia.42. Przy krzyżowaniu różnych ras w zależności od tego.1156.

że do omawianego wcześniej stada liczącego 100 krów. ee = q= 0. 207 . z frekwencją allelu Ed wynoszącą 0. obniżenia płodności i produkcyjności lub niepożądanego genotypu.9 + (l -0.01. które hodowca zamierza pozostawić do hodowli. a frekwencję genu u osobników wprowadzonych do stada literą p'. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0. to część osobników rodzimych będzie równa (1 —m).42. wprowadzono 20 krów. Zmiany w strukturze genetycznej populacji zależą od tego. a eliminuje z populacji zwierząt geny niepożądane. E d e = 2pq = 0. ee = q2 = 0. zmalała osobników heterozygotycznyh Ede i homozygotycznych ee. w którym frekwencja allelu Ed wynosiła 0. Hodowca preferuje geny korzystne.49. jakie geny czy genotypy są preferowane. Ede = 2pq = 0.74 czyli wzrosła o 0.26. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy.9.18. E'e = 2pq = 0.2 • 0. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej. Selekcja Wybór zwierząt.74) = 0.0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd. Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0. stanu zdrowotnego. ee = q = 0.09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0.7 = 0. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku.3848.oznaczymy literą m.5476.4. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0. zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy. nazywany jest selekcją. Nowa frekwencja allelu e wynosi (1 — 0.2) • 0.7.81. Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p.

złożonym z 1000 ptaków. Zmiana frekwencji genu. co oznacza. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie. że w omawianym już wcześniej stadzie kur andaluzyjskich. W pewnym stadzie. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego: Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0.013 i wyniesie 0. można obliczyć ze Jeśli natomiast selekcja preferuje genotyp recesywny.8. będącą jej konsekwencją. Dobór par do kojarzeń W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe.4. zależy od rodzaju tej selekcji. że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. Załóżmy. wartość l współczynnik osiąga. prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. to oznacza. będąca konsekwencją selekcji. wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. w którym frekwencja allelu bezrożności wynosi 0. prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. że wartość O jest wówczas. gdy usuwane są wszystkie niepożądane genotypy.187. gdy nie ma w ogóle selekcji. zastosowano kojarzenia w obrębie takich samych 208 . Jeśli współczynnik selekcji będzie wynosić 0. zmianę częstości genu recesywnego. wówczas frekwencja genu tworzącego ten genotyp wyniesie: wzoru: Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną. Cecha ta dziedziczy się z dominacją zupełną. Efekt selekcji zostanie zachowany.Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. Współczynnik ten może przybierać wartość od O do l. Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji. czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled).

25 AA + 0. stado powróci do stanu równowagi genetycznej. W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej 209 .25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie Frekwencja genów pozostała nie zmieniona. Aby się o tym przekonać. np.genotypów. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych. pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt. gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami. W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0. Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych. Odwrotna sytuacja zaistniałaby. Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji. koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi. maleje natomiast częstość genotypów heterozygotycznych.5 Aa + 0. stosowane są kojarzenia osobników spokrewnionych.5 (allel a). Oznacza to. można przeprowadzić obliczenia: Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji. Niekiedy. iż kojarzono koguty czarne z kurami czarnymi. ojca z córką czy matki z synem. W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0.5 (allel A) i q = 0.

iż allele niekorzystne z reguły są recesywne. w której frekwencja genu dominującego wyraźnie wzrośnie. to w następnym pokoleniu ustali się nowa równowaga genetyczna. to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach. 8.brat x siostra) prowadzą do wytworzenia tzw. iż w potomstwie uzyskamy 5 osobników homozygot dominujących. w których stopień homozygotyczności jest bliski 100%.6. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. Jeśli było to jednorazowe zaburzenie. że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych. zwłaszcza w małych populacjach. żywotności czy ujawnienie się wad dziedzicznych. zjawisko tak nazwane przez Wrighta w 1931 roku. Biorąc pod uwagę. jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać. Szczepy wsobne są wykorzystywane w badaniach biomedycznych. którego skutkiem będzie zmniejszenie płodności. szczególnie niebezpieczny może być wzrost homozygot recesywnych. szczepów wsobnych. Dryf genetyczny Dryf genetyczny. Im większa jest pula genów w jakiejś populacji. 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus. tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210 . Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. w których działa on najsilniej. Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych. która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. polega na zmianie frekwencji genów i genotypów w małych populacjach. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. Może jednak się zdarzyć tak. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt.

zalecane jest monitorowanie zmian w strukturze genetycznej populacji. może dojść do znacznego ograniczenia puli genów. Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini. amylazy. można także przedstawiać ją w procentach. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych. należące do markerów genetycznych klasy I. Mogą to być loci kontrolujące syntezę transferyny. albuminy. różne typy białek surowicy krwi czy enzymy erytrocytarne. By temu niekorzystnemu zjawisku zapobiec. Wartość tego parametru zawiera się w granicach od O do l. które zachodzą w wyniku pracy hodowlanej. czego wynikiem będzie utrata zdolności adaptacyjnych. czyli markery genetyczne klasy II). opisanych w rozdziale: Markery genetyczne.i mikrosatelitarny. ceruloplazminy czy anhydrazy węglanowej. na przykład warunkujących antygeny erytrocytarne. Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru: 211 .wych. esterazy. Na skutek długotrwałej selekcji. zwłaszcza w małych populacjach.

Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi. unweighted pair group method). najczęściej stosowany jest wzór: Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów. najdalszego sąsiedztwa — CLM (ang. complete linkage method) lub skupienia parami — UPGM (ang. tak na podstawie polimorfizmu sekwencji mikrosatelitarnych. polymorphic Information content). 212 . które cechuje duża zmienność genetyczna. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. jak i polimorfizmu białek i antygenów erytrocytarnych. Szacowanie dystansu genetycznego i wybór ras. należy znać frekwencję wszystkich alleli w danym locus: Dystans genetyczny Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw. na przykład: najbliższego sąsiedztwa — SLM (ang. obliczonych różnymi metodami. Do szacowania dystansu genetycznego (Dr). Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci. By obliczyć wartość PIĆ. single linkage method). dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. O markerach genetycznych jest mowa w innym rozdziale.Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. a także między populacjami w obrębie gatunku.

. Na przykład. Analizą objęto 141 koni z linii El Paso. Palasa a Partnera.Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp. najmniejszy między linią Celebesa a Probata. wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0. Partnera a Banata 0. 146 z linii Celebesa. 150 z linii Banata. Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych.32. 369 z linii Probata. a także między linią Banata a Celebesa i Probata.37 (ryć. 50:111-120.39 oraz Palasa a Partnera 0. 213 . 219 z linii Palasa. Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa. 146 z linii Partnera i 202 z linii Bandosa. 8-1). 1997). Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM. Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III. Prace i Materiały Zootechniczne.

.

Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne). Im mniejsza zmienność genetyczna w danej populacji. wykorzystując wzór: gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1. określający prawdopodobieństwo. opisaną w rozdziale: Metody analizy i modyfikacji genomu. W wyniku analizy polimorfizmu minisatelitarnego (tzw. że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA. band sharing).ang. a także metodę RAPD. odcisk palca DNA. tym większa wartość tego współczynnika. W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej. Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS . opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji). .

U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ). Determinacja płci ssaków Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw. mają gonady męskie i żeńskie.Rozdział 9 Determinacja i różnicowanie płci oraz interseksualizm Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów. 9. Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie. czyli zmieniają one płeć w ciągu życia. płci gonadowej i 3) uformowanie się wewnętrznych 216 .1. 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. Ten typ determinacji płci obserwuje się u wielu gatunków gadów. a w przypadku ptaków Z oraz W. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. tzn. behawioralna determinacji płci. Zwierzęta takie są zazwyczaj obojnakami. a samice heterogametyczne (układ Z W). które są hermafrodytami sekwencyjnymi. płeć chromosomowa. a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. głównie temperatury. wielu gatunków żółwi i niektórych gatunków jaszczurek. W przypadku ssaków wyróżnia się chromosomy X oraz Y. w jakich rozwijają się zarodki. a płcią homogametyczną są samice (układ XX). Płeć może zależeć od warunków środowiska zewnętrznego. Z kolei u niektórych gatunków ryb zachodzi tzw. Wśród ryb spotyka się również gatunki. w tym u wszystkich krokodyli. U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci. U ssaków płcią heterogametyczną są samce (układ XY).

a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. pici fenotypowej (ryć. 9-1). 217 .i zewnętrznych cech płciowych — powstanie tzw. Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym. W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe. Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego. Pojawiają się one w endodermie pęcherzyka żółtkowego. Pleć fenotypowa obejmuje również zmiany powstające w mózgu.

W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi. przełączenie rozwojowe. oprócz kory nadnerczy. Wiadomo o nich. SRY. Od końca lat 50. W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). palce cynkowe. W rosnącej gonadzie wyróżnia się część korową i rdzeniową. a w tym: WT1. czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. także w niezróżnicowanej gonadzie. Gen SF1 (ang. podobnie jak białko SRY. Produkt tego genu miał odpowiadać za tzw. ZFX i FOXL2.Dotychczasowe badania wykazały. Gen ten podlega ekspresji. Badania molekularne pokazały. Białko kodowane przez ten gen składa się z trzech regionów (ryć. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra. Produktem tego genu jest białko zawierające tzw. Fgf9. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. regulującego ekspresję hydroksylaz steroidowych. Badania cytogenetyczne prowadzone u ludzi dowiodły. w przeciwieństwie do jajnika. Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. które pełni rolę czynnika transkrypcyjnego. którego locus występuje w chromosomie Y. steroidogenic factor 1) koduje białko receptora jądrowego. którego produkt należy. że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y. Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9. SF1. testis determining factor) — czynnik determinujący jądro. Przyjęto. że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów. wiadomo było. do grupy białek określanych skrótem HMG (ang. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. sex determining region Y). SOX9. że jest tam zlokalizowany gen TDF (ang. 218 . Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. high mobility group). polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej. a część korowa w jajniku. Gen WT2 (ang. gdzie obserwuje się zanik jego ekspresji. że funkcja tego genu jest tożsama z funkcją genu SRY (ang. że pełnią funkcję czynników transkrypcyjnych. że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. 9-2).

który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać.Region środkowy. w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1. niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik. Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. że jego locus występuje w chromosomie X. Miillerian inhibitor substance). odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. również położonemu w chromosomie X. aniżeli w odniesieniu do jądra. anti-Mullerian hormone — AMH). Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. składający się z 79 aminokwasów. że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego. po pojawieniu się produktu genu SRY. a z przewodów Miillera — jajowody i macica. Ekspresja tego genu zachodzi w komórkach Sertolego. Bardziej szczegółowe dane wskazują. Białko SRY. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza. ma strukturę podobną do białek z grupy HMG. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. a drugi rozwija się. Obecnie większą rolę przypisuje się genowi ZFX (tzw. tak jak białka WT1 i SOX9. że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9. oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). pełni funkcję czynnika transkrypcyjnego. że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. Początkowo przypuszczano. Wiadomo. a jego produktem jest jądrowy receptor dla hormonów. Z testosteronu powstaje dihydrotestosteron. Z przewodów Wolffa rozwinąć się mogą nasieniowody. określanego także jako hormon antymiillerowski (ang. czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. w momencie kiedy rozpoczyna się proces formowania gonady męskiej. Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej). wysepka CpG). Bardzo ciekawe jest również to. Kaskadowe włączanie tych genów. Gdy gen SRY jest nieobecny. omówiony wcześniej. który podtrzymuje rozwój przewodów Wolffa. odpowiada za prawidłowe różnicowanie się gonady męskiej. gen palca cynkowego). W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu 219 . a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9).

lub do zahamowania podziału mejotycznego. Znane są też geny położone w innych częściach chromosomu Y. Szczególnie istotną częścią chromosomu Y jest region AZF. że w chromosomie Y poza genem SRY.kodującego testosteron. jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY. Zakłada się. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci. Jeśli w genotypie wystąpi delecja tego locus. który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej. Gen ten umiejscowiony jest w obu chromosomach płci. że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. takich jak całkowity brak spermatogoniów. W regionie tym występują geny. np. czy też klonowania. Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y. z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. występują także inne geny. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. macicę i górną część pochwy. w których genotypie występuje duplikacja locus DSS (DAX1). W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody. oznaczających czynnik odpowiedzialny za powstanie azoospermii. Jego nazwa pochodzi od słów angielskich azoospermia factor. samic biorczyń. Należy również zwrócić uwagę. RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1). gen RBM (ang. to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. np. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. czyli brak plemników w ejakulacie. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. to rozwój w kierunku męskim nie jest zakłócony. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro). których ekspresja związana jest z przebiegiem spermatogenezy. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa. Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy. gen Ube1Y (ang. 220 . Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). splicing) mRNA.

Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego. głównie przeżuwaczy. kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych. to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci 221 .ubiąuitin activating enzyme-1). co w konsekwencji prowadzi prawie zawsze do niepłodności. frymartynizm). Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów. że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. że informacja genetyczna zawarta w chromosomie Y jest bogatsza. ze względu na bardzo duże zróżnicownie obserwowanych zmian. w którym powstały połączenia naczyniowe. Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy. to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony.2. który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach. kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski. w którym kształtują się jajniki. często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy. 9. Połączenie krwiobiegów bliźniąt różnopłciowych sprawia. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. Interseksualizm Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego. Jeśli połączenie łożysk dotyczy płodów różnopłciowych. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian. Frymartynizm Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych. niż to wcześniej zakładano. co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników. które określa się terminem interseksualizmu lub obojnactwa. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu. W rozwoju embrionalnym różnicowanie się jąder poprzedza okres. Z przedstawionych wyżej informacji można wyciągnąć wniosek.

Linie te różnią się układem chromosomów płci — w jednej występuje układ XX. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. w mniejszym lub większym zakresie. że rozwinie się nawet gonada męska. a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. wskaźnik niepowtarzalności rui itp. Znacznie rzadziej zdarza się to u owiec (od l do 10%. dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie. Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo. to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych. że badania kliniczne samic są niewystarczające.) są często obniżone. Okazuje się. stwierdza się niepłodność samic frymartynów. zależnie od 222 . niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych. że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż). gdy zewnętrzne narządy płciowe są prawidłowo uformowane. Szacuje się. chociaż parametry określające ich przydatność rozpłodową (np. Buhaje takie mogą być wykorzystywane w rozrodzie. Chimeryzm dotyczy również erytrocytów. że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy. Z tego powodu we krwi frymartynów. Bardzo pomocne okazało się badanie cytogenetyczne. Biorąc jednak pod uwagę. Trzeba podkreślić. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy. a także samców będących bliźniętami frymartynów. Ze względu na wspólną cyrkulację krwi u płodów. Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany. polegające na ustaleniu zestawu chromosomów płci w leukocytach. które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. obraz nasienia. sekwencje mikrosatelitarne). że badany osobnik jest frymartynem. Powstawanie anastomoz jest bardzo często stwierdzane u bydła.żeńskiej w takim stopniu. Ponieważ linie te pochodzą od dwóch różnych genotypów. zależnie od rasy). a w drugiej układ XY. Możliwe jest również powstanie połączeń. Identyfikacja sekwencji typowych dla chromosomu Y (np. a w ślad za tym drogi płciowe będą miały charakter męski. a często u owiec (od 40 do blisko 100% ciąż. szczególnie wówczas. stwierdza się obecność dwóch linii komórkowych — jednej własnej. których łożyska są połączone anastomozami. w komórkach błony śluzowej. Wówczas dihydrotestosteron. ale także molekularnych (np. może być wskazówką. że prawie we wszystkich przypadkach. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych. a drugiej współbłiźniaka. dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. może zakłócić. powstający z wydzielanego przez komórki Leydiga testosteronu. proces kształtowania się zewnętrznych narządów płciowych. przy jednoczesnym ich braku np. w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę.

Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie. a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. miały niedorozwinięte jądra. w zakresie od 0. Konsekwencją występowania 223 .5% (bydło) do kilku procent (niektóre rasy owiec. Charakteryzowały się one gorszym tempem wzrostu. w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie. U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych. Z badań przeprowadzonych na owcach wynika. że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. Kilkanaście takich przypadków opisano u buhajów. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych.rasy). Z jednej strony mogą to być aneuploidie. Zespół niewrażliwości na androgeny Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników. Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. co oczywiście prowadziło do bezpłodności. które są fenotypowo prawidłowo rozwinięte. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY. merynos booroola). Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. Z drugiej strony ważną rolę odgrywają mutacje strukturalne. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). w które są zaangażowane chromosomy płci. np. Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. Mutacje chromosomów płci Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY. XYY lub XXX).

przy jednoczesnym braku kluczowego genu SRY. Zespół odwróconej płci u koni W hodowli koni częstym typem interseksualizmu jest tzw. STS). W genotypie tych zwierząt nie ma genu SRY. z wykorzystaniem techniki PCR. przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem. Najczęściej zespół ten diagnozowany jest u fenotypowych samic. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder. częściowa lub całkowita delecja). zespół odwróconej płci (ang. Badania molekularne genów położonych w chromosomie Y. że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze. Okazało się. Interseksualizm bezrogich kóz Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz. Bezrożność kóz uwarunkowana jest przez dominujący allel P. który uznawany jest za niezbędny do rozwoju gonady męskiej. Przyczyny takiego stanu mogą być różne. co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim. a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie. tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych. ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL. Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane. a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. ale z powiększoną łechtaczką. a stopień 224 . od prawie typowo samczych do samiczych. jak i wewnętrznych cech płciowych. Taki typ odwrócenia płci spotykany jest również u kóz. a w ich genotypie nie stwierdza się genu SRY. chociaż zdarzają się zwierzęta z powiększoną łechtaczką. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte. które mają układ chromosomów XY. który polega na niezgodności między płcią fenotypową i chromosomową. w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego.nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu. ZFY. a wśród nich należy wymienić: mutację w locus SRY (np. Osobniki takie powinny być samicami. sex reversal). świń i psów. które mają układ chromosomów płci XX. U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX.

że odpowiedzialna za to jest delecja 11 700 par zasad. Zaburzenia te polegają na braku lub niedorozwoju pochwy. Allele te prezentują typ dziedziczenia pośredniego. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej. Ciekawe jest. że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe. W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono. z tym jednak że genotyp Rr+ wykazuje niepełną penetrację. który jest odpowiedzialny za rozwój interseksualny. że kariotypy obu gatunków są prawie identyczne. a rzadko jajnikojądra. że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek. U obu ras bydła stwierdzono. Wreszcie mogą występować również osobniki. co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym). ale w części proksymalnej (w pobliżu centromeru). które mają zdecydowanie samczy fenotyp. Z badań porównawczych wiadomo. ukończono wieloletnie badania. jest allel R genu Roan (umaszczenie dereszowate) u bydła. polledness and intersexuality syndrome). również w zakresie układu loci w chromosomach. a w ich genotypie występuje gen SRY. allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). Co więcej należy podkreślić. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. Allel R odpowiada za powstanie białego umaszczenia. czyli mających układ chromosomów płci XY. szyjki macicy i macicy. Zespół tych zmian jest określany jako choroba białych jałowic 225 . Można z tego wyciągnąć wniosek. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm. że jest on położony w chromosomie l — w części dystalnej. że locus genu bezrożności bydła został umiejscowiony również w chromosomie l. Choroba białych jałowic Innym przykładem genu o działaniu plejotropowym. których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. zlokalizowana w niekodującym fragmencie DNA. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. Okazało się. Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym.nasilenia tych zmian jest bardzo zróżnicowany. Gonady zazwyczaj mają strukturę jądra. W 2001 r. natomiast jajniki są rozwinięte prawidłowo. tzn. Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. gen PIS — ang. że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci.

W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej. a srom tworzył z odbytem wspólny otwór (ryć. Przypuszcza się. w którym ostatnio umiejscowiono locus genu Roan. W potomstwie jednego knura pojawiło się kilkanaście obojnaków. w których kariotypie występowały dwa chromosomy X. bowiem ponad 90% chorych jałówek ma umaszczenie białe.(ang. a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. że choroba białych jałowic ma złożone podłoże. white heifer disease). a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny. pomimo nieobecności genu SRY. Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła. Tło genetyczne tych przypadków jest słabo poznane. a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny).XX. Badania chromosomowe wykazują. Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym.3%. Można natomiast przypuszczać. że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm. Locus tego genu został wcześniej zmapowany w regionie. Wśród nich niejednokrotnie zdarzają się przypadki.XY. Interseksualizm u świń Przypadki interseksualizmu u świń obserwuje się z częstością około 0. że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38. w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe. . Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. 9-3 wkładka kolorowa). Zakłada się. Sytuacja taka wskazuje. gdzie gonady mają strukturę jądra lub jajnikojądra. pomimo braku genu SRY w ich genotypie. macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich. Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38. U zwierząt tych stwierdzano obecność jąder. że genem roan może być gen kodujący czynnik wzrostu komórek tucznych. że powstanie gonady męskiej może nastąpić pomimo braku genu SRY.XX/38. Dotychczasowe obserwacje dowodzą. z tym jednak że łechtaczka była bardzo powiększona. który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego.

iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje. Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna. Jest pięć typów łańcuchów ciężkich (gr. zdolność uczenia się. są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. Zastanawiające jest. której celem jest zwalczenie.Rozdział 10 Genetyczne podstawy odporności i oporności Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał. ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego. Genetyczne podłoże różnorodności przeciwciał Immunoglobuliny.gamma 227 . jakim jest główny układ zgodności tkankowej.. usunięcie tych obcych białek. α .delta. połączonych z dwoma łańcuchami lekkimi (ang. bakterii czy wirusów). mimo że ma tylko pięć klas przeciwciał. adaptatywnej).. Są one elementem odporności swoistej (nabytej. reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm. wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato. podobnie jak układ nerwowy. ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np. γ . light — L).1. czyli przeciwciała. Ma on. o masie po 25 kDa. heavy — H). 10. δ . po 50 kDa każdy.. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). zapamiętywania. Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. ε .epsilon.alfa..

W części stałej łańcucha ciężkiego.i μ . D. constant — C). W części zmiennej znajdują się trzy regiony hiperzmienne (ang. w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie. utworzonej przez łańcuchy ciężkie. oznaczone HV1. których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. hinge region). u koni l: 25). variable — V) oraz części stałe (ang. HV2 i HV3. IgD. Stosunek przeciwciał.. które mają łańcuch lekki typu κ. hypervariable). jak i lekkie mają części zmienne (ang. G i M od symboli łańcuchów ciężkich. nazywane są także regionami determinującymi dopasowanie (ang. Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi. IgG i IgM. u myszy l: 20. między domeną CH1 i CH2. do łańcucha λ zależy od gatunku (np. Badacz ten odkrył. E. Ponieważ regiony te determinują swoistość przeciwciał. Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin.mi) i dwa typy lekkich (κ— kappa i λ. complementarity determining regions CDR). Zarówno łańcuchy ciężkie. iż informacja genetyczna 228 . Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku. u ludzi wynosi on 70:30. Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA. natomiast A. Przeciwciało ma kształt litery Y (ryć. IgE. 10-1). a wzdłuż jej ramion znajdują się łańcuchy lekkie. region zawiasowy (ang. — lambda). znajduje się tzw.

Część stała obu rodzajów łańcuchów jest kodowana przez gen C. Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie. natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A. iż dziedziczone są nie całe geny immunogłobulinowe. przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V. u myszy natomiast odpowiednio w chromosomach 2. Różnorodność przeciwciał. a nie na jego powinowactwo do antygenu. natomiast geny łańcucha lekkiego typu κ w 2. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. 6 genów funkcjonalnych i 3 pseudogeny regionu J. Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V. D. natomiast łańcucha ciężkiego przez trzy geny: V. a łańcuchów lekkich z rekombinacji regionów V. ] i C. kilkadziesiąt genów D i kilka genów J. D (ang. Rekombinacyjne łączenie się genów. których kolejność łączenia się jest następująca: gen D z genem J. ich swoistość wynikają z tego. następnie z genem V. diversity) i J. może kilkaset). które nazwał segmentami. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen. variable) i J (ang.immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów". zachodzące dzięki aktywności enzymu — rekombinazy. Proces syntezy przeciwciała następuje po skompletowaniu genów. 6 i 16. powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. Geny determinujące region C różnią się od pozostałych tym. dla lekkiego — kilka. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. J i C. ale ich segmenty. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D. 10-2). że wpływają na funkcję przeciwciała. typu λ w 22 chromosomie. Różnorodność przeciwciał wynika z wielu przyczyn. Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla.. joining). 229 . Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. Przypuszczalnie jest wiele genów kodujących region V. Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt. czyli połączeniu się segmentów po jednym z każdej grupy minigenów. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang. jest głównym źródłem różnorodności przeciwciał.

rzadziej natomiast delecje.2. Genetyczne podłoże różnorodności receptorów limfocytów J W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B. które razem stanowią przeciwciało. Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu. 10. Najczęściej są to mutacje punktowe. prowadzi to do zmienności na złączach i utworzenia nowego genu. powodujące zmianę pojedynczego aminokwasu.Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J. przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego. Ponieważ są to nowo powstałe odcinki DNA. atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T). bądź też usuwane (do około 20 nukleotydów). będące specyficznym receptorem tego limfocytu. tym samym liczba wariantów genu D] może być zwiększona około 10 razy. Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego. Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu). oraz odpowiedzi typu humoralnego 230 . insercje lub konwersje. Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). natomiast genu VDJ następne 10 razy. V-D i D-J) mogą być wstawiane nukleotydy (od l do 15).

2 regionów D i 12 genów dla łańcucha β-J. cytotoksyczne CD8. Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. zachodzi podobnie jak rekombinacja genów przeciwciał. Poprzez proces rearanżacji genów. Limfocyty pomocnicze mają receptory CD4. Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie. że wszystkie elementy genów są włączone w rearanżacje. podobnie jak limfocyty B. Podobnie.5 x 106 α-β heterodimerów. około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V. D i J (łańcuchy p i §). Oczywiście jest mało prawdopodobne. Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ.3. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. Badania polegające na przeszczepach skórnych 231 . Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I. Główny układ zgodności tkankowej — MHC Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. 10. odpowiedzialnych za przyjęcie przeszczepu. Proces rearanżacji elementów genów receptorowych.(Th — pomocnicze limfocyty T). które odpowiadają za syntezę przeciwciał. ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2. który kontroluje ich syntezę. Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej. Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ). który następuje podczas dojrzewania komórek T w grasicy. jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. doprowadziły do wykrycia grup (klas) antygenów oznaczonych I. Prowadzone w latach 30. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi. II i III. przez Petera Gorera poszukiwania innych antygenów grupowych krwi.

U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo. ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech). zwłaszcza transplantacji szpiku kostnego. Antygen H-Y występuje tylko u samców. pochodzi tylko od matki. minor histocompatibility loci). Natomiast inny antygen. major histocompatibility complex — MHC). Antygeny te są istotną barierą podczas transplantacji tkanek. Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. maternally transmitted antigen). że większość z nich znajduje się w chromosomie 2. nazwany Mta (ang.między tymi liniami. iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. gdy biorca i dawca są zgodni pod względem haplotypów MHC. gdyż gen kodujący go jest zlokalizowany w chromosomie Y. a tylko w niewielkim stopniu od innych loci. być może dlatego. nazwanych słabymi antygenami zgodności tkankowej (ang. natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska. H-3. Zatem jest on przekazywany przez ojca męskim potomkom. słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców). Tabela 10-1 Lokalizacja MHC i nazwa u poszczególnych gatunków 232 . Nawet wówczas. jak i ilościowej. wykazały. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i. często ich efekt jest niedoceniany. W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał. podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. H-5 i inne. wykonywanych dla kilkunastu kolejnych pokoleń. H-l.

w populacji istnieje bardzo duża liczba różnych haplotypów. są wysoce polimorficzne. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku. U drobiu nie stwierdzono regionu klasy III. Ponieważ MHC zawiera wiele genów oraz. często są one nazywane antygenami MHC. a drugim podstawową funkcję — LA (tab. w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów 233 . układ ten cechuje ogromny polimorfizm. C i A u ludzi). nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku. 10. iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu. jak już wspomniano. crossing over czy rekombinacji wewnątrzgenowych.3. Struktura i funkcje głównego układu zgodności tkankowej U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I. rzadziej mutacji punktowych.1. należące do klasy I i II (np. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt. 10-1). a wraz z nim — haploidalny genotyp MHC (haplotyp). regionu K. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. Zwłaszcza niektóre geny MHC. leukocyte antigens — LA). Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną. Z powodu powiązań tego układu z układem grupowym krwi B. będących glikoproteinami. D i L u myszy i B. powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I). W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów. II i III. MHC u drobiu nazwano kompleksem B. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych.Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA. Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka. Wykryto natomiast specyficzny region klasy IV. jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin. kodujący białka zlokalizowane na krwinkach czerwonych.

których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC. biorąc tym samym udział w reakcji przeciwko infekcji wirusowej. obecnie wiadomo. wpływa na możliwość immunologicznego rozpoznania obcych białek. w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. N-końcowy fragment łańcucha ciężkiego. Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. Łańcuch ciężki składa się z trzech części: • Najdłuższy. 234 . że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego. który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. Domeny αl i α2 odznaczają się polimorfizmem. Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. oznaczone symbolami αl. Jest on kodowany przez geny MHC i ma trzy koliste domeny. zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach. które kodują miejsce wiązania peptydów. Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T.• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie. W domenach tych występują alloantygeniczne miejsca. Mimo iż początkowo uważano. każda złożona z około 90 aminokwasów. a także w odrzucaniu przeszczepu. że MHC pełni funkcję tylko w odrzucaniu przeszczepu. 10-3). a więc w tych. stanowi około 80% jego długości i znajduje się na zewnątrz komórki. co zostało już udowodnione. natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. α2 i α3. Łańcuch ciężki jest kodowany przez geny MHC. Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny.

Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. śródbłonowej i wewnątrzkomórkowej. które są między nim a błoną komórkową. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. składają się z trzech części: zewnątrzkomórkowej N-końcowej. 10-4). komórki den-drytyczne i limfocyty B). • Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy. przechodzący przez błonę komórkową. Cząsteczki MHC klasy II. który leży w cytoplazmie komórki. Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie. stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi. Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin. regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I. oznaczonych symbolami α i β. W rowku tym wiązane są antygeny. podobnie jak łańcuch ciężki cząsteczki klasy I. Łańcuchy te.zawierające determinanty specyficzne dla osobników. Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. które następnie są prezentowane limfocytom T. • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy). kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β. 235 .

Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. jak i klasy II prezentują obcy peptyd (antygen) limfocytom T. a potem również zwierząt gospodarskich. Białka C2. że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC. klasyczne cząsteczki klasy I. 10-5). Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości. complement) i liczbą. gdyż ich miejsce wiążące pozostaje otwarte z obu stron. ponieważ mają zamknięte miejsce wiążące.1. Dotychczas wykryto co najmniej 15 genów klasy la. złożony z kilku aminokwasów peptyd. niektóre z nich też biorą udział w odpowiedzi immunologicznej.1. Badania sekwencji genu Qa-2. które określono symbolem H-2 (ryć. Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu. Późniejsze badania ujawniły.Zarówno białka MHC klasy I. I. Pierwotnie w MHC u myszy zidentyfikowano regiony K. Jednak cząsteczki klasy I mogą wiązać jedynie krótki. Główny układ zgodności tkankowej myszy Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy. 10. S i D. oznaczane symbolem la). z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib).3. Natomiast produkty genów kompleksu Tlą i Qa wyka- 236 . których jest łącznie z czynnikami regulującymi około 30. Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. Białka te są oznaczane literą C (ang. a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka.3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. kontrolujących syntezę klasycznych białek MHC klasy I. u myszy natomiast przez loci regionu S w obrębie H-2. W jego skład wchodzą białka surowicy i płynów tkankowych. Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). od kilkunastu do ponad 20 aminokwasów. C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III. Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I.

1% całego genomu. oznaczone symbolem Ir (ang. natomiast u myszy z trzech eksonów. który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. Gen ten u ludzi składa się z ośmiu eksonów.żują wiele różnic w porównaniu z antygenami transplantacyjnymi. u człowieka w 15 chromosomie. -P. immune response). 10-6). Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S). z wyjątkiem H2-P. czyli ponad 0. Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. u myszy w 2. Główny układ zgodności tkankowej człowieka • U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6. zajmuje łącznie około 4 mpz DNA (4 miliony par zasad). Struktura HLA przedstawiona jest na liniowym diagramie (ryć. Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E. w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom).3 i Tla zmapowano dotychczas 31 genów.3. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%. -O/N oraz -M. -F i -G należą do nieklasycznych cząsteczek klasy I. w grupie sprzężeniowej z locus dehydrogenazy sorbitolu. Białka klasy III są kontrolowane przez geny regionu S.2. 10. znajduje się poza MHC. Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A. -B i -C. Geny klasy II HLA znajdują się w pięciu podklasach: DQ.1. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny. Każda podklasa ma co najmniej jeden gen łańcucha α i β. bardzo istotny dla ekspresji produktów genów klasy I. DP. DOB/DNA i DM. DR. przy czym trzy pierwsze . Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I. W regionie Qa-2. natomiast cząsteczki kontrolowane przez loci HLA-E.

na przykład DRA. Podobnie jak u myszy. bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I. m. Nieliczne z genów MHC. jak i do genów klasy II. DOB/DNA. białek transkrypcyjnych oraz białek nieprawidłowych.in. -B.kodują klasyczne cząsteczki klasy II. iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. Odkryty niedawno locus DM jest nieco inny niż pozostałe. -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. które strukturalnie nie należą do genów klasy II. podczas gdy czwarta podklasa. HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka. iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. 10-11).in. m. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". determinuje syntezę nieklasycznych cząsteczek klasy II. nie podlegających transkrypcji (np. geny dla 21-hydroksylazy (CYP21). Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów. białek szoku 238 . Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych. region klasy II HLA zawiera także geny. Jest pewnym paradoksem. mają tylko 2 allele. Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów. że geny HLA-A. Stwierdzono na przykład. Biorą one udział w proteolizie białek. Są to geny TAP1 i TAP2 kodujące peptydowe transportery. Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC. 314 alleli klasy II i 40 alłeli klasy III. co potwierdza fakt. Dotychczas wykryto 267 allełi klasy I HLA. przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC.

Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami.cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB). który koduje krótki fragment transbłonowy łańcucha cząsteczki 239 . iż homologia między poszczególnymi gatunkami i człowiekiem jest duża. Jak wspomniano na początku tego podrozdziału.1. Na przykład homologia genów klasy II u ludzi i myszy jest następująca: myszy: ludzie: Aa Aβ DQα DQβ Eα Eβ DKα DRβ P O/N DP DOB/DNA M DM 10.3. Geny klasy I należą do dwóch grup — A i B. Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111. główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt. różniących się delecją 6 par zasad w eksonie 5. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany. Jest to najlepiej poznany chromosom bydła. Główny układ zgodności tkankowej bydła Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie. Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa. Produkty genów klasy I są to klasyczne cząsteczki MHC.3. Wiadomo jednak. w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych. Struktura BoLA przedstawiona jest na rycinie 10-7.

Regiony klasy I i II znajdują się blisko siebie.4 cM. że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. Niektóre geny. Są to PD1. różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC. mają dużą homologię. PD7 i PD14. DQA. W obrębie klasy II obserwowany jest duży polimorfizm genów. Wydaje się. z odpowiadającymi im genami HLA. Homologia między genami BoLA i HLA jest stosunkowo duża. Region klasy II zawiera wiele genów. DQB. których homologia wynosi około 80-85%. spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. że jest ich około 7-10.MHC. W locus DRB wykryto pseudogen (DRB1). i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1. Główny układ zgodności tkankowej świni Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. 26 DQB i 31 DQA. Nie jest znana dokładna liczba genów klasy I SLA. odległość między nimi wynosi 0. szacuje się. natomiast DQA bydła i człowieka — 75% homologii. w SLA 240 . Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB. Tylko kilka genów regionu klasy I wykazuje ekspresję. w granicach 75-87%. DRĄ i DRB. Podobnie jak u innych gatunków. par zasad mniejsza niż w MHC u ludzi. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś.

ovine aries). ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B.Ryć. 10-8. które wykryto w tym pseudogenie. w eksonach 3 i 4 znajdują się kodony „stop". 241 . w którym stwierdzono delecję nukleotydu w kodonie 53. W regionie klasy III. podobnie jak u bydła. w przeciwieństwie do innych gatunków. zmodyfikowano) znajdują się także pseudogeny. Główny układ zgodności tkankowej owcy Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA. Mapa sprzężeniowa owczego chromosomu 20. W regionie tym są także inne geny typowe dla tego układu (ryć. obok genów MHC znajdują się pseudogeny. W wyniku mutacji. W regionie klasy II. C2 i C4. znajdują się po jednym genie CYP22. Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont. a częstość rekombinacji między nimi wynosi 0. przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ. Geny klasy II wykazują duży polimorfizm.6 cM. 1996. Dotąd nie sporządzono mapy fizycznej tego układu. 10-8). ma długość 5. w którym znajduje się główny układ zgodności tkankowej. Najlepiej poznany jest pseudogen DRB2. ale można również spotkać określenie Ovar (ang. powodujące.6%. Jest nim na przykład gen DRB2. iż nie jest on funkcjonalny.

około 0.5%. chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA. Kompleks B znajduje się w 16 mikrochromosomie. Z kolei. przypuszcza się natomiast. Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. O ile funkcje regionów B-F i B-L są znane. Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców. Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem 242 . par zasad. a klasy IV — B-G. natomiast w odniesieniu do Rfp-Y większość badaczy uważa.Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. Region klasy I oznaczony jest symbolem B-F. 10-9). o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. Główny układ zgodności tkankowej kury U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y. które są klasyfikowane niezależnie. Długość tego regionu u owiec wynosi około 150 tyś. Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21). częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. częstość rekombinacji między skrajnymi loci tego układu -. U drobiu nie ma regionu klasy III. Jak już wspomniano przy omawianiu budowy cząsteczki klasy I. że jest on zlokalizowany również w tym chromosomie (ryć. Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz. klasy II — B-L. Za typowy MHC uważany jest kompleks B. Badania MHC u drobiu koncentrują się na kompleksie B.

Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. Udoskonaleniem tej techniki jest test HTC.2. Do badań serologicznych wykorzystywane są surowice lub.1. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej. tuberkulozę. Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC). Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań. Znaczenie głównego układu zgodności tkankowej 10. Identyfikacja cząsteczek głównego układu zgodności tkankowej Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych. allele specific oligonucleotides — ASO). dzięki której możliwe jest wykrycie obecności danego allelu MHC. badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis. 10.3. pozwalających na identyfikację określonej cząsteczki (białka. inwazję kleszczy i pasożytów oraz trypanosomatozę (tab. 243 . Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii. Związek MHC z odpornością na choroby Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe.3. 10.3.3.zgodności tkankowej. w którym używane są homozygotyczne komórki stymulujące. 2) poprzez analizę molekularną DNA. U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane. • metoda RFLP. ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby. jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. od pewnego czasu. antygenu) MHC. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości). przeciwciała monoklonalne. białaczkę. 10-IV). poprzedzona amplifikacją danego frag mentu DNA (PCR). Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej.3. Na przykład.

U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej. haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany. ale stwierdzono już jego związek z odpornością na raka skóry. kokcydiozę. mięsaka Rousa i cholerę ptasią. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej. U bydła mlecznego stwierdzono istotne oddziaływanie niektórych 244 .3.2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne.2. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka. Na przykład.2*8 — podatność 10.3. oddziałuje także na inne cechy (produkcyjne i reprodukcyjne). Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje. oprócz szczególnej roli w reakcji immunologicznej.

Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i. 10. Dotyczyły one wpływu MHC na stopień owulacji. iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków. Zarys przebiegu reakcji odpornościowej W odpowiedzi na wniknięcie patogenów (wirusy. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób. czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe. nie do końca został poznany. przeżywalność zarodków i płodów oraz liczebność miotu. odgrywają cząsteczki głównego układu zgodności tkankowej. bez względu na to. 245 . U koni natomiast stwierdzono. reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech. gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń. przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC. po czym powstały kompleks transportowany jest na powierzchnię komórki. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji. zależnie od rodzaju patogenu i miejsca infekcji.cząsteczek MHC klasy I na cechy związane z użytkowością mleczną. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. Tutaj też następuje związanie cząsteczki MHC z peptydem. Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością. zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. Wykazano wyraźny wpływ haplotypu rodziców na te cechy. W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. jak dotychczas. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. Zasadniczą rolę w ich rozpoznaniu. obniżać stopień przeżywalności i masę ciała cieląt. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu).4. czyli są degradowane do peptydów.

Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I. które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne. które zabijają zakażoną komórkę (ryć. 10-10. są rozkładane na peptydy w wakuolach (endosomach). Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej.nazywane inaczej zabijającymi. mające na powierzchni cząsteczkę CD8. 10-10a). prezentując przede wszystkim obce antygeny. Peptydy te wiążą się z cząsteczkami MHC klasy II. Powstały Ryc. jeśli bakterie zostaną pochłonięte przez makrofagi. makrofagi lub limfocyty B. Podczas infekcji bakteryjnej. przedostającymi się z siateczki śródplazmatycznej. (b) prezentacja antygenu przez cząsteczki MHC klasy II 246 . Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny.

natomiast cząsteczka klasy II może ich związać dwa razy więcej. a następnie cała komórka pęka. które służą jako receptory antygenów. 10-10b). Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247 . Zdolność cząsteczek MHC do wiązania peptydów. jest rozpoznawany przez limfocyt pomocniczy T. które uległy apoptozie. które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. Następnie peptydy te są wiązane przez cząsteczki klasy II. Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów. prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. Utworzony kompleks. degradują i prezentują wszystkie antygeny (ryć. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG. określane jako Th2. 10-10b). Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć. Makrofagi wchłaniają. ale także oporności/podatności na choroby zakaźne i inwazyjne. które dotarły tu z siateczki śródplazmatycznej. po przedostaniu się na powierzchnię komórki.). Jeśli bakterie zostaną pochłonięte przez limfocyty B. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek. nieśność itd. 10-10b). ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć. IgE lub IgA). gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów. Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek.5. a raczej ich pojemność jest różna.kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). wkrótce potem jądro. W określonych przypadkach. a jej fragmenty są trawione przez sąsiadujące komórki. w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze. Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD. apoptosis opadanie) jest to programowana śmierć komórki. chromatyna ulega kondensacji na obrzeżach jądra. Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8). Genetyczna oporność na choroby Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność. czyli jej fizjologiczna śmierć. Apoptoza (gr. makrofagi mogą pełnić rolę pośrednią. 10.

Umożliwi to poznanie sposobu jej dziedziczenia. należy oszacować jej zmienność genetyczną. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania. których celem jest znalezienie takich genów. chociaż w przypadku niektórych schorzeń stwierdzono. Jeśli okaże się. W przypadku gdy oporność na chorobę jest cechą poligeniczna. Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. czyli określenie jego położenia w chromosomie. 248 . Na ogół jest to cecha poligeniczna. iż cecha oporności jest warunkowana pojedynczym genem. Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną. Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów. następnie sklonowanie go i poznanie sekwencji nukleotydów. może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów. iż oporność na nie zależy od pojedynczego genu o dużym efekcie.kowanej oporności na choroby. np. Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. celowe jest zmapowanie tego genu. 10-11). następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. Gdy cecha — wskaźnik oporności jest już wybrana.

związana z opornością na raka oczu. i barwne upierzenie drobiu. warunkowaną wieloma lub jednym genem. • cechy ustalane za pomocą badań molekularnych DNA. Y2/ D' i P'. która prowadzi do śpiączki afrykańskiej (trypanosomatoza). a markerami genetycznymi. rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. wskazujące na większą niż u osobników białych oporność na choroby wirusowe. co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu. Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową). u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B. • cechy. Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi. Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów. Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB.Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością. W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych. które są określane za pomocą testów serologicznych lub elektroforezy. Znajomość cech określanych metodami serologicznymi. Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze. umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus. jak i rasowe. Na przykład. Na przykład. gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei. Choroba ta dziesiątkuje populacje bydła 249 . takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). które mogą być wskaźnikami oporności na choroby. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne. Sprzężenia takie są szczególnie korzystne w selekcji. Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech. jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). jak: • cechy eksterierowe (widoczne gołym okiem). jak i techniki inżynierii genetycznej.

Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst. simentalery czy szwyce. Obserwowane są zarówno różnice rasowe. a także. S. Wyniki badań wrażliwości kur na bakterie Salmonella (S. że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby. której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych. S. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. Kokcydioza jest równocześnie przykładem choroby. zwłaszcza u młodych kurcząt. zmniejszone wykorzystanie paszy. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie. pullorum. nie zabezpieczając ich przed infekcją. Zmienność podatności zwierząt na choroby najlepiej poznano u kur. Ponadto świadczą one.afrykańskiego. typhimurium. z zachowaniem ich wysokiej produkcyjności. Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej. jak i indywidualne. Na przykład. Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków. gallinarum. w tym przypadku jest to temperatura otoczenia. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. W Norwegii od 1978 roku mastitis jest już włączone jako cecha 250 . enteritidis) sugerują. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. śmiertelność. S. Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach). Kokcydioza powoduje obniżony stopień wzrostu. Należą do nich stany zapalne gruczołu mlecznego (mastitis). iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę.

iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. za duże lub za małe strzyki. wapń. Wydaje się. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. Stwierdzono na przykład. przez uprzednio zarażoną wirusem białaczki komórkę jajową. kobalt i mangan). Innym schorzeniem u bydła. Ta metoda selekcji jest zalecana na przykład w Szwecji. co zostało udowodnione. coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia. jest białaczka limfatyczna. ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników. charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. ustawienie strzyków. wysokość zawieszenia wymienia i szybkość oddawania mleka. opartej na wskaźnikach fenotypowych oporności. kształt i wielkość wymienia oraz strzyków. iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków. Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. którego leczenie jest bezskuteczne. których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy. że skłonność do białaczki jest przekazywana przez rodziców. iż byłoby celowe prowadzenie selekcji pośredniej. że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby. a zwłaszcza przez chore matki. jak: magnez.selekcyjna w programach hodowlanych. która w znacznym stopniu jest uwarunkowana genetycznie. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. jak również niekorzystnym warunkom środowiska (np. że mastitis najczęściej występuje u krów. w celu ograniczania występowania mastitis poprzez selekcję. ale także zakażenia przez łożysko. Jej występowanie stwierdzono na wszystkich kontynentach. takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek. zbyt duża wielkość i niskie zawieszenie. siarę i mleko oraz. Można zatem przypuszczać. Podstawowymi kryteriami tej selekcji są. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. oprócz wydajności. Z drugiej 251 . Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów. niedobór niektórych pierwiastków. Wiadomo. Na podstawie licznych badań można sądzić. Wydaje się.

przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę. ale także innych schorzeń. coli i F18 E. Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna. że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie. cieszy się mniejszym zainteresowniem wśród badaczy. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt. W tym miejscu należy podkreślić. lub też jako zdolność do współżycia z pasożytem (ang. . przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. której wartość waha się w granicach 0. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta.6. resistance). na przykład schorzeń kończyn. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne.jednak strony wielu badaczy stwierdzało. Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem. coli jest opisane w podrozdziale: Mutacje genowe. Stwierdzono. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem. co może być dowodem na dziedziczenie podatności na białaczkę. iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np.5-0. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. w odróżnieniu od genetycznej zmienności oporności. Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie.

stężenie nośnika — żelu itp.Rozdział W klasycznym ujęciu marker genetyczny to cecha jakościowa. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych. antygenowe determinanty białek surowicy krwi (allotypy). temperatura. gdy w populacji występują przynajmniej dwa allele w locus tego markera. które nie kodują informacji genetycznej. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością. a dokładniej — rozpoznające konkretną determinantę antygenową. uwarunkowana w sposób prosty — tzn. umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). czy jest on polimorficzny. antygeny głównego układu zgodności tkankowej. Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA. wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka. a z drugiej strony od parametrów fizycznych rozdziału (napięcie. Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych. uzyskanych metodą PCR. Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. przydatna do celów analizy genetycznej.). pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253 . Przydatność markera zależy od tego. W ten sposób badane są antygeny erytrocytarne (grupy krwi). która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej. W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. co zachodzi wówczas. przez jedną parę alleli. Metody serologiczne wymagają stosowania surowic testowych.

a w mniejszym stopniu sekwencje minisatelitarne. Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus). Z badań prowadzonych u człowieka wynika. które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. cechujący się obecnością charakterystycznych białek. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. Klasa II markerów to sekwencje niekodujące. i 60. polskiego badacza Ludwika Hirszfelda. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50. który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym. że są związane z błoną plazmatyczną erytrocytów. dotyczącej kontroli pochodzenia.in.1. cząsteczkami adhezyjnymi czy białkami strukturalnymi. Jeśli białko ma tylko jedną determinantę antygenową.mentu DNA genu (metoda SSCP — ang. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. Do pionierów tych badań należy zaliczyć m. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I.geny. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi. na powierzchni erytrocytów. który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych). Antygeny erytrocytarne (grupy krwi) Grupy krwi były najwcześniej wykorzystane w analizie genetycznej. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP. że mogą one być enzymami. Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. czyli sekwencje kodujące -. Wspólną ich właściwością jest to. np. SSCP). Ich efektem było wykrycie wielu układów grupowych. czyli Ag-NOR). że markery zostały podzielone na dwie klasy. 11. single stranded conformation polymorphism). Przez grupę krwi należy rozumieć typ krwi. wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych. receptorami. wówczas jest rozpoznawane 254 . W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. Klasa I obejmuje klasyczne markery. o właściwościach antygenowych. a ich obecność można wykryć metodami serologicznymi. Objęcie badaniami niekodujących sekwencji DNA spowodowało.

a to z kolei może wpłynąć na zmianę struktury białka. Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów. a w tym jego determinanty antygenowej. że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi. może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej. Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny.za pomocą jednej surowicy testowej. Wreszcie może być taka sytuacja. a przez to do utworzenia (lub zlikwidowania) 255 . to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. Jeśli białko ma kilka determinant antygenowych. Jeśli takie geny mają wiele alleli. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych.

że białko ma tylko jedną determinantę antygenową. że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256 . czyli zespole antygenów. Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. 11-1). prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć. W takiej sytuacji mutacja genu zmienia jedną Ryć. gdy białko ma więcej determinant antygenowych. 11-2. Gdyby dla uproszczenia przyjąć. Sytuacja staje się bardziej złożona. ab oraz a’bc). przykład dla białka mającego kilka determinant antygenowych. które pojawiają się w trzech fenogrupach: abc. Mówi się wówczas o fenogrupach. które dziedziczą się jak jednostka. Schemat opiera się na założeniu.nowej determinanty w antygenie erytrocytarnym. a więc są uwarunkowane przez jeden allel. Mechanizm powstawania zróżnicowania antygenów erytrocytarnych. to wówczas każda mutacja genu.

11-2). że występują obie sytuacje. Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów. Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. a w konsekwencji do nietypowego dziedzi- 257 . że istnieje także druga teoria tłumacząca fenomen fenogrup. Należy jednak zaznaczyć. że każdy antygen warunkowany jest przez jeden gen.z determinant. Przyjmuje ona. ale nie narusza struktury pozostałych (ryć. Badania prowadzone u zwierząt wykazały.

H. T'. X). S. L. w których wykryto dotąd tylko dwa allele (np. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A. F. C. M. C. Zatem możliwe jest. U) oraz owcy (układy: A. Biologiczna funkcja powyższych białek nie została jeszcze poznana. M. R. L. F. O. E. D. w którym występuje allel „ — " określany jest jako otwarty. C. głównie w odniesieniu do układu grupowego B. układ L bydła czy układ C świni). Przykłady takie opisano u bydła. O). Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. H. a drugi allel (allel „ —") koduje białko. Ponadto determinanty mogą 258 . G. D. w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). M. D. M. K. Wśród poznanych układów są takie.czenia antygenów krwinkowych. G. C. Należy pamiętać. B. które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. I. B. że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. 11 w genomie bydła (układy: A. R'). Q. P) oraz 15 w genomie świni (układy: A. N. przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową. J. Układ grupowy. D. F. C. J. B. Z. 11-1). W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. K. B. Na drugim biegunie są układy o olbrzymim polimorfizmie. jak np. Można przypuszczać. K. układ grupowy B bydła. J. że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. 13 w genomie kury (układy: A. E. P.

Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe. W efekcie wśród alleli będą takie. konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie). w których zidentyfikowano kilka czy kilkanaście alleli.2. czyli zawierającej wiele różnych przeciwciał). Jak to już wcześniej wspomniano. aby surowice testowe. pod względem liczebności grupą markerów genetycznych klasy I. W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło. pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej. świnie. W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. oraz takie. Na uwagę zasługuje układ grupowy A świni. Cel ten osiąga się poprzez cykliczne przeprowadzanie. W układzie grupowym A występują dwa antygeny A oraz O. Gen S ma dwa allele: S oraz s. że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt. po grupach krwi. które powinny spełniać warunek swoistości.mieć wiele wariantów. International Society for Animal Genetics — ISAG). Polegają one na tym. charakteryzowały się identyczną swoistością. Jego ekspresja zależna jest od dodatkowego locus S. Za pomocą dostępnych surowic testowych należy ustalić. które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). a każdy z nich jest rozpoznawany przez odrębną surowicę testową. przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss. międzynarodowych testów porównawczych (ang. Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np. 11. comparison test). Surowice takie są produkowane przez laboratoria. które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę). a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej). erytrocytów i leukocytów są drugą. to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. który ma działanie epistatyczne w stosunku do locus układu A. erytrocytów i leukocytów Białka surowicy krwi. Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S. Niezmiernie istotne jest. badanie grup krwi wymaga stosowania surowic testowych. elektroforeza w żelu poliakryloamidowym lub elektroforeza 259 . jakie antygeny występują na erytrocytach w poszczególnych próbkach. wyprodukowane w różnych laboratoriach. Procedura produkcji oparta jest na immunizacji zwierząt. które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt. Białka surowicy krwi. pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang.

Spośród ponad 25 białek najbardziej polimorficzne 260 . i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Na przykład u koni testy takie wykonywane są dla 16 systemów białek. Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III. Polimorfizm białek leukocytów. Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt). Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych. nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC). będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną.dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. elektrofokusing).

Z drugiej strony. twarde i suche). U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli. Tak więc. Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej. przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). 261 . Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). Allel ten. przy czym jeden z alleli (ALBS) występuje u większości ras. Polimorficzne warianty są związane z różną aktywnością tego enzymu. hampshire i duroc. niektóre allele są charakterystyczne dla danych ras. Najwięcej wariantów tego białka zidentyfikowano u bydła. Spośród białek i enzymów erytrocytarnych (tab. Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz). z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków. jak świnia. występuje szczególnie często u zwierząt podatnych na stres. koń i koza. Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych. P/3. określany jako zerowy. owiec (chromosom 15). inhibitor α-proteaz i transferyna. mającą dwa aktywne centra wiązania żelaza. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. PO1B. podczas gdy allel TfA występuje przede wszystkim u yorkshire. U świń są one determinowane przez ściśle sprzężone loci (Pi1. przy czym u bydła jest to enzym leukocytarny.są albumina. u bydła w chromosomie l. natomiast jest ona aktywna w leukocytach i innych tkankach. Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich. jak np. Locus transferyny u świń znajduje się w chromosomie 13 (13q31). PIZ. kur i bydła. Ze względu na to. są one cennymi markerami genetycznymi. które mają skłonność do wytwarzania mięsa typu DFD (ciemne. U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach. PO1A. U koni jest ono determinowane przez 13 alleli. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. Transferyna jest β-globuliną. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D. PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. PO1AB i PO1BY dla wielkiej białej polskiej. Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. U świń w locus ADA znanych jest sześć alleli. u owiec także w chromosomie l (Iq42q45).

wśród nich bydło czarno-białe i czerwono-białe. Na przykład u bydła w trzech pozycjach tego łańcucha. Warianty tego białka różnią się tylko budową łańcucha β. jest monomorficzna.Hemoglobina wykazuje największy polimorfizm u owiec. kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27. bydła i kóz. U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15 262 . jak np. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła. są różne aminokwasy. u rasy Jersey i niektórych ras mięsnych. Większość ras bydła.

jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). Ciekawe jest. Białka mleka Głównymi białkami mleka są kazeiny αs1. jest układ Lpb. U bydła zidentyfikowano 3 allotypy. U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin. bva2 oraz bvb.4. a w piątym układzie (Lps) tylko jeden allel. oznaczonych symbolem Lp. u których najbardziej polimorficzny. 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki. Ze względu na ścisłe sprzężenie loci kazein. od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). 11. kontrolowane przez allele bval. β. wykazują właściwości antygenowe. 14 allotypów dla γ-globulin i 3 dla α-globulin. biorące udział w transporcie cholesterolu. iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA.i γ-globulinach. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin. 11. Określenie genotypu na podstawie 263 . stwierdzono dotychczas u świń. Większość tych allotypów jest determinowana przez kodominujące allele.3. αs2. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek. dotychczas zidentyfikowano 3 allotypy. Lpt i Lpu) znane są po dwa allele. układ sprzężonych alleli nazywany jest haplotypem. Allotypy immunoglobulin i lipoprotein Antygenowe właściwości surowicy krwi. bo liczący ponad 21 allotypów. są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku. Również lipoproteiny. określane terminem allotypy. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku. Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu. u owiec 1. W następnych układach (Lpr. W przypadku antygenów immunoglobulin u bydła. a wielkość tego wytwarzania zależy od nasilenia anemii. U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy). U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad). β i κ oraz białko serwatkowe — P-laktoglobulina. Największe zróżnicowanie allotypów lipoprotein.chromosom).

Białko serwatkowe mleka bydła. Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy. U bydła w locus kazeiny αsl wykryto pięć alleli: A. Allel F powstał w wyniku mutacji punktowej w allelu A. składają się one bowiem odpowiednio z 207 i 199 aminokwasów. co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. a u bydła indyjskiego — alleł C. powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny. albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII. znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny. determinowanych allelami: A. z których jedynie A i D są obecne w genotypie bydła ras europejskich.badania białka jest możliwe tylko u samic będących w okresie laktacji. B. Białko β-laktoglobuliny składa się z 162 aminokwasów. Podobnie jak w przypadku κkazeiny. przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B. E. a wariant A — alaninę. C. C i D. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A. której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. W pozycji 136 łańcucha polipeptydowego B jest treonina. pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. β-laktoglobulina. C. natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy. bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB). Dotychczas u bydła wykryto 6 typów κ-kazeiny. wynikające z polimorfizmu genu kodującego to białko. Podobnie allel G powstał wskutek tranzycji C→T w allelu A. B. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2. polegającej na tranzycji G→A. F i G. opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA. B. β-Laktoglobulina odgrywa rolę w odporności organizmu. które powodują zmianę aminokwasu. będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną). tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów. U bydła europejskiego najczęściej występuje wariant β-kazeiny A. D i E. Różnica między 264 . występuje w dwóch wariantach A i B. a w wariancie A — izoleucyna. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu.

11. natomiast wariant B — glicynę (GGT). Uzyskany układ prążków. polegające na delecji odpowiednio 11 i 37 aminokwasów. Badanie takie wymaga zastosowania sond o dużej specyficzności. Z kolei w pozycji 118 w wariancie A jest walina (GTC). Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A. który także jest już rutynowo stosowany. B. ale także sekwencje ją otaczające. Zostało to wykorzystane w opracowanym teście PCR-RFLP. przedstawia wysoce charakterystyczny obraz osobniczego DNA. opisano po raz pierwszy sekwencje minisatelitarne. do kontroli pochodzenia i identyfikacji śladów biologicznych. W mleku kóz i owiec. W połowie lat 80. w loci kontrolującym główne białka mleka występują po 2 allele. że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT). a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. Podobnie u owiec. to na błonie radiograficznej pojawia się układ prążków.5. w którym są 3 allele. O). C i E różnią się między sobą kilkoma podstawieniami aminokwasów. Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus.wariantem A i B polega na tym. 33. B. C. o tyle allele D i F wykazują znacznie większe różnice. Fragmenty te pochodzą z wielu loci. Do najbardziej znanych sekwencji minisatelitarnych należą: 33. E. podobnie jak bydła. oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265 . który może być wykorzystany m.15 (motyw podstawowy: AGAGGTGGGCAGGTGG). Ich cechą charakterystyczną jest to. jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. są cztery frakcje białek.6 (motyw podstawowy: AGGGCTGGAGG) i 33. Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B. Sekwencje te występują w wielu miejscach (loci) genomu.in.alanina (GCC). to znaczy zawierających nie tylko sekwencję minisatelitarną. Polimorfizm DNA W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące. a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości. F. W pozostałych loci wykryto po 2 allele.5 (motyw podstawowy: GGGAGGTGGGCAGGAGG). nazywany niekiedy „odciskiem palca" DNA (ang. który reprezentuje fragmenty DNA o różnej długości. zaś w B -. z wyjątkiem locus P-laktoglobuliny (chromosom 3p28). DNA fingerprint). wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo. D. że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną. O ile allele A.

(np. Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika. tzn. a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. gdy nie są znane ani sondy molekularne. że ich loci są położone głównie w częściach telomerowych chromosomów. za pomocą sekwencji starterowej o losowej 266 . że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. Szacuje się. możliwe stało się analizowanie pojedynczych loci. Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. polegający na tym. bo zawierających motyw podstawowy długości kilku nukleotydów. w przypadku homozygoty. Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu. high stringency). CATA) motywy podstawowe. Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji.durą (ang. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego. pochodzących z DNA wyizolowanego od danego osobnika. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. lub dwóch fragmentów — u heterozygoty (ryć. Do tej pory najczęściej opisywano dwu. Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych. po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną. że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. także powtarzających się tandemowo. Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA. Warto zaznaczyć. Zostały one określone terminem sekwencji mikrosatelitarnych. żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. CA) lub czteronukleotydowe (np. Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów. Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych. Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili. (GT)nGAT(AG)m. dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. random amplified polymorphic DNA — RAPD). (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. 11-3 wkładka kolorowa). polimorficznego fragmentu DNA. Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas. Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony. że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. gdy za pomocą techniki PCR.

Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I. że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna. są poddawane elektroforezie. W ten sposób identyfikuje się markery określane skrótem SCAR (ang. Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. w której dominują nukleotydy C i G. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. np. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP). seauence characterized amplified region). zaowocował identyfikacją nowej klasy markerów genetycznych. który zlokalizowano w chromosomie 9 u psa.AATCGGC oraz allel 2 — AATGGGC. spośród których większość występuje poza strukturą genów. Polimorficzny fragment. że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw. Należy zaznaczyć. Na przykład. prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1. w tym sekwencjonowanie. które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. Jeśli amplifikowany fragment jest wystarczająco duży. progressive rod-cone degeneration). Badając grupę osobników można stwierdzić różnice w układzie prążków. ale może od267 . Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę. Wynika z tego. został następnie molekularnie opisany. których celem jest sekwencjonowanie genomów różnych gatunków. reprezentujące zazwyczaj różne loci w genomie. to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne). czyli nie wpływa na budowę polipetydu. Dynamiczny rozwój badań. w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). co doprowadziło do identyfikacji markera specyficznego SCAR. Zamplifikowane fragmenty. a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). single nucleotide polymorphism).kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów). Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD. wykryty za pomocą techniki RAPD. Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach. O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu. określanych symbolem SNP (ang. Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP. allel l .4 mln miejsc SNP. cichego podstawienia. charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli. jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%. amplifikowanego przez starter 5'-AGAATAGGC-3'.

ALB-A. Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to.działywać na ekspresję genu. ES-I. marker assisted selection). Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP. 268 . Podstawą tej kontroli jest to. MAS (ang. Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. on zatem może być ojcem źrebięcia. u bydła są to układy B (40 antygenów). w których występuje wiele antygenów. że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a. 11. natomiast u koni układy A (7 antygenów). Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. E (17 antygenów) i L (12 antygenów). PHI-I. którego nie stwierdzono u jednego z rodziców. Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego. Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np. Do kontroli pochodzenia najlepsze są układy grupowe. Spełnia je ogier 2. tzw. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej. D (17 antygenów). Warunków tych nie spełnia ogier l. w tym sekwencjonowania DNA. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. że potomek dziedziczy jeden allel z każdego locus od ojca. Wykorzystanie markerów genetycznych w hodowli zwierząt Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia. ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego.6. ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej. czyli markerów genetycznych klasy I. Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek. następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT). P-ad i Q-b oraz typy białek TF-O. P (4 antygeny) i Q (3 antygeny). Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). D-cgm. C (12 antygenów) oraz S (8 antygenów). można wykluczyć jego ojcostwo. drugi od matki. Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. u świń układy M (12 antygenów). Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik.

sekwencja minisatelitarna. którą jest np. Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia. W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory. Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne. Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. 11-4). W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru: Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka. jedna jest oparta na polimorfizmie minisatelitarnym. prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269 . Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. Uzyskany obraz prążków jest charakterystyczny dla danego osobnika. ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć. druga na polimorfizmie mikrosatelitarnym.ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą.

łączne prawdopodobieństwo wykluczenia dla wszystkich 270 .Jak już wspomniano. W takim przypadku określa się tzw. analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia.

Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów. dostępności informacji zarówno o jednym. Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). jak i obojgu rodzicach: Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia. 271 . określanego symbolem SNPs (ang. drugi — 263 pz). przedstawiono na rycinie 11-5 (wkładka kolorowa). szacowaniu zmienności genetycznej i dystansu genetycznego. Również to. Dwa z nich otrzymały od matki allel długości 243 pz.badanych loci. dodawany do każdej próby DNA analizowanej za pomocą sekwenatora. drugi od ojca. 1300 par zasad). w której stosuje się kilka markerów równocześnie. matka natomiast heterozygotą (jeden allel . Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA. sprawia. Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje. przy czym allel długości 235 pz odziedziczyły po ojcu. że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych. której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora. Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks. natomiast trzeci — allel 263 pz. Ojciec jest homozygotą pod względem allelu długości 235 pz. jak to jest przy cechach monogenowych — jakościowych. dokładnie tak.243 pz. W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki. Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2). iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia. Wszystkie szczenięta są heterozygotami. Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków. W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów. których częstość szacuje się na 10-2-10-5 na pokolenie. single nucleotide polymorphisms).

11-VII). Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową. głównie klasy II. Okazało się. cechy użytkowości mlecznej). jaka będzie wartość tej cechy w przyszłości. U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła. marker assisted selection). dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. Geny takie nazwano głównymi lub genami o dużym efekcie. czyli istotnych z hodowlanego punktu widzenia. wydajnością białka w mleku. warunkujących cechy użytkowości mlecznej (tab. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec. Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych. o istotnym wpływie na cechy użytkowe. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych". brunatnego szwajcarskiego i simentali. Prowadzone są badania w celu znalezienia takich genów. której kryteriami są genotypy zwierząt w danych loci. Identyfikacji genotypu w loci tych markerów daje 99. które mają znaczący wpływ na kształtowanie się cech użytkowych. W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną. można dla młodej jałówki określić. Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. a postęp genetyczny jest uzyskiwany w krótszym czasie. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych.Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego. Markery genetyczne. Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach. są również pomocne w doskonaleniu niektórych cech jakościowych. zwiększoną plenność świń. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. Znając sprzężenie między określonym markerem genetycznym a np. W przypadku tych cech jest już możliwa selekcja bezpośrednia. że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. 11-VI). Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt. zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech).99% prawdopodobieństwa wykluczenia. Jest to cecha dziedzicząca 272 .

jak również intensywnej hodowli (zasiniaczenia i ukryte 273 . w których coraz więcej uwagi poświęca się dobrostanowi zwierząt. Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich. której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała).się z dominacją całkowitą.

które mogą być wykorzystane do tego celu. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to. w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania. przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I. jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia. sprzężone z locus polled.uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji. że locus polled. coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani. że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources). zwłaszcza infekcyjnych. Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji. ponadto jest zabiegiem kłopotliwym. które cechuje duża zmienność genetyczna. występuje w l chromosomie. jak i klasy II. zanim wystąpią objawy chorobowe. Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób. Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. Szacowanie dystansu genetycznego i wybór ras. ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. Znane są już dwie sekwencje mikrosatelitarne. 274 . Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii). Aby tego uniknąć. Dotychczas wiadomo jedynie. kontrolujący bezrożność/rogatość u bydła. Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych.

U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM. czyli geny. Genom może być opisany za pomocą kilku parametrów. dlatego pojęcie genomu odnoszone jest do DNA jądrowego. Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów.Rozdział 12 Mapy genomowe Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. jak i sekwencje niekodujące. Przyjmuje się. wyrażona w cM. Sekwencje powtarzalne 275 . Po pierwsze. 12-1). Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM). Całkowita długość genomu u ssaków. Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów. jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. 12. że w genomie ssaków występuje około 35 tysięcy genów. która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów. Organizacja DNA jądrowego W obrębie genomu występują zarówno sekwencje kodujące.1. Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad. Tam też znacznie częściej zachodzi crossing over. Miejsca te można wybarwić metodą barwienia prążkowego typu T. mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). Zdecydowanie przeważają sekwencje niekodujące. Rozmieszczenie loci genów w genomie jest nierównomierne. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów. które stanowią około 97% całego DNA (ryć.

Szczególnie cenne. Niezależnie od tego. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to.dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej. z punktu widzenia przydatności tych sekwencji do analizy genetycznej. że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu. którą uwidocznia się metodą barwienia prążkami C. Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. Oznacza to. że liczba powtórzeń danego układu podstawowego wykazuje w obrębie 276 . sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych. że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad. Szacuje się. że genom jest bardzo silnie nimi nasycony. ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim). jest to. Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów).

podobnie jak elementy nukleotydowe.populacji silne zróżnicowanie. Podobnie jak poprzednio. przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. Organizacja DNA mitochondrialnego Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin). Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. ale w danym miejscu występuje tylko jedna kopia sekwencji. leżą w pobliżu białkowych struktur kompleksów. jest sekwencja telomerowa (TTAGGG/AATCCC). Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz. sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element). Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego. że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. Skróceniu ulegają właśnie sekwencje telomerowe. Elementy nukleotydowe to takie sekwencje. które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. jest do tej pory słabo rozpoznana. Inaczej mówiąc. Funkcja sekwencji powtarzalnych. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych. że sekwencje te. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się. z wyjątkiem sekwencji telomerowych. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. które również są rozproszone w wielu miejscach genomu. Wiadomo.2. Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny. których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element). 12. w których asocjuje heterochromatyna z kilku chromosomów. 277 . Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu. w pobliżu końców ramion chromosomów. która stanowi zakończenia ramion chromosomowych.

a tylko część przez mtDNA. w których być może replikacja mtDNA nie zachodzi. że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang. Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy. zatem muszą być syntetyzowane wewnątrz mitochondriów. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA. cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V. Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. przy czym kompleks V jest to syntaza ATP. poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. ubichinon/koenzym Q. Wiadomo już. kopii mtDNA. 278 . Białka będące podjednostkami enzymów łańcucha oddechowego (np. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie. mtDNA jest bowiem kolisty. Jego długość wynosi około 16 tysięcy par zasad.Mitochondria należą do organelli komórkowych przekształcających energię. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. oxidative phosphorylation — OXPHOS). Całkowita liczba genów w ludzkim mtDNA wynosi 37. Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka. Większość komórek zawiera od tysiąca do 10 tyś. Struktura mtDNA jest inna niż DNA jądrowego. W nich odbywa się większość reakcji oddychania komórkowego.

ale w przeciwnych kierunkach. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących. Prawie cały mtDNA zawiera sekwencje kodujące. czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach. 279 . wchodzące w skład cząsteczki mtDNA. który ma większy udział nukleotydów guanylowych — G i tymidylowych .DNA występujący w mitochondriach nie jest powiązany z białkami. a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA. a niektóre geny nawet nakładają się na siebie. Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech. różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H). Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych. w odróżnieniu od DNA jądrowego. a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. transkrypcji podlegają obie nici kolistego DNA. 12. w której obrębie występuje potrójna struktura DNA. Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA. nazywa się cytogenetyczną lub fizyczną mapą genomu. która wskazuje położenia loci w chromosomach. Kolejną cechą charakterystyczną mtDNA jest to. Z kolei mapa opisująca sprzężenia. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego. Mapa. Łańcuchy komplementarne.T niż łańcuch lekki (L). pozostający w asocjacji z cząsteczką macierzystą. wyrażonych w cM. który stanowi dominującą część genomu. genów (markery klasy I). uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. co więcej. Markerowa mapa genomu Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. pomiędzy sprzężo nymi loci oraz ich uszeregowaniu. b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli). tzn. i niekodujących. c) odległościach genetycznych. dlatego niejednokrotnie mówi się o markerowej mapie genomu. która przebiega równocześnie. na obu łańcuchach.3. uformowana przez krótki fragment nowego łańcucha H. W mtDNA występuje jedno miejsce inicjujące transkrypcję. że geny mitochondrialne nie zawierają intronów.

na przykład mikrosatelitę — marker klasy II. Często sondę stanowi tzw. reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję. cDNA (komplementarny DNA) genu.3. sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang. że w cDNA nie występują introny. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany. ponieważ w mRNA.12. która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. na bazie którego syntetyzowano cDNA. Jest to taka sekwencja nukleotydowa. ale nie jedyną. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa. Różnica między DNA genu a jego cDNA polega na tym. Fizyczna mapa genomu Podstawową. 280 .1. metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym.

Malowanie chromosomów polega na zastosowaniu sondy. w którym sonda połączy się z DNA chromosomu. Analizę taką określa się terminem porównawczego malowania chromosomów (ang. Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych. Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. Hybrydyzacją in situ ma wiele odmian. która zawiera unikatowe sekwencje DNA wybranego chromosomu. (b) ta sama metafaza po hybrydyzacji. 12-3). Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. że do identyfikacji chromosomu. Ponadto. dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. gdzie sonda hybrydyzowała z DNA chromosomu splicing). (a) chromosomy barwione metodą prążków Q. albo po hybrydyzacji. świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. Q lub R). malowaniu chromosomów (ang. 12-3. związanego z barwnikiem fluorescencyjnym (ryć. 12-4 wkładka kolorowa). W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu. FISH) na chromosomie 3 psa. wykorzystuje się techniki prążkowego barwienia (G. jest rozpoznawane przez obserwację mikroskopową. które stosuje się albo przed hybrydyzacją. Warto wspomnieć o dwóch: tzw. zgodnie z przyjętym wzorcem kariotypu. comparative chromosome 281 . jasne punkty wskazują miejsce. technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków. Trzeba podkreślić. które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt.Ryć. chromosome painting) i mapowaniu na chromatynie jąder interfazowych. Miejsce. Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu.

painting) i polega ona na tym. Przeprowadzone eksperymenty ujawniły. które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. są bardzo złożone. 12-1). Należy jednak 282 . człowieka). że sondę chromosomowo specyficzną. Dowodzi to. konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych. stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. jakie zaszły podczas ewolucji. bydła). które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. W ten sposób można wskazać. utworzoną dla jednego gatunku (np. że w genomach bydła. że zmiany na poziomie chromosomowym.

jeżeli obejmuje segment długości co najmniej kilku milionów par zasad. czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów. Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku. Na przykład. Polega ona na poddawaniu komórek gatunku mapowanego. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji. naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16. które będą się między sobą różniły liczbą zachowanych chromosomów bydła. komórki nowotworowe myszy). którego genom jest badany — w tym przykładzie są to komórki bydlęce. który jest to chromosom 1 w jakim regionie mieszczą się badane loci. że grupa tych loci jest położona w tym samym chromosomie.6 milionów par zasad. przyjmuje się bowiem. to stopniowo „gubione" są chromosomy. Sytuacja taka świadczy o tym. Loci takie nazywa się syntenicznymi. Okazuje się jednak. Tak wyprowadzone klony poddawane są analizie elektroforetycznej. że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA. ale czasami może się zdarzyć tak. W tym przypadku są to chromosomy bydła. nieznana pozostaje również wzajemna odległość między nimi. że metoda malowania chromosomów ma ograniczoną dokładność. której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku. np. które zawsze pojawiają się razem. 0 ich umiejscowieniu wiadomo jedynie tyle. z fibroblastami pochodzącymi z mięśni czy skóry bydła. naświetlaniu promieniami jonizującymi. utrzymywanych w hodowli. że są położone w jednym chromosomie. że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków. a zatem fragmentacja chromosomów. że jeżeli takie komórki są hodowane w warunkach in vitro. a w każdej 283 . Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. Polega ona na tym. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. przed hybrydyzowaniem z komórkami nośnikowymi (np. które nie pochodzą z komórek nowotworowych. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków. Nie można natomiast wskazać. podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego. W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki). że sonda chromosomowo specyficzna da widoczny sygnał.zaznaczyć. mysich komórek nowotworowych. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci. których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym.

Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka. że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej.. Dalej.funkcja wiarogodności. 0. które odzwierciedlają częstość.współczynnik rekombinacji. Odległość taka oznacza. że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych.5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci. u potomstwa osobników o znanych genotypach. Jednostką odległości genetycznej jest l cM. na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci. względem hipotezy alternatywnej. Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania. loci). w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. służy tworzeniu genetycznej mapy genomu. przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia. L . 7 tyś..3. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang. wynoszą zazwyczaj 5 tyś. ze względu na zbyt małe prawdopodobieństwo zajścia crossing over. tym mniejsze fragmenty.2. z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. Kolejność postępowania jest następująca. lub 12 tyś. obliczana jako prawdopodobieństwo wystąpienia określonych genotypów. 12. radów. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu.5) r . Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie. w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. na tyle blisko. Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego. krzyżówka trójpunktowa). Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania. Najpierw poszukuje się sprzężeń pomiędzy loci. zawierający się w przedziale (0. wykorzystywane w mapowaniu radiacyjnym. przyjmującej niezależne dziedziczenie (r = 0.z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa. Genetyczna mapa genomu Analiza segregacji alleli w loci markerowych. przy założonym współczynniku rekombinacji (r). W tym celu korzysta się z wiedzy o genotypach osobników 284 .. Dawki promieniowania jonizującego.

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

Warto zwrócić uwagę. są coraz lepiej poznane. że do 2005 r. Wśród tych ostatnich pierwszym genomem. królika. obok wymienionych w tabeli 12-11. a w tym także mapowania radiacyjnego) i sprzężeniowego. 291 . takie jak: lis pospolity. comprehensive map). Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe. dla którego ustalono sekwencję nukleotydów. lis polarny oraz jenot. 12-111). jest genom psa. analizy hybrydowych komórek somatycznych. Coraz więcej informacji pojawia się o mapach: kota. Tak opracowane mapy określane są terminem map zintegrowanych (ang. zostanie ustalona sekwencja genomu bydła. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt. świni i kury. Przewiduje się. a w tym i konkretnych chromosomów. W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r. że również mapy genomów innych gatunków zwierząt gospodarskich. Szczegółowe dane dotyczące map poszczególnych genomów.situ. są zamieszczone w internetowych bazach danych (tab. Opublikowano ją we wrześniu 2003 r. bawoła. a także łososia i pstrąga tęczowego.) i domowych.

np.3. exudative — PSE). Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych). jak i jakościowe. tzn. Stwierdzenie. odpowiedzialnych za występowanie różnych alleli. które polega na opisie struktury genu. mięso blade. Następnie podejmowana jest żmudna analiza. Punktem wyjścia jest precyzyjne opisanie zmienności cechy. jest pokazany na rycinie 12-6. a konkretnie przez allel recesywny. który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA. ang. Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw. polegająca na klasyfikacji fenotypów dla interesującej cechy. Najpierw ustalono. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP).12. Hodowca wskazuje cechę. którego celem jest identyfikacja nieznanego genu. dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych. miękkie i wodniste. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. że cecha ta warunkowana jest monogenowo. homozygot recesywnych 292 . marmurkowatość mięsa. tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali. że allele któregoś z markerów kosegregują z określonymi fenotypami cechy. zlokalizowanych w różnych miejscach genomu. pale.5. które z hodowlanego punktu widzenia mają istotne znaczenie. wydajność białka w mleku. która ma istotne znaczenie gospodarcze. Mogą to być zatem zarówno cechy ilościowe. jak i genotypów w jak największej liczbie loci markerowych. wskazuje. że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres. bezrożność. Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu. odporność na infekcje specyficznymi patogenami. Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. soft. Ogólny schemat postępowania. choroby genetyczne itp. wydajność rzeźna. gen główny w przypadku cech ilościowych). Wykorzystanie markerowych map genomowych w hodowli Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów.

że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym. Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang. Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym. w chromosomie 6 świni (ryć. Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu. candidate gene). Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI. Badania molekularne tego genu u osobników wrażliwych na stres wykazały. 12-7a). Loci tych markerów umiejscowiono. np.GP7. locus układu grupowego krwi H oraz loci polimorficznych białek krwi .in. Był nim gen receptora rianodyny (RYR1). za pomocą hybrydyzacji in situ. które okazały się ściśle sprzężone z locus HAL. 12-6. PGD i A1BG). który nie rozpoznaje 293 . którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych (nn). Kilka lat później zidentyfikowano pierwsze markery genetyczne (m. która polega na zamianie argininy na cysteinę w pozycji 615.Ryć.

W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech). że hipertrofia mięśniowa (tzw. 12-7. podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. muscular hyperthrophy). Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić. który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot. Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową. Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN). Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1. że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła. 12-7b). w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy sekwencji zawierającej mutację. Od połowy lat 80. wywodzących się z rasy belgijskiej 294 . (b) MSTN.Ryć. jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. (c) BMPR-IB. wiadomo było. (d) PRKAG3 oraz regionów chromosomowych.

dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. wpływający na plenność owiec rasy merynos booroola. 295 . pokrywających w miarę równomiernie większość genomu. W 2001 r. W początkowym stadium badań zakłada się. w którym prawdopodobnie występuje locus genu głównego.błękitnej i asturiana. wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). są prowadzone w licznych ośrodkach naukowych. co fenotypowo objawia się hipertrofią mięśniową. 12-7d). Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101. które ma mniejszą wartość technologiczną. a konkretnie kontrolujący liczbę owulujących oocytów podczas rui. różnych mutacji uszkadzających funkcję białka miostatyny. kwaśnego mięsa. Badania zmierzające do identyfikacji genów głównych. Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop"). 12-7c). które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. Dominujący gen RN~ powoduje większą. Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. Okazało się. W 1994 roku ukazała się praca dowodząca. że gen FecB to zmutowana postać genu BMPR-IB. Przykładem może być gen FecB. W 2000 r. Locus genu RN umiejscowiono w chromosomie 15. że w chromosomie 4 świni. który odpowiada za zawartość glikogenu w mięśniach. które umiejscowione są w chromosomie 6 (ryć. Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech. a allel recesywny rn+ mniejszą zawartość glikogenu. że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania. Analiza segregacji licznych markerów genetycznych. który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego. nie udało się jeszcze wskazać genów kandydujących. które w znaczący sposób wpływają na cechy użytkowe. Co więcej. że jest nim zmutowany allel genu PRKAG3. że mutacja polegała na braku (delecji) 11 nukleotydów. czyli genu głównego. Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi. ustalono. zakończyły się wieloletnie poszukiwania genu RN. który jest biologicznie nieaktywny. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. Innym przykładem jest gen RN. Okazało się.

296 . występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. czego efektem jest 3-krotny wzrost ekspresji genu IGF2. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego. że gen ten podlega piętnowaniu gametycznemu. a to upośledza funkcję kodowanego enzymu. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja. między markerami mikrosatelitarnymi S0083 i S0090.in. Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym. gdy zmutowany allel jest odziedziczony od ojca. że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. Z kolei w październiku 2003 r. że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie. Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. krowa nosicielka. W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu. że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka. w budowie czaszki. czyli duży efekt fenotypowy pojawia się tylko wtedy. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku.między markerami S0001 i S0067. W 2001 r. że również wiele krów było nosicielkami zmutowanego genu bd. Z badań prowadzonych w rodzinach referencyjnych wynikało. Oznaczało to. że w chromosomie 12. że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej. W początkowym okresie jego użytkowania stwierdzono. określana symbolem bd (ang. że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę. Można się spodziewać. którzy również byli nosicielami tego niepożądanego genu. Odnotowano też znaczące osiągnięcie dotyczące bydła. doniesiono. chore cielę — homozygota recesywna). Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel. 12-7e). bulldog disease). w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. 12-7f). Jednym z przykładów może być letalna wada rozwojowa — achondroplazja. wykazano. Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela. Trzeba zaznaczyć. ze względu na wywoływane zmiany m. który odpowiadałby za kształtowanie tych cech ilościowych. charakteryzującego się wybitną wartością hodowlaną. Sugestia ta została potwierdzona także w innych badaniach.

polegającą na zniekształceniu kręgów (ang. CVM — central vertebral malformation). Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej. narkolepsja u dobermanów i labradorów. jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów).W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową. Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów. a ostatnio scharakteryzowano gen oraz mutację w nim występującą. Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują. że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt. . ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli. a opracowany test molekularny skomercjalizowano. Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne. dziedziczny zanik siatkówki u owczarków francuskich). W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. Wśród nich są geny wywołujące takie schorzenia. Niestety badań tych nie opublikowano. Wiele z tych mutacji występuje w ściśle określonych rasach. U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów.

P. pod red. B. Wydawnictwo Naukowe PWN. B. Jaszczaka i J. J. Wydawnictwo Naukowe PWN. K. ang. Michejdy). pod red.D. A. z j. Wydawnictwo Naukowe PWN. pod red. J.. Roitt. ang. Lamont. Ośrodek Wydawnictw Naukowych PAN. Modlińskiego. Pawlaka). Bala. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. 298 . Rozwiązywanie problemów medycznych (2003). z j. Węgleńskiego. Wydawnictwo Naukowe PWN. Wydawnictwo Naukowe PWN. Warszawa. pod red. Filistowicza. Warszawa. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997). Korf (przekład pod red. Genetyka człowieka. Stansfield (przekład zbiorowy pod red. Elementy genetyki klinicznej (2001). Wydawnictwo Akademii Rolniczej w Poznaniu. Słownik terminów genetycznych (2002).B. W. Genom człowieka. Leksykon rozrodu zwierząt (1996). pod red. Schook i S. Stryer (tłum. K. Prus-Głowackiego). Rosłanowskiego. Jeżyk genów. Wydawnictwo Medyczne Słotwiński Yerlag. pod red. A. Brown (przekład pod red. Wydawnictwo Polskiego Towarzystwa Zootechnicznego.C. L. Cz. J. L. Immunologia (1996). Karty z Dziejów Zootechniki Polskiej. Brostoff. Juszczaka i S. pod red. P. pod red. CRC Press Inc.Literatura uzupełniająca Podręczniki Biochemia (1997). W. Poznań. Prószyński i S-ka. L. Wydawnictwo Naukowe PWN.R. Leksykon biologiczny (1992). Genomy (2001). ang. Jury i H. Krzyżosiaka. Małe (tłum. I. Poznawanie zasad dziedziczenia (1997). pod red. Węgleńskiego). Kłyszejko-Stefanowicz.J. Brzeski). P. J. Cytobiochemia (1995). The Major Histocompatibility Complex Region of Domestic Animal Species (1996). J. Nowicki i wsp. Warszawa. II— lata 1972^-1997 (1997). King. Krzanowskiej. D. Wiedza Powszechna. z j. pod red. Wydawnictwo Naukowe PWN. Brema. M. Wężyka. Wydawnictwo Naukowe PWN.. Singer (tłum. Biotechnologia zwierząt (1997). L.A. USA. Biologia molekularna w medycynie. Waśniewska-Brzeska i J. Berg i M. Zwierzchowskiego. Genetyka molekularna (1995). W. R. Żeromskiego). Cz. T. Augustyniaka i J. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994).

Journal of Applied Genetics 43: 123-130. De Gortari M. Dodds K. Charon K..S.S.G. Cuthbertson R. (2002).. International Human Genome Seąuencing Consortium (2001). Ramikssoon Y.A. Population biology of antigen presentation by MHC class I molecules.. Stone R.W. The genetics of pigmentation: from fancy genes to complex traits. 299 . Naturę 409: 860-921. Charon K. (1996). Ludzki genom mitochondrialny — mutacje. (1998). (1996). Freking B. i wsp. (1998). Pareek Ch..W. Medycyna Weterynaryjna 52 (2): 89-93.T. (1996). Zeszyt specjalny 8: 9-18.. Trends in Genetics 12 (8): 299-305.. Keele J. Kamiński S. Science 301: 1898-1903. Sonstegard T.. Keele J. Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Pierzchała M. (2002).M. (1996)... Leymaster K. Long S.. Grzybowski G. Goodfellow P.M. Postępy Biologii Komórki 24 (8): 69-75. Genome Research 7: 235-249. Bartnik E..P. Kamiński S. Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding. Seminars in Reproductwe Medicine 20: 157-167. Friend S. (1996).W. (1997).B.E. Prace i Materiały Zootechniczne 50: 69-78. Prace i Materialy Zootechniczne. Kamiński S..H. 12): 53-58. Smith T. Beattie C. Initial seąuencing and analysis of the human genome. Lechniak D. (1994). Ohta T. A second-generation linkage map of bovine genome. Crawford A.L..F. Ellis S. Chromosome abnormalities in domestic sheep (Ovis aries). Journal of Applied Genetics 37: 179-196.. Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych. (2003). Science 272: 67-74. (1999). (1997). (2002). (1997). Lopez-Corrales N.T. Kirkness E. Geny oddziałujące na jakość tuszy i mięsa świń. Parham P. Postępy Biologii Komórki 26 (supl.. Journal of Applied Genetics 38: 65-76. Current Opinion in Genetics & Development 6: 316-321. Mammalian Genome 9: 204-209. Kurył J.P. Kappes S. Kappes S. DNA microarrays — a methodological breakthrough in genetics..L. (1996).. Journal of Applied Genetics 37 (3): 299-312. i wsp. Stoughton R. Dymnicki E.. Magiczne mikromacierze.M. Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt. Beattie C. Mapa genomu świni (Sus scrofa domestica). Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence. The dog genome: survey seąuencing and comparative analysis. Biotechnologia 3 (38): 38-50. Molecular genetics of sex determination. (1997).M. Minireview — MHC studies in domestic animals.W... Krzanowska H. A second-generation linkage map of the sheep genome. (1996). Early steps in mammalian sex determination. Stone R. Cotinot C. Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich. Metody oraz znaczenie sterowania proporcją płci u bydła. polimorfizmy i choroby.. Świat Nauki 4 (128): 36-43. Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej. (1998).A.J. (1997). Prace i Materialy Zootechniczne 49: 7-28.Artykuły przeglądowe Barsh G. Medycyna Weterynaryjna 54 (2): 92-96. European Journal of Immunogenetics 21: 209-215. (1998).M. Grzybowski G.A. Postępy Nauk Rolniczych 7 (nr 5): 87-97. McGraw R.A.

Beattie C. (1998). Initial seąuencing and comparative analysis of the mouse genome. Barciszewski J. Medycyna Weterynaryjna 59: 847-852.W. Journal of Heredity 89 (6): 473-480. (1993). Kurył J. (1997). Smith T.. (1999). Kulig H.S. (1998).Rejduch B. Aberracje chromosomowe u bydła o użytkowości mięsnej. Świtoński M. Basics of gametic imprinting.L. 10): 195-217. Świtoński M. Słomski R. (2002). Biotechnologia 2 (41): 33-56. A comprehensive map of the porcine genome. (1998). Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej. Prace i Materiały Zootechniczne 52: 37-42. Słota E. — Celera Genomics (2001).. Journal of Applied Genetics 40 (2): 117-128. Danielak B. Waterston R. Węgrzyn J. Inheritance of colours in horses. Genetic aspects of mastitis resistance in cattle. (1994). Journal of Applied Genetics 44: 1-20. Szatkowska L. Kwiatkowska J. Rosochacki S. Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus).. Szwaczkowski T. Medycyna Weterynaryjna 50 (8): 379-382. Sysa P. i wsp. (2003). Keele J... Ruvinsky A. Naturę 420: 520-562. Prace i Materiały Zootechniczne 46: 29-40. Medycyna Weterynaryjna 53 (10): 581-584. (1997). Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt. Journal of Applied Genetics 38 (3): 319-328. . Postępy Biologii Komórki 25 (supl. Stranzinger G. Barciszewska M.J.. (1997). (1996).A. Świtoński M. Rohrer G. Napierała D. (1998). Świtoński M. Genome Research 6: 371-391.. The seąuence of the human genome. Kozubska-Sobocińska A. Antigenic markers of protein genes and their nomenclature in cattle.. Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka.. Szydłowski M. (1998). Zwierzchowski L. Yenter C... Science 291: 1304-1351. (1999).Z. Wierzbicki H. Identyfication of animal major genes in field collected data by use of statystical methods. Alexander L. Stachurska A.W. Prace i Materiały Zootechniczne 53: 35-48.P. Zych S. Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt.. (1998). Journal of Animal and Feed Sciences 2/3: 91-103. Walawski K. i wsp. Prace i Materiały Zootechniczne 50: 11-39. Postępy Biologii Komórki 25 (supl. 2):288-237.. 10): 113-122. Synaptonemal complexes in domestic mammals — a review.. Hu Z.H. Poszukiwanie genów kontrolujących cechy tuczne.. Krajowy system kontroli cytogenetycznej buhajów. Journal of Applied Genetics 38:195-204. Skiba E. Zwierzchowski L. Journal of Dairy Science 82 (suppl. Szymański M.J. Żywiecki M..... Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej. Determinacja płci u ssaków. (1998). opasowe i rzeźne — najnowsze osiągnięcia. (1994). (2003). Noncoding RNA transcripts.

Skorowidz Opracowali: Krystyna M. Marek Świtoński Numery stron. Gwiazdką oznaczono numery stron. Charon. na których hasła znajdują się na rysunku lub w jego podpisie. na których znajduje się główny opis. są pogrubione. .

Sign up to vote on this title
UsefulNot useful