Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

...... 3............................... 3...................1........................................................... 3...................4...5.............. 3................................ Gametogeneza ........ 48 48 49 50 52 53 54 56 57 60 61 62 63 64 66 4 Metody analizy i modyfikacji genomu ............................. 4. 2....7......................................................................................................... Budowa genu ...................... Regulacja ekspresji genu .......1....2.................................... RNA ....................... 3..... Transkrypcja ................. Replikacja DNA ...............................................6..................... Inaktywacja chromosomu X w zarodkach żeńskich ...... 3...Spis treści 1 2 Wstęp — zarys historii genetyki ........................1...................................... n 1 5 16 23 31 33 37 43 3 Gen i jego ekspresja ............................................5.... 2............ 3............... Geny homeotyczne .............. 3................................................................................................................2.......................... Piętno gametyczne .... 3.......... Translacja ........................................................................ 4....................... Chromosomy i podziały jądra komórkowego ...................................................3......................................6.........1....................................................................................7............................7.... 2.. Endonukleazy restrykcyjne ........1........................................... Barwienie prążkowe chromosomów .....................................4....................................................3..................................................3..........1............................................................ 2.................2........ Kariotyp . Mejoza .......................... Budowa kwasów nukleinowych . Kod genetyczny ............4.......7............ Wektory... Budowa chromosomu .2. 69 69 72 ...................................... 3................................................. Czynniki transkrypcyjne ...... .... 3..... Metylacja DNA ............. 2....................5..........................7...............................................................................2. 3.......... DNA ................. Mitoza....................... .................... 3....................... 2.............................................................7................. 3...1..

......2.......... 6... 5......... 5.... 7............. Współdziałanie alleli ........................................... 6................4........................1.............5...................... Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych ...............................................3...... 6.............. 5.......... 5......................................4.................... 4................ .....................9..........2.... 76 78 82 86 87 88 91 91 5 Mutacje .................... Rekombinacja molekularna i klonowanie ......... 5.4......... Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) .. 6...4.................1................................................................................ 5....................8.................... Mutacje genowe ......... Polimorfizm fragmentów restrykcyjnych DNA (RFLP) ............. 6..2.4. 5......... 5...............................5.... Choroby monogenowe wywołujące wrodzone wady rozwojowe 5..............................................................................................2...................1.................1.............................. Geny modyfikujące ..2.....................4...2....................1....................................................2.............4.......... 4..................................................... Mutacje w mitochondrialnym DNA ... Geny letalne........1.... Epistaza ........3... Komplementarność .. Mutacje genomowe .....1...... 95 96 100 111 112 112 118 123 124 124 127 132 135 143 144 6 Podstawowe mechanizmy dziedziczenia cech .................. 4....................4.............5.10............................4.........3......................... Dziedziczenie cech sprzężonych .....3......... 4.......3............. Techniki hybrydyzacji i sondy molekularne ........ Mutacje genowe wpływające na cechy produkcyjne zwierząt .... 5..................4......4..4......... Biblioteki genomowe i genowe .......................... Rodzaje zmienności i czynniki ją wywołujące ............................. 7........................ 4...................4...................... semiletalne i subwitalne ........................................................4.....................4.. 146 147 147 150 152 157 160 160 161 162 163 164 164 175 176 7 Zmienność cech............ Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce ............................. Cechy sprzężone z płcią .......................................... 5.....................................................................................................1.... Plejotropia .............. ............................................. 5...................................1..... 6....3.. 6. Niezależne dziedziczenie cech (II prawo Mendla) ...... Skutki mutacji genowych .... Mutacje chromosomowe ....................2.1.............................1............ Sekwencjonowanie DNA .................. Sumujące działanie genów . 4................. ........ Mutacje genowe wywołujące choroby genetyczne .......4.......... 4.............................. 6....... Ograniczanie występowania chorób genetycznych......................... Dziedziczenie umaszczenia. Dziedziczenie pozajądrowe . Przyczyny i rodzaje mutacji genowych .. 6....4.. Współdziałanie genów z różnych lód w kształtowaniu fenotypu ... Dziedziczenie cech warunkowanych jedną parą alleli ... Miary skupienia ................................4...... Miary zmienności ..........5.................4.................... 6.4......... 5.... Badanie ekspresji genów ..........3..............5... 6................... 7...2........................ ........... 179 179 182 182 8 ...................................... 6...........2.......7................... 5..........................2................. 6................... Transgeneza .............. 6.1.........................1......................2.... Penetracja i stopień ekspresji (ekspresywność) genów ............. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny ............................4.. .....................6......................

..... 10.. 7.........................3.1....... Determinacja płci ssaków ...... 10.....3........... 227 227 230 231 233 236 237 239 243 243 243 244 245 247 11 Markery genetyczne .......... ....................5.............2..1...... Wykorzystanie markerów genetycznych w hodowli zwierząt....... 10. 10...........5...........3...............................3..........3....................3......... 9......3.....................................................3................................................3.........3.............. Główny układ zgodności tkankowej myszy ........ Genetyczne podłoże różnorodności receptorów limfocytów T .........3...................2......1.. ....4............. 11................... 7........... ....1...3........3......... Białka mleka ............................................... Związek MHC z odpornością na choroby .. erytrocytów i leukocytów ......... Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami .........................2......3.................................. 10......... Allotypy immunoglobulin i lipoprotein ........2.2...... Zmienność transgresywna .......................2.............1...........5..................................... 10.................... 7.............. 8.......... 210 216 221 10 Genetyczne podstawy odporności i oporności ............................................ 8...............1....................... 10........ Frekwencja genów i genotypów w przypadku dominowania ...... Prawo równowagi genetycznej .....3...3.... 7....... 9......2....................... 11.......................1......... 8................. Czynniki naruszające równowagę genetyczną .. Polimorfizm DNA ............... Identyfikacja cząsteczek głównego układu zgodności tkankowej 10....... Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8... Główny układ zgodności tkankowej człowieka .. Główny układ zgodności tkankowej zwierząt gospodarskich 10. Genetyczne podłoże różnorodności przeciwciał .................. 185 187 187 189 190 8 Podstawy genetyki populacji .2.6... Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych ....................... ............ Białka surowicy krwi. Struktura i funkcje głównego układu zgodności tkankowej ..... Geny o dużym efekcie ................ Dziedziczenie cech ilościowych ................ 10...................................1........................ .......... Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10......................... Genetyczna oporność na choroby .................... 198 198 201 201 204 205 210 9 Determinacja i różnicowanie płci oraz interseksualizm .......... Znaczenie głównego układu zgodności tkankowej ...7.......2.............1.... ....... 8.............. 11..... Zmienność cech ilościowych ..........6.... 11...................................................................3....2........................ 253 254 259 263 263 265 268 9 ........... Zarys przebiegu reakcji odpornościowej .1..... 8.................... 10.... Interseksualizm .. 11.................3..........4..... Antygeny erytrocytarne (grupy krwi) .1..... Główny układ zgodności tkankowej — MHC ........4......... 11...................................... 10....... Miary rozproszenia .3....3......

...........2.... Strategia mapowania genomu...................... 12.............................................................. Wykorzystanie markerowych map genomowych w hodowli .......................... ...... 293 298 298 Skorowidz ........................................................... Organizacja DNA mitochondrialnego ................................ Markerowa mapa genomu ...................2.......... 12......... Artykuły przeglądowe .. 12.... 12.......... Organizacja DNA jądrowego .......................................3.................................... 301 ........................................................ Fizyczna mapa genomu ................... Aktualny stan map genomowych zwierząt gospodarskich .3.1 2 Mapy genomowe ....................................................3....................... Podręczniki .. ....1................1...... 12....... .................................................................. ... 12.......3..5............. Genetyczna mapa genomu ...................3....... 12..4........... 12............ 275 275 277 279 280 284 287 289 292 Literatura uzupełniająca ................................ .3....3.....

byli Schwann i Schleiden. W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. czyli nauki o budowie i funkcji komórek. Zgodnie z teorią Darwina.Rozdział 1 Wstęp . umożliwiając im nie tylko przeżycie. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków. komórek i ich organelli. konstruktorów. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty 11 . który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania. ogłoszonej w 1838 roku. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. Autorami pierwszej z nich — teorii komórkowej budowy organizmów. chemików. wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. Główną tezą tej teorii było twierdzenie.zarys historii genetyki Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii. stanowiącą zaczątek genetyki. Badania nad mieszańcami roślin. że wszystkie rośliny i zwierzęta są zbudowane z komórek. a z drugiej formułowaniem przełomowych hipotez i teorii. Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych. O powstawaniu gatunków drogą doboru naturalnego. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum). korę mogą powstawać jedynie przez podział innych komórek. której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. podstawą ewolucji organizmów żywych jest dobór naturalny. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. tkanek. rośliny samopylnej. Okazało się to niezwykle stymulujące dla rozwoju cytologii. ale także przekazanie tych korzystnych właściwości potomstwu. Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX. a ostatnio również informatyków. które stało się początkiem nauki o ewolucji.

Wright i Haldane wprowadzili do genetyki metody statystyczne. które okazały się bardzo istotnymi narzędziami badawczymi. nasiona żółte lub zielone itd. których celem było poznanie praw rządzących dziedziczeniem cech. Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne. Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie. które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2). nasiona gładkie lub pomarszczone. Ten dział genetyki określa się często jako genetykę cech ilościowych. przy czym jedna gameta zawiera tylko jeden taki element. Na początku XX wieku podjęto wiele badań. Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków. że nośnikiem informacji genetycznej są białka. Stało się to za sprawą trzech badaczy: Corrensa.czerwone lub białe. MacLeod i McCarty wykazali. W latach 20. do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. którą można uważać za początek cytogenetyki. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. Przez wiele lat przypuszczano. Fischer. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. Pierwsze doniesienia o „pałeczkowatych" strukturach. za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet. a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. Niektórzy autorzy uważają. Przełom nastąpił w 1944 roku. kiedy to trzej badacze: Avery. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki. że 12 . w tym struktur związanych z dziedziczeniem. że można je określać tylko jednym terminem — genetyka populacji. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. które kilkadziesiąt lat wcześniej podał Mendel. nazwanych w 1888 roku przez Waldeyera chromosomami. de Yriesa i Tschermacka. cech ilościowych. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi. Rok później Morgan ogłosił chromosomową teorię dziedziczenia. Opis mitozy przedstawił w 1882 roku Flemming. Mendel uzyskał pierwsze pokolenie mieszańców (F1). Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. o których różnorodności wiedziano już wówczas dość dużo. zostały podane przez polskiego botanika Strasburgera w 1880 roku. Dopiero wówczas zrozumiano genialność odkryć Mendla. którzy niezależnie od siebie doszli do wniosków.

przetwórstwem żywności.nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA).). koń. zwierząt. to czas usilnych badań. wykrywaniem 1 zwalczaniem patogenów. Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie. Nirenberg i Ochoa. hodowlą zwierząt i roślin. opracowanie techniki rekombinacji i klonowania DNA (1972 r. Zostały one zakończone w pierwszej połowie lat 60. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego. jak świnia. że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna. teorii operonu. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów. ale również jego sekwencjonowanie.) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r. bydło. kura czy pies. ochroną środowiska itp. Odkrycie enzymów restrykcyjnych (1962 r.) oraz enzymu odwrotnej transkryptazy (1970 r. a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań. W doświadczeniu tym można upatrywać początku genetyki molekularnej. ustalenie kolejności par nukleotydów w całym DNA ludzkim. w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. a wiodącą rolę w tych badaniach odegrali między innymi Khorana. która wyjaśniała mechanizm ekspresji genów u bakterii.) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. tzn. liczącym ponad trzy miliardy par nukleotydów. Do wniosku tego doszli na podstawie wyników eksperymentu. owca. W przypadku człowieka celem jest nie tylko mapowanie genomu. Warto podkreślić. Warto zaznaczyć. których celem było poznanie struktury chemicznej DNA. sekwencjonowania DNA (1975 r. Program ten został urucho miony w 1987 roku.). W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów.. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków. Początek lat 50. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw. roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych. W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości. że molekularne poznanie genomów człowieka. Human Genome Organisation Project) 13 .

oraz 2) prywatną firmę CELERA. Głównymi metodami hodowlanymi są selekcja i krzyżowanie. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów. wysoką mięsność świń czy wydajność tłuszczu w mleku krów. dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. Przewiduje się. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych. jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła. . Wydaje się. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt. roślin. Istotnym elementem pracy hodowlanej jest kontrola pochodzenia. Ustalono. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji. świni i kury. bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych. że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój. Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji. zwierząt. Pierwsze osiągnięcia zostały już opublikowane. a w przypadku mutacji genowych — metod genetyki molekularnej. której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć. że do 2005 roku zostaną zsekwencjonowane genomy bydła. czego jednym z licznych przykładów jest hodowla zwierząt. a także człowieka powinna wywołać głębokie zastanowienie się nad tym. W grudniu 2002 roku ustalono sekwencję genomu myszy. którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek. wysoką plenność owiec rasy boorola i inverdale. Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. a ostatnio także polimorfizmu DNA. gdzie jest granica. a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa.

Należy jednak podkreślić. Do prokariontów zalicza się bakterie i sinice. który w 1910 roku ogłosił chromosomową teorię dziedziczenia. dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota). oprócz bakterii i sinic. Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. zdolnego do podziałów (kariokinezy). 2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie. Głównymi tezami tej teorii było twierdzenie. czyli są haploidalne. biorąc pod uwagę organizację informacji genetycznej i budowę komórki. mejoza). Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu. Prokarionty nie mają wyodrębnionego jądra komórkowego. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana. które są zbudowane z kwasów nukleinowych i białek. a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. które podlegają podziałom (mitoza. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię. W jądrze komórkowym występują chromosomy. Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. zbudowany z „nagiej" kolistej cząsteczki DNA. Eukarionty zbudowane są z komórek mających jądra komórkowe. Do eukariontów zalicza się wszystkie organizmy komórkowe. Odpowiednikiem jądra komórkowego jest nukleoid.Rozdział 2 Chromosomy i podziały jądra komórkowego W podziale systematycznym organizmów żywych wyróżnia się. że nie 15 . że: 1) geny zlokalizowane są w chromosomach. Tym samym organizmy te zawierają pojedynczy zestaw genów.

wiedziano wówczas. 2. G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu. z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu. Oznaczenia: P — profaza. S. kwasów rybonukleinowych (RNA). 2-1. Dzięki kondensacji cząsteczki DNA.1. M — metafaza. Budowa chromosomu Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA). Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego. białek histonowych i niehistonowych. chromosom Ryć. Gl. A — anafaza i T — telofaza 16 . która następuje za pomocą białek histonowych i niehistonowych. Fazy (GO.

subtelo-i akro-(telocentryczny) (ryć. (3. że są siostrzane.71-3. Czwarta chromarydy siostrzane Ryć. Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu. 2-1).01-7. ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć. nucleolar organizer region). Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej.8S. 2-2). 18S i 28S.osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). określane inaczej jako obszar jąderkotwórczy — NOR (ang. Niektóre chromosomy mają. który jest odpowiedzialny za uformowanie jąderek podczas interfazy. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17 . W jąderkach budowane są podjednostki rybosomów. O chromatydach mówi się.00). która obejmuje nie tylko ustalenie liczby chromosomów. także przewężenie wtórne.01-oo). 2-2. Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym. (1. W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5.00-1. Wówczas to chromosom ma długość rzędu kilku mikrometrów. ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. oprócz przewężenia pierwotnego. Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC. Część końcowa ramienia chromosomowego nazywana jest telomerem. Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-. określanym jako centromer. a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną.70). Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1. submeta-.00) i (7.

Fragment ramienia chromosomu. Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Oznacza to. a drugi od ojca danego osobnika. morfologii. który występuje za przewężeniem wtórnym.frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej. W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy. Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć. występują w układzie XX u samic oraz XY u samców. Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y. 2-3). która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y). Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego. układu prążków poprzecznych oraz. Heterochromosomy. co najważniejsze — zestawu loci genów. W każdej parze jeden chromosom pochodzi od matki. które są w nich położone. nazywa się satelitą. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału. Podczas fazy S następuje replikacja — 18 . jak i żeńskiej. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. która z kolei zawiera jedną cząsteczkę DNA. że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację. oznaczane u ssaków symbolami X oraz Y. Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X.

Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom. zawierający po dwie cząsteczki histonów: H2A. która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. Fragment DNA owinięty na oktamerze histonowym (1. 19 . 2-4. ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki. że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. inaczej par zasad (pz). Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu. H2B.8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz. PWN) samoodtworzenie DNA.Ryć. Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz. w zakresie od 0 do 80 pz. a procesy te. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt. w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. Przyjmuje się. 1997. H3 i H4). 2-4). Jest on zbudowany z rdzenia białkowego (oktamer histonowy. na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów. charakteryzują się niezwykłą precyzją (ryć.

a jej ostatecznym etapem jest utworzenie domen pętlo wych. Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu. Jej replikacja występuje w późnym okresie fazy S. W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów. Dlatego te sekwencje DNA określane są terminem S AR (ang. z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny. Heterochromatyna fakultatywna jest częścią chromatyny. ciałka Barra. przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. Chromosomy interfazowe zachowują strukturę nukleosomowa. Pojawia się ona podczas zapłodnienia. przykładem jest jeden z chromosomów X u osobników żeńskich. Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów. Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. W niej zlokalizowane są kodujące sekwencje DNA. Heterochromatyna konstytutywna jest frakcją chromatyny. sekwencji nukleotydowych. Solenoid podlega dalszej spiralizacji. czyli geny.Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid. która zawsze występuje w stanie skondensowanym. głównie powtarzalnych sekwencji DNA. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną. należącymi do rodziny białek HMG (ang. które są zakotwiczone w rdzeniu białkowym chromatydy. Zbudowana jest z niekodującycK. Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości. zbudowanym z białek niehistonowych. który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw. które odpowiadają za zbliżenie się sąsiednich nukleosomów. domeny. że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. Wiadomo jednak. która może ulec trwałej kondensacji. scaffold attachment region). high mobility group). Podlega ona replikacji w początkowym okresie fazy S. wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20 . które tworzą większe chromocentra. rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego. czyli regionami wiążącymi się ze szkieletem chromosomu.

W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych.w oocycie drugiego rzędu (komórce jajowej). w których jeden chromosom jest pochodzenia ojcowskiego. Chromosomy homologiczne mają loci tych samych genów. ale mogą zawierać w nich różne allele 21 . a drugi matczynego.

Należy podkreślić. czyli nadliczbowe względem podstawowego ze- 22 . 2-5 i 2-6). Chromosomy B. 2-1. od 30 u norki do 78 u psa (tab.Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale. że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota. ryć.

2. Efektem tego jest zmienność ich liczby zarówno między osobnikami. że często są zbudowane z heterochromatyny konstytutywnej. charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych. fuzji centrycznej u lisów polarnych. iż są nieaktywne genetycznie. jak i pomiędzy komórkami w obrębie jednego osobnika. Prążki mają identycz23 . wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T. Okazało się. czyli można przypuszczać. że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii.stawu A. chociaż wiadomo. może być uwidocznione za pomocą technik barwienia różnicującego. Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. Konsekwencją tego jest występowanie u lisów osobników. Barwienie prążkowe chromosomów Zróżnicowanie wewnętrzne chromosomu. np. 2.49 lub 48 chromosomów. Do tej pory nie poznano funkcji tych chromosomów. które mogą mieć 50. Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej.

Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące 24 . Wynika z tego. że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole. po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny.ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku. ale także układ prążków na chromosomach. Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym.

a następnie barwienia roztworem Giemsy.(ryć. Silne wiązanie barwnika kwinakryny następuje w miejscach. W efekcie na chromosomach 25 . 2-7a). Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny). gdzie dominują pary zasad A-T.

Wskazuje to zatem. takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze. Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych. gdzie przy barwieniu QFQ występuje prążek nie świecący. Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach. a prążki jasne odpowiadają nie świecącym prążkom Q. H2 i H3. Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG). a pozostają trudne do usunięcia. Oprócz opisanych wyżej metod prążkowych. są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl. wysepki CpG). Heterochromatyna konstytutywna 26 . Ponadto. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T. znane są metody. ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. które się wybarwiają roztworem Giemsy. Zależność ta jest szczególnie interesująca.pojawiają się prążki ciemne i jasne (ryć. Największe zagęszczenie genów występuje w obrębie izochor H3. Oznacza to na przykład. 2-8). które pozwalają na uwidocznienie charakterystycznych regionów chromosomu. 2-7b). w których jest też najwięcej wysepek CpG. Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu. silnie skondensowane obszary heterochromatynowe. Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. Prążki R. że prążki R są głównymi regionami. a miejscami szczególnie bogatymi w loci genów są prążki T. wykorzystywanych do identyfikacji chromosomów homologicznych. gdzie przy barwieniu QFQ obserwowane są prążki świecące. w których zlokalizowane są geny. które zaszły w kariotypach zwierząt. W takich warunkach znaczna część euchromatyny zostaje usunięta. Prążki ciemne występują w tych samych miejscach. są one niezbędne przy mapowaniu fizycznym genów. a przy barwieniu GTG prążek jasny.

2-9a). inaczej Ag-NOR. które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). W miejscach tych następuje wytrącenie metalicznego srebra. np. a rzadziej na końcach. Znane są również takie gatunki zwierząt. 27 . czy też w częściach środkowych ramion. które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć.jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć. to barwienie azotanem srebra. 2-9b). u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona. Prążki Ag-I. 2-10).

28 .Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków. Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych.

Owca.60 (ryć. co odróżnia go od autosomów akrocentrycznych o podobnej wielkości. 2-5b). Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X. W chromosomie X brak jest centromerowego prążka C. natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim. 2-6a). 2-5a).i submetacentrycznych) oraz 6 par akrocentrycznych. Chromosom X jest średniej wielkości metacentrykiem. 2n = 60. a chromosom Y jest małym metacentrykiem. w którym nie jest jeszcze zakończona kondensacja chromosomów. Układ prążków C. Koza. Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. Obszary jąderkotwórcze występują. w pobliżu centromeru (ryć. Chromosom X jest dużym chromosomem metacentrycznym. Podobnie jak w przypadku bydła. podobnie jak u bydła. Chromosom Y jest najmniejszym chromosomem metacentrycznym. w części telomerowej ramion długich pięciu par autosomów. W stadium prometafazy. 2n = 38 (ryć. Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. Wszystkie autosomy są akrocentryczne. a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. który ma dodatkowy prążek 29 . W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. a chromosom Y jest małym metacentrykiem. trudnym do odróżnienia na podstawie morfologii od autosomów. Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków. a chromosom Y jest małym metacentrykiem. 2-6b).Bydło. Świnia. 2n . ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem. a chromosom Y jest akrocentrykiem. Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X. 2n = 54 (ryć. 2-9a). natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów. Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych. Chromosomy płci są łatwe do identyfikacji. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach. Chromosom X jest dużym akrocentrykiem. także koza ma wszystkie autosomy akrocentryczne. Również akrocentryczny jest chromosom X. Koń. w chromosomie X widoczne są krótkie ramiona. 2n = 64 (ryć. 2-10a). w ramionach krótkich. Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków.

W grupie dużych autosomów analizuje się najczęściej 8 par. przy czym najczęściej obserwowano l. Wszystkie chromosomy. Lis polarny. 2 lub 3 chromosomy B. 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. z grupy mikrochromosomów. Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. Wszystkie autosomy z grupy A są chromosomami dwuramiennymi. Obszar jąderkotwórczy występuje tylko w jednej parze autosomów. 2n = 34 +B (ryć. a chromosom W jest małym metacentrykiem. W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. 49 lub 48. Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych. łącznie z chromosomami płci. którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów. a chromosom Y bardzo małym akrocentrykiem. Lis pospolity. Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. mają bloki heterochromatynowe w okolicy centromeru. 2-7a). którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B.interstycjalny w ramieniu długim. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. w okolicach centromeru. 2-9b). 2-10b). Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. Ponadto. Chromosom X jest dużym metacentrykiem. Chromosom Y jest w znacznej części heterochromatynowy. nazywanych mikrochromosomami. 30 . występuje liczna grupa bardzo małych chromosomów. 2n = 78. Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną. wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne. Liczba chromosomów B waha się od O do 7. 2n = 50. dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe. W kariotypie kury. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. a chromosom Y bardzo małym akrocentrykiem. a chromosomy z grupy B są akroćentryczne lub subtelocentryczne. Chromosom X jest dużym metacentrykiem. oraz w chromosomie Y. Kura. U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. Chromosom Z jest dużym metacentrykiem. podobnie jak u innych ptaków.

2-8b). a czwartą fazą jest podział. nabłonka). proliferacją limfocytów przy reakcji odpornościowej organizmu. ale także identyczną sekwencję nukleotydów w DNA.3. a także z pierwszymi etapami gametogenezy. W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki.Pies. Mitoza Mitoza to proces podziału jądra komórkowego. Chromosom X jest dużym metacentrykiem. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. a chromosom Y jest małym metacentrykiem. Rozpoczęcie fazy S oznacza. 2n = 78 (ryć. S i G2 tworzą okres międzypodziałowy — interfazę. że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. który prowadzi do powstania dwóch komórek potomnych. komórki krwi. 2. W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. Komórki potomne mają nie tylko taką samą liczbę chromosomów. Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y. mających genotyp identyczny z tym. jaki miała komórka rodzicielska. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki. w części terminalnej ramion długich. a faza S jest związana z procesem samoodtworzenia się DNA (replikacja). odnawianiem niektórych komórek u dorosłych organizmów (np. Wszystkie autosomy są akrocentryczne. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów. Jeżeli ilość DNA wyrazimy za 31 . Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu. Fazy Gl.

to w jądrze komórkowym po replikacji jest 4C. a centriole dzielą się na dwie parzyste struktury. mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska. odpowiedzialne za powstanie wrzeciona podziałowego. Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32 . Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. 2-12). Następuje formowanie się wrzeciona podziałowego. w których każdy z chromosomów jest zbudowany z jednej chromatydy. Po zakończeniu podziału jądra komórkowego następuje cytokineza. W tej fazie chromosomy są rozprzestrzenione w całej komórce. łączą się z centromerami chromosomów w taki sposób. W końcu. W obrębie jądra komórkowego zanikają jąderka. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. odbudowuje się błona jądrowa oraz jąderka. metafazy. występujących w jądrze komórki somatycznej. rozchodzą się do przeciwległych biegunów komórki. Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych. W trakcie omawiania podziału mej etycznego pokazane zostanie. że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. 2-11). Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. W wyniku kariokinezy w komórce powstają dwa jądra potomne. że najmniejszą zawartość DNA (1C) mają gamety (ryć.4. anafazy i telofazy (ryć. 2. jakie występują w profazie. dezintegracji ulega błona jądrowa. czyli podział cytoplazmy i rozdział organelli komórkowych. Chromosomy ulegają dekondensacji. wychodzące z centrosomu (obszar wokół centrioli). W profazie rozpoczyna się proces kondensacji chromosomów.pomocą umownych wartości C. Centriołe. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. W telofazie zachodzą procesy odwrotne do tych. Mitoza składa się z czterech faz: profazy. Istotnym zmianom podlegają również inne organelle komórkowe. Kariotyp Uszeregowanie chromosomów. organelle komórkowe odpowiedzialne za wytwarzanie rybosomów. Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. którego włókienka. w pary homologiczne określane jest terminem kariotyp.

Poznań 1988) 33 . b— zanikające jaderko. a — centriole. T — telofaza. Schemat przebiegu podziału mitotycznego. A — anafaza. C — cytokineza. PM — prometafaza.spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. 2-12. Oznaczenia: P — profaza. d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt. Wydawnictwo AR. Być. c — dezintegrująca błona jądrowa. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. M — metafaza. Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów.

Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu.lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła. że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny. G lub R. ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. 2-13. położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds. w których wszystkie Ryć. Standaryzacji Kariotypu Świni. submeta-. Jest to spowodowane tym. kozy i psa. do których zalicza się: długość chromosomu. subtelo. 2-8a 34 .Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć.

Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy Ryć.1988) 35 . Standaryzacji Kariotypu Świni (Hereditas 109:151-157. przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne. 2-14. Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds.chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości.

Ag-I G G G. 1985 Hereditas 103:171-176.zróżnicowane pod względem morfologicznym. wielkość oraz wzór prążkowy (najczęściej prążki G lub R). 1999 J w- Hereditas 109:151-157. Natomiast w drugiej połowie lat 90. 2-14). Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. 2001 jw. przyjętym dla danego gatunku. nazywa się idiogramem (ryć. precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe. R G. i 85:317-324. 2-13). dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G. 2-14). 1981 Chromosome Research 4:306-309. kozy i konia. R R G. 1999 . Przykładem może być kariotyp świni (2n = 38). R Źródło Cytogenetics and Celi Genetks 92:283-299. Ag-I G. W obrębie regionów numerowane są także kolejne prążki. Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony. w zakresie wyznaczonym przez liczbę par dla danego gatunku. owcy. Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej. Graficzne przedstawienie kariotypu. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni. 1988 Chromosome Research 5:433-443. w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem. które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. 1997 Hereditas 103:33-38. Każda para homologiczna ma opisaną morfologię. C. Brytania). dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang. Opracowanie kariotypu. C. 1985 Cytogenetics and Celi Genetks 31:240-248. Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła. R G. R G. Q. owcy. Ponadto. obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków. opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11 Wykaz gatunków. Q. kozy i kota. które są numerowane (ryć. konia. świni. która odbyła się w 1976 roku w Reading (W. landmarks). czasami określanego kariogramem. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery. 1996 Cytogenetics and Celi Genetks 86:271-276. W latach 80. bydła.

Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne. pachyten. które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału. Należą do nich: kondensacja chromosomów. Strukturą tą jest kompleks synaptonemalny (ang. tzn. która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. 2. dla których opracowano wzorce. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten. tzn. Mejoza Podział mejotyczny prowadzi do powstania komórek. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną. podobnie jak w przypadku podziałów mitotycznych. synaptonemal complex — SC). pojawiającej się w zygotenie i pachytenie profazy I. polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych. Wejście komórki w podział mejotyczny poprzedzone jest. w których występują takie same fazy jak w mitozie. anafaza i telofaza (ryć. replikacją DNA w fazie S. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu.5. zygoten. a element centralny powstaje w miejscu. które występują również w mitozie. komórki te mają zmniejszoną do poziomu 1C zawartość DNA. który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. Mejoza składa się z dwóch podziałów. metafaza. Ponadto. w których liczba chromosomów jest zredukowana o połowę. która mocuje chromosom do wewnętrznej strony błony jądrowej. W tabeli 2-II zestawione są gatunki. Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej. Elementy lateralne 37 . Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym. Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. Każdy element lateralny zakończony jest tarczką przylegającą. 2-15). diploten i diakinezę.szych par spośród 39) oraz poprawiono wzorzec kariotypu konia.: profaza. czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. dezintegracja błony jądrowej. 2-16 i 2-17). z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów.

2-15. AI — anafaza I. c — początek budowania kompleksu synaptonemalnego.Tli Ryć. a — tarczka przylegająca. DL — diploten. Poznań 1988) . P — pachyten. e — chiazma (wg: Genetyka zwierząt. Ali — anafaza II. b — centromer. DK — diakineza. d — guzek rekombinacyjny. Pil — profaza II. MII — metafaza II. TI — telofaza I. Oznaczenia: PI — profaza I. Schemat przebiegu podziału mejotycznego. Wydawnictwo AR. MI — metafaza I. Z — zygoten. L — leptoten. Tli — telofaza II.

synaptonemal complex protein): SCP1. że crossing over może zajść. sekwencjami DNA. Koniugacja chromosomów 39 . Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego. Badania białek SC pokazały. mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz). Wynika z tego. że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. występującymi w tej części domen pętlo wy ch. to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi. Wiele wskazuje na to. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej. które są zakotwiczone w rdzeniu białkowym chromatydy. Ponieważ koniugacja ma charakter homologiczny. Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. Ostatnio przeprowadzone badania pokazały jednak. zależnie od gatunku. która z kolei miała umożliwiać zajście crossing over na początku pachytenu.łączą się tylko z niewielką częścią DNA chromosomów (około 1%). których długość. Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. chociaż jeszcze nie poznanymi. zanim dojdzie do koniugacji za pośrednictwem SC. domen pętlowych. SCP2 i SCP3. U ssaków dobrze poznano strukturę trzech białek SCP (ang. że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE).

dzięki 40 .zostaje zakończona na początku pachytenu (ryć. na okładce). Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów. Biwalent jest także formowany przez heterochromosomy X i Y (ryć. 2-17b).

Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału). Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji. które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. Ponieważ tak się nie dzieje. a tym samym i jego chromatydy. że na jednych chromosomach liczba ta byłaby znaczna. że crossing over jest zjawiskiem obligatoryjnym. gdzie wystąpiło crossing over. a na innych brak byłoby takich wymian. Wiadomo. a drugi od matki. tzn. ponieważ brak crossing over pociąga za sobą brak chiazm. W metafazie I biwalenty. która uczestniczyła w wymianie. Należy podkreślić. gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. ich zanikania. jaka była przed crossing over. które są podklasą prążków R. Wówczas to chromosom. Należy jednak pamiętać. Zjawisko to określane jest terminem interferencji.niewielkim regionom pseudoautosomalnym (ang. Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. poza miejscami. że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca. Chromatyda. stanowiące cytologiczny dowód zajścia crossing over. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm. w przeciwieństwie do sytuacji. pseudoautosomal region — PAR). Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I. Potencjalnie mogłoby istnieć niebezpieczeństwo. zachodzi w przypadkowym miejscu biwalentu. miał zestaw alleli tylko jednego z rodziców. Po zakończeniu pachytenu — w diplotenie. składające się z maksymalnie skondensowanych chromosomów homologicznych. co wynika z zasady. że SC jest w to istotnie zaangażowany. Przyjmuje się. Losowość crossing over naruszona jest również przez to. następuje rozkład kompleksów synaptonemalnych. uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego. które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. czyli musi zajść w obrębie każdego biwalentu. tzn. a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T. przy czym liczba tych zdarzeń waha się od l do 5. że pierwotnym źródłem zmienności są mutacje. Zasadniczo crossing over jest zdarzeniem losowym. Zasada ta dotyczy także biwalentu X-Y. zmierzają do płaszczyzny równikowej 41 . a w świetle ostatnich badań można przypuszczać. które uruchamiają homologiczną koniugację. Na początku pachytenu występuje zjawisko crossing over. że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over. której efektem jest zmienność w świecie ożywionym. w których powstają chiazmy. że zachodzi ono rzadziej w pobliżu centromeru. Losowość zachodzenia crossing over jest jednak ograniczona.

Oznacza to. Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób. 2-18a). Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział. w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć. 2-18c). że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej.komórki (ryć. 42 . który nie jest poprzedzony replikacją DNA. natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego. czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym. W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. że do centromeru przyłączają się włókna tylko z jednego bieguna. Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I. Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA. 2-18b).

a ich chromatydy mają zrekombinowane układy alleli. inne matczynego. 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43 . Ten fenomen. 2. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. Po ustawieniu się chromosomów podczas metafazy II (ryć. Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki. Przebieg mejozy. rozpoczyna się telofaza. można podzielić na: chromosomowe. obok mutacji. jakie występują w profazie mitotycznej. które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. chromatydowe i wewnątrzchromatydowe. Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny. Gametogeneza Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym. a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają. a niektóre mają zrekombinowany układ alleli. W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. Ten typ określany jest jako rekombinacja chromatydowa. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego.Drugi podział ma przebieg zgodny z mitozą. przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa.6. wśród których jedne są pochodzenia ojcowskiego. w której zachodzą procesy odwrotne do tych. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C. Rekombinacje genetyczne zachodzące podczas mejozy. Trzystopniowa rekombinacja sprawia. z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów. że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice. 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). rozumiane w szerokim sensie. że wśród gamet nie występują dwie o tym samym zestawie alleli. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy. jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza).

który okrywa górną część jądra komórkowego znajdującego się w główce plemnika.geneza. a druga podlega dalszym podziałom. zostają przekształcone w oocyty I rzędu. które występowały w jajniku. 2-20). Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. z których jedna komórka zajmuje miejsce pierwotnego spermatogonium. Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. po zakończeniu mejozy. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych. Ostatecznie. podlegają głębokim przeobrażeniom podczas procesu spermiogenezy. a jest ich najczęściej sześć. Podziały te są zsynchronizowane. oraz witki. który jest nazywany diktiotenem. Główne zmiany. która jest określana jako syncytium. wstawki znajdującej się u podstawy główki. Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. które rozpoczynają podział mejotyczny. która stanowi przedłużenie wstawki. stem cells). 2) zgrupowaniu mitochondriów w pobliżu centrioli. będące w stadium diktiotenu. w wyniku którego powstają plemniki. w stosunku do akrosomu. jako komórki niezróżnicowane. Spermatydy. czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika. Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu. w której zgrupowane są mitochondria. powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi. które są umiejscowione po przeciwnej. w której jest umiejscowione jądro komórkowe i akrosom. 3) wykształceniu na bazie centrioli włókna osiowego witki. które wykazują zdolność do samoodnawiania. 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach. Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego. Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki. Oocyty przechodzą w stan spoczynkowy. które niezwłocznie rozpoczynają podział mejotyczny. 2-19). 44 . Dojrzały plemnik zbudowany jest z główki. jakie zachodzą podczas spermiogenezy. Następne podziały mitotyczne spermatogoniów. W ten sposób wszystkie oogonia. w których komórki linii płciowej lokują się w części korowej gonad. nie kończą się cytokinezą. która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. czyli komórek nie w pełni zróżnicowanych. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. polegają na: 1) przekształceniu aparatu Golgiego w akrosom. stronie jądra komórkowego. Pierwszy podział prowadzi do powstania dwóch spermatogoniów.

Dzieje się to na drodze wyrzucenia przez oocyt zawartości 45 . w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki.Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. Oocyt znajduje się w stadium metafazy II. przed owulacją następuje ponowne uruchomienie podziału mejotycznego. regulowanych hormonalnie. który jest wspomagany przez otaczające komórki pęcherzykowe. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. W kolejnych cyklach płciowych. których wzrost był wystarczająco intensywny. Oocyt I rzędu kończy pierwszy podział mejotyczny. przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu. W pęcherzykach. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej. a w nich rozrasta się również oocyt. pewna część pęcherzyków rozpoczyna wzrost. to może nastąpić dokończenie oogenezy. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji.

ziaren korowych. podlega dekondensacji i powstaje przedjądrze męskie. Powoduje to „utwardzenie" osłonki przejrzystej. znajdujących się pod powierzchnią oocytu. a drugie reprezentujące zestaw chromosomów żeńskich. po czym następuje telofaza II. Zapłodniony oocyt II rzędu przekształca się w zygotę. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego. które pozostały w oocycie 46 . który zapłodnił oocyt. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie. do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. a chromatyna plemnika. która staje się barierą nie do pokonania dla plemników. Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny. w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika.

Zawartość DNA wzrasta do poziomu 4C. inseminacja. że zygota jest gotowa do rozpoczęcia podziału mitotycznego. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów. pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. Warto zauważyć. co powoduje. przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. zygotach. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii). Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. zarodkach. Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu. kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro). Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki. które umożliwiają uzyskiwanie potomstwa pożądanej płci. można wprowadzić techniką elektrofuzji komórkę somatyczną. samic dawczyń do rogów macicy tzw. które są określane jako enukleowane. Na przykład. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA. który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. samic biorczyń. profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja). Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II). Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu. do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy. Do takich oocytów. W taki właśnie sposób sklonowano słynną owcę Doiły. że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne). .po zakończeniu drugiego podziału mejotycznego. a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów). U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich.

czyli procesowi generującemu pierwotną zmienność genetyczną. Budowa kwasów nukleinowych Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych. McCarty. za pomocą kodu genetycznego. C. przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy. Badania te przeprowadzili badacze amerykańscy O.M. Po trzecie. które z kolei podlegają rekombinacjom podczas mejozy. DNA ma zdolność do samoodtwarzania się.Rozdział 3 Gen i jego ekspresja Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi. w sekwencji nukleotydów zapisana jest. Crick przedstawili model budowy DNA. MacLeod i M. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA.1. Po pierwsze. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA).T.D. Po drugie. a także o strukturze cząsteczek rybosomowego (rRNA). DNA może podlegać mutacjom. transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. 3. W ślad za tym odkryciem nastąpiły następne. W 1953 roku J. Watson i F. Z kolei proces ekspresji 48 . informacja o pierwszorzędowej strukturze białek. a przez następne lata rozszyfrowywano kod genetyczny. który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. które są niezbędne do pełnienia funkcji nośnika informacji genetycznej. czyli replikacji. Avery. Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości. DNA charakteryzuje się trzema właściwościami.

genu jest nierozerwalnie związany z RNA. cukier deoksyryboza i reszta kwasu fosforowego (ryć. W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy. 3. który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów. Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi 49 . Struktura ta określana jest w języku polskim terminem podwójna helisa (ang. W DNA występują cztery zasady azotowe. które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C). występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu. w którego skład wchodzą: zasada azotowa. rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów. 3-1). Podstawową jednostką struktury DNA jest deoksyrybonukleotyd. i tRNA (transportujący RNA). które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji. helix). DNA Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. a rzadziej podwójny heliks.1.1.

polskim lub bp od słów angielskich base pairs). Przyjmuje się. Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku.2. inaczej nazywanych przewężeniami wtórnymi. że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha. lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. natomiast liczba aktyw50 . Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą.1. a naprzeciw guaniny znajduje się cytozyna. 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang. że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA. w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). tzn. powstaje pre-rRNA o stałej sedymentacji 45S. W jąderku zlokalizowane są cztery rodzaje rRNA. a w przypadku mRNA także dla procesu translacji. W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA). z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA. Taka organizacja podwójnej helisy DNA sprawia. bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. prowadzonej przez polimerazę I RNA. który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. Długość cząsteczki DNA wyraża się liczbą par nukleotydów. którego długość wynosi około 14 000 pz. RNA Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych.8S. nucleolar organizer region — NOR). czyli każdy łańcuch ma koniec 3' i 5'. tak więc w parze AT są dwa wiązania wodorowe. Przeciwna polaryzacja polega na tym. Pomiędzy zasadami powstają słabe wiązania wodorowe. Trzy rodzaje rRNA: 5. Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji. określaną wielkością S — stała sedymentacji. Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. które są wyróżniane ze względu na wielkość cząsteczki. Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla. 3. Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane.z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. naprzeciw adeniny zawsze występuje tymina. a w parze GC trzy takie wiązania. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności. Podczas transkrypcji.

które są komplementarne do kodonu aminokwasu transportowanego przez tRNA. która katalizuje związanie tRNA z. Na końcu 3' cząsteczki tRNA występuje sekwencja CCA. 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem.nych obszarów. Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA). tzn. Geny 5S rRNA są transkrybowane przez polimerazę III RNA.właściwym aminokwasem. W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową. a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć. zlokalizowane są w podjednostce dużej (60S). o mało poznanej funkcji. zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu. występujący w wielu powtórzeniach w innej części genomu. które podlegają transkrypcji.8S i 28S. jest zmienna. Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60. zawiera układ trzech nukleotydów. Czwarty rodzaj — 5S rRNA jest kodowany przez gen. 5S. Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów. Wymienione rodzaje rRNA uczestniczą w budowie rybosomu. a trzy pozostałe rodzaje. W nici takiej mogą jednak występować fragmenty komplementarne. które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. co oznacza. że przekracza liczbę znanych aminokwasów. który jest zaangażowany w dostarczanie aminokwasów do rybosomów. 51 . 3-2). w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas. czyli takich. 3) pętla III — dodatkowa. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. 2) pętla II — antykodonowa. 5.

a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów. określana terminem niekodujący RNA (ncRNA — ang. bądź mejozy. Podobnie jest w przypadku mejozy. czyli mitozy. a także regulacji ekspresji genów. które określane są jako replikony. Każdy podział mitotyczny musi być poprzedzony replikacją. z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji.2. 3. noncoding RNA). że jest to bardzo ważna grupa RNA. Na uwagę zasługuje jeszcze jedna klasa RNA. Na przykład. modyfikacji nukleotydów. która bierze udział w procesie wycinania intronów z pre-mRNA. Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach. liczba replikonów w genomie ssaków szacowana jest na około 25 000. 52 . Ostatnie badania wykazują. Replikacja DNA Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji.Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych.

które następnie są łączone przez enzym ligazę w ciągłą nić. Wynika z tego. mającego charakter trójkowy.3. w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. który ma być wbudowany w procesie biosyntezy białka. Od tej zasady są tylko nieliczne wyjątki. to ogółem możliwe jest utworzenie 64 trójek (tab. że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). fragmenty Okazaki). Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. które dotyczą niektórych kodonów w mitochondrialnym DNA. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą. 3-1). Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego. 3-3). który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym. Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). Tryplet AUG. Po pierwsze. kodon UGA w kodzie uniwersalnym jest 53 . W ten sposób powstają tzw. Rozplecione łańcuchy polinukleotydowe stanowią matryce. Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. kod ma charakter trójkowy. Po drugie. że sekwencje nukleotydów w tych łańcuchach. widełki replikacyjne (ryć. o czym była już mowa wyżej. a nić powstająca w sposób nieciągły opóźnioną. tzn. W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów. tzn. tzn. jest on uniwersalny. rozpoczyna część kodującą genu. który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA. a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. są różne. Kod genetyczny Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego. które nie kodują żadnego aminokwasu. trzy kolejne nukleotydy (kodon. takie. w obrębie danego odcinka DNA. Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne. tryplet) w DNA zawierają informację o aminokwasie. Oznacza to. 3.Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. na których w sposób komplementarny syntetyzowane są drugie łańcuchy. np. Drugi.

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. translacji i potranslacyjnej modyfikacji białka. czyli dobudowa60 . badania serologiczne — grupy krwi. że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele. Należy jednak pamiętać. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. potranskrypcyjnej modyfikacji mRNA. elektroforeza białek. która wskazuje. hybrydyzacja ze znakowanym przeciwciałem itp. Podczas rozwoju ontogenetycznego. że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA. które mogą występować w układzie homo. Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki.3. wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych. w skład którego będą wchodziły różne kombinacje eksonów. Wśród nich znaczną grupę stanowią geny pełniące tzw. W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw. Zakończenie transkrypcji związane jest z sekwencją AAUAAA. obecność rogów. Modyfikacja mRNA.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek.). czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. oprócz zmian opisanych w podrozdziale poświęconym transkrypcji. replikacja DNA. którego całościowe poznanie wymaga jeszcze wielu lat badań. Niemniej znanych jest już wiele mechanizmów. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji. Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu. takie jak: przemiany energetyczne. Warto pamiętać. poligeny. Mechanizm ten nazywa się alternatywnym składaniem mRNA. podatność na stres itp. zależnie od tego. Jest to bardzo złożony proces. Z drugiej strony.7. w jakim kierunku różnicuje się dana komórka. które są zaangażowane w kontrolę ekspresji genów. budowa struktur komórkowych itp. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. co ma oczywiście związek z ekspresją genów. obok genów ulegających powszechnej ekspresji. umaszczenie.lub heterozygotycznym. housekeeping genes). Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. funkcje gospodarza komórki (ang. jest włączana i wyłączana ekspresja różnych genów. że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu. Regulacja ekspresji genu W genomie ssaków występuje około 35 tysięcy genów. zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. obejmuje także inne procesy. Ekspresja genu obejmuje procesy: transkrypcji.

7.1. leucine zipper). modyfikacjom polegającym na zmianie sekwencji nukleotydów. Proces ten nazywa się redagowaniem mRNA. powstałe na bazie tego samego matrycowego DNA. są zaliczane do następujących grup: białka zawierające tzw. Okazuje się. Wreszcie mRNA powstały podczas transkrypcji może ulegać. Czynniki transkrypcyjne.in. Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie. takich jak hormony. które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji. 3. Forma rozpuszczalna tego białka powstaje na matrycy mRNA. 3-7). dodatkowego kodonu stop. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang. Taką formę modyfikowania mRNA opisano m. Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. zinc finger). Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć. Efektem tego może być na przykład pojawianie się w transkryptach. białka o strukturze typu heliks-skręt-heliks (ang. czyli od jego stabilności. w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA). odpowiedzialne za syntezę polipeptydów o różnej długości. palce cynkowe (ang. przed przejściem do cytoplazmy. Czynniki transkrypcyjne Czynnikami transkrypcyjnymi nazywane są białka. ogonek poliA) na końcu 3' mRNA. a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych. który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik 61 . W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty. Wymienione struktury wchodzą w kontakt z nicią DNA. zależnie od ich struktury trzeciorzędowej. Funkcjonują wówczas dwa rodzaje mRNA. Białka te w swojej strukturze zawierają dwa istotne obszary.nie sekwencji poliA (tzw. powstających w niektórych tkankach.

G2 — części strukturalne genów transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu. 3-7. a jedynie wiążą się z receptorami błonowymi.2. Geny homeotyczne Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych. Oznaczenia: HP — hormon peptydowy.) nie wnikają do wnętrza komórki. Poznanie genów od62 . Gj. Wiązanie takie wywołuje wiele reakcji.7. R — receptor hormonu peptydowego. lub też z udziałem przekaźników modyfikujących białka w cytoplazmie.Ryć. gdy do receptora jest przyłączony hormon steroidowy. 3. Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. insulina itp. Schemat regulacji ekspresji genów za pomocą hormonów. Domena wiążąca DNA jest aktywna tylko wówczas. hormon wzrostu. co można uznać za regulację ekspresji genów na etapie potranslacyjnym. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników. HS — hormon steroidowy. Hormony peptydowe (np. RS — receptor hormonu steroidowego. a z drugiej strony od różnicowania się komórek. Pl P2 — promotory genów. których mechanizm działania jest jeszcze słabo rozpoznany. T1 T2 — przekaźniki wewnątrzkomórkowe.

Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks. położonych w jednym chromosomie. która koduje fragment białka (tzw.3. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej. że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. HOX2. ANT-C i BX-C. tzn. Struktura tych genów wykazuje zaskakujące podobieństwo. Okazało się. HOX3 i HOX4. Trzeba jednak podkreślić. Metylacja DNA Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną. które w genomie muszki owocowej występują w dwóch kompleksach. Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. 3.7. Wynika z tego. U ssaków geny te. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji.powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. Prawie cały DNA zawiera zmetylowaną cytozynę. ich ekspresja następuje w ściśle określonej kolejności. że mają one sekwencję o długości około 180 pz (tzw. że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne. Obok wielu genów. że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów. że około 56% genów zawiera te sekwencje. Geny te funkcjonują w układzie hierarchicznym. zgrupowane są w czterech kompleksach: HOX1. których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących 63 . Rozwój muszki owocowej przebiega pod kontrolą genów. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia. czego skutkiem jest przejście DNA w stan nieaktywny. Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. homeoboks). które odpowiadają za poszczególne etapy morfogenezy. Oznacza to. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. w liczbie około 30. a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie. która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. domena białkowa) o długości 60 aminokwasów.

wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. a także w komórkach somatycznych organizmu dorosłego. znane są liczne geny. czy cytozyna jest metylowana. czyli nieistotne jest. jak i genom matki. Natomiast zarodki androgenetyczne. 3. tzn. to 64 . czyli nie wpływa na prawidłowość replikacji wysepek CpG. gdy pochodzą np. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna. lub aktywne. znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. czy allel pochodzi od ojca. w której cytozyny nie są metylowane. tzn. Zjawisko to niekiedy dotyczy całych regionów chromosomowych. jak i męski rozwijały się prawidłowo. dobrze rozwijały struktury trofoblastu. gametic imprinting). jeśli pochodzą od ojca. genotyp Aa jest równoważny genotypowi aA. od matki. były zdecydowanie niedorozwinięte. z tym jednak że struktury wywodzące się z trofoblastu. Powstałe na drodze manipulacji zarodki ginogenetyczne. czy niemetylowana. czy od matki. Dowód na to. Jedynie zarodki zawierające zarówno genom żeński. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca. Piętno gametyczne W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze.7. że do rozwoju osobniczego niezbędny jest zarówno genom ojca. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję. niedorozwinięty zaś był sam zarodek. czyli ze strony końca 5'. w które zaangażowane są fragmenty podlegające piętnowaniu. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji. a od którego allel a. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną.4. które mogą być nieaktywne. tzn. czyli uczestniczące w formowaniu łożyska. 3-8). Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych.w części poprzedzającej gen. dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. a drugi — MspI przecina tę sekwencję niezależnie od tego. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych. rozwijały się dość dobrze. Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. a nie tylko diploidalna liczba chromosomów. zależną od tego. zawierające dwa genomy żeńskie. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. Jeden z nich -— HpaII przecina sekwencję CCGG. od którego z rodziców pochodzi allel A. typowy dla danej płci (ryć. mające dwa genomy męskie. W obu przypadkach dochodziło do obumarcia zarodka. Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego.

a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska).M r ZYGOTA 2ENSKA M P ZYGOT-A MĘSKA Ryć. W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. jeśli pochodzi od ojca. Tak więc. tylko jeden gen — UBE3A nie podlega ekspresji.in. Wiadomo. że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego. który nosi nazwę zespołu Pradera-Willego. że fragment chromosomu 15 podlega piętnowaniu gametycznemu. W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego. Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony. a inny w gametogenezie żeńskiej. 3-8. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m. Piętnowanie gametyczne. M — chromosom pochodzący od matki wówczas rozwija się zespół zmian fenotypowych (m. gen SNRPN — ang. głębokie upośledzenie umysłowe.in. a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. brak mowy. Przyjmuje się. Podobna sytuacja powstaje. otyłość i niedorozwój umysłowy).in. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca. drgawki) określanych jako zespół Angelmana. smali nuclear ribonucleoprotein polypep65 . ubiquitin protein ligase E3) pochodzenia matczynego. P — chromosom pochodzący od ojca. gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). natomiast kilka genów (m. że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej. podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym. Wynika z tego.

Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. W genie tym występują dwa regiony. W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X. a także 11 i 12 podlegają piętnowaniu. Może się jednak zdarzyć. W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX).tide N). czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego. że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. albo matczynego. obok chromosomu Y. nie ulega ekspresji. że inaktywacją chromosomu X jest formą piętnowania. jeśli są położone w chromosomie pochodzącym od matki. Stan taki określany jest terminem hemizygotyczności. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych. Przykładem może być gen Igf2 (ang.7. Sytuacja ta jest spowodowana tym. W komórkach żeńskich występują dwa chromosomy X. Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego. które zachodzi podczas wczesnego rozwoju zarodkowego. Na przykład. wywołujące zahamowanie transkrypcji. co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych. duże fragmenty chromosomu 7. że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca. W komórkach męskich występuje tylko jeden chromosom X. 3. który podlega piętnowaniu podczas gametogenezy żeńskiej. Obecnie znane są 34 geny. a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego.5. 66 . Inaktywacja chromosomu X w zarodkach żeńskich Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji. W efekcie oba allele są transkrybowane. które podlegają metylacji. do którego nie może się przyłączyć białko (represor). które są objęte zjawiskiem piętnowania gametycznego. Okazało się. niezbędnych do podjęcia transkrypcji. insulin growth factor type 2) u myszy. które podlegają piętnowaniu gametycznemu u myszy.

.

Spełnia on funkcję regulacyjną. Barwienie to pokazuje. że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3. ciałka Barra. w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X. a część pochodzenia matczynego (ryć. albo w chromosomie ojcowskim. W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). a jego obecność ujawnia się w postaci tzw. Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X. Warto zaznaczyć. który to stan jest utrzymywany w komórkach potomnych.Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R. W centrum inaktywacji zidentyfikowano locus Xist (ang. Później. 3-9). X inactive specific transcript). Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym. który pełni główną rolę w uruchomieniu inaktywacji. w której część komórek ma aktywny chromosom pochodzenia ojcowskiego. że nieaktywny chromosom X jest replikowany w późnym okresie fazy S. . że produktem locus Xist jest niekodujący RNA (ncRNA). albo matczynym. które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu. W konsekwencji organizm żeński jest swoistą mozaiką. ekspresja genu Xist pojawia się losowo. Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X. Inaktywacja jest związana z metylacją DNA danego chromosomu. Wiadomo.

Endonukleazy restrykcyjne Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. wirusowy. co umożliwia np. niszczony jest przez endonukleazy bakterii. W celu ochrony własnego DNA przed działaniem restryktaz. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne. Endonukleazy dzieli się na trzy klasy. substratów i produktów. strawienia) DNA. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. DNA nie jest odpowiednio oznaczony (zmetylowany). System ten polega na tym. drugi to metylotransferazy (zwane też metylazami). nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów. Nazewnictwo endonukleaz tworzone jest w ten sposób. np. Większość metod wymaga fragmentacji (pocięcia. że pierwsza litera stanowi skrót nazwy rodzaju bakterii. Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów. ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii.Rozdział 4 4. by nie zostały przecięte przez endonukleazy. niszcząc niepożądane. serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. bakterie wykształciły system restrykcji-modyfikacji. Ponieważ obcy. następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii. Na przykład. które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak. a także kofaktorów. że bakterie wytwarzają dwa rodzaje enzymów. Do klasy I enzymów 69 . Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz.1. enzym HindIII pochodzi z bakterii Haemophilus influenzae. metody in situ) bądź w wyizolowanym DNA lub RNA. Jeden to endonukleazy. obce cząsteczki DNA. w zależności od ich mechanizmu działania. druga i trzecia — gatunku.

utrudniającą ich wykorzystywanie w analizie DNA. iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów. czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna. Różnica między tymi dwiema klasami polega na tym. które wykazują aktywność nukleazy. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I. jony magnezu (Mg2+) i S-adenozylometionina. jak ATP. jest to. że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1. ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. a ich działanie zależy od obecności takich kofaktorów. Cechą tych enzymów.zaliczane są te restryktazy. ale wzmacnia ich aktywność). Tabela 4-1 Przykłady enzymów restrykcyjnych 70 .

Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum) przecinają rozpoznaną sekwencję w różnych miejscach: . Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie. w których enzymy przecinają te sekwencje. Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6. rozpoznają te same sekwencje DNA. mogą być różne. Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję: Niektóre enzymy. mimo że pochodzą z różnych szczepów bakterii. 4-1). lepkich końcach. Jednak miejsca. rzadziej 8 nukleotydów. dając fragmenty mające tzw.Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. tępe końce. Są to izoschizomery. charakteryzujące się dwustronną symetrią (tzw. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej. Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach. sekwencje palindromowe). czego konsekwencją jest powstawanie fragmentów DNA o tzw.

CCTAC(N)13. diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP).. aby wstawiając 72 . izolacji i identyfikacji genów. • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki.GAAGA(N)8'.2. Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'..3' 3'. 4. HinPI) tną jednoniciowy DNA. W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii).. fagowy.. opisane pod względem fizycznym i genetycznym. Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora... drożdżowy) jest zdolny do autonomicznej replikacji.GGATG(N)9'. Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA. • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców). którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji. wykorzystywanym m. Niektóre enzymy potrzebują takich samych buforów.. mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza. Wektory Wektory są podstawowym narzędziem klonowania DNA. w której mieszanina DNA z enzymem jest inkubowana.. • powinny mieć jeden lub kilka silnych promotorów tak.3' 3'. do sporządzania map genomowych...in.5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA. Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą. Są one podstawowym narzędziem..5' podobnie enzym FokI (Flavobacterium okeanokoites): 5'. plazmidowy. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych. sekwencjonowania DNA. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne... oraz składem buforu.. a tylko nieliczne enzymy (np.CTTCT(N)7. klonowania molekularnego i rekombinacji genów czy fragmentów genomu. Wektor (np.. do którego fragment ten został uprzednio włączony (rekombinacja molekularna)..od rozpoznawanej sekwencji.

i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych. umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. za pomocą których można je ziden tyfikować. Przykładowy wektor plazmidowy pUC19. RODZAJE WEKTORÓW Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi). długości 10-40 kpz. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd. geny oporności na antybiotyki. Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori. • zawierają znaczniki (markery). np. którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. Kosmidy służą do klonowania większych cząsteczek DNA. korę mogą stanowić zagrożenie ekologiczne. Najczęściej jest to gen kodujący enzym. Kosmidy Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. Podobnie jak 73 . przedstawiony jest na rycinie 4-1. Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych. Za pomocą modyfikacji molekularnych (np. • ze względów etycznych wektor nie powinien mieć genów. rozkładający barwny substrat. plazmidy i kosmidy. np.w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów. Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. „polilinker" (miejsce wielokrotnego klonowania). gen β-galaktozydazy oznaczony symbolem lacZ. Wektory fagowe Spośród wektorów fagowych największe znaczenie ma fag λ. gen oporności na antybiotyk. • nie są zdolne do przeżycia poza komórką gospodarza. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. Wektory plazmidowe Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. który ma długość 2686 par zasad. Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie.

bakulowirusów. adenowirusów i retrowirusów. Wektory drożdżowe Wektory te wykazują zdolność replikacji tak w komórkach drożdży. Papilloma. coli. jak 74 .Ryć. drożdżach. krowianki. bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. Schemat wektora plazmidowego pUC19. Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz w przypadku wektorów plazmidowych. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych. geny markerowe i silne promotory. 4-1. do wektorów fagowych wprowadzono polilinkery. W przypadku komórek zwierzęcych są to pochodne wirusów SV40. Najwcześniej był stosowany wirus SV40. Są one również stosowane w somatycznej terapii różnych schorzeń. którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu. ale efektywność tego działania jest większa. komórkach ssaków) stosowane są: Wektory — pochodne wirusów Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych. Do klonowania fragmentów DNA w organizmach eukariotycznych (np. Sztuczny chromosom bakteryjny (BAC) Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). wadą natomiast organiczona długość wbudowanego obcego DNA.

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach. gdy są one zhybrydyzowane z komplementarną matrycą. amplifikując badany gen (odcinek DNA). Te dwa etapy są powtarzane. Odwrotna transkrypcja-PCR. że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. RT-PCR (ang. wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. Nie może być natomiast 81 . W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego. wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji. Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C). Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego. np. co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych). Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. reverse transcription-polymerase chain reaction). która łączy specyficznie dwa przyległe oligonukleotydy. Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje. mutacja punktowa). Reakcja ta stosowana jest do wykrywania mutacji punktowych. O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. Enzymem używanym do tej reakcji jest termostabilna ligaza. z zastosowaniem biotyny. Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami).przerwa.

SSCP (ang. np. między nićmi DNA:DNA. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod. Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością.5. których materiałem genetycznym jest RNA. bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej. a następnie jego denaturacji i elektroforezie. 4. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to. Techniki hybrydyzacji i sondy molekularne Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe. jak również do wykrywania wirusów. Konformacja ta zależy od sekwencji nukleotydów. że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA. Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. Jeśli badany DNA pochodzi od nosiciela zmutowanego genu. single stranded conformation polymorphism). RFLP lub sekwencjonowania. Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA. w których określana jest ilość mRNA. Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany. RNA: RNA i RNA: DNA istnieją wiązania wodorowe. które przyjmują określoną konformację przestrzenną. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA. które jest oczywiście najbardziej precyzyjne. W tych przypadkach może być stosowana metoda RT-PCR. Jak wiadomo. jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją. Polimorfizm konformacji jednoniciowych łańcuchów DNA. podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA). polegająca na tym.wykorzystana w badaniach ekspresji genów. które ułatwiają ten 82 .

kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego). Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej. Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P). który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1. northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). iż muszą być stosowane wkrótce po ich wyznakowaniu. Sposób znakowania sond można podzielić na dwie główne grupy: 1. stosowana w hybrydyzacji kwasu rybonukleinowego. Znakowanie izotopowe charakteryzuje się dużą czułością. Izotop ten jest stosowany do znakowania DNA i RNA. 83 . by było możliwe wykrycie powstałej hybrydy. że można ją stosować nawet wówczas. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. który przenikając przez żel zabiera ze sobą fragmenty DNA. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP. który jest nicią pojedynczą. Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. takich jak hybrydyzacja Southern blotting (DNA). czyli cięższe fragmenty) lub poliakryloamidowym (krótsze. Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe. Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy.proces. Sonda musi być odpowiednio wyznakowana. czas półtrwania 14. Ogromną zaletą hybrydyzacji jest to. By była możliwa hybrydyzacja sondy z badanym DNA.71 MeV — megawoltów). do 500 par zasad). wirusów lub organizmów wyższych). Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. klonowane sekwencje lub syntetyczne oligomery stosowane w PCR. jednak niewielką rozdzielczością.3 dnia. nie wymaga etapu denaturacji. Technika northern blotting. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. Wadą sond znakowanych izotopem jest również to. Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy. Zjawisko to stało się podstawą metod analizy kwasów nukleinowych. dCTP i UTP a 32P. Fragmenty te są następnie zatrzymywane na filtrze. gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA. lżejsze. Znakowanie sond.

głównie DNA. okres półtrwania 12. 84 . Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S. a detekcja sygnału jest poprzez autoradiografię (ryć. 4-6). Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę. stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+.018 MeV). Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C). emitujący promieniowanie β. Hybrydyzacja na filtrach. Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny. Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych. digoksygeniny). w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą. Hybrydyzację z wyizolowanym DNA można przeprowadzać. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji. Na wydajność hybrydyzacji wpływają także inne czynniki. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach. Znakowanie nieizotopowe zapewnia dobrą rozdzielczość. gdy jest on unieruchomiony na filtrze. Hybrydyzację przeprowadza się z reguły w temperaturze 68°C.1 dnia. Znakowanie sond można przeprowadzać za pomocą kilku różnych metod.167 MeV). Zaletą tej metody jest to. w której przebiega hybrydyzacja. Hybrydyzacja jest poprzedzona prehybrydyzacją. ale daje mniejszą czułość detekcji. głównie DNA. który emituje promieniowanie β (energia promieniowania E = 0. które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0. 2. Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura. • tryt (3H). Przyjmuje się. jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg). w zależności od zastosowanego znacznika. że różnica ta powinna wynosić 20-25°C. tak powstają pochodne nukleotydów. Podstawowym źródłem trytu jest trytowana tymidyna. iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego). okres półtrwania 87. Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. biotyny.26 roku. używany jest do znakowania kwasów nukleinowych. której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. z wyjątkiem obecności sondy.• izotop siarki (35S).

Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana. fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). W metodzie zwanej „odcisk palca" DNA (ang.in. Hybrydyzacja w zminiaturyzowanej postaci. pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. do wykrywania ściśle określonych fragmentów DNA (np. 85 . Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. Na niewielkiej płytce (ok. l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja). Metoda hybrydyzacji służy m. Jej różne warianty są opisane w rozdziale: Mapy genomowe. w diagnostyce chorób).Wykorzystanie metody hybrydyzacji. Podobnie jak metoda PCR. również hybrydyzacja może być przeprowadzana na preparatach chromosomowych. określana jako technika mikromacierzy DNA. Metoda ta nosi nazwę hybrydyzacji in situ (ISH).

3' 3'.. czyli lżejsze. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus. Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału... tym szybciej.AGGCTAT 86 . Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll): GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA: GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA.A-.6. Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP). Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu.ATCCAGTCCTCGCCTGATTTCGAA. Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze..ATAGCTT .5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego. Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych. Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu.4. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) Polimorfizm fragmentów restrykcyjnych DNA (ang.. Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym. natomiast dalej będą prążki o zmniejszającej się masie...TTCGA.

4. natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory. quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA. Jest on amplifikowany 87 . Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania.Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz. Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe). Tworzenie biblioteki genomowej Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym. wśród nich są geny determinujące cechy jakościowe. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe. Tak otrzymany cDNA zawiera tylko sekwencje kodujące. a także ilościowe (ang. Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka. Interseksualizm. W zależności od wielkości fragmentów DNA używane są różne wektory. Biblioteki genomowe i genowe Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii.7. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. Geny o dużym efekcie. których budowa molekularna jest znana. Tworzenie biblioteki genowej (cDNA) Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. 11 pz i 7 pz. metoda rekombinacji molekularnej. Proces ten jest opisany w części dotyczącej klonowania DNA. sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). jak kosmidy. wprowadzonych za pomocą wektorów do bakterii. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe. czyli eksony. omówiona wcześniej. Materiałem wyjściowym w tym przypadku jest RNA.

W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen. W ten sposób każdy klon bakterii ma cały określony gen. ddGTP lub ddTTP (ryć. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej. przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy. czyli reakcji antygen-przeciwciało. Każda z czterech probówek zawiera matrycowy DNA. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda. Sangera. Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. 4-7). wykorzystuje się bibliotekę genomową. nieznany jeszcze fragment. Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem. mieszaninę deoksynukleotydów. jest stosowane dość często w genetyce molekularnej. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. terminatorów) jest zakończenie syntezy nici 88 . 4. przeprowadzane są cztery oddzielne reakcje syntezy DNA. której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej). chromosome walking). polegające na określeniu sekwencji nukleotydów.8. Metoda enzymatyczna została opracowana w 1977 roku przez F. starter. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą). która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący. Biblioteka genomowa jest również przydatna w poszukiwaniu genu. Postępujemy tak do momentu. Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki. Rolą tych dideoksynukleotydów (tzw. a następnie rekombinowany z wektorem i wprowadzany do bakterii. Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. bufor reakcyjny. Sekwencjonowanie DNA Sekwencjonowanie DNA.metodą PCR. gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen. ddCTP. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań. o którym niewiele wiadomo. polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP.

autoradiogram żelu sekwencyjnego Ryć. 25 supl.6 mm). ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany. W celu detekcji prążków DNA. metodą autoradiografii.2-0. 4-7.. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera. W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości. w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89 . grubości 0. kończące się odpowiednim nukleozydem. kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp. Postępy Biologii Komórki. Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm. by tylko część syntetyzowanych fragmentów DNA uległa terminacji. 10 :219-237. zależnie od użytego w reakcji dideoksynukleotydu. 1998) komplementarnej w miejscu włączenia określonego dideoksynukleotydu. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki.

która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. Do mieszaniny reakcyjnej dodawana jest także piperydyna. które mają zdolność modyfikacji zasad w cząsteczce DNA. 10 :219-237.kleotydy lub wyznakowany starter. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp. 4-8. polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów. Metoda chemiczna. Postępy Biologii Komórki. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów.. 4-8): autoradiogramżelusekwencyjnego Ryć. Do rozszczepiania wykorzystywane są hydrazyna. podobnie jak przy metodzie enzymatycznej. 25 supl. 1998) 90 . siarczan dimetylu (DMS) i kwas mrówkowy. Sekwencjonowanie metodą chemiczną przeprowadza się. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta. że jest szybka. opracowana w 1977 roku przez Maxama i Gilberta. Enzymatyczna metoda sekwencjonowania ma tę zaletę. w czterech oddzielnych probówkach.

pozwala także na wyróżnienie grup komórek. przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny. które morfologicznie nie różnią się od sąsiednich. tzw. kilka firm oferuje specjalistyczną aparaturę. Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80. Jedna z wymienionych metod. Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów. pyroseąuencing. 4. ale są inne pod względem biochemicznym. do zygoty myszy szczurzego genu hormonu wzrostu. northern blotting. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji. Samce transgeniczne przekazywały swojemu potomstwu obcy gen. których długość zależy od miejsca rozszczepienia łańcucha DNA. Zwierzęta transgeniczne to takie. Różnią się one od innych komórek ekspresją pewnych genów. Następnym etapem. natomiast samice były niepłodne.9. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego. znacznie różni się od powyższych metod. hybrydyzacja in situ na skrawkach tkanek. Najnowsza metoda sekwencjonowania. podobnie jak w metodzie enzymatycznej. zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba). nieaktywnych w komórkach zdrowych. Transgeneza Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane. jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym. Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA. Podobne 91 . 4.10.W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca. Badanie ekspresji genów Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek. autoradiografia i odczytanie sekwencji nukleotydów. RT-PCR) i translacji (western blotting). Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika.

ogranicza jej stosowanie. Jak dotychczas opisana technika jest stosowana z sukcesem u myszy. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza. Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). który może być wprowadzony tą metodą. zapłodnionej komórki jajowej. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich. Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. w którym miejscu genomu włączy się transgen. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne. które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu. w gruczole mlecznym). gen struktury hormonu wzrostu (ang. Na razie nie mamy żadnego wpływu na to. np. blastocyst pozbawionych węzła zarodkowe go). które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa. około 8 kpz. embryonic steam cells). które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego. 92 . najczęściej męskiego. Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro. Wykorzystanie techniki transgenezy 1.rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu. że w procesie transgenezy wprowadzane są konstrukty genowe. growth hormone — GH). • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. umożliwiającej ukierunkowaną ekspresję transgenu (np. Należy jednak zauważyć. Wielkość fragmentu DNA. Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost. nawet niekorzystne.

poprzez wprowadzenie do genomu owiec genów białek keratynowych. Odporność na choroby można uzyskać przez wprowadzenie do komórek 93 . • modyfikacji cech biochemicznych u zwierząt.• modyfikacji składu mleka. duże nadzieje wiąże się z poprawą jakości białek mleka. W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy. na przykład poprawy jakości i tempa wzrostu wełny. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie.

Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu. W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu. które wykazują nadekspresję określonych genów. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. metabolizm węglowodanów i lipidów. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc). kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii. których celem jest ocena jego wpływu na wzrost. których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny. z powodu nadostrej reakcji układu immunologicznego biorcy. świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. ksenotransplantów) dla ludzi. iż samice transgeniczne wytwarzają mleko zawierające obce białko. krowy wytwarzające mleko z ludzką laktoferyną. najlepiej dominujące. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw. ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych. wykazujące karłowatość. 2. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych. blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. Zaletą tej metody jest to. Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych. laktację. . 3. Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym. prowadzącej do odrzucenia przeszczepionego narządu.zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych. świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię).

Należałoby zatem rozróżnić proces przenoszenia mutacji. obserwowanymi wśród organizmów żywych. Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. a poznanie ich podłoża wymaga zastosowania metod molekularnych. a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych. dlatego większość z nich jest niekorzystna dla organizmów.Rozdział Mutacje Mutacje to nagłe i trwałe zmiany w informacji genetycznej. które były korzystne lub obojętne dla organizmu. jako wynik błędów w przebiegu niektórych procesów komórkowych. Dzieli się je na: genomowe. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas. Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji. za pośrednictwem komórek płciowych. Wreszcie mutacje genowe dotyczą zmian w budowie genu. Mutacje mogą powstawać samoistnie. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy. chromosomowe i genowe. a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji. nazywane też aberracjami chromosomowymi. Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. związane są z naruszeniem budowy chromosomu. przez następne pokolenia. Mutacje chromosomowe. a ponadto. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi. powstałych de novo. W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu. promieniowanie jonizujące. niektóre związki chemiczne). gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji. cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych 95 . które uszkadzają DNA lub strukturę chromosomu (np. czyli takich. takich jak replikacja DNA czy podział jądra komórkowego.

W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji. 5. to stan ten określa się jako poliploidalność. która odbywa się już po wniknięciu plemnika do oocytu. prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista. Mutacje genomowe Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów. wśród których do najważniejszych zalicza się (ryć. wysoka plenność u niektórych ras owiec (np. co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). głównie żeńskiej. Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego. Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny). Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości. 96 .pokoleń. Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. Jeżeli powstają układy o większej liczbie genomów niż dwa. 5-1): 1. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik. Znane są i inne mutacje. Dlatego można bez większych zastrzeżeń przyjąć. Zdarzenia takie określa się mianem połispermii. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia. Zaburzenie przebiegu mejozy. monoploidia). Na przykład. ponieważ obok mutacji szkodliwych (np. 2. że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych. z jakimi spotykamy się w hodowli zwierząt gospodarskich. a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna. a oocyt II rzędu ma diploidalną liczbę chromosomów. pojawiające się od czasu do czasu na fermach zwierząt futerkowych. mutacja w genie BMPR-IB) itp. choroby genetyczne) znanych jest wiele przykładów pokazujących. które wpływają korzystnie na cechy produkcyjne zwierząt.1.

Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. tetraploidalne oogonium. które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego. 4. 5-1. Euploidie są mutacjami letalnymi. Mutacje te są jedną z przyczyn niepowodzeń 97 . zazwyczaj we wczesnym okresie rozwoju zarodkowego. to znaczy takiego. Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka. układ taki klasyfikowany jest jako mozaicyzm. Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym. np. czego skutkiem jest rozwój haploidalnego zarodka. że prowadzą one do śmierci osobnika. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo). Ponieważ komórki te wywodzą się z jednej zygoty. co oznacza. gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności. takich na przykład jak brak cytokinezy po podziale jądra komórkowego. 2n i 4n czy 2n i 3n itd. np.Ryć. Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza). Niektóre mechanizmy powstawania mutacji genomowych typu euploidii 3. W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego.

zarodka) prowadzi do mozaicyzmu.w rozrodzie zwierząt. którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki. Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. jaka jest skala tego problemu. Jeśli natomiast występuje brak obu chromosomów w parze. Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. Wyjątek stanowią aneuploidie chromosomów płci. że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela. to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). a nadmiar chromosomów to trisomia (2n +1). Aneuploidia to druga kategoria mutacji genomowych. że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). Równocześnie wynika z tego. to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). Klacz obarczona tą mutacją ma kariotyp 98 . Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. gdy oba chromosomy zmierzają do jednego bieguna komórki. w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. Nieprawidłowa segregacja w jednym biwalencie. Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów. Jeżeli gamety takie będą uczestniczyły w zapłodnieniu. Zazwyczaj mutacje te stwierdzano w układzie mozaikowym. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci. to stan taki określany jest jako nullisomia (2n —2). Trudno jednak określić. Wskazuje to. jednak powodują powstanie licznych wad rozwojowych. Zdecydowana większość aneuploidii jest letalna. prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1. Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. 5-2a). że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych. a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). Tak więc brak chromosomu nazywa się monosomią (2n — 1).

W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy.XY/61. 99 . Osobniki takie mają diploidalną liczbę chromosomów 61. Zwierzęta takie mają zasadniczo normalny eksterier.XXY. Znane są również przypadki trisomii XXY u buhajów.XXY lub występuje u nich układ mozaikowy 60. zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników.XX.2n = 63.X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63. dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego.XO/64.

podczas podziału komórkowego. Mogą powstać także inne nietypowe struktury. w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. tandem fuzja. Przedstawione wyżej prawidłowości wskazują. nie ma ryzyka przeniesienia tej mutacji na następne pokolenia. Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna. a zatem i szerokiego rozprzestrzenienia w populacji. Mutacje chromosomowe Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder. jest niemożliwe. to nastąpi utrata fragmentu chromosomu (delecja). Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika. to zazwyczaj mają pochodzenie de novo. translokacja wzajemna). co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu. Niemniej jednak. a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu. Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią. niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni. przez odpowiedzialne za to systemy naprawy komórkowej. Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd 100 . Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu. że osobniki mające w swoim kariotypie trzy chromosomy X są płodne. W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza. W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. bez zastosowania metod cytogenetycznych. 5-2b). że aneuploidie ilekroć się pojawiają. wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych. Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć.Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. albo głębokie zaburzenia rozwojowe lub bezpłodność. Dzięki temu. której zdiagnozowanie. gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela. ze względu na dość częste występowanie u klaczy monosomii chromosomu X. Jest to skutek segregacji chromosomów w anafazie I. 5. poza nielicznymi wyjątkami.2. takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. Jeżeli pęknięcie nie zostanie naprawione.

Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje. Mutacje chromosomowe. ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. fuzje tandemowe. których skutkiem jest przegrupowanie informacji genetycznej w kariotypie. tandem fuzje.niesiostrzanych podczas crossing over. nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych. mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych. lub też w układzie niezrównoważonym. gdy występuje ona w komórkach linii płciowej. wyciszacz). jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej. inwersje. fuzje centryczne. Zdarzyć się może. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor. a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów. Przypadki takie. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas. które w momencie powstania mają charakter zrównoważony. zauważalnych zmian fenotypowych. padnięcie po urodzeniu lub ubój z konieczności. bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np. duplikacje. izochromosomy). buhaje). inaczej centromerowe (translokacje robertsonowskie). prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. Szczególna 101 . Wynika to przede wszystkim z tego. wśród których wyróżniane są inwersje peri.i paracentryczne. U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych. Znane są liczne przykłady u ludzi. występując pierwotnie w układzie zrównoważonym. Zaliczane są do nich: fuzje centryczne. że zdecydowana większość tych przypadków nie jest identyfikowana. czego skutkiem jest uruchomienie procesu nowotworowego. odnotowywane jako martwe urodzenie. Mutacja chromosomowa może wystąpić w układzie zrównoważonym. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. Inne — tzn. wzmacniacz. Jeżeli dotknie to osobnika o dużej wartości genetycznej. prowadzą do zmiany sąsiedztwa genów. jak i ze strukturą samego genu. translokacje wzajemne. bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć. są letalne lub prowadzą do poważnych. gdy ilość informacji genetycznej w komórce została zmieniona. a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. Z kolei mutacje zrównoważone. mają najczęściej negatywny wpływ na płodność nosiciela mutacji. translokacje wzajemne i inwersje. podobnie jak aneuploidie. że mutacje chromosomowe niezrównoważone. to szansa na wykrycie nosicielstwa mutacji jest znacznie większa.

gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru. Fuzja centryczna (translokacja robertsonowska) powstaje wówczas. a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć. 5-3a.uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji. 102 .

który zawiera przede wszystkim niekodujące sekwencje powtarzalne. buhaj. triwalent oraz biwalent X-Y są wskazane 103 . Ryć. 5-4. reprezentujące prawie cale ramiona długie chromosomów. kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym.5-4a). natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy). nie odbija się negatywnie na nosicielu. zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom. kozioł. Translokacje robertsonowskie: (a) rob(l. Utrata małych fragmentów z okolicy centromeru.29). barwienie roztworem Giemsy. (b) rob(5.7). Duże fragmenty. chromosom translokacyjny oraz chromosomy pici są wskazane.

Jeżeli fuzji uległy chromosomy homologiczne. co w rzeczywistości odpowiada układowi n + 1. a w tym również w Polsce. które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego.Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden. ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. a druga będzie miała n chromosomów. 5-4b). podczas której chromosom dwuramienny przechodzi do jednego bieguna. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła. w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. Zupełnie inaczej przedstawia się sytuacja. Pięć lat później ten sam badacz wykazał. że jej nosiciele mają zmniejszoną płodność o około 5%. Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. 104 . 5-4a). W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji. 5-3b. że połowa gamet będzie typu n —l (układ powstający na biegunie. Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych. to w pachytenie profazy I uformuje się triwalent. do którego nie przeszedł chromosom dwuramienny). W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent. a oba chromosomy akrocentryczne do drugiego bieguna komórki. na wszystkich kontynentach. Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard.). czyli ukształtuje się układ aneuploidalny. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom. szczególnie ras mięsnych. blonde d'Aquitaine itp. w których uczestniczyły chromosomy z różnych par. jak poprzez badanie cytogenetyczne. Opisano wiele różnych fuzji. z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych. Prowadzi to oczywiście do tego. Należy zaznaczyć. to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób. Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. z tym jednak że wśród nich będzie chromosom dwuramienny. W przypadku zapłodnienia powstają zygoty aneuploidalne. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety. Jeżeli komórka taka rozpocznie podział mejotyczny. mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych. gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. Fuzje centryczne są często identyfikowane u bydła. W efekcie powstają gamety o zrównoważonej informacji genetycznej. podczas gdy na drugim biegunie zabraknie jednego chromosomu.

W Polsce. a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. W tym przypadku można wręcz mówić o polimorfizmie kariotypowym.a niekiedy także w małych izolowanych rasach lokalnych (np. dwóch par akrocentryków. obowiązkowymi badaniami objęte są wszystkie młode buhaje. Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona. jest lis polarny. nr 23 i 24). natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48. przed ich wprowadzeniem do stacji produkcji nasienia.29 zdiagnozowano wiele innych przypadków. Ciekawe. którą opisano w Polsce. Chromosomy biorące udział w fuzji przedstawiono schematycznie 105 . w których zaangażowane były chromosomy z innych par. Przykładem może być fuzja między chromosomami z pary 5 i 22. który wprowadził taką regulację. u którego fuzja centryczna występuje bardzo często. że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49. Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. Oprócz fuzji 1. Ryć. Gatunkiem. jedynych w kariotypie lisa. 5-5. Szwecja była pierwszym krajem. włoskie bydło rasy podolian czy bydło korsykańskie). Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. białe bydło rrytyjskie. począwszy od 1989 roku.

Jest to segregacja naprzeciwległa. bądź duplikacją. że suma informacji genetycznej zawarta w dwóch chromosomach. jeśli oczywiście wystąpi w linii komórek płciowych. jest taka sama jak w dwóch nie zmienionych chromosomach. tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych. Dwa pozostałe rodzaje segregacji. które będą obarczone bądź delecją. a do drugiego przechodzą chromosomy. jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. Podobnie jak w przypadku fuzji centrycznej. 5-7). Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych. gdy rozród jest oparty na sztucznej inseminacji. W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. pochodzących z dwóch różnych chromosomów. Należy zaznaczyć. w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par. także translokacją wzajemna jest mutacją dziedziczną. to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60. 5-8). że około 50% gamet wytwarzanych przez 106 . jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji. 5-6a. że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela.Należy podkreślić. 0 2n = 58 (ryć. Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. prowadzą do uformowania niezrównoważonej (delecje. Skutek takiej translokacji będzie zazwyczaj letalny. które uczestniczyły w trans lokacji. szczególnie wówczas. a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia. 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję. Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej. lisy polarne. określane jako sąsiednie. Przyjmuje się. że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over. to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. tzn. Przedstawione obserwacje wskazują. Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć. który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2. Pokazuje to jedno cześnie. które podlegały translokacji. 5-6b. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. że powstaną gamety o zrównoważonej informacji genetycznej. a nie częstego powstawania de novo. Segregacja symetryczna (2:2) nie gwarantuje jeszcze. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów. duplikacje) ilości informacji genetycznej w gametach. to podczas mejozy dojdzie do powstania gamet. 5-5).

(b) segregacja tetrawalentu podczas mejozy nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu. to doprowadzą do powstania zygot. Hodowca odnotuje 107 . 5-6. w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany Ryć. Translokacja wzajemna: (a) schemat powstawania. które będą ginęły zazwyczaj w życiu płodowym.*Schemat nie uwzględnia segregacji tetrawalentu.

.

a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. ponad 90 różnych translokacji wzajemnych. w rozmaitych rasach. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów. Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej. po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie). Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych. Podobnie normalny fenotyp mają lochy nosicielki. morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu.wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika.lub dwuramiennym. Knury nosiciele mają prawidłowe libido. która prowadzi do bezpłodności samców nosicieli. Przypuszcza się. Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). a połowa będzie nosicielami translokacji. podobnie jak w przypadku translokacji typu autosom-autosom. W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo. U samic nosicielek stwierdza się jedynie zmniejszenie płodności. w którym polowa będzie miała prawidłowy kariotyp. podobnie jak w przypadku fuzji centrycznej. Jedno z nich występuje w części końcowej ramienia w chromosomie jedno. w którym wystąpią dwa translokowane chromosomy. a obraz nasienia (koncentracja. Stan taki towarzyszy nosicielstwu translokacji wzajemnej. Oczywiście stan taki może być spowodowany różnymi czynnikami. które były rozprzestrzenione w populacjach w różnym stopniu. że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy. ale wśród nich połowa będzie miała układ. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. Trzeba podkreślić. Fuzja tandemowa jest mutacją podobną do fuzji centrycznej. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. Do tej pory zidentyfikowano na świecie. a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego. 5-7). Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109 . w którą zaangażowany jest chromosom X (translokacja typu X-autosom). Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia.

Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu. podczas którego dochodzi do uformowania pętli inwersyjnej. Jeżeli w obrębie pętli zajdzie crossing over. Najmniej korzystny. oraz 3) pełna koniugacja. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu. Uwaga ta dotyczy 110 . to wówczas inwersja jest określana jako pericentryczna. gdzie na jednym z chromosomów występuje odwrócony fragment. w którym wystąpiły dwa pęknięcia. to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. z wyjątkiem sytuacji. Oceniano wówczas. z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). dojdzie do powstania aneuploidalnych gamet. która częściowo jest niehomologiczna. może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną. jest pierwszy sposób koniugowania. to podczas mejozy. Inwersje dość rzadko opisywano u zwierząt gospodarskich. gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu. tzn. 2) chromosomy częściowo pozostają nieskoniugowane — w części. Jeżeli odwrócony fragment nie obejmuje centromeru. to nieprawidłowość jest określana jako inwersja paracentryczna. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna. tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym. że fragment pomiędzy punktami pęknięć został odwrócony o 180°. spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie. Mutacja ta jest dziedziczona przez połowę potomków nosiciela. chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70.chromosomami akrocentrycznymi. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. to wówczas powstaną gamety obarczone delecją lub duplikacją. Przebieg koniugacji podczas pachytenu profazy I. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. z punktu widzenia skutków gametogenezy. Jeżeli w obrębie odwróconego fragmentu występuje centromer. Znane są nieliczne przypadki tej mutacji u bydła. w obrębie fragmentu objętego inwersją na jednym z chromosomów. podobnie jak przy fuzji centrycznej. analogicznie do schematu przedstawionego dla translokacji robertsonowskich. a następnie zostały one niewłaściwie naprawione w taki sposób. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii. które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej. było dość duże. Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji. może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków. że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%.

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej. a w formie tautomerycznej z tyminą. Im większy stopień zwielokrotnienia danej sekwencji. prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). że enołowa forma tyminy łączy się z guanina. należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym. tym wcześniej rejestrowany jest początek objawów chorobowych. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi. Inną 117 . U ludzi zdrowych liczba powtórzeń wynosi 10-36. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę. Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. zlokalizowanego w chromosomie 4. Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka. natomiast w formie enolowej łączy się trzema mostkami z cytozyną. zespół kruchego chromosomu X. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH). między innymi chorobę Huntingtona. dystrofię miotoniczną. czyli tzw. Mutacje genowe mogą być także następstwem zakłóceń w splicingu. w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony). z których 10 powoduje choroby genetyczne. Z kolei. Mutacje te związane są z tzw. zaś ketonowej na enolową (=C—OH). a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. Skutkiem tego będzie pojawienie się pary G-C w miejscu. gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). obróbce mRNA. nazwanej dojrzewaniem. Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA). Dotychczas wykryto je u ludzi w 12 loci. gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina. Błąd replikacji zachodzi wówczas. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. Z kolei. niestabilnymi sekwencjami DNA. Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne.i protonów w cząsteczce zasady. iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. guanina w normalnej formie (ketonowej) łączy się z cytozyną. Błąd włączania polega na tym. Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form.

Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym. jak i intronu. Należy podkreślić. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. trypletów). Są one wykorzystywane w analizie polimorfizmu DNA. jest polimorfizm fragmentów restrykcyjnych — RFLP (ang. iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. dlatego nazywane są cichymi podstawieniami (ang. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym. Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu. identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA. substitution at silent site). gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów. Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. Skutki mutacji genowych Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. piętno gametyczne. ani kodowanego przez ten gen białka. Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji: 118 . Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony.2. Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu. Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi. gdyż kodon AAC również koduje asparaginę. restriction fragment length polymorphism). mającym szczególne znaczenie dla molekularnej analizy DNA. Przypuszcza się. Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np.4. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie. Jednym ze skutków mutacji genowych. 5. Natomiast jeśli ojciec przekazuje zmutowany allel. Taka sytuacja jest możliwa. Jeśli allel zmutowany pochodzi od matki. różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4. różnica w długości sekwencji może dochodzić do 50%.cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw.

bovine leukocyte adhesion deficiency). Innym przykładem mutacji typu zmiany sensu.1. w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi. 2. nasienia i jaj zawiera rozdział: Markery genetyczne. mleka. przejawiająca się zmniejszeniem odporności cieląt. warunkujący czarne umaszczenie. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka. Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła 119 . Mutacja ta jest przedstawiona na rycinie 5-10. odnoszącym się do polimorficznych białek. jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę. Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+. jest locus β-laktoglobuliny (białko mleka). której następstwem jest śmierć przed ukończeniem 1. która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. oraz T→C (zapis dla DNA. Mutacje typu zmiany sensu . w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy. Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła. roku życia osobników homozygotycznych pod względem zmutowanego genu. Na przykład. Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. Mutacje typu nonsens (mutacja stop) . mutacje genowe nie zawsze mają niekorzystny skutek.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) - Ryć..na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. 5-10. Jak już wcześniej wspomniano. Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. skutki tego mogą być dla organizmu letalne.

iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl.cytrulinemia. Cytrulinemia występuje również u ludzi.amber (UAG). Bydło holsztyńskie ma umaszczenie z reguły czarno-białe. ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. We wspomnianym już locus E u bydła allel recesywny e. Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia. Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. lecz stanowią sygnał zakończenia translacji. Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem. Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu. Począwszy od kodonu 104 (GGT) dla glicyny. kodujący u zwierząt homozygotycznych ee umaszczenie czerwone. deficiency uridine monophosphate synthase). występująca u bydła rasy holsztyńsko-fryzyjskiej. Jest ono przyczyną zamierania zarodków. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. wykorzystujący to. ochrę (UAA) lub opal (UGA). w procesie translacji przyłączane są inne aminokwasy. następnie roz120 . Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna . również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu. powstaje nieaktywny peptyd złożony z 85 aminokwasów. W jej konsekwencji. powstaje krótszy N-końcowy fragment tego polipeptydu. powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady. Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. występuje u bydła. 3. przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. natomiast allel dominujący ma takie miejsce. czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka. Jest to schorzenie nazwane DUMPS (ang. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen. które nie kodują aminokwasów. a w konsekwencji zmniejszenia płodności krów. Schemat tej mutacji przedstawiono na rycinie 5-10. w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu. Podobnie jak mutacje typu zmiany sensu. zamiast aktywnego enzymu składającego się z 412 aminokwasów. a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy.

Częstość występowania tej wady. zamianę fazy odczytu. płuc i oskrzeli. Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi. polegająca na zakłóceniu transportu jonów chlorkowych. a nawet śmiertelnych chorób genetycznych. pełniącego funkcję kanału chlorkowego. dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. Insercja trójki może spowodować: dodanie aminokwasu – w białku. W obrębie tego genu wykryto wiele mutacji. przy czym najczęściej jest stwierdzana mutacja w eksonie 10. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. Mutacja ta prowadzi 121 . jeśli trójka nukleotydów zostanie wstawiona między kodony. oznaczona symbolem ΔF508 (ryć. Dotyczy to przede wszystkim trzustki. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym. prowadzącej do przedwczesnej śmierci. 4. cystic fibrosis transmembrane conductance regulator). utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów).dzielany elektrofor etycznie. jeśli trójka „rozerwie" istniejący dotychczas kodon. 5-11). Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego. zwanego CFTR (ang. możliwe jest także pojawienie się kodonu „stop". wynosi l: 2500 osób. Mutacje te mogą prowadzić do poważnych zaburzeń. Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego.

Mutacje zachodzące podczas obróbki potranskrypcyjnej. a także umaszczenie zwierząt i inne. łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny). oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. i glicyna — 509 póz. ale może być również rozpoznawalny w okresie późniejszym. zwanej składaniem (ang. o czym pisano już wcześniej. skrócenie kręgosłupa u bydła i psów. czego konsekwencją jest synteza zmienionego białka. jaka jest zakodowana w sekwencji (CAG)n. na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA. Częstość tych mutacji wynosi 10-40%. złożonej z takiej liczby glutamin. powoduje powstanie domeny glutaminowej. Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA. Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika. na przykład wielopalczastość. Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej. Zwielokrotnienie powtarzającej się sekwencji CAG. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe. a następnie sekwencja GGT dla glicyny. 122 . w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. blok metaboliczny).do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego. przekształcającego fenyloalaninę w tyrozynę. Gen C warunkuje wytwarzanie enzymu tyrozynazy. 5-12 wkładka kolorowa). natomiast w allelu F . 5-13). 5. Często są to zaburzenia przebiegu szlaku metabolicznego (tzw. na przykład białko determinowane przez locus Albino (C). W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów. Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny.3 eksony kodujące 37 aminokwasów. W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka. najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. kodującej aminokwas glutaminę.

powodujący różny stopień nasilenia niedorozwoju umysłowego. powodując jego ciemnienie na powietrzu. prze kształcającego ten kwas w kwas maleiloacetooctowy.4. czyli bielactwo . brwi i rzęsy.brak oksydazy kwasu homogentyzynowego.B. Jednym z genów. 5. Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę). osobniki albinotyczne mają bardzo jasną skórę. kwas homogen tyzynowy jest odkładany w stawach. Tyrozynoza -.niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego. przekształ cającego 3.4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę. białe włosy.brak enzymu tyrozynazy. Alkaptonuria -.3. 123 . np. którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich. chrząstkach i skórze wywołując stany zapalne. a jego nadmiar jest wydalany z moczem. Albinizm. cukrów czy lipidów. Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków. C. D. Mutacje genowe wpływające na cechy produkcyjne zwierząt Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. nie powodujący wyraźnie złych skutków dla organizmu. biorącego udział w przemianie tego kwasu w kwas homogentyzynowy. E. a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie.. jest gen hormonu wzrostu — somatotropiny (ang. tęczówka oka nie jest zabarwiona. growth hormone — GH). Albinizm występuje także u zwierząt.

U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA. U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang.Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową. kwaśne mięso (RN). wykryty u owiec rasy romney.15 prosięcia u świń bardzo plennej rasy meishan i 0. estrogen receptor gene — ESR) a wielkością miotu. Należy jednak pamiętać. sprawia dużo trudności. a szczególnie wrodzonych wad rozwojowych. Mutacje genowe wywołujące choroby genetyczne Mutacje genowe często prowadzą do powstania chorób genetycznych. 5.4. psychicznych itp. że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych. 5. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. Zależnie od stopnia penetracji tych genów można je podzielić na: 124 . Geny letalne. Inne mutacje to: gen FecJ u owiec jawajskich. Spośród wykrytych dotychczas mutacji. Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią. np.6 jagnięcia. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych. największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie). odpornościowych.42 prosięcia u wielkiej białej. Stąd poznanie podłoża wielu chorób genetycznych.4. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0. wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie. O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2). które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu. semiletalne i subwitalne Wpływ szkodliwego działania zmutowanych genów jest różny.4. endokrynologicznych.1.4. Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1. gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji. metabolicznych.

może być różny. powodując śmierć nie tylko homo-. • geny subwitalne. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce. homozygota recesywna). • geny semiletalne. powodują śmierć osobnika. Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego. powodujących poważne zakłócenia procesu trawienia. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w. uzyskamy wówczas lisy zdolne do życia. również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. w którym dany gen przejawia działanie letalne. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia. w którego genotypie wystąpią.• geny letalne. U kur gen achondroplazji (Cp) w układzie hetero- 125 . ale dają zauważalny efekt fenotypowy. nie ograniczając na ogół przeżywalności czy sprawności życiowej. gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. jest gen W. Oba zmutowane geny w układzie homozygotycznym (WpWp. będącym również wynikiem mutacji genu ω. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. natomiast u osobników heterozygotycznych nie są letalne. Niektóre z nich. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych. w stosunku l platynowy: l srebrzysty (ryć. 5-14 wkładka kolorowa). w okresie pourodzeniowym lub u dorosłych osobników. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego. w których genotypach wystąpią w dawce aktywnej (np. które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. który jest letalny w podwójnej dawce. Również okres w życiu osobnika. z nie wyjaśnionych dotąd przyczyn. Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry. Innym genem. ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. WW) działają letalnie. w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). powodujące śmierć ponad 90% osobników. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym. inne zaś później. warunkujący umaszczenie tzw. białopyskie. powodujące w aktywnej dawce śmierć od 50 do 90% osobników. Przykładem jest gen platynowego ubarwienia u lisów. warunkującego srebrzystą barwę włosa. Geny te działają letalnie w układzie homozygotycznym.

Zakres działania tych genów jest różny. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. jak też od interakcji ze środowiskiem. jak achondroplazja recesywna. U samców gen ten jest letalny. co obrazuje schemat: jedynie samice. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt. 126 . Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami. Niektóre geny letalne mogą także powodować śmierć matki. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń. Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec. Cecha ta występuje tylko u samic. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji. bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. Zmienność tej cechy u krów jest duża. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. natomiast u homozygotycznych — bardzo wyraźne. natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną.zygotycznym (Cpcp) warunkuje krótkonożność. iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców. gdyż ich działanie zależy między innymi od czynników środowiskowych. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31. od niewielkich zmian (np. w potomstwie występuje stosunek samców do samic l: 2. warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. Geny semiletalne często jest trudno odróżnić od genów letalnych. Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się W przypadku gdy matka jest heterozygotą. Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych. U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne.

sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich. wady te nie dziedziczą się. Zdarza się jednak. wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała. Niektóre z tych genów są przyczyną zaburzeń metabolicznych. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego. a powstałe pod wpływem czynników środowiskowych. Można to uczynić biorąc pod uwagę: 127 . Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika. powodując tzw. obarczone nimi zwierzęta nazywane są potworkami. 2) wady — są to pewne zaburzenia w prawidłowej budowie. następny podrozdział dotyczy wad wrodzonych. ich rodzajów. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. Choroby monogenowe wywołujące wrodzone wady rozwojowe Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała.Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych.4. Wady takie. chromosomowych lub genomowych. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne. 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia. epilepsja u bydła). Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu.4.2. Teratologia. mimo że są pochodzenia pozagenetycznego. nauka zajmująca się zaburzeniami rozwojowymi. do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi. bloki metaboliczne. powstające w okresie płodowym. 5. inne ujawniają się w późniejszym okresie życia (np. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych. 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód. że niektóre anomalie. Przykład takiego bloku podano już wcześniej. przypominające mutanty. noszą nazwę fenokopii. powodując niepłodność czy utrudniając akt kopulacji.

homozygotyczne pod względem genu niezupełnie dominującego. creeper — pełzacz). u herefordów). Badania genetyczne wykazały. dała początek nowej rasie bydła — dexter). czyli zahamowanie rozwoju układu kostnego. którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany). ulegają poronieniu zwykle przed ósmym miesiącem (ryć. Mutacja ta powoduje powstanie kodonu terminacyjnego. 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich. W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację. kodowany przez ten gen. Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. u którego występuje recesywna karłowatość chondrodysplastyczna (ang. Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. że płody dotknięte tą wadą. Do mutacji wpływających na cały kościec należy karłowatość. U japońskiego bydła mięsnego. chondrodysplastic dwarfism). Jest to prosta cecha recesywna. skrócenie lub brak żuchwy. 5-15 wkładka kolorowa). 128 . Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. Gen karłowatości u osobnika heterozygotycznego. wpływa pośrednio na zwięzłość budowy. skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy. Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy. polegającą na insercji 4 nukleotydów w genie. jak i dalszych. 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika. przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. Nosicielstwo allelu achondroplazji. japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN). U bydła wada ta występuje u ras mięsnych (np. OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH Wady układu kostnego Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja. powodując tylko nieznaczne skrócenie kończyn. Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii. stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej. 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka. charakteryzującego się wybitną wartością hodowlaną. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. oznaczonego symbolem bd (ang.1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie. cechująca się skróceniem kończyn. bulldog disease).

obserwowana głównie u bydła. central vertebral malformation). fibroblast growth factor receptor 3 -. stwierdza się osłabione zdolności rozrodcze. świń. amputacji kończyn. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego. Genetycznym podłożem tej wady jest autosomalny gen recesywny. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi". deformację grzbietu. że jest to cecha letalna dla jednej płci. Wada ta. Anomalią układu kostnego. a nawet niepłodność. polega na niezrośnięciu się kości czaszki. Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. Jest ona wynikiem mutacji (transwersja adeniny na tyminę. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn. brakowi gałek ocznych 129 . Jest ona letalna u bydła i indyków. która zależnie od gatunku. U owiec niektórych ras mięsnych (suffolk. Natomiast samce prawdopodobnie nie osiągają dojrzałości. hampshire) w Stanach Zjednoczonych w latach 80. Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. a nawet ludzi jest tzw. Wadzie tej często towarzyszą: skrócenie żuchwy. bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego. rozmnażają się one prawidłowo. a u tych. cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. Może ona natomiast towarzyszyć: wodogłowiu. spider syndrome). przepuklinie mózgowej. któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. jest autosomalna recesywna cecha skrócenie kręgosłupa. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość.Zaburzeniem. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw. żeber i mostka oraz części pyskowej (garbaty nos). U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. U psów skrócenie kręgosłupa nie jest letalne dla suk. świń i owiec. Anomalia ta uwarunkowana jest genem recesywnym. Szczenięta obarczone tą wadą cechuje mniejsza żywotność. Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka. pęcinowego lub kolanowego. amputacja kończyn (akroteriaza) (ryć. U jagniąt. 5-16 wkładka kolorowa). które występuje u większości ras bydła. Możliwe więc. które przeżyły. rozdwojenie podniebienia i brak większości zębów. Ogólne zesztywnienie stawów notowane jest u bydła. a nawet płci wykazuje różny stopień letalności. a także u owiec.FGFR3).

jak włosy i pióra. u bydła rasy Jersey. że wszystkie bezwłose psy (tzw. jak wodogłowie. Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. że osobniki homozygotyczne rodzą się martwe. w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. chińskie. Płytki te są porozdzielane rowkami. Ptaki. Inną wadą dziedziczną układu powłokowego jest brak owłosienia. gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości. Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. perskie lub meksykańskie) są heterozygotami. a to z kolei może spowodować śmierć w pierwszych tygodniach życia. Wady układu powłokowego Wady układu powłokowego odnoszą się nie tylko do skóry. U owiec obserwowana jest również cecha recesywna — brak żuchwy. która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka. prowadzącą do śmierci płodów lub noworodków. Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła. w których rosną włosy. naked). 130 . Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu. uwarunkowana recesywnym genem sprzężonym z płcią. Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. Na podstawie szczegółowych badań można sądzić. Anomalia ta polega na skróceniu dolnej części dzioba. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu. ale i takich jej wytworów. skrócenie szczęki. Cielęta dotknięte tą wadą w warunkach naturalnych giną. Nienormalność ta jest prostą cechą recesywna. U drobiu wadą układu powłokowego jest nagość. królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. Wyniki badań wskazują. Schorzenie to przybiera najostrzejszą formę. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi. niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). duck). Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. U bydła.lub zesztywnieniu stawów. natomiast najłagodniejszą. U psów brak owłosienia uwarunkowany jest genem dominującym. które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle. Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. psy tureckie. W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. oznaczonym symbolem n (ang. u bydła ayrshire.

to prosta autosomalna cecha recesywną występująca zarówno u bydła. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. Brak odbytu jest recesywną cechą letalną. sprzężone z płcią zaburzenie zwane paroksyzmem. powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. u koni natomiast okrężnicy. jak i u koni. powodując jego rozjaśnienie. podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną. determinowana u bydła genem dominującym. U świń gen warunkujący tę wadę wykazuje działanie plejotropowe. Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. Niedrożność jelit zaś. U bydła nienormalność ta dotyczy jelita biodrowego.Wady układu pokarmowego Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. U drobiu występuje również recesywne. usztywnieniem nóg oraz drżeniem ciała. warun131 . U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. Obie nienormalności warunkowane są genem recesywnym. Większość z tych kurcząt ginie przed 15 tygodniem życia. Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja. U indyków i kur notowane jest wrodzone zaburzenie równowagi. Prostą autosomalna cechą występującą u bydła. rasy houdan i polskie czubatki). Atak taki trwa około 10 sekund. Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. Wady układu nerwowego Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. Zwierzęta dotknięte tą wadą rodzą się żywe. nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. wpływa bowiem na umaszczenie. Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. ale nie mogą stać. wykazują powiększenie czaszki. świń i drobiu jest wodogłowie wewnętrzne. przy czym u kur gen ten nie jest letalny (np. Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. crest). Niedorozwój móżdżku najlepiej został poznany u bydła i owiec. u których jest prostą cechą recesywną. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem. Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy. następnie upadkiem. natomiast u królików — recesywnym. natomiast heterozygoty mają piękny czub. Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych.

Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang. nasieniowodów. ale nie mogą jeść. ogierów i samców innych ssaków jest wnętrostwo.4. knurl). Anomalią o dużej częstości występowania.kowane recesywnym genem letalnym lo (ang. 5. loco). dlatego nazwano je „gałkowatymi". pić i giną w ciągu kilku dni. a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego. iż objawy pojawiają się u zwierząt w różnym wieku. Nienormalność tę można usunąć zabiegiem chirurgicznym. związanym z niedorozwojem przodomózgowia. Trudność tę powiększa to. macicy.4. jak na przykład brak lub niedobór pewnych enzymów czy hormonów. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne. ale także u knurów. Pisklęta obarczone tą wadą kłują się dobrze. której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych. Zaburzeniem układu nerwowego. Podłoże genetyczne zaburzeń natury biochemicznej. powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych. szczególnie u buhajów. Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów. Niepłodność obserwowana jest także u buhajów. jest paraliż i przykurcz mięśni kończyn i szyi. czyli szczytowej części główki. Wady układu rozrodczego Dość często występujące. 132 . świń i owiec. niedrożność jajowodów czy wnętrostwo. czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny. Obustronne wnętry są niepłodne również po takim zabiegu. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu. autosomalna cecha recesywna. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. takie jak: niedorozwój (hipoplazja) jąder. Jest to prosta. Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu. jest trudne do identyfikacji.3. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. jajników. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy. występujący u bydła. Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem.

wytwarzany w nadmiernych ilościach i odkładany we krwi. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych. Genetycznym podłożem tej wady u bydła jest gen recesywny. charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia. a dotycząca czynnika IX (czynnik Christmas). lecz jest ono jednak innej natury niż porfiria u bydła. zroślaki (zrośnięte dwa płody). a w skrajnych przypadkach — wrzodów. wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej. wywoływana działaniem genu recesywnego sprzężonego z płcią. mająca łagodniejszy przebieg. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny. które są niewątpliwie dziedziczne. a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu. ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna. która jest produktem rozkładu chlorofilu. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa). reagują powstawaniem pęcherzy na skórze. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne. istnieje wiele anomalii. Schorzeniem notowanym u ludzi i psów. kościach. niezbędnego do wytwarzania tromboplastyny osocza. zębach i innych częściach ciała. który przyspiesza przemianę protrombiny w trombinę. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. Należą do nich przypadki wielokończynowości.Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. 133 . Uczulenie na promienie słoneczne występuje również u owiec. Fenotypowym obrazem tej wady jest egzema na pysku i uszach. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła. Oprócz ogromnej liczby wrodzonych wad dziedzicznych. powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II. Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. a także owiec. składnika hemoglobiny. których podłoże genetyczne jest dobrze poznane. i hemofilia B.

134 .

ale w swoim genotypie 135 . kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana. częstość jest niewielka.5. które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji). Terminem nosiciel określamy osobnika. W Polsce. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania. są zauważalne i łatwe do eliminacji.4. Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń. który jest fenotypowo normalny. Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli). ale jedynie te.4.4. niestety. Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli. Ograniczanie występowania chorób genetycznych Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach.

będą pochodzić wszyscy synowie fenotypowo normalni. Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. głównie wykorzystywanych w sztucznej inseminacji (np. Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. to około 50% jego potomków będzie homozygotami recesywnymi. jednakże połowa z nich będzie homozygotami dominującymi. Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią.ma gen letalny (czy semiletalny) w układzie heterozygotycznym. a połowa nosicielami niepożądanego genu. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Testowanie takie jest możliwe jedynie wtedy. Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza. fenotypowo ujawniają swą obecność wówczas. Jeśli będzie to gen letalny powodujący zamieranie zarodków. że aż 18% osobników jest nosicielami niepożądanego allelu. Natomiast wśród jego córek połowa będzie normalnych. wśród których można się spodziewać obecności nosicielek recesywnego allelu. 136 . u ptaków samce). Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice. gdy występują w stanie homozygotycznym. to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. buhaje). 2. Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic. jak już wspomniano. Geny te. Schemat takiego kojarzenia jest następujący: Jeżeli testowany osobnik jest nosicielem allelu recesywnego. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności. gdy homozygoty recesywne wykazujące wadę żyją i są płodne. Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników. a u połowy ujawni się wada dziedziczna. Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. skojarzonego z normalnymi kurami.

Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus. to wśród córek połowa będzie miała genotyp AA. 3. test automatyczny).Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. a połowa Aa. zakupione przez Stacje Hodowli i Unasieniania Zwierząt. że samice matki tych córek są homozygotyczne (AA). kojarzone są z losowo wybranymi samicami. Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. jest kojarzenie samca z jego własnymi córkami. Wówczas schemat kojarzenia testowego jest następujący: Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. lecz trudną do zaakceptowania ze względów hodowlanych. W hodowli bydła młode buhaje. Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). Jeśli przyjmiemy. 137 . Rejestracja ta z jednej strony daje obraz częstości występowania tych wad. z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich). a samiec jest heterozygotyczny. w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw. Dokładną metodą identyfikacji nosicielstwa recesywnego genu. Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych.

Ponieważ jest to gen recesywny. Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi. Białko to odgrywa istotną rolę w odporności organizmu. Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych. występująca również u ludzi pod nazwą LAD (ang. Zagadnienie to opisano niżej. że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy). Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2. rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego. Analiza rodowodowa wykazała. W diagnostyce tych chorób stosowane są techniki biologii molekularnej. Stwierdzona w pozycji 383 nukleotydu mutacja. który koduje strukturalną podjednostkę CD18 p2-integryny. Jest to choroba autosomalna recesywna. szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne. Na początku lat 90. U bydła zespół BLAD był znany od kilkunastu lat. po raz pierwszy opisano go w 1983 roku. które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. fenotypowo zdrowe).Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt. a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu). spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych. W latach 70. Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to. powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138 . Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. głównie PCR-RFLP. w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej. tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. leukocyte adhesion deficiency).

Jej podłożem genetycznym jest zmutowany. tzw. iż zmutowany allel nie ma miejsca restrykcyj139 . natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. podejmowane są środki prewencyjne. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów.wego na glicynę. Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni. ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. ciche podstawienie 775 nukleotydu. który bierze udział w cyklu mocznikowym. a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. Mutacja ta została już przedstawiona wcześniej. Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to. Obraz elektroforetycznego rozdziału wygląda następująco: W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. Za pomocą analizy fragmentów restrykcyjnych określa się. jaki allel występuje w badanym DNA. jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa. Z kolei. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA. recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej. Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach. opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia.

Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu. a dla normalnej homozygoty dwa prążki 118 pz i 72 pz. W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę. występujące po zmianie diety. powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży. Objawami tej choroby są ataki drżenia mięśni i paraliżu. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. pojawiający się u koni „ąuarter" w USA.nego dla enzymu Avall w kodonie 86. 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym. Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz. Zmutowany allel genu UMPS. za140 . Osobniki heterozygotyczne są fenotypowo normalne. natomiast allel zmutowany (DUMPS) — nie będzie. Z drugiej jednak strony. natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. hyperkalemic periodic paralysis). również wcześniej przedstawioną mutacją letalną. nie dającą żadnych skutków fenotypowych. Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz. których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych). nazwany HYPP (ang. polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). dla heterozygotycznego trzy prążki: 194 pz. Podobnie jak w przypadku poprzednich mutacji. Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. Kolejną. powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT). do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku. okresie głodzenia. występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego. niemożliwa jest analiza DNA osobników homozygotycznych. dlatego nazwano go „genem zamieralności zarodków". Pierwsza z nich to okresowy paraliż. 118 pz i 72 pz. określony symbolem DUMPS (ang. Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni. ale wykazują obniżony poziom aktywności enzymu. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. jest recesywna mutacja genu syntazy urydynomonofosforanowej. deficiency uridine monophosphate synthase).

na granicy prążka 12 i 13 (20pl2-pl3). indukując zmiany ich konformacji. spongiform encephalopathies). Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej. natomiast u bydła i owiec w długim ramieniu chromosomu 13. poznanych chorób prionowych u zwierząt jest trzęsawka (ang. scrapie — drapać) u owiec. Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny. u owiec — 13ql7-ql8. Omawiając choroby genetyczne nie sposób pominąć tzw. iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen. nazwane prionami. Jedną z najdawniej. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. bo około 250 lat temu. u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20. namnażają się w ten sposób. W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach. jak P 141 . dobrze umięśnionych. Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang. Z tego powodu określane są gąbczastymi encefalopatiami (ang. z zastosowaniem enzymu restrykcyjnego Tagi. iż przekształcają prawidłowe cząsteczki białka w szkodliwe. co powoduje załamanie się układu immunologicznego. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). Białkowe cząsteczki infekcyjne. którym jest białko. severe combined immunodeficiency disease — SCID). trwającym miesiące lub lata bez żadnych objawów. Choroba ta charakteryzuje się brakiem limfocytów T oraz B. że nie występuje ona w polskiej populacji koni arabskich. Gen kodujący białko komórkowe oznaczono symbolem PrPc. jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP. natomiast badania przeprowadzone w Polsce wykazały. a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). przy czym u bydła w pozycji 13ql7. Przypuszcza się. chorób prionowych. warunkujący białko prionowe — symbolem PrPSc. Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji. Podobna choroba od 50 lat znana jest u ludzi. Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA.działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. jego zmutowany allel. Mutacja HYPP dziedziczy się z niezupełną dominacją.

Spośród trzech możliwych genotypów (6:6. 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. downstream prion-like protein) lub doppel. Gen ten koduje białko określane jako Dpl (ang. Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. które wywołuje scrapie u owiec. które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny. 142 . a jej rezultaty nie były zadowalające. Białko to ma około 250 aminokwasów. Dotychczas stwierdzono. oznaczenia literowe V/A). Wydaje się. kóz i bydła. Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. U bydła chorobą prionową jest rozmiękczenie mózgu (ang. Jest to choroba ośrodkowego układu nerwowego. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii. bovine spongiform encephalopathy — BSE). które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. że w pobliżu genu białka prionowego znajduje się gen Prnd (ang. Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". rok później została opisana jej patologia. Czynnikiem zakaźnym BSE jest to samo białko prionowe. prion-doppel). związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. Wykryto już kilka mutacji w tym genie u owiec. Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej. że najbardziej odporne są owce o genotypie AA136RR154RR171. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. R/H) oraz 171 (arginina/glutamina. 154 (arginina/histydyna. 5-III). Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc. R/Q) (tab. że częściej występuje 6 powtórzeń. a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). Metoda ta okazała się jednak zbyt droga i długotrwała. Ponadto tylko ten genotyp nie występował u krów z BSE. 5-17). W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm.śledziona czy węzły chłonne. Ostatnie badania wykazały.

bydło jest szczególnie podatne na inwazje kleszczy. Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt. bydło indyjskie jest bardzo odporne na kleszcze. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny Gen odporności na kleszcze W niektórych krajach. powodujące rocznie padnięcie około 10 min prosiąt na świecie. głównie w północnej Australii i innych regionach tropikalnych. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi.5. występowanie tych 143 . determinujący odporność na kleszcze. jak również w Europie. Gen K88 i F18 U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen.5. ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. umożliwiających adhezję bakterii i ich rozwój.4. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie. w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli. Z kolei. Należą do nich biegunki okresu noworodkowego u prosiąt. Z kolei. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła.

polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę). ataksja. 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych. oznaczona symbolem M307. wykazuje ścisłe sprzężenie z genem ECF18R. Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika. konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa). Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra. warunkującego odporność na infekcje E. W jednym z nich (FUT1) wykryto dwie mutacje. stwierdzono bowiem. coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. Loci receptorów dla E. coli (bakterie te mają fimbrie). Mutacje te mogą być dziedziczone po matce. oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. coli F18). 5.receptorów warunkowane jest genem głównym (o dużym efekcie). Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne. iż mogą 144 . coli K88 zlokalizowano w chromosomie 13. iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg.5. z których jedna. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E. coli F18. U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa.in. trzech prążków (93. Podatność jest cechą dominującą (allel B). Mutacje w mitochondrialnym DNA Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. a ich charakterystyczną cechą jest to. schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E. której objawami są m.2-fukozylotransferazy. blisko locus Tf (transferyny). z ałlelem zmutowanym M307A. mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym. a odporność recesywną (allel b). znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany). W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1'. Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l. Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA.

Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną. poszarpane czerwone włókna (MERRF).dotyczyć całych tkanek. iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom. Z kolei. mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). Przykładem pierwszej sytuacji jest wspomniana już choroba LHON. ale dalszym pokoleniom cechę tę przekazują tylko córki. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego. podobnie jak w DNA jądrowym. Mutacje w mitochondrialnym DNA. Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki. Miejsce i zasięg występowania danej mutacji powodują. inne natomiast u odpornych. wywoływaną przez wirus. iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach.in. Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. jak i synom. Podstawienia nukleotydów w genach kodujących tRNA powodują m. jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP). Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np. pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. polegają na substytucjach nukleotydów (głównie tranzycja). . insercji bądź delecji nukleotydów. dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną. Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. padaczkę miokloniczną i tzw. mitochondrialną miopatię. drugi natomiast mutacją homoplazmatyczną. której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. kwasica mleczanowa i napady udaropodobne). chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona. Skutkiem tranzycji są takie choroby u człowieka. że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka. Wiadomo na przykład. Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi.

a nawet kilkadziesiąt par genów. a ich ujawnienie się zależy przede wszystkim od założeń genetycznych. posiadanie/brak rogów). Ponadto. barwa umaszczenia. Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym. jak: umaszczenie zwierząt.Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu. Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków. w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. kolor upierzenia u drobiu. Zjawisko to nazywa się plejotropią. kiedy jeden gen wpływa na kształtowanie się kilku cech. która jest łatwa do odróżnienia w zespole innych właściwości (np. umaszczenia. że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone. Ogólnie cechy można podzielić na jakościowe i ilościowe. Cechy jakościowe są warunkowane jedną. 146 . W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen. Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy. Znane są również przykłady. Oznacza to. rogatość lub bezrożność bydła. Mechanizm dziedziczenia cech jakościowych jest zróżnicowany. układy grupowe krwi itd. np. bowiem na ich ekspresję wpływa kilkanaście. rzadziej kilkoma współdziałającymi ze sobą parami genów. Do cech jakościowych zalicza się takie. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości. owiec i kóz. Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. Wspólną właściwością tych cech jest to.

W procesie gametogenezy allele z danej pary rozchodzą się do gamet.Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem. Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus. Zygota. A-a). Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek). drugi natomiast od matki. Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów). Jak już wspomniano. a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. Współdziałanie alleli Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu.1. która zawiera dwa jednakowe geny z danej pary alleli. Dziedziczenie cech warunkowanych jedną parą alleli 6. Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary. Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie. Geny te nazywane są parą alleli lub allelomorfów. Potomek dziedziczy zatem jeden allel z danej pary od ojca. 147 . dając wszystkie możliwe formy danej cechy. Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla. Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. I prawo Mendla. W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech. cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą. że gameta zawiera tylko jeden gen z danej pary alleli.1. drugi natomiast — nieallelicznego (kilka par genów). natomiast mająca dwa różne geny — heterozygotą (Aa). mówi o tym.1. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA. nazywa się homozygotą (AA lub aa). 6. zwane prawem czystości gamet.

gdyż gen dominujący P maskuje jego ekspresję. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2). jest poniższy przykład. Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. część zaś białe. Stwierdzono. jednolite umaszczenie (dominuje) i łaciatość u bydła. jednolitego umaszczenia. będących homozygotami alternatywnymi (PP i pp) pod względem locus polled. otrzymuje się potomstwo (pokolenie Fl) mroziate. to stosunek liczbowy osobników czerwonych. U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. czarne umaszczenie u bydła. zawsze da potomstwo heterozygotyczne. że fenotyp zwierzęcia odzwierciedla jego genotyp. dominujące nad czerwonym i inne.Przykładem całkowitej dominacji może być bezrożność u bydła. Ilustracją tego typu dziedziczenia. iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie). Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt. Z kolei u świń rasy cornwall. Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. Para rodziców. który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. Charakterystyczną cechą tego typu dziedziczenia jest to. Są one zatem w stosunku do siebie równorzędne. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz. również czarno umaszczonych. mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. nazywanego również dziedziczeniem typu Zea. W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. z którego część ma umaszczenie czerwone. Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie. część mroziate. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane). Dominowanie niezupełne genów z jednej pary alleli polega na tym. w locus tym występuje allel be. długość uszu u owiec rasy karakuł i inne. wykazujące dominującą formę cechy. że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire. Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi. Przykładem tego typu współdziałania allelicznego jest grupa 148 . białe i stalowoniebieskie). kontrolowany przez allel dominujący Bew z locus Be. upierzenie kur andaluzyjskich (czarne.

Układ taki. obok dotychczasowej pary alleli pojawia się allel trzeci.krwi AB w układzie ABO u ludzi. w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu. Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. dając jedynie inną jej formę lub natężenie. w którym w jakiejś populacji 149 . w wyniku mutacji genowych (patrz rozdział: Mutacje). Zdarzają się również takie loci. Naddominowanie polega na tym. w których u różnych osobników znajdują się więcej niż trzy allele. W przypadku niektórych loci. że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa). który warunkuje tę samą cechę co allele pierwotne.

że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1). to ich segregacja jest praktycznie niezależna. nazywamy szeregiem (serią) alleli wielokrotnych.występują więcej niż dwa allele. rogate) — allele recesywne e i p.in.1. Allele wielokrotne charakteryzują się tym. bezrogie) zawierają dominujące geny Ed i P. czerwone). Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie. to liczba genotypów będzie się równała: Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. mówiące o niezależnym dziedziczeniu się cech. Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne. natomiast gamety osobnika rasy shorthorn (czerwone. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla). Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP. Niezależne dziedziczenie cech (II prawo Mendla) Niezależne dziedziczenie cech stwierdził Grzegorz Mendel. Oznacza to. ep. jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. 6. Dzieje się tak 150 . to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone). bezrogie. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku.2. Jeśli szereg składa się z n liczby alleli. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie. eP. czyli będą czarne. badając m. Edp. Wszystkie gamety osobnika aberdeen-angus (bydło czarne. iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu. Zwierzęta z pokolenia Fj będą mieć genotyp EdePp.

151 .

sporządzając szachownicę genetyczną Punneta. a druga według typu Zea. Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie. a tylko kilka do kilkudziesięciu chromosomów. gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych.1. inaczej mówiąc. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4. Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy. W tym przypadku można mówić o niezależnej segregacji chromosomów. Dziedziczenie cech sprzężonych Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to. 6-2). gdy obie cechy dziedziczą się z dominowaniem całkowitym. Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2. że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p. bezrogie): l (czerwone. iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy. Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli. Ponieważ każdy osobnik wytwarza 4 rodzaje gamet. cechy kontrolowane przez te geny będą się dziedziczyć razem.dlatego. istnieje możliwość ujawnienia się 6 różnych fenotypów. rogate): 3 (czerwone. Zatem każdy chromosom zawiera wiele genów. to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. rogaty). a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może 152 . bezrogie): 3 (czarne. w którym występuje przynajmniej jeden gen dominujący z każdej pary. rogate) (ryć. zwiększy się liczba możliwych fenotypów. lecz 9 różnych fenotypów. Natomiast gdy jedna cecha dziedziczy się według typu Pisum. liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n 6. Najliczniejszą grupę potomstwa stanowią osobniki o genotypie.3. Cechy takie nazywamy sprzężonymi. dziesiątki tysięcy różnych genów. Jeśli będzie rozpatrywana większa liczba cech równocześnie. Jednak organizmy żywe mają tysiące.

W wyniku crossing over u części osobników potomnych. mianownik drugi chromosom z tej pary. Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący: Natomiast genotyp podwójnej homozygoty recesywnej: W celu określenia. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. W odróżnieniu od cech segregujących niezależnie. 153 . Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy. im dalej od siebie znajdują się geny.być stosowany do tych cech. Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). normalne skrzydła są dłuższe od odwłoka. jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom. Częstość tej wymiany jest tym większa. dzikiej) każdej cechy u muszki. złożone z homologicznych chromosomów. w którym licznik oznacza jeden chromosom. bądź w różnych chromosomach i jest to faza odpychania (trans). że są one w fazie przyciągania (cis). pojawią się kombinacje cech w innym układzie niż u rodziców. Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. została przyjęta nazwa faza sprzężenia. rekombinantów. iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty. skrzydła szczątkowe (gen recesywny v — vestigal). Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. tzw. Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna. U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł. zwanej crossing over. W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym. genotyp dla cech sprzężonych jest zapisywany w postaci ułamka. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami.

W naszym przykładzie odległość między loci B i V wynosi 18. z jaką crossing over zachodzi między sprzężonymi loci. Doświadczalnie zostało udowodnione. W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over. że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów. której symbolem jest cM (centymorgan. jeśli pojedynczy 154 . od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana). iż częstość. Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu). Można jednak przewidzieć częstość występowania podwójnego crossing over. Procent rekombinacji przyjęto za jednostkę odległości między genami. W danym przykładzie rekombinanty stanowią około 18.5% całego potomstwa z tej krzyżówki. Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy. Wynika to z tego. jest ona iloczynem częstości przypadków pojedynczych crossing over. Na przykład.Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe.5 cM. czyli l cM = 1% rekombinacji. jest stała. natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami).

to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci. krzyżówki trzypunktowe. Trzecią cechą rozpatrywaną będzie kolor oczu. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie. stosuje się tzw. By tego uniknąć. Przyczynę stanowi to. Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi. czyli 0. a w obszarze II — 0.05 = 0. iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka. Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej.1%. jak przed tą wymianą i nie będzie można odróżnić rekombinantów.crossing over w obszarze I zachodzi z częstością 0. to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C. umożliwiające dokładne ustalenie położenia loci względem siebie. 155 . Również w tej krzyżówce. Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych. podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. Jeśli przyjmiemy.02x0. a nie za pomocą przyjętego dla nich symbolu „ + ". Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych. Zjawisko to nosi nazwę interferencji. a gen recesywny c (cinnabar). Jest to jednak wartość przybliżona. Jeśli jednak zajdzie podwójny crossing over. to częstość występowania podwójnego crossing over wynosi 0. Z kolei. allele dominujące będą oznaczone literami alfabetu.001. U muszki owocowej dominuje czerwony kolor oczu (dziki).05 (5%). W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny: Natomiast drugi rodzic ma genotyp: W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv. w celu lepszego uwidocznienia efektu crossing over. natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV. że kolejność ułożenia loci w chromosomie jest następująca: A-B-C. warunkuje kolor cynobrowy.02 (2%). układ genów będzie taki. gdyż w naturze jest ona niższa.

W celu okreś156 . W ten sposób tworzone są mapy genetyczne. wyrażonym w procentach: Analogicznie do tego odległość między loci C i V wynosi: Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco: Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie. Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane.W potomstwie uzyskano następujące genotypy i liczebności: Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów.

Powstaje wówczas mapa fizyczna. Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi. a synowie po matce). Sposób ich dziedziczenia jest inny niż cech autosomalnych. należy zastosować inne metody badania (cytogenetyczne). uwarunkowana jest recesywnym genem h. Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ). iż u osobnika diploidalnego występuje tylko jeden gen z danej pary. że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego.lenia. Cechy sprzężone z płcią Cechy. nazywamy cechami sprzężonymi z płcią.1. nazywamy hemizygotycznym.. U ssaków samice są homogametyczne (XX). samce zaś heterogametyczne (XV). a heterogametyczną samice (ZW). O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. Dzieje się tak dlatego. 157 . że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki). Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład. ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. Układ genetyczny polegający na tym.4. a pleć homogametyczną cechę recesywną. a osobnika — hemizygotą. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu. Gdy płeć heterogametyczną ma cechę dominującą. obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu. występująca u ludzi. cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. a nie — jak u płci homogametycznej — od pary genów. Cecha zmniejszonej krzepliwości krwi (hemofilia). Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób: Fenotyp Samice Samce Samice Samce Jak wynika z tego zestawienia. W rozdziale tym pokazano m. samce nie mogą być heterozygotami (nosicielami genu hemofilii). 6. Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. w którym chromosomie znajduje się dana grupa genów sprzężonych. psów i niektórych zwierząt gospodarskich. Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego). których geny są umieszczone w chromosomach płci.in.

dominuje nad jego allelem b (gen czarnej barwy upierzenia). Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce.Ryć. „dziedziczenie na krzyż" Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B. Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. w pokoleniu F. Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią. 6-3. Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych. Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra. takich. 6-4 wkładka kolorowa). tj. warunkujący cechę jastrzębiatości upierzenia. u których zaraz po 158 .

Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia. natomiast osobniki homozygotyczne recesywne będą rogate. orange). Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. których założenia genetyczne znajdują się u osobników obu płci.wykluciu można rozróżnić płeć. mając taki sam genotyp. Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech. 6-5 wkładka kolorowa). Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach). warunkowana przez locus O (ang. Rasą autoseksingową są polbary. Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. Cechy te nazywane są cechami 159 . geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw. Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate. ale ujawniają się tylko u jednej płci. Niektóre z nich to tzw. B (niebieskie dzikie) i b (czekoladowe). rasa sussex) i złocistości upierzenia (rhode island red). U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych. zlokalizowany w chromosomie X. Samce mogą być tylko czarne (o-) lub rude (O-). ang. U zwierząt domowych jest wiele cech sprzężonych z płcią. Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci. Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw. ale ich ekspresja jest uzależniona od płci.będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach. dwarf — karłowaty). Osobniki męskie i żeńskie. Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym. Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. mające gen jastrzębiatego upierzenia. Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści. część z nich przedstawiono w rozdziale: Mutacje. samice zaś bezrogie. cechy związane z płcią. Przykładem takiej cechy jest rogatość owiec rasy dorset horn. iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie. mogą się różnić fenotypowo. inne — rude (genotyp Oo) (ryć. wytworzone przez polską badaczkę Laurę Kaufman. Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X. Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone). co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego. Jest ono następstwem tego.

Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy. który bierze udział w syntezie jakiegoś związku (np. W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt. 6. powodują pojawienie się nowej formy cechy jakościowej. 6. pracę serca i aktywność procesów trawiennych. Na przykład gen warunkuje syntezę enzymu. nieśność samic ptaków. Plejotropia może być właściwa lub rzekoma. wpływa zatem na inne właściwości organizmu. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt". Współdziałanie genów z różnych loci w kształtowaniu fenotypu W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy. w wyniku łącznego działania.ograniczonymi płcią lub ograniczonymi do płci. Należą do nich: zdolność wydzielania mleka u samic ssaków. Z kolei ten związek ma różnorodne funkcje fizjologiczne. Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. kiedy jeden gen oddziałuje na powstanie kilku cech.2. opisany w podrozdziale: Dziedziczenie umaszczenia. Plejotropia O plejotropii mówimy wówczas. gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę.in. Zmiany te są jednak następstwem nieprawidłowego opierzenia. na tempo przemiany materii. Plejotropia właściwa występuje wtedy. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m. wnętrostwo czy przepuklina mosznowa u samców. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe. Przykładem jest gen warunkujący platynową barwę u lisów. 160 . które nie chroni ptaka przed nadmierną utratą ciepła.5. hormonu). która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech.1. Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. W przypadku wielu cech geny z różnych par alleli.

Komplementarność Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć.1. Jest kilka rodzajów tego współdziałania. 6. Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161 .Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. 6-6a. Ryć. 6-6a).2. W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p.

Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. Epistaza Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza. który hamuje ujawnienie się genu z innej pary. Z krzyżowania osobników o ustalonej cesze kształtu grzebienia. jego allel p — grzebienia pojedynczego (ryć. całkowicie różny od obojga rodziców.2. Dwa dominujące geny z różnych par alleli. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy. warunkujący go genotyp to podwójna homozygota recesywna — rrpp. w którym wystąpią 4 fenotypy w stosunku 9:3:3:1. gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_). która powstaje w wyniku działania każdego z nich osobno. charakteryzująca się tym. wyandotte. ale mają 162 . Gen. gdyż brak w ich genotypach genu C. współdziałające razem i wytwarzające odmienną formę cechy niż ta. że w pokoleniu Fl pojawia się nowy fenotyp. U białych leghornów jest inna sytuacja. natomiast gen hamowany to gen hipostatyczny. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia. Kury niektórych ras (np. Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego. podobna do wspomnianej wyżej u świń. 6-6b wkładka kolorowa). nazywamy genami komplementarnymi lub dopełniającymi się. a jego allel r — pojedynczy. jak i różyczkowego. Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym. pojawia się również nowy typ — grzebień pojedynczy. plymouth rock) mają upierzenie białe. warunkującego wytwarzanie pigmentu (melaniny) w piórach. którego nie było w dwóch pokoleniach przodków. W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy. w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy. nazywany jest genem epistatycznym. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP). Zjawisko epistazy może wyjaśnić poniższy przykład.2. 6. że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. natomiast w pokoleniu F 2 . Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc).Gen R warunkuje kształt różyczkowy grzebienia. natomiast gen P powoduje powstanie grzebienia groszkowego. której genotyp może mieć kilka różnych wariantów. która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. Ptaki te są również białe. tj.

natomiast czarno umaszczonych (np. Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP. powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę.Ryć. którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc). W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów. które modyfikują przejawianie się jakiejś prostej cechy. Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć. Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary. rasy cornwall): aa ii EE. zwane modyfikatorami. oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. dotyczącej dziedziczenia umaszczenia. Geny epistatyczne mogą tłumić działanie wielu innych par. warunkowanej zwykle jedną parą genów.3. 163 . mimo iż cecha łaciatości warunkowana jest inną parą alleli. 6-7). 6. Geny modyfikujące Istnieje pewna grupa genów. Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC.2. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I. Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne. Gen epistatyczny nie zawsze jest dominujący w swojej parze. Allele z locus E i A są opisane w dalszej części tego rozdziału. Różny stopień białej plamistości spowodowany działaniem genów modyfikujących w swych genotypach gen C. który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. psów i kotów. Geny te. 6-7. W potomstwie F2.

Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny. i feomelaniny (kolor czerwony lub żółty). 6-8): 1) hydroksylację tyrozyny do 3. syntetyzowane z metabolitów DOPA-chromu. powodując różne jej nasilenie. a czarna lub brązowa w lecie). 164 . melanocyte stimulating hormone).2. Ostatnie badania wykazały. Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np.6. iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę. U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych. natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. biała w zimie.). wpływając na przykład na zmianę ilości wytwarzanego pigmentu. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny). Dziedziczenie umaszczenia Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach. kortykotropina i hormon melanotropowy — MSH (ang. Synteza. wytwarzane z metabolitów cysteinylo-DOPA-chinonu. Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. Sumujące działanie genów Inną formą współdziałania nieallelicznego genów jest polimeria. nieśność itd. rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci. wydajność mleczna. Geny te nazywane są genami polimerycznymi. Zjawisko to polega na tym.3. addytywnymi lub poligenami.6-dihydroksyindolu (DHI) do indolochinonu. ale czynniki środowiskowe mogą modyfikować umaszczenie. natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej. zależne od sumującego się ich działania.4. że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych. Należy pamiętać. 6. iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu.4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5. Zmiany te spowodowane są działaniem niektórych hormonów. Do niedawna uważano. Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. takich jak gonadotropiny. że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację.

które zostały już sklonowane. Jest wiele genów. zwany również intermedyną lub melanotropiną. jest wytwarzany przez część pośrednią części gruczołowej przysadki. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti). Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów. Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165 .Ryć. REGULACJA NA POZIOMIE TKANKOWYM Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina). komórkowym i subkomórkowym. Receptor ten jest determinowany przez locus E (Extension). Hormon melanotropowy. W determinację koloru jest włączonych wiele loci. Hormon ten stymuluje produkcję poszczególnych melanin na przemian. ma działanie plejotropowe na rozwój i różnicowanie organizmu. Schemat biosyntezy melaniny Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym. warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). a hamowanie produkcji feomelaniny wewnątrz melanocytów. Wiele genów. 6-8. jeśli nie wszystkie związane z wytwarzaniem pigmentu. a podczas rozwoju embrionalnego wędrują do powstającej skóry. Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. Geny. Melanocyty pochodzą z rdzenia nerwowego. Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. Melaniny są wytwarzane w melanocytach. które współdziałają ze sobą w sposób kompleksowy.

odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych. w jednolity typowy sposób. Dominant White Spotting (W) . które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów. co wpływa na koloryt (układ barw). Geny. Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu). Większość z tych mutacji ma wpływ plejotropowy na rozwój. melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę. brak syntezy melaniny w przypadku albinizmu). zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) .dominujący biały nakrapiany i Steel (Sl) . Należą do nich geny z loci D (Dilute — rozjaśniony). U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego). REGULACJA NA POZIOMIE SUBKOMÓRKOWYM Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym). a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. podczas gdy locus Extension działa w melanocytach. oba typy melanin nie są więc syntetyzowane jednocześnie.stalowy.. Do loci działających na poziomie tkankowym. REGULACJA NA POZIOMIE KOMÓRKOWYM Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów. Mutacje w tych loci wpływają wyraźnie na kolor oczu. U osobników typu dzikiego. wpływają bezpośrednio na ilość i typ wytwarzanej melaniny. E (Extension . Locus E (Extension) koduje przede wszystkim receptor MSH. nazywanych agouti. przez działanie na mechanizmy włączone w funkcję melanocytu. lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np. Locus D koduje strukturalne białko.niesieniu do myszy.pełna barwa). gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów. Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora. 166 .plamisty. pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. Locus ten kontroluje ilość eumelaniny. W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np. które działają na pigmentację ssaków na poziomie subkomórkowym.. A (Agouti — dziki).

wykazały. czyli wycinania intronów. której funkcja jest decydująca dla wytwarzania pigmentu. która prowadzi do wymiany cysteiny na tyrozynę. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny. 6-9 wkładka kolorowa). ale dotychczas nie stwierdzono. Locus C kontroluje liczbę i intensywność ziaren pigmentu. Historycznie był on uważany za locus strukturalny dla tyrozynazy. warunkujących umaszczenie himalajskie i szynszylowate. Specyficzna funkcja tego białka nie jest jeszcze poznana. ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową. Warunkiem ekspresji genów z tych loci jest 167 . czy pełnią one jakąś rolę (np. skórze i tęczówce oka. ale mechanizm działania tego genu dotąd nie jest znany. c (ryć. a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. natomiast inne geny regulują typ formowanego pigmentu. prowadząca do osłabienia funkcji enzymu. a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu). Tyrozynaza przejawia swą ekspresję w melanocytach. Wiadomo jednak. Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino. Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji. Takie białka nie są kompetentne katalitycznie. Badania poszczególnych mutacji w locus Albino u królików.Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm. gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka. B i E. Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny. że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. zmiany sensu i mutacje zmiany fazy odczytu. iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown. inhibitora) w melanocytach. Interesujące jest to. cch. jeszcze inne — sposób. ch. U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną. ale są to mutacje typu nonsens. która powoduje uwrażliwienie efektu fenotypowego na temperaturę. Mutacje w locus C powodują brak pigmentu we włosach. w jaki pigment ma być formowany. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. w którym występuje dominacja w następującej kolejności: C. Geny z locus C u królików tworzą szereg alleli wielokrotnych. Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A.

Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. Allel ten odpowiedzialny jest za eliminację eumelaniny. warunkujących różne odmiany umaszczenia. bez względu na to. u obu gatunków są dwa allele — E i Ed. W locus B również są dwa allele — dominujący B (czarny pigment) i b. u lisa polarnego jest rozcieńczona lub usunięta w ogóle. która z reguły zajmuje miejsce eumelaniny. w populacji lisa polarnego w Islandii). Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -.pigment czekoladowobrązowy. Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1. ale genotyp ten występuje bardzo rzadko (np. z wyjątkiem locus W. W locus E. We wszystkich tych loci. jak G. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie.genotyp gg. R. jakie są geny z innych loci. w układzie homozygotycznym -. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci. W. U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. Feomelanina. w tym przypadku kolor jest determinowany allelami z locus A. P. warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny. W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny. u lisa 168 . Lis polarny o genotypie aa jest czarny. S.oczywiście obecność odpowiednich genów z locus C. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny. Natomiast u lisa polarnego zamiast allelu A jest allel A".

. Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. Niestety dotychczas nie przeprowadzano badań molekularnych locus A. W (białopyski). W3 (biały Georgian) i W M (gen marble). Mutacje dominujące. umiejscowionym w chromosomie 18. że u bydła umaszczenie czarne. U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe. SJ i SH) i t (T).perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. recesywny allel e. opisanych w rozdziale: Mutacje. s (trzy allele: S. 169 . DD — niebieski). w układzie homozygotycznym mają efekt letalny. natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. są 3 allele: Ed warunkujący umaszczenie czarne dominujące. np. W locus W są następujące allele: w.srebrzystego: genotyp pp . jest homologiczny do allelu ES0 u myszy. złożonego z około 350 aminokwasów. oraz allel E+ umożliwiający ekspresję alleli z locus A. Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. Mutacja w locus s (Shadow) charakteryzuje się heterochromią. brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). melanocyte stimulating hormon receptor). będącego antagonistą białka MSH-R. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny. F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia). Locus E koduje syntezę białka MSH-R (ang. W locus tym. Allel dominujący Ed. a drugie brązowe. takie jak W i W. kodujący czarny kolor. W (platynowy). natomiast gen marble daje inny efekt fenotypowy u tych odmian. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a. natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. Allele z tego locus mogą wykazać ekspresję tylko wtedy. gdy w locus E jest genotyp E+_. natomiast allel a w układzie homozygotycznym — recesywne czarne. który w układzie homozygotycznym warunkuje umaszczenie czerwone. Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. Letalny jest także genotyp WW. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy. Locus A koduje syntezę białka. której skutkiem może być różny kolor oczu u tego samego osobnika. W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna. przy czym genotyp ww występuje u lisa rudego i srebrzystego. jedno oko niebieskie. Genetyczne podłoże umaszczenia u bydła Wyniki wielu badań sugerują. Allele te powstały w wyniku mutacji punktowych.

ale recesywny w stosunku do białego (I). belgijskie błękitne). bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. który dominuje nad s. natomiast u shorthornów jest odwrotnie. cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie. U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic. W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej. W tym samym locus u bydła tej rasy znajduje się allel Sc. a mała allelu e (czerwone umaszczenie). U ras bydła (np. Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego. warunkujący fenotyp nazwany colorsided — łaciaty. recesywny s — łaciatość. Na przykład. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica. Kolejność dominowania tych alleli jest następująca: E-Ep-e. ale jest recesywny w stosunku do allelu S. w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. locus I (biały dominujący) i locus Be (Belted opasany). U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe. poland-china i pietrain. także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey. Genetyczne podłoże umaszczenia u świń U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti). locus E (Extension). blisko telomerowego regionu ramienia p. W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a . Badania. obserwowana jest zmienność w ekspresji cechy łaciatości. Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire. mroziate). że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension.Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. odpowiedzialny za umaszczenie dominujące białe. Większość ras świń udomowionych ma allel recesywny a — nieagouti. powodując różne zaburzenia. W locus I są dwa główne allele: 7 (inhibicja koloru). Wśród 170 . Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8)..nieagouti. i allel i — recesywny (kolorowy). kora jest efektem plejotropowego oddziaływania allelu R na płodność. u których allel s jest utrwalony. wskazują. cornwall i hampshire. Podobnie jak u myszy i bydła. w których do analizy sprzężeń użyto ponad 230 markerów genetycznych. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę. iż locus ten jest umiejscowiony w chromosomie 6.

Genetyczne podłoże umaszczenia u koni Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony). jest kodowany przez allel Be w z locus Be. trzeciego allelu w locus Extension — ED). Locus I został zlokalizowany w chromosomie 8. allel dominujący E determinuje syntezę eumelaniny. zatem wystarczy jeden allel W. Wzory umaszczenia. D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. W locus C u koni nie występuje allel recesywny c. We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele. występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace. wykazujący niepełną dominację. wessex saddleback. dominujący w stosunku do jednolitego umaszczenia. I p (czarne łaty) oraz im (brudny szary). natomiast inne rasy są homozygotami recesywnymi (ii). Umaszczenie białe. w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. by było 171 . Locus E warunkuje wytwarzanie określonego rodzaju melaniny. Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. overo (O). ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. hannover-braunschweig. jak np.świń domowych dominujący biały jest przeważający. takie jak tobiano (TO). hampshire (ryć. 6-10 wkładka kolorowa). który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"'. W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. oznaczonych symbolem Id (deresz). Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. sabino (SB) czy tarantowate (LP). Allele z tego locus wpływają na ekspresję genów z locus A. są determinowane przez geny z innych loci. Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina). G (Gray — siwy) i RN (Roan — deresz). Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. Biały pas. charakterystyczny dla niektórych ras. Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus. siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały). cremello). Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita. Genotyp tego knura jest następujący: aa U EE BewBew.

który jest epistatyczny w stosunku do wszystkich alleli z innych loci. Genotypy w 7 loci. determinujące wybrane rodzaje umaszczenia koni. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_). z wyjątkiem allelu W. zestawiono w tabeli 6-II. Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny. który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny.umaszczenie białe). 172 . lethal white foal syndrome). Allel D z locus Dun wykazuje zupełną dominację. Allel G (w homo.i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub. Należą do nich allele dominujące z loci W. na skutek braku części jelita. w locus W mają genotyp homozygoty recesywnej (ww). znacznie rzadziej. Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina. O i RN.LWFS (ang. osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd). z wyjątkiem białego. Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" . Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww). wobec którego jest hipostatyczny. Natomiast umaszczenie siwe kontroluje allel dominujący z locus G. Wszystkie rodzaje umaszczenia.

Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. Badania specjalistyczne wykazały. Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. który w fenotypie ujawnia się ze zmienną intensywnością. podczas gdy feomelanina może być syntetyzowana. Niektóre allele z tego locus mają efekt plejotropowy. warunkuje białe umaszczenie owiec. natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. Owce biało umaszczone są zwykle prawie pozbawione pigmentu. inne wpływają na typ włókien. w których genotypach jest allel Awh. Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów. będący pierwszym w kolejności dominowania z szeregu alleli z tego locus. wzór koloru i obecność lub brak białych znaków. Allel A wh . Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała. od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. Przykładem tego jest brązowoczerwony kolor wełny karakułów. Brw — czekoladowobrązowej eumelaniny. 173 . że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu. czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina. 6-III).Genetyczne podłoże umaszczenia u owiec U owiec stwierdzono trzy typy pigmentu: czarna eumelanina. Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec.15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. bądź mieszaniny jasnych i ciemnych włókien wełny. np. warunkuje wytwarzanie czarnej eumelaniny. bądź też oba efekty występują łącznie. Allel typu dzikiego. Bw. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny. Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny. allel Awh zmniejsza płodność owiec o około 0. ale mogą mieć pigment tan. natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny. natomiast recesywny allel.

AwhAwh. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension. Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy). Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej.Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. recesywny. łaciate afgańskie) jest kontrolowane przez allel W a z locus White. Ew umożliwia normalną ekspresję alleli z locus Agouti. Allel typu dzikiego. z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS). natomiast homozygoty SSSS są całkowicie białe. Owce ras wełnistych. Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. Allel ten jest epistatyczny 174 . a także homozygotyczne białe. Umaszczenie białe dominujące (białe perskie. U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. ale epistatyczny do dominującej brązowej (tan).

w przypadkach krańcowych. Wrn. Na przykład. iż działanie genów może wywoływać różnorodne efekty. O penetracji całkowitej mówimy wówczas. Penetracja może być całkowita lub niezupełna. Natężenie drgań jest bardzo zróżnicowane. Penetracja i stopień ekspresji (ekspresywność) genów Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika. Inny allel z tego locus. Pierwsze z tych zjawisk określane jest jako penetracja genu. ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. mające taki sam genotyp. 6. Penetracja. gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów. że jego penetracja wynosi 80%. warunkuje dominującą szarość u karakułów. z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. mówimy o penetracji niezupełnej. natomiast drugie jako ekspresywność genu. inaczej określana jako przenikliwość. ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny.4.w stosunku do wszystkich innych genów umaszczenia. Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. jest to częstość. rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym. Penetracja określonego genu może być różna zależnie od płci. to mówimy. współdziałania tych genów między sobą oraz współdziałania ze środowiskiem. wykazują charakterystyczny dla niego fenotyp. inne zaś jej nie mają. która w formie homozygotycznej jest letalna. 175 . w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą. Stwierdzono to na podstawie wyników doświadczenia. kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy. Z drugiej strony. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. a nawet. Często zdarzają się przypadki. jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników. Natomiast jeśli nie wszystkie osobniki.

stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. Dziedziczenie pozajądrowe Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym. Pewność. a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. Zarówno stopień penetracji. że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki. geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji. a także położenie zarodka w macicy i nawet obecność innych płodów. w którym pojawiają się pierwsze objawy. Z kolei. sole mineralne oraz inne związki krążące we krwi. dziedziczą się różnie. że niektóre cechy nie podporządkowują się temu terminowi. Nie bez znaczenia jest stan zdrowotny matki. Należy jednak pamiętać o tym. Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością.5. Już na początku naszego stulecia zauważono. jak: wiek. a także chloroplas176 .Pojęcie stopień ekspresji (ekspresywność. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach. możemy mieć wtedy. Geny z różnych loci mogą dawać podobne fenotypy. Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne). docierające przez łożysko do rozwijającego się płodu). jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony. Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych. gdy jest ona obserwowana u osobników spokrewnionych ze sobą. Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. ujawniające się w różnym stopniu. które nie są dziedziczne. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. zależnie od kierunku krzyżowania. iż mamy do czynienia ze zmiennością przejawiania się tego samego genu. 6.

4. Powstał nowy termin dziedziczenie pozachromosomowe. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała. natomiast komórka jajowa ma ich około 100 tysięcy. Plemnik zawiera od 50 do 100 mitochondriów. u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca. analizowanego metodą RFLP. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je. +26 ±99 kg.9. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. inaczej pozajądrowe lub cytoplazmatyczne. może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. Jak dotąd. Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. Mitochondrialny DNA. w przeciwieństwie do DNA jądrowego. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały. średnią i niską wydajnością mleka. Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg. ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA. Przyczyną tego. O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje. w świetle wyników najnowszych badań. jest przekazywany następnemu pokoleniu wyłącznie przez matki. między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. Natomiast allele charakteryzujące się niską frekwencją (^ 0. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym.1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce. -879 ±114 kg mleka. iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0. której wartość zawiera się w granicach od 0.tach roślin wyjaśniło podłoże tego zjawiska. że warunkuje on od 2 do 10% zmienności tych cech.3 do 0. tli . Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika). W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA.

Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej. Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe.rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka. prowadzone za pomocą technik molekularnych (RFLP). wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu. Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła.Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności. Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA. . Stwierdzono bowiem istotny wpływ zamiany (tranzycji . U owiec badania mitochondrialnego DNA..

jeśli rozpatrujemy populację zwierząt. może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa). wydajność mleczna w kolejnych laktacjach).1. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza. 179 .Rozdział 7. które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np. Istnieje także zmienność grupowa. Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej. mamy do czynienia ze zmiennością wewnątrzosobniczą. Rodzaje zmienności i czynniki ją wywołujące Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników. Na zmienność fenotypową. W przypadku cech. czyli indywidualna. interakcja genotyp-środowisko. tzw. występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa). lub S2 w przypadku próby losowej pochodzącej z tej populacji. Zmienność oznaczamy symbolem S2. zwaną także ogólną.

w którego genotypie funkcjonuje jeden gen dominujący. Natomiast rekombinacje. są przyczyną powstawania różnych genotypów. ale różniące się pod względem założeń genetycznych (homo.i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu. innych układów w obrębie chromosomu lub między chromosomami. Głównymi składnikami zmienności genetycznej są: zmienność addytywna. Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów.Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie. odchylenie dominacyjne i odchylenie epistatyczne. Osobniki fenotypowo identyczne (bezrogie). Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych. Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą. Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. Poniższy schemat krzyżowania bydła obrazuje to odchylenie. Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest 180 . Mutacje prowadzą do powstawania nowych genów. Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym. i osobnikami homozygotycznymi — dominującym i recesywnym. które kontrolują występowanie danej cechy. ale także fenotypu (bezrogie i rogate). która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. Zmienność dominacyjna jest to część zmienności genetycznej.

których wartość wyrażana jest za pomocą liczb naturalnych. Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. upierzenie biafe).białe upierzenie kur rasy leghorn i whiterock. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych. Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży. Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. Do szacowania tego udziału stosowane są parametry genetyczne. Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało. do których należy odziedziczalność. warunkowanych zwykle jedną parą alleli. a zwłaszcza jej składnika — zmienności addytywnej. mających istotne znaczenie. np. Do czynników środowiskowych.). uzyskuje się mieszańce biało upierzone. genotypów i fenotypów w danej populacji (stadzie). Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny. Z krzyżowania osobników 0 białym upierzeniu. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. w zmienności fenotypowej danej cechy ilościowej. Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału 181 . Zmienność skokowa występuje również w przypadku pewnych cech ilościowych. czynniki klimatyczne) lub okresowo (żywienie. należących do tych ras. należy także efekt matki pre-i postnatalny. jak 1barwnie upierzone. W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów. Zmienność skokowa odnosi się przede wszystkim do cech jakościowych. sposób utrzymania itp. liczba prosiąt w miocie. dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami.

w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. a niektóre wartości powtarzają się. harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta). wydajność mleka w kilogramach. Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych. Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt.2. procentowa zawartość tłuszczu w mleku itp. ważona. 7. ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru: . Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np. Miary skupienia Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna. Średnia arytmetyczna nie odzwierciedla zmienności. 7. które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji). według wartości rosnących lub malejących (szereg statystyczny uporządkowany). którego elementami są poszczególne osobniki.2. zmierzyć) u wszystkich osobników stanowiących próbę. zwanej próbą. Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej. Jeśli liczba obserwacji jest duża. np. wysokość w kłębie w centymetrach.1. szereg rozdzielczy. W celu określenia zmienności cechy musimy ją oznaczyć (np. Miary zmienności Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników. dane zestawia się w tzw. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy.charakterystycznego dla danej cechy.

gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. np. a w trzeciej l kg. 7-1): Średnią ważoną obliczamy wówczas. Wzór na obliczanie średniej harmonicznej jest następujący: Przykład: Ważono mleko oddawane przez krowę w kolejnych minutach doju. Wzór na jej obliczanie jest następujący: Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu. w drugiej 2 kg. Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący. jaka była średnia szybkość oddawania mleka: 183 . do obliczania średniej prędkości. W pierwszej minucie uzyskano 4 kg mleka.Średnia arytmetyczna charakteryzuje się następującymi właściwościami: Przykład (dane z tab.

Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy. odbiega od rozkładu normalnego. gdy rozkład zmienności cechy jest asymetryczny. Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu. W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną: .Średnią geometryczną stosuje się wtedy. tzn.

0. standardowe odchylenie i współczynnik zmienności.2. w którym licznik jest sumą kwadratów odchyleń: Jeśli próbę stanowi mała liczba obserwacji. Wartości zlogarytmowane tego współczynnika wyniosły: 0. 185 . że najczęściej średnia arytmetyczna nie jest liczbą całkowitą.6518. 0. a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie)..3010. Wartość modalna (średnia modalna) jest to wartość cechy. natomiast ich suma = 0. ale przez N—1.1239. Wariancja nie może mieć wartości ujemnej. 0.2. ale podniesione do kwadratu. Miary rozproszenia Podstawowe miary rozproszenia to wariancja.0697.0294. Ma ona miano takie jak analizowana cecha. w celu ułatwienia obliczeń stosuje się wzór roboczy.0414. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną: Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1. w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji. 7.28. która najczęściej powtarza się w szeregu liczbowym. która dzieli szereg uporządkowany malejąco lub rosnąco na połowę. czyli 128%.0864. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji.Przykład: Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych. Wartość środkowa (mediana) jest to wartość cechy. Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej Biorąc pod uwagę. 0. 0.

Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru: gdzie: Współczynnik zmienności wyraża zmienność w procentach. Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt. Sposób obliczania miar rozproszenia przedstawiono niżej. a także zmienności tej samej cechy w różnych populacjach (np. wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji. Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). np.Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji. wykorzystując dane liczbowe zawarte w tabeli 7-1. Wariancja: . Dobór zwierząt do grup doświadczalnych powinien być losowy. tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona. dotyczące masy ciała owiec w wieku 10 miesięcy.

3. zwiększające wartość cechy). addytywnymi lub kumulatywnymi. nazywane inaczej genami polimerycznymi. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie. które skupiają się wokół wartości średniej. natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. Zagadnienie to obrazuje przykład. niosącymi 120 jaj rocznie. czyli obojętne dla wartości cechy.1. Założono również. Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny).3. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc). Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. Przyjmuje się. Kolejnym założeniem jest to. uzyskano 64 genotypy. że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy. w którym hipotetycznie przyjęto. warunkujące 7 poziomów nieśności (fenotypów tej cechy). Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych. że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. Poligeny. U potomstwa w pokoleniu F2 nastąpiło rozszczepienie. mające założenia genetyczne warunkujące nieśność 240 jaj rocznie. czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. specyficznie ze sobą współdziałają.7. że każdy poligen ma dwa allele. a drugi neutralne. że efekty genów A. skrzyżowano z kurami o genotypach aabbcc. Koguty o genotypach AABBCC. B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. Dziedziczenie cech ilościowych Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. Zmienność cech ilościowych 7. że nieśność kur warunkowana jest trzema parami alleli z różnych loci. Najczęściej występują genotypy warunkujące wartości fenotypowe cechy. Zakłada się. natomiast zmniejsza się częstość występowania form skrajnych. Liczba poligenów kontrolujących cechy ilościowe jest nieznana. uzyskujemy przedstawiony niżej obraz graficzny: 187 . pomiędzy którymi zachodzi dziedziczenie pośrednie. Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej. przy czym jeden z nich ma działanie pozytywne (tzn.

Po zestawieniu wartości fenotypowych cechy. w którym jest średnia wartość cechy. poniżej i powyżej średniej. że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej. determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy: W podanym przykładzie celowo pominięto wpływ czynników środowiskowych. zwana krzywą Gaussa. Znaczenie tych czynników jest istotne. • rozkład ten jest symetryczny. gdyż zacierają one różnice między fenotypami. 188 . Rozkład normalny charakteryzuje się tym. co w przypadku cech ilościowych o zmienności ciągłej powoduje. a najmniej skrajne wartości. a oś symetrii przechodzi przez punkt. iż: • jest to rozkład.

Jak już wspomniano. 7. • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny). 95. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np. rasy. Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. procent tłuszczu w mleku oraz wartość energetyczną mleka.6% wszystkich obserwacji cechy.3. Zmienność transgresywna Zwierzęta gospodarskie. 99. U trzody chlewnej. wielkości matki oraz jej stanu fizjologicznego i zdrowotnego. co wartość średniej arytmetycznej. nawet ras o ustalonym genotypie. a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. maternal effect). ilości substancji odżywczych dostarczanych płodowi (lub płodom). • w przedziale x±S znajduje się ok. stwierdzono. Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym. omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech). a także wielu czynników środowiskowych. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy. 68.2% wszystkich obserwacji. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189 . Wielkość efektu matki prę. behawior matczyny). na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. Mogą one maskować oddziaływanie poligenów. Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw. Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka. Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów.2.• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie. na przykład. • w przedziale x±3 S znajduje się ok. jak i mitochondrialnym DNA. • w przedziale x ±2 S znajduje się ok. wpływ matki na potomstwo jest większy od wpływu ojcowskiego.i postnatalnego zależy od gatunku. dziedziczenie pozajądrowe.4% wszystkich obserwacji. że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang. są heterozygotyczne pod względem znacznej liczby loci. z innych ras).

W badaniach prowadzonych na simentalerach stwierdzono. Geny o dużym efekcie W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka). Ilustruje je przykład: Załóżmy. Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna. której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty. Gen o dużym efekcie jest identyfikowany wówczas. genotyp DDEEFF. Zjawisko to nosi nazwę transgresji. w którym obok poligenów działa gen o dużym efekcie. W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot). bądź wartości wyższe lub niższe niż u rodziców. warunkujące różną wydajność mleczną. quantitative trait locus). U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25). Jest to wynikiem dziedziczenia. E i F. Efekty genów D. gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie.3. czyli wykazujące większą zmienność cechy. E i F są identyczne (D = E = F). growth hormone). wykorzystywanej w pracy hodowlanej. równą wartości cechy u rodziców.wartości cechy takie. zwany inaczej genem głównym. Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang. Genotyp ddeeff warunkuje wydajność 2400 kg mleka. spłaszczony albo nadmiernie uwypuklony. Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy. a każdy z nich zwiększa produkcję mleka o 400 kg. iż zwierzęta homozygotyczne pod względem allelu B hormonu 190 . W przypadku niektórych cech zaobserwowano zmienność. Niektóre geny o dużym efekcie zostały wykryte przypadkowo. natomiast heterozygotyczny DdEeFf— 3600 kg mleka. Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. DDEEFF — 4800 kg. że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D. Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej. Cechy takie charakteryzują się rozkładem normalnym. jakie obserwowano u rodziców. 7.3.

Dotychczas wykazano. Hormon wzrostu reguluje rozwój mięśni. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej. będących nosicielami zmutowanego allelu. Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt.5. Zwierzęta takie są więc dobrym materiałem do tuczu. a najnowsze osiągnięcia są omówione w rozdziale 12. powodowane transportem.wzrostu charakteryzowały się o 382 + 18. iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe. Dalsze badania zmierzają do ustalenia. W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka.3. iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe). Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie. Gen receptora rianodyny (KYR1). Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych. 191 . prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. Badania cytogenetyczne wykazały. jak karłowatość i akromegalia. a IGF-1 wspomaga jego działanie. iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu. jak zawartość mięsa w tuszy i powierzchnia oka polędwicy.5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA. Świnie U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie. Stwierdzono także. bydła i szczura. Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni. które allele mają związek z użytkowością mięsną. porcine stress syndrome). warunkami termicznymi i niektórymi czynnikami chemicznymi. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. z równoczesnym zmniejszeniem otłuszczenia. Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną. a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu. Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena.

fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. Procedurę tego testu przedstawiono na rycinie 7-1. jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki. że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1). W innym. natomiast w zmutowanym 192 . powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. z których najistotniejsza jest mutacja w 1843 nukleotydzie. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI). opatentowanym przez badaczy kanadyjskich.Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan. początkowo oznaczono go symbolem Haln. Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. co umożliwiło opracowanie molekularnych testów diagnostycznych. Badania przeprowadzone przez naukowców kanadyjskich wykazały. Mutacja ta likwiduje miejsce trawienia niektórymi enzymami. W obrębie genu RYR1 stwierdzono 18 mutacji punktowych.

allelu zmiana tej sekwencji powoduje. powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym. iż zlokalizowany w chromosomie l (1p2. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19. Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi. 32 pz. że jeden z alleli tego genu.5-2. pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie 193 . estrogen receptor gene) może mieć istotny wpływ na wielkość miotu.jeden prążek długości 81 pz.4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3).. U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce). Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością. warunkuje cechę kwaśnego mięsa. wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę. Test molekularny wykrywający mutację genu PRKAG3 został opatentowany. występujący w chińskiej plennej rasie meishan. W pracy hodowlanej należy prowadzić kojarzenia tak. W genie tym stwierdzono siedem mutacji. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy.4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. duroc). u bydła w 18. a u koni w 10 chromosomie. by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych. yorkshire. czego wynikiem jest uzyskanie nie strawionego fragmentu genu. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz. Wyniki tych badań wskazują. Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1. prowadzone u świń innych ras (niemiecka landrace. Pierwsze sugestie co do istnienia genu o dużym efekcie. Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. natomiast dla heterozygoty trzy prążki: 81 pz. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu. że enzym nie znajduje miejsca cięcia. dla homozygotycznego (nn) . Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). ale tylko tranzycja G-»A w kodonie 200. Stwierdzono. wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. Gen wpływający na wielkość miotu (ESR). 49 pz.

jak wzrost i grubość słoniny na grzbiecie. W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. Bydło Geny białek mleka. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń. gdyż określony wariant tego białka. identyfikowanych w mleku córek. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka. 7-2). Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. Białko wariantu A różni się od B dwoma aminokwasami. ekonomicznie ważne cechy. wyprowadzanych z udziałem rasy meishan. Gen β-laktoglobuliny ma długość około 7800 par zasad. wykorzystywanych jako dodatkowe kryterium selekcji buhajów. Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy. tłuszczu i kazein oraz lepszą przydatnością technologiczną. W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC). Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny.1754). przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. zlokalizowany w chromosomie 6. Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. zawiera 7 eksonów. utrzymywanych w zakładach unasieniania. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII. Gen κ-kazeiny. Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT). natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć. Gen β-laktoglobuliny uważany jest za gen o dużym efekcie. białka i tłuszczu). wariant A alaninę (GCT). podczas gdy w wariancie B — treonina (w DNA kodon ACC). podobnie jak κ-kazeiny. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. Opracowana została metoda identyfikacji genotypów κ-kazeiny. Gen ten nie wykazuje plejotropowego negatywnego działania na inne. wpływa na wydajność mleka i jego składników. Jest to konsekwencja różnic w sekwencji nukleo- 194 .

a — marker. 2 — trawienie enzymem restrykcyjnym Hindlll tydowej obu alleli. b — produkt nie strawiony.AB AA BB Ryć. mniejszy obwód i masa jąder. transforming growth factor β). Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa. zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi. jak i ich mieszańców. l — trawienie enzymem restrykcyjnym Hinfi. natomiast u krów dłuższa ciąża. Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras. spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej. jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). Duża masa płodu stwarza wyraźne trudności naturalnego porodu. dlatego mutacja ta jest oznaczona jako nt821(del11). Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne. Rozwiązaniem 195 . Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. Gen hipertrofii mięśniowej (MH — ang. należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci. muscular hypertrophy). Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2. Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem. Gen miostatyny należy do rodziny TGFβ (ang. 7-2.

Ostatnio ustalono. b) tranzycja C→T w 610 nukleotydzie.pośladki) -. Gen CLPG pochodzący od matki jest nieaktywny. że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. Owce Gen hipertrofii mięśniowej (CLPG). noncoding RNA). takie jak gen Inverdale (FecXI. Mutacje a) i c) występują u bydła francuskiego maine-anjou. b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia. Pomimo ujemnych następstw związanych z hipertrofią mięśni. że istnieją dwa allele — CLPG i clpg. natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. czy gen CLPG pochodzi od ojca. gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). pyge -. Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. U owiec występuje mutacja powodująca hipertrofię mięśniową. Hipertrofia ujawnia się u potomka wówczas. że locus ten podlega transkrypcji. Przypuszcza się. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. począwszy od pozycji 419 nukleotydu. Jak wykazały ostatnie badania. zlokalizowany w chromosomie płci X) 196 . 7-3 wkładka kolorowa). Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji. a jego produkt to niekodujący RNA (ncRNA ang. które uszkadzają funkcję kodowanego białka. warunkujące zwiększony stopień owulacji. cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. U owiec wykryto geny główne.ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. nazwany callipyge (z greckiego calli — piękne. który pełni nieznaną jeszcze funkcję regulacyjną. c) transwersja G → T w nukleotydzie 676. Co ciekawe. Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. Przypuszcza się. Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. która jest odpowiedzialna za substytucję cysteiny przez tyrozynę. mutacje te są charakterystyczne dla określonych ras bydła mięsnego. która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy.symbol CLPG. Jest to pojedynczy autosomalny gen. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów. w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego. czy od matki. Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938. Prowadzone są badania w celu jego izolacji.

owca fińska). Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB. . której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego. Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB. uwarunkowaną genami o addytywnym efekcie. W locus BMPR-IB wykryto mutację w 830 nukleotydzie. będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego. że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. odpowiedzialnej za dużą plenność owiec rasy merynos booroola. wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz. w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. W przeciwieństwie do owiec ras wysokopiennych (owca romanowska. fecundity gene of booroola). połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II). „Thoka" u owiec islandskich. u których zwiększona plenność jest cechą poligeniczną. wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie). trzy prążki (110 pz. Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych. Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to. zawierającego miejsce mutacyjne.u owiec rasy romney. Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80. gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. polegającą na tranzycji adeniny na guaninę. produkt PCR nie strawiony) dla homozygoty typu dzikiego. ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang.

lecz zbiorowości określonej jako populacja. Prawo równowagi genetycznej Struktura genetyczna populacji Populację tworzy określona.Rozdział Podstawy genetyki populacji Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia. w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki. Ponieważ badacze ci działali niezależnie od siebie. 8. Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników. opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów. jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G. prawo to nosi nazwę Hardy' ego-Weinberga. teoretycznie nieskończona liczba osobników. Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową. że każdy osobnik ma określony fenotyp. tak więc w populacji występuje określona liczba fenotypów. Hardy'ego i niemieckego lekarza W. Rozpatrując daną cechę można powiedzieć. 198 . Hodowla jest działalnością genetyczno-populacyjną.H. Weinberga. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej.1. Podstawowym prawem genetyki populacji. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. mogące się rozmnażać i występować na danym obszarze. Populację stanowią zwierzęta należące do jednego gatunku. mimo iż dotyczyły nieraz grupy zwierząt.

Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów. Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). Zatem w stadzie tym jest 1000 alleli A i 1000 a. 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim). Częstość występowania. 250 ptaków czarnych ma w swych genotypach 500 genów A. Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego. ptaki niebieskie mają 500 genów A i 500 genów a. Oba te elementy są od siebie zależne. Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca: Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków. każdy ma dwa allele).z których każdy reprezentowany jest przez pewną liczbę osobników. natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). Suma frekwencji wszystkich fenotypów równa się l lub 100%. Jeśli frekwencję allelu dominującego oznaczymy symbolem p. to: 199 .5 (50%). inaczej frekwencja danego fenotypu. a allelu recesywnego symbolem q.5 (50%). oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. Sposób postępowania obrazuje poniższy przykład. które ten allel mógłby zająć w badanej populacji. podobnie frekwencja allelu a = 1000/2000 = 0. Suma frekwencji obu alleli wynosi l (100%). Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci. Częstość występowania (frekwencja) allelu A = 1000/2000 = 0. Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu. Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów. W genotypach 250 ptaków białych jest 500 alleli a.

200 . Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga. bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci. wówczas struktura genetyczna w pokoleniu potomnym będzie następująca: czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. w której frekwencje genów u obu płci są jednakowe. które wpływają na zmianę struktury genetycznej populacji. które mówi o tym. że: w dużej. a' zdarzają się również migracje i mutacje. zatem rozkład fenotypów i genotypów w tej populacji wynosi: Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie. jeśli nie działają czynniki naruszające równowagę.Rozpatrywana cecha dziedziczy się z niezupełną dominacją. a osobniki charakteryzują się równą płodnością i żywotnością. O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej. losowo kojarzącej się populacji. Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci.

3 = 0.2. a 90 czerwonych. 8. Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q.7.09.3. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0. że zawierają jedynie allele recesywne. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych. Wiedząc.8. W stadzie tym prowadzone są kojarzenia losowe. że w przypadku losowych kojarzeń rozkład genotypów jest następujący: łatwo jest obliczyć frekwencję pozostałych genotypów: W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot.(EdEd) lub heterozygotyczne (Ede). że frekwencja homozygot recesywnych wynosi q2. jak i genów stwarza pewne trudności. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący: 201 . która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0. gdyż w ich przypadku wiadomo na pewno. Pozostałe 910 krów ma genotypy homo. łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q. Frekwencja genów i genotypów w przypadku dominowania W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej. Zatem obliczanie frekwencji zarówno tych genotypów. Wiedząc.

W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa). U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C. fenotypy. W populacji tej. genotypy i ich frekwencja są następujące (tab. Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli.q. himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc). q dla genu dla genu c. r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. Frekwencja poszczególnych fenotypów wynosi zatem: Frekwencję genów oznaczono symbolem p dla genu C. 13 himalajskich i 2 albinosy.przy czym p. w której są kojarzenia losowe. Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). 8-1): 202 .

Po dodaniu takich samych genotypów uzyska się rozkład: Z zestawienia tego wynika. W danym przykładzie r2 = 0. (q + r) równa się: Frekwencję genu c = r można obliczyć. że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi: Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego.013. stąd r = = 0. Frekwencję genu można obliczyć następująco: W badanej populacji królików frekwencja genów umaszczenia jest więc następująca: 203 .114. Podstawiając dane liczbowe. znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc).

000 8. natomiast a — jego recesywnym allelem.ogółem = 1. U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi: U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu: 204 . Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych. lecz przyjmie postać: przy czym A jest genem dominującym. który ją warunkuje). geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej.4. Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu. Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym. U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). jak i u mężczyzn. czyli zgodna z rozkładem dwumianowym. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych.08. których liczba w genotypach jest jednakowa bez względu na płeć osobnika. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0. U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm.

92 d. Ekspresja fenotypowa mutacji. powodująca pojawienie się nowej barwy okrywy włosowej. Wszystkie te czynniki. o tyle pozostałe czynniki są związane z jego świadomą działalnością. Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie: 205 . Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u. ale także mogą się pojawić nowe allele. kontrolujących cechę ilościową. O ile mutacje i dryf genetyczny nie zależą od hodowcy. Jeśli zmutuje allel dominujący.D. 8. pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD). ale będą nosicielkami genu daltonizmu (Dd). umaszczenie zwierząt futerkowych. 1472 kobiety będą rozróżniały barwy. Natomiast mutacja genu warunkującego cechę jakościową. Czynniki naruszające równowagę genetyczną Do czynników naruszających równowagę genetyczną populacji należą: mutacje. W rozdziale dotyczącym mutacji podano. może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji.5. mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq. dobór par do kojarzeń i dryf genetyczny. z wyjątkiem doboru. zależy od genetycznego uwarunkowania danej cechy.08 Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64. Mutacje Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. selekcja. natomiast częstość mutacji odwrotnej symbolem v. W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ). migracje. Analogicznie. Jeśli zmutuje jeden z genów addytywnych. wpływają na zmianę frekwencji genów i genotypów. która może wpłynąć na zmianę struktury genetycznej populacji. w której mutacja wystąpiła. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus.= p = 0. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej). jego frekwencja zmaleje o wartość równą up. pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ).= q = 0. mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji. np.

Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0. zatem migracja nie zawsze wiąże się z wprowadzaniem osobników. Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji) 206 . powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. W wyniku mutacji genowej.1156.34. W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja. może ona dotyczyć wprowadzania nasienia. wielkość zmian frekwencji genów i genotypów jest różna. ee = q2 = 0. a 6 alleli e w kierunku allelu Ed. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. Zmianie uległa także frekwencja genotypów.7.4488. po pewnym czasie populacja wróci do równowagi. allelu czerwonego umaszczenia e = q = 0. które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną.14 alleli Ed zmutowało w kierunku allelu e. krzyżowanie wypierające). czyli ustali się nowy układ genetyczny. po mutacji: EdEd = p2 = 0. Migracje Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia. Ede = 2pq = 0.09. w przypadku wielokrotnego krzyżowania.3. Natomiast krzyżowanie uszlachetniające. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0. Może nawet. Jeśli jest to zabieg jednorazowy.49. ee = q = 0. Ede = 2pq = 0.4356. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji.42. Przy krzyżowaniu różnych ras w zależności od tego. doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów.66. i wyniosła 0. natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0. ile razy dokonywane jest to krzyżowanie.1.

01. zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0. w którym frekwencja allelu Ed wynosiła 0.74 czyli wzrosła o 0. zmalała osobników heterozygotycznyh Ede i homozygotycznych ee. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0. nazywany jest selekcją. Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy.9 + (l -0. które hodowca zamierza pozostawić do hodowli.2 • 0.2) • 0. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej. obniżenia płodności i produkcyjności lub niepożądanego genotypu. ee = q= 0. Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p.74) = 0. E d e = 2pq = 0.18.oznaczymy literą m.26. a frekwencję genu u osobników wprowadzonych do stada literą p'. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji. ee = q2 = 0.7 = 0. że do omawianego wcześniej stada liczącego 100 krów.9. Ede = 2pq = 0. to część osobników rodzimych będzie równa (1 —m).4. z frekwencją allelu Ed wynoszącą 0. a eliminuje z populacji zwierząt geny niepożądane. stanu zdrowotnego. Nowa frekwencja allelu e wynosi (1 — 0.49.0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd.3848. wprowadzono 20 krów.81. Selekcja Wybór zwierząt. ee = q = 0.7. E'e = 2pq = 0. Zmiany w strukturze genetycznej populacji zależą od tego. jakie geny czy genotypy są preferowane.09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0. Hodowca preferuje geny korzystne.42. 207 .5476. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku.

można obliczyć ze Jeśli natomiast selekcja preferuje genotyp recesywny. że w omawianym już wcześniej stadzie kur andaluzyjskich. wartość l współczynnik osiąga. w którym frekwencja allelu bezrożności wynosi 0. Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji.4. Efekt selekcji zostanie zachowany. Jeśli współczynnik selekcji będzie wynosić 0. że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. W pewnym stadzie. będąca konsekwencją selekcji. Załóżmy. co oznacza.187. Zmiana frekwencji genu. Cecha ta dziedziczy się z dominacją zupełną. zastosowano kojarzenia w obrębie takich samych 208 . gdy nie ma w ogóle selekcji.Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie. Współczynnik ten może przybierać wartość od O do l. czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled). to oznacza. prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. Dobór par do kojarzeń W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe. że wartość O jest wówczas.013 i wyniesie 0. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym. gdy usuwane są wszystkie niepożądane genotypy. wówczas frekwencja genu tworzącego ten genotyp wyniesie: wzoru: Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną. złożonym z 1000 ptaków.8. zależy od rodzaju tej selekcji. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego: Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0. zmianę częstości genu recesywnego. prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. będącą jej konsekwencją.

stado powróci do stanu równowagi genetycznej. stosowane są kojarzenia osobników spokrewnionych. Aby się o tym przekonać.5 (allel A) i q = 0. maleje natomiast częstość genotypów heterozygotycznych. ojca z córką czy matki z synem.25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie Frekwencja genów pozostała nie zmieniona. W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0. Odwrotna sytuacja zaistniałaby.genotypów. Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych. pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt. Oznacza to. na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji. Niekiedy. W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej 209 . Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych.5 Aa + 0. koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi. można przeprowadzić obliczenia: Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji.5 (allel a). np.25 AA + 0. iż kojarzono koguty czarne z kurami czarnymi. W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0. gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami.

Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego. Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać. Jeśli było to jednorazowe zaburzenie.brat x siostra) prowadzą do wytworzenia tzw. Może jednak się zdarzyć tak. Dryf genetyczny Dryf genetyczny. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210 . to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach. szczególnie niebezpieczny może być wzrost homozygot recesywnych.6. polega na zmianie frekwencji genów i genotypów w małych populacjach. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus. którego skutkiem będzie zmniejszenie płodności. że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych. w których stopień homozygotyczności jest bliski 100%. iż w potomstwie uzyskamy 5 osobników homozygot dominujących. która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. zjawisko tak nazwane przez Wrighta w 1931 roku. w których działa on najsilniej. iż allele niekorzystne z reguły są recesywne. Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. żywotności czy ujawnienie się wad dziedzicznych. to w następnym pokoleniu ustali się nowa równowaga genetyczna. Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać. Im większa jest pula genów w jakiejś populacji. szczepów wsobnych. Biorąc pod uwagę. w której frekwencja genu dominującego wyraźnie wzrośnie. jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej. 8. Szczepy wsobne są wykorzystywane w badaniach biomedycznych. zwłaszcza w małych populacjach. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt.

i mikrosatelitarny. na przykład warunkujących antygeny erytrocytarne. esterazy. Na skutek długotrwałej selekcji. które zachodzą w wyniku pracy hodowlanej. amylazy.wych. ceruloplazminy czy anhydrazy węglanowej. Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności. By temu niekorzystnemu zjawisku zapobiec. opisanych w rozdziale: Markery genetyczne. należące do markerów genetycznych klasy I. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych. zwłaszcza w małych populacjach. różne typy białek surowicy krwi czy enzymy erytrocytarne. można także przedstawiać ją w procentach. czego wynikiem będzie utrata zdolności adaptacyjnych. Mogą to być loci kontrolujące syntezę transferyny. zalecane jest monitorowanie zmian w strukturze genetycznej populacji. czyli markery genetyczne klasy II). może dojść do znacznego ograniczenia puli genów. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru: 211 . Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini. albuminy. Wartość tego parametru zawiera się w granicach od O do l.

single linkage method). By obliczyć wartość PIĆ. O markerach genetycznych jest mowa w innym rozdziale. które cechuje duża zmienność genetyczna. jak i polimorfizmu białek i antygenów erytrocytarnych. obliczonych różnymi metodami. Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci. najdalszego sąsiedztwa — CLM (ang. tak na podstawie polimorfizmu sekwencji mikrosatelitarnych. unweighted pair group method). complete linkage method) lub skupienia parami — UPGM (ang. 212 . Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi. polymorphic Information content). Szacowanie dystansu genetycznego i wybór ras. należy znać frekwencję wszystkich alleli w danym locus: Dystans genetyczny Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw.Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. a także między populacjami w obrębie gatunku. na przykład: najbliższego sąsiedztwa — SLM (ang. dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. Do szacowania dystansu genetycznego (Dr). najczęściej stosowany jest wzór: Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich.

Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM. 8-1). Na przykład. Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych. Prace i Materiały Zootechniczne. 146 z linii Partnera i 202 z linii Bandosa. 369 z linii Probata. 219 z linii Palasa.32. Analizą objęto 141 koni z linii El Paso.39 oraz Palasa a Partnera 0. 50:111-120. 146 z linii Celebesa. a także między linią Banata a Celebesa i Probata. Partnera a Banata 0. Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III. Palasa a Partnera.37 (ryć.Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp. najmniejszy między linią Celebesa a Probata. 1997).. 213 . wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0. Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa. 150 z linii Banata.

.

Im mniejsza zmienność genetyczna w danej populacji. odcisk palca DNA. wykorzystując wzór: gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1.Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne). a także metodę RAPD. W wyniku analizy polimorfizmu minisatelitarnego (tzw.ang. band sharing). W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej. opisaną w rozdziale: Metody analizy i modyfikacji genomu. . określający prawdopodobieństwo. opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji). że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA. tym większa wartość tego współczynnika. Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS .

Zwierzęta takie są zazwyczaj obojnakami. czyli zmieniają one płeć w ciągu życia. głównie temperatury. które są hermafrodytami sekwencyjnymi.1. Z kolei u niektórych gatunków ryb zachodzi tzw. U ssaków płcią heterogametyczną są samce (układ XY). płeć chromosomowa. a płcią homogametyczną są samice (układ XX). wielu gatunków żółwi i niektórych gatunków jaszczurek. W przypadku ssaków wyróżnia się chromosomy X oraz Y. Płeć może zależeć od warunków środowiska zewnętrznego. płci gonadowej i 3) uformowanie się wewnętrznych 216 . 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. Wśród ryb spotyka się również gatunki. a w przypadku ptaków Z oraz W. 9. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. Determinacja płci ssaków Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw. w tym u wszystkich krokodyli. tzn. a samice heterogametyczne (układ Z W). mają gonady męskie i żeńskie. Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie. behawioralna determinacji płci. U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci. Ten typ determinacji płci obserwuje się u wielu gatunków gadów. w jakich rozwijają się zarodki. U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ).Rozdział 9 Determinacja i różnicowanie płci oraz interseksualizm Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów.

W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe. 217 . a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym. Pojawiają się one w endodermie pęcherzyka żółtkowego. które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego. 9-1). Pleć fenotypowa obejmuje również zmiany powstające w mózgu. Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. pici fenotypowej (ryć.i zewnętrznych cech płciowych — powstanie tzw.

że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów. 9-2). Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. SOX9. że pełnią funkcję czynników transkrypcyjnych. także w niezróżnicowanej gonadzie. SF1. Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. a w tym: WT1. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. ZFX i FOXL2. przełączenie rozwojowe. steroidogenic factor 1) koduje białko receptora jądrowego. że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y. że jest tam zlokalizowany gen TDF (ang. SRY. 218 . W rosnącej gonadzie wyróżnia się część korową i rdzeniową. testis determining factor) — czynnik determinujący jądro. a część korowa w jajniku. W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). palce cynkowe. Białko kodowane przez ten gen składa się z trzech regionów (ryć. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra. oprócz kory nadnerczy. którego locus występuje w chromosomie Y. że funkcja tego genu jest tożsama z funkcją genu SRY (ang. Od końca lat 50. Produkt tego genu miał odpowiadać za tzw. Badania cytogenetyczne prowadzone u ludzi dowiodły. Przyjęto. sex determining region Y). Gen WT2 (ang. polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej. podobnie jak białko SRY. gdzie obserwuje się zanik jego ekspresji. że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. Gen ten podlega ekspresji. do grupy białek określanych skrótem HMG (ang. Gen SF1 (ang.Dotychczasowe badania wykazały. wiadomo było. czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. Wiadomo o nich. W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi. high mobility group). które pełni rolę czynnika transkrypcyjnego. Produktem tego genu jest białko zawierające tzw. Fgf9. w przeciwieństwie do jajnika. Badania molekularne pokazały. regulującego ekspresję hydroksylaz steroidowych. którego produkt należy. Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9.

również położonemu w chromosomie X. odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron. w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1. oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). po pojawieniu się produktu genu SRY. odpowiada za prawidłowe różnicowanie się gonady męskiej. w momencie kiedy rozpoczyna się proces formowania gonady męskiej. wysepka CpG). że jego locus występuje w chromosomie X. Z testosteronu powstaje dihydrotestosteron. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. Obecnie większą rolę przypisuje się genowi ZFX (tzw. Gdy gen SRY jest nieobecny. Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. pełni funkcję czynnika transkrypcyjnego. a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9). czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. Białko SRY. a drugi rozwija się. który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. omówiony wcześniej. Początkowo przypuszczano. a z przewodów Miillera — jajowody i macica. że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9. Kaskadowe włączanie tych genów. tak jak białka WT1 i SOX9. Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej). Bardziej szczegółowe dane wskazują. Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika. które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego. Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. Z przewodów Wolffa rozwinąć się mogą nasieniowody. anti-Mullerian hormone — AMH). Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać. ma strukturę podobną do białek z grupy HMG. określanego także jako hormon antymiillerowski (ang. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. aniżeli w odniesieniu do jądra. Ekspresja tego genu zachodzi w komórkach Sertolego. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza. W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu 219 . Miillerian inhibitor substance). gen palca cynkowego). Bardzo ciekawe jest również to.Region środkowy. składający się z 79 aminokwasów. a jego produktem jest jądrowy receptor dla hormonów. Wiadomo. który podtrzymuje rozwój przewodów Wolffa. niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik.

np. oznaczających czynnik odpowiedzialny za powstanie azoospermii. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro). że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa. Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy. Znane są też geny położone w innych częściach chromosomu Y. w których genotypie występuje duplikacja locus DSS (DAX1). Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci. to rozwój w kierunku męskim nie jest zakłócony. że w chromosomie Y poza genem SRY. np. który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej. Zakłada się. gen RBM (ang. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. czy też klonowania. RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. W regionie tym występują geny. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. Jeśli w genotypie wystąpi delecja tego locus. splicing) mRNA.kodującego testosteron. Jego nazwa pochodzi od słów angielskich azoospermia factor. samic biorczyń. czyli brak plemników w ejakulacie. lub do zahamowania podziału mejotycznego. Należy również zwrócić uwagę. występują także inne geny. macicę i górną część pochwy. z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X. Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY. gen Ube1Y (ang. Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1). to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. 220 . takich jak całkowity brak spermatogoniów. W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody. Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). których ekspresja związana jest z przebiegiem spermatogenezy. Szczególnie istotną częścią chromosomu Y jest region AZF. Gen ten umiejscowiony jest w obu chromosomach płci.

to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony.2. ze względu na bardzo duże zróżnicownie obserwowanych zmian.ubiąuitin activating enzyme-1). że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. głównie przeżuwaczy. które określa się terminem interseksualizmu lub obojnactwa. często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy. w którym kształtują się jajniki. Z przedstawionych wyżej informacji można wyciągnąć wniosek. Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów. Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy. Frymartynizm Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych. to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci 221 . kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. w którym powstały połączenia naczyniowe. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian. W rozwoju embrionalnym różnicowanie się jąder poprzedza okres. frymartynizm). który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach. Połączenie krwiobiegów bliźniąt różnopłciowych sprawia. 9. co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników. Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego. Jeśli połączenie łożysk dotyczy płodów różnopłciowych. że informacja genetyczna zawarta w chromosomie Y jest bogatsza. Interseksualizm Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego. co w konsekwencji prowadzi prawie zawsze do niepłodności. kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych. niż to wcześniej zakładano.

że prawie we wszystkich przypadkach.żeńskiej w takim stopniu. niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych. Możliwe jest również powstanie połączeń. że rozwinie się nawet gonada męska. że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy. a w ślad za tym drogi płciowe będą miały charakter męski. a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. Z tego powodu we krwi frymartynów.) są często obniżone. a często u owiec (od 40 do blisko 100% ciąż. proces kształtowania się zewnętrznych narządów płciowych. szczególnie wówczas. obraz nasienia. przy jednoczesnym ich braku np. Bardzo pomocne okazało się badanie cytogenetyczne. które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. Powstawanie anastomoz jest bardzo często stwierdzane u bydła. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy. może zakłócić. w komórkach błony śluzowej. a w drugiej układ XY. sekwencje mikrosatelitarne). stwierdza się niepłodność samic frymartynów. Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych. a także samców będących bliźniętami frymartynów. polegające na ustaleniu zestawu chromosomów płci w leukocytach. stwierdza się obecność dwóch linii komórkowych — jednej własnej. wskaźnik niepowtarzalności rui itp. to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. Buhaje takie mogą być wykorzystywane w rozrodzie. Szacuje się. Biorąc jednak pod uwagę. w mniejszym lub większym zakresie. że badany osobnik jest frymartynem. Ponieważ linie te pochodzą od dwóch różnych genotypów. Identyfikacja sekwencji typowych dla chromosomu Y (np. Ze względu na wspólną cyrkulację krwi u płodów. których łożyska są połączone anastomozami. w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę. że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż). zależnie od 222 . Znacznie rzadziej zdarza się to u owiec (od l do 10%. że badania kliniczne samic są niewystarczające. może być wskazówką. Chimeryzm dotyczy również erytrocytów. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. powstający z wydzielanego przez komórki Leydiga testosteronu. ale także molekularnych (np. Wówczas dihydrotestosteron. Okazuje się. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych. Trzeba podkreślić. Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo. dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie. zależnie od rasy). Linie te różnią się układem chromosomów płci — w jednej występuje układ XX. a drugiej współbłiźniaka. gdy zewnętrzne narządy płciowe są prawidłowo uformowane. chociaż parametry określające ich przydatność rozpłodową (np.

które są fenotypowo prawidłowo rozwinięte. Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. merynos booroola). XYY lub XXX). Charakteryzowały się one gorszym tempem wzrostu. w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie. niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). Mutacje chromosomów płci Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY. Z badań przeprowadzonych na owcach wynika. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy. w które są zaangażowane chromosomy płci. Z drugiej strony ważną rolę odgrywają mutacje strukturalne. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych. Zespół niewrażliwości na androgeny Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. Z jednej strony mogą to być aneuploidie. U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera. miały niedorozwinięte jądra. a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. w zakresie od 0. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych. Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. np.rasy). że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników.5% (bydło) do kilku procent (niektóre rasy owiec. Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. Kilkanaście takich przypadków opisano u buhajów. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY. co oczywiście prowadziło do bezpłodności. Konsekwencją występowania 223 .

przy jednoczesnym braku kluczowego genu SRY. a wśród nich należy wymienić: mutację w locus SRY (np. chociaż zdarzają się zwierzęta z powiększoną łechtaczką. Zespół odwróconej płci u koni W hodowli koni częstym typem interseksualizmu jest tzw. które mają układ chromosomów XY. ale z powiększoną łechtaczką.nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu. ZFY. jak i wewnętrznych cech płciowych. od prawie typowo samczych do samiczych. Taki typ odwrócenia płci spotykany jest również u kóz. Najczęściej zespół ten diagnozowany jest u fenotypowych samic. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie. a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte. który uznawany jest za niezbędny do rozwoju gonady męskiej. co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim. że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze. ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL. a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp. który polega na niezgodności między płcią fenotypową i chromosomową. tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych. Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. świń i psów. z wykorzystaniem techniki PCR. w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego. Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane. Bezrożność kóz uwarunkowana jest przez dominujący allel P. Okazało się. a stopień 224 . częściowa lub całkowita delecja). a w ich genotypie nie stwierdza się genu SRY. które mają układ chromosomów płci XX. STS). Osobniki takie powinny być samicami. Badania molekularne genów położonych w chromosomie Y. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder. Przyczyny takiego stanu mogą być różne. U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX. W genotypie tych zwierząt nie ma genu SRY. zespół odwróconej płci (ang. przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem. sex reversal). Interseksualizm bezrogich kóz Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz.

W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono. Okazało się. również w zakresie układu loci w chromosomach. U obu ras bydła stwierdzono. zlokalizowana w niekodującym fragmencie DNA. tzn. Gonady zazwyczaj mają strukturę jądra. z tym jednak że genotyp Rr+ wykazuje niepełną penetrację. a rzadko jajnikojądra. Allele te prezentują typ dziedziczenia pośredniego. Allel R odpowiada za powstanie białego umaszczenia. czyli mających układ chromosomów płci XY. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej. allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). Wreszcie mogą występować również osobniki. polledness and intersexuality syndrome). Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym. Ciekawe jest. natomiast jajniki są rozwinięte prawidłowo. Zaburzenia te polegają na braku lub niedorozwoju pochwy. że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm. ale w części proksymalnej (w pobliżu centromeru). szyjki macicy i macicy. ukończono wieloletnie badania. co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym). że locus genu bezrożności bydła został umiejscowiony również w chromosomie l. że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. Choroba białych jałowic Innym przykładem genu o działaniu plejotropowym. że kariotypy obu gatunków są prawie identyczne. Z badań porównawczych wiadomo. Można z tego wyciągnąć wniosek. Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. które mają zdecydowanie samczy fenotyp. Zespół tych zmian jest określany jako choroba białych jałowic 225 . że jest on położony w chromosomie l — w części dystalnej. W 2001 r. jest allel R genu Roan (umaszczenie dereszowate) u bydła. który jest odpowiedzialny za rozwój interseksualny. a w ich genotypie występuje gen SRY. Co więcej należy podkreślić. gen PIS — ang. że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek.nasilenia tych zmian jest bardzo zróżnicowany. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. że odpowiedzialna za to jest delecja 11 700 par zasad. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe.

macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich. Locus tego genu został wcześniej zmapowany w regionie. white heifer disease). . Wśród nich niejednokrotnie zdarzają się przypadki. 9-3 wkładka kolorowa).(ang. U zwierząt tych stwierdzano obecność jąder. Interseksualizm u świń Przypadki interseksualizmu u świń obserwuje się z częstością około 0. gdzie gonady mają strukturę jądra lub jajnikojądra. w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe. a srom tworzył z odbytem wspólny otwór (ryć. Zakłada się. z tym jednak że łechtaczka była bardzo powiększona. że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm. pomimo braku genu SRY w ich genotypie. że choroba białych jałowic ma złożone podłoże. pomimo nieobecności genu SRY. że powstanie gonady męskiej może nastąpić pomimo braku genu SRY. W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej. a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny). Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym. a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. w którym ostatnio umiejscowiono locus genu Roan.XX/38. a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny. Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła. Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38. w których kariotypie występowały dwa chromosomy X. Przypuszcza się. W potomstwie jednego knura pojawiło się kilkanaście obojnaków.XX. Tło genetyczne tych przypadków jest słabo poznane. który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. Dotychczasowe obserwacje dowodzą. bowiem ponad 90% chorych jałówek ma umaszczenie białe. że genem roan może być gen kodujący czynnik wzrostu komórek tucznych. że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38. że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. Sytuacja taka wskazuje.3%. Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego.XY. Można natomiast przypuszczać. Badania chromosomowe wykazują.

mimo że ma tylko pięć klas przeciwciał. Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. α . 10.. ε .gamma 227 . usunięcie tych obcych białek.. połączonych z dwoma łańcuchami lekkimi (ang. jakim jest główny układ zgodności tkankowej. iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje. zdolność uczenia się. po 50 kDa każdy. ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego. są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał. δ . podobnie jak układ nerwowy. light — L). bakterii czy wirusów).Rozdział 10 Genetyczne podstawy odporności i oporności Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. γ .epsilon. reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm.delta. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np. o masie po 25 kDa. której celem jest zwalczenie. adaptatywnej). Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna. zapamiętywania. Zastanawiające jest.alfa. wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato.1. Genetyczne podłoże różnorodności przeciwciał Immunoglobuliny.. Są one elementem odporności swoistej (nabytej. Ma on. czyli przeciwciała. Jest pięć typów łańcuchów ciężkich (gr.. heavy — H).

IgD. Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi. constant — C). region zawiasowy (ang. Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA.i μ . W części zmiennej znajdują się trzy regiony hiperzmienne (ang. hinge region). 10-1). których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. natomiast A. D. znajduje się tzw. Stosunek przeciwciał. między domeną CH1 i CH2. HV2 i HV3. a wzdłuż jej ramion znajdują się łańcuchy lekkie. G i M od symboli łańcuchów ciężkich. Zarówno łańcuchy ciężkie. variable — V) oraz części stałe (ang. IgG i IgM.mi) i dwa typy lekkich (κ— kappa i λ. u koni l: 25). Badacz ten odkrył. E. utworzonej przez łańcuchy ciężkie.. Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku. do łańcucha λ zależy od gatunku (np. W części stałej łańcucha ciężkiego. Ponieważ regiony te determinują swoistość przeciwciał. complementarity determining regions CDR). hypervariable). nazywane są także regionami determinującymi dopasowanie (ang. u ludzi wynosi on 70:30. Przeciwciało ma kształt litery Y (ryć. u myszy l: 20. jak i lekkie mają części zmienne (ang. IgE. iż informacja genetyczna 228 . Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin. — lambda). oznaczone HV1. w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie. które mają łańcuch lekki typu κ.

229 . ale ich segmenty. jest głównym źródłem różnorodności przeciwciał.. 6 i 16. natomiast łańcucha ciężkiego przez trzy geny: V. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. joining). a łańcuchów lekkich z rekombinacji regionów V.immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów". Geny determinujące region C różnią się od pozostałych tym. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen. 10-2). variable) i J (ang. przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V. których kolejność łączenia się jest następująca: gen D z genem J. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang. D. u myszy natomiast odpowiednio w chromosomach 2. natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A. Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D. D (ang. ich swoistość wynikają z tego. czyli połączeniu się segmentów po jednym z każdej grupy minigenów. Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla. iż dziedziczone są nie całe geny immunogłobulinowe. Różnorodność przeciwciał. Proces syntezy przeciwciała następuje po skompletowaniu genów. ] i C. Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów. diversity) i J. typu λ w 22 chromosomie. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V. powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. Przypuszczalnie jest wiele genów kodujących region V. kilkadziesiąt genów D i kilka genów J. Różnorodność przeciwciał wynika z wielu przyczyn. Rekombinacyjne łączenie się genów. które nazwał segmentami. dla lekkiego — kilka. Część stała obu rodzajów łańcuchów jest kodowana przez gen C. że wpływają na funkcję przeciwciała. a nie na jego powinowactwo do antygenu. 6 genów funkcjonalnych i 3 pseudogeny regionu J. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie. J i C. Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt. może kilkaset). zachodzące dzięki aktywności enzymu — rekombinazy. następnie z genem V. Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. natomiast geny łańcucha lekkiego typu κ w 2.

10. bądź też usuwane (do około 20 nukleotydów). Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego. Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu). które razem stanowią przeciwciało. atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T). powodujące zmianę pojedynczego aminokwasu. Genetyczne podłoże różnorodności receptorów limfocytów J W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B. tym samym liczba wariantów genu D] może być zwiększona około 10 razy. rzadziej natomiast delecje. Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu.2. Najczęściej są to mutacje punktowe. będące specyficznym receptorem tego limfocytu. insercje lub konwersje. natomiast genu VDJ następne 10 razy. Ponieważ są to nowo powstałe odcinki DNA. V-D i D-J) mogą być wstawiane nukleotydy (od l do 15). oraz odpowiedzi typu humoralnego 230 . prowadzi to do zmienności na złączach i utworzenia nowego genu. przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego.Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J.

Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej. cytotoksyczne CD8. liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. 2 regionów D i 12 genów dla łańcucha β-J. Proces rearanżacji elementów genów receptorowych. jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. który następuje podczas dojrzewania komórek T w grasicy.(Th — pomocnicze limfocyty T). Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie. Podobnie. Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I. podobnie jak limfocyty B. ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2. Główny układ zgodności tkankowej — MHC Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ).5 x 106 α-β heterodimerów. odpowiedzialnych za przyjęcie przeszczepu. Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ. zachodzi podobnie jak rekombinacja genów przeciwciał. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T. Limfocyty pomocnicze mają receptory CD4. Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. że wszystkie elementy genów są włączone w rearanżacje.3. II i III. Oczywiście jest mało prawdopodobne. około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V. Poprzez proces rearanżacji genów. D i J (łańcuchy p i §). który kontroluje ich syntezę. które odpowiadają za syntezę przeciwciał. przez Petera Gorera poszukiwania innych antygenów grupowych krwi. Prowadzone w latach 30. 10. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi. Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V. doprowadziły do wykrycia grup (klas) antygenów oznaczonych I. Badania polegające na przeszczepach skórnych 231 .

być może dlatego. Antygeny te są istotną barierą podczas transplantacji tkanek. wykonywanych dla kilkunastu kolejnych pokoleń. Natomiast inny antygen. gdyż gen kodujący go jest zlokalizowany w chromosomie Y. pochodzi tylko od matki. H-3. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i. H-l. że większość z nich znajduje się w chromosomie 2. iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. gdy biorca i dawca są zgodni pod względem haplotypów MHC. ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech). Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. minor histocompatibility loci). natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC. major histocompatibility complex — MHC). nazwany Mta (ang. maternally transmitted antigen). Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska. a tylko w niewielkim stopniu od innych loci. Tabela 10-1 Lokalizacja MHC i nazwa u poszczególnych gatunków 232 . słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej. U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo. podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. Zatem jest on przekazywany przez ojca męskim potomkom. zwłaszcza transplantacji szpiku kostnego. Antygen H-Y występuje tylko u samców. często ich efekt jest niedoceniany. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców). Nawet wówczas. W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał. wykazały. nazwanych słabymi antygenami zgodności tkankowej (ang.między tymi liniami. jak i ilościowej. H-5 i inne.

leukocyte antigens — LA). II i III. D i L u myszy i B. jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt.Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku. Struktura i funkcje głównego układu zgodności tkankowej U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I. crossing over czy rekombinacji wewnątrzgenowych. Ponieważ MHC zawiera wiele genów oraz. iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych. jak już wspomniano. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym. Wykryto natomiast specyficzny region klasy IV. regionu K. powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I). jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin. Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną. W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów.1. a drugim podstawową funkcję — LA (tab. MHC u drobiu nazwano kompleksem B. będących glikoproteinami. Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka.3. rzadziej mutacji punktowych. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. są wysoce polimorficzne. układ ten cechuje ogromny polimorfizm. U drobiu nie stwierdzono regionu klasy III. a wraz z nim — haploidalny genotyp MHC (haplotyp). C i A u ludzi). w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów 233 . 10-1). Zwłaszcza niektóre geny MHC. często są one nazywane antygenami MHC. Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA. w populacji istnieje bardzo duża liczba różnych haplotypów. Z powodu powiązań tego układu z układem grupowym krwi B. 10. należące do klasy I i II (np. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku. kodujący białka zlokalizowane na krwinkach czerwonych.

Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T. że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego. który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. 10-3). Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. N-końcowy fragment łańcucha ciężkiego. w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. że MHC pełni funkcję tylko w odrzucaniu przeszczepu. oznaczone symbolami αl. biorąc tym samym udział w reakcji przeciwko infekcji wirusowej. które kodują miejsce wiązania peptydów. Łańcuch ciężki składa się z trzech części: • Najdłuższy. Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny. co zostało już udowodnione. 234 . których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC. zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach. Jest on kodowany przez geny MHC i ma trzy koliste domeny. natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. Domeny αl i α2 odznaczają się polimorfizmem. obecnie wiadomo.• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie. a także w odrzucaniu przeszczepu. α2 i α3. każda złożona z około 90 aminokwasów. W domenach tych występują alloantygeniczne miejsca. Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. Łańcuch ciężki jest kodowany przez geny MHC. a więc w tych. stanowi około 80% jego długości i znajduje się na zewnątrz komórki. wpływa na możliwość immunologicznego rozpoznania obcych białek. Mimo iż początkowo uważano.

stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi. Cząsteczki MHC klasy II. • Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy. które następnie są prezentowane limfocytom T. Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy). Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. oznaczonych symbolami α i β. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie. kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. składają się z trzech części: zewnątrzkomórkowej N-końcowej. 10-4). 235 . komórki den-drytyczne i limfocyty B). przechodzący przez błonę komórkową. W rowku tym wiązane są antygeny. Łańcuchy te. który leży w cytoplazmie komórki. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I. które są między nim a błoną komórkową. Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3. Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin.zawierające determinanty specyficzne dla osobników. Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. śródbłonowej i wewnątrzkomórkowej. podobnie jak łańcuch ciężki cząsteczki klasy I.

Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości. W jego skład wchodzą białka surowicy i płynów tkankowych. z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib). które określono symbolem H-2 (ryć. u myszy natomiast przez loci regionu S w obrębie H-2. że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC. S i D.1. oznaczane symbolem la).3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. Pierwotnie w MHC u myszy zidentyfikowano regiony K. gdyż ich miejsce wiążące pozostaje otwarte z obu stron. a potem również zwierząt gospodarskich. 10. Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. niektóre z nich też biorą udział w odpowiedzi immunologicznej. complement) i liczbą. złożony z kilku aminokwasów peptyd. których jest łącznie z czynnikami regulującymi około 30. kontrolujących syntezę klasycznych białek MHC klasy I. klasyczne cząsteczki klasy I. Natomiast produkty genów kompleksu Tlą i Qa wyka- 236 . Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). Późniejsze badania ujawniły. Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I. Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu. jak i klasy II prezentują obcy peptyd (antygen) limfocytom T.1. Badania sekwencji genu Qa-2. a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka.Zarówno białka MHC klasy I. I. Białka te są oznaczane literą C (ang. Główny układ zgodności tkankowej myszy Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy.3. Jednak cząsteczki klasy I mogą wiązać jedynie krótki. C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III. 10-5). od kilkunastu do ponad 20 aminokwasów. Dotychczas wykryto co najmniej 15 genów klasy la. ponieważ mają zamknięte miejsce wiążące. Białka C2.

Geny klasy II HLA znajdują się w pięciu podklasach: DQ. bardzo istotny dla ekspresji produktów genów klasy I. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny. Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I. DR. Struktura HLA przedstawiona jest na liniowym diagramie (ryć. -O/N oraz -M. w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom).żują wiele różnic w porównaniu z antygenami transplantacyjnymi. Gen ten u ludzi składa się z ośmiu eksonów. natomiast cząsteczki kontrolowane przez loci HLA-E. Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E. DOB/DNA i DM. oznaczone symbolem Ir (ang. -F i -G należą do nieklasycznych cząsteczek klasy I.2. Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A. Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S).1% całego genomu. przy czym trzy pierwsze . Każda podklasa ma co najmniej jeden gen łańcucha α i β. immune response). -P. 10-6). u człowieka w 15 chromosomie.1.3 i Tla zmapowano dotychczas 31 genów. który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. czyli ponad 0. Białka klasy III są kontrolowane przez geny regionu S. -B i -C. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%. Główny układ zgodności tkankowej człowieka • U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6. znajduje się poza MHC. W regionie Qa-2.3. 10. DP. natomiast u myszy z trzech eksonów. Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. w grupie sprzężeniowej z locus dehydrogenazy sorbitolu. zajmuje łącznie około 4 mpz DNA (4 miliony par zasad). u myszy w 2. z wyjątkiem H2-P.

przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC. Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów. co potwierdza fakt. Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC. -B. region klasy II HLA zawiera także geny.in. jak i do genów klasy II. Są to geny TAP1 i TAP2 kodujące peptydowe transportery.kodują klasyczne cząsteczki klasy II. Odkryty niedawno locus DM jest nieco inny niż pozostałe. że geny HLA-A. białek transkrypcyjnych oraz białek nieprawidłowych. 314 alleli klasy II i 40 alłeli klasy III. Jest pewnym paradoksem. iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). Dotychczas wykryto 267 allełi klasy I HLA. mają tylko 2 allele. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. m. Biorą one udział w proteolizie białek. nie podlegających transkrypcji (np. m. na przykład DRA. Stwierdzono na przykład. Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów. białek szoku 238 . Podobnie jak u myszy. geny dla 21-hydroksylazy (CYP21). iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. determinuje syntezę nieklasycznych cząsteczek klasy II. które strukturalnie nie należą do genów klasy II. Nieliczne z genów MHC. DOB/DNA. podczas gdy czwarta podklasa. bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I.in. 10-11). Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka. Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych.

1. różniących się delecją 6 par zasad w eksonie 5. Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111.cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB). Główny układ zgodności tkankowej bydła Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie. Na przykład homologia genów klasy II u ludzi i myszy jest następująca: myszy: ludzie: Aa Aβ DQα DQβ Eα Eβ DKα DRβ P O/N DP DOB/DNA M DM 10. Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami.3. w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych. który koduje krótki fragment transbłonowy łańcucha cząsteczki 239 . główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt. Produkty genów klasy I są to klasyczne cząsteczki MHC. Struktura BoLA przedstawiona jest na rycinie 10-7. Jest to najlepiej poznany chromosom bydła. iż homologia między poszczególnymi gatunkami i człowiekiem jest duża. Jak wspomniano na początku tego podrozdziału. Geny klasy I należą do dwóch grup — A i B. Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa. Wiadomo jednak. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany.3.

PD7 i PD14. Region klasy II zawiera wiele genów. że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. DQB. Podobnie jak u innych gatunków. 26 DQB i 31 DQA. z odpowiadającymi im genami HLA. W locus DRB wykryto pseudogen (DRB1). DRĄ i DRB. par zasad mniejsza niż w MHC u ludzi. różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC. w granicach 75-87%. DQA. W obrębie klasy II obserwowany jest duży polimorfizm genów. Wydaje się. odległość między nimi wynosi 0. natomiast DQA bydła i człowieka — 75% homologii.4 cM. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1. których homologia wynosi około 80-85%. Homologia między genami BoLA i HLA jest stosunkowo duża. i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. mają dużą homologię. Są to PD1. Regiony klasy I i II znajdują się blisko siebie. Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB. Nie jest znana dokładna liczba genów klasy I SLA. spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. Główny układ zgodności tkankowej świni Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. w SLA 240 . że jest ich około 7-10.MHC. Tylko kilka genów regionu klasy I wykazuje ekspresję. Niektóre geny. szacuje się. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś.

10-8. Najlepiej poznany jest pseudogen DRB2. a częstość rekombinacji między nimi wynosi 0. Geny klasy II wykazują duży polimorfizm. Główny układ zgodności tkankowej owcy Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA. 10-8). ovine aries). podobnie jak u bydła.Ryć. zmodyfikowano) znajdują się także pseudogeny. powodujące. w eksonach 3 i 4 znajdują się kodony „stop". w którym znajduje się główny układ zgodności tkankowej. Dotąd nie sporządzono mapy fizycznej tego układu. obok genów MHC znajdują się pseudogeny.6 cM.6%. W regionie klasy II. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B. Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont. w przeciwieństwie do innych gatunków. Mapa sprzężeniowa owczego chromosomu 20. które wykryto w tym pseudogenie. W wyniku mutacji. C2 i C4. 241 . przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ. znajdują się po jednym genie CYP22. w którym stwierdzono delecję nukleotydu w kodonie 53. 1996. W regionie klasy III. ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. Jest nim na przykład gen DRB2. ma długość 5. ale można również spotkać określenie Ovar (ang. W regionie tym są także inne geny typowe dla tego układu (ryć. iż nie jest on funkcjonalny.

Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21). które są klasyfikowane niezależnie. częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. Badania MHC u drobiu koncentrują się na kompleksie B. Jak już wspomniano przy omawianiu budowy cząsteczki klasy I.około 0. Długość tego regionu u owiec wynosi około 150 tyś. o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. Główny układ zgodności tkankowej kury U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y. Kompleks B znajduje się w 16 mikrochromosomie. przypuszcza się natomiast. Region klasy I oznaczony jest symbolem B-F. że jest on zlokalizowany również w tym chromosomie (ryć. 10-9). gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem 242 . Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. Za typowy MHC uważany jest kompleks B. natomiast w odniesieniu do Rfp-Y większość badaczy uważa. U drobiu nie ma regionu klasy III. Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz. klasy II — B-L. chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA. Z kolei.Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. częstość rekombinacji między skrajnymi loci tego układu -. par zasad. Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). a klasy IV — B-G. Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. O ile funkcje regionów B-F i B-L są znane. że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców.5%.

poprzedzona amplifikacją danego frag mentu DNA (PCR). inwazję kleszczy i pasożytów oraz trypanosomatozę (tab. Identyfikacja cząsteczek głównego układu zgodności tkankowej Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych. antygenu) MHC. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej. 10-IV). • metoda RFLP. tuberkulozę. 10. 10. U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane. w którym używane są homozygotyczne komórki stymulujące.3.3. Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC). Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań.2. 2) poprzez analizę molekularną DNA. Na przykład. od pewnego czasu. Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. Udoskonaleniem tej techniki jest test HTC. Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej.3. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości). ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby. jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii. 243 . badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis.1.3.3.zgodności tkankowej. białaczkę. dzięki której możliwe jest wykrycie obecności danego allelu MHC. allele specific oligonucleotides — ASO). Znaczenie głównego układu zgodności tkankowej 10. przeciwciała monoklonalne. pozwalających na identyfikację określonej cząsteczki (białka. Związek MHC z odpornością na choroby Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe. Do badań serologicznych wykorzystywane są surowice lub.

oddziałuje także na inne cechy (produkcyjne i reprodukcyjne).2*8 — podatność 10. Na przykład. Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje.2. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej. haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3.U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis. oprócz szczególnej roli w reakcji immunologicznej. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany.3.3. mięsaka Rousa i cholerę ptasią. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka. kokcydiozę. U bydła mlecznego stwierdzono istotne oddziaływanie niektórych 244 .2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3. ale stwierdzono już jego związek z odpornością na raka skóry.

Zarys przebiegu reakcji odpornościowej W odpowiedzi na wniknięcie patogenów (wirusy. przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji. czyli są degradowane do peptydów. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. jak dotychczas. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków. przeżywalność zarodków i płodów oraz liczebność miotu. Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i. Tutaj też następuje związanie cząsteczki MHC z peptydem. Zasadniczą rolę w ich rozpoznaniu.cząsteczek MHC klasy I na cechy związane z użytkowością mleczną.4. natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń. po czym powstały kompleks transportowany jest na powierzchnię komórki. iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. Dotyczyły one wpływu MHC na stopień owulacji. Wykazano wyraźny wpływ haplotypu rodziców na te cechy. 10. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu). Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością. gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne. zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. obniżać stopień przeżywalności i masę ciała cieląt. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. 245 . czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. zależnie od rodzaju patogenu i miejsca infekcji. bez względu na to. odgrywają cząsteczki głównego układu zgodności tkankowej. W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. nie do końca został poznany. U koni natomiast stwierdzono.

Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej. Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny. jeśli bakterie zostaną pochłonięte przez makrofagi. Powstały Ryc. 10-10. Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I. Peptydy te wiążą się z cząsteczkami MHC klasy II. makrofagi lub limfocyty B. są rozkładane na peptydy w wakuolach (endosomach). które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne. które zabijają zakażoną komórkę (ryć. 10-10a). Podczas infekcji bakteryjnej. przedostającymi się z siateczki śródplazmatycznej. (b) prezentacja antygenu przez cząsteczki MHC klasy II 246 . prezentując przede wszystkim obce antygeny. mające na powierzchni cząsteczkę CD8.nazywane inaczej zabijającymi.

gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów. makrofagi mogą pełnić rolę pośrednią. Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć. Następnie peptydy te są wiązane przez cząsteczki klasy II. ale także oporności/podatności na choroby zakaźne i inwazyjne. a raczej ich pojemność jest różna. Jeśli bakterie zostaną pochłonięte przez limfocyty B. degradują i prezentują wszystkie antygeny (ryć. Zdolność cząsteczek MHC do wiązania peptydów. a jej fragmenty są trawione przez sąsiadujące komórki. Genetyczna oporność na choroby Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność. czyli jej fizjologiczna śmierć. Utworzony kompleks. IgE lub IgA). 10-10b). Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8). ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć.kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). nieśność itd. Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów. Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek. apoptosis opadanie) jest to programowana śmierć komórki. określane jako Th2.). które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. wkrótce potem jądro. W określonych przypadkach. które uległy apoptozie. prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. Makrofagi wchłaniają. które służą jako receptory antygenów. które dotarły tu z siateczki śródplazmatycznej. jest rozpoznawany przez limfocyt pomocniczy T. w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze. Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247 . 10. Apoptoza (gr. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG. natomiast cząsteczka klasy II może ich związać dwa razy więcej. 10-10b). chromatyna ulega kondensacji na obrzeżach jądra.5. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek. Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. 10-10b). Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD. a następnie cała komórka pęka. po przedostaniu się na powierzchnię komórki.

należy oszacować jej zmienność genetyczną. 248 . Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć. Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. chociaż w przypadku niektórych schorzeń stwierdzono. Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów.kowanej oporności na choroby. np. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania. czyli określenie jego położenia w chromosomie. 10-11). Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. Umożliwi to poznanie sposobu jej dziedziczenia. celowe jest zmapowanie tego genu. iż oporność na nie zależy od pojedynczego genu o dużym efekcie. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. Gdy cecha — wskaźnik oporności jest już wybrana. Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną. iż cecha oporności jest warunkowana pojedynczym genem. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową. następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. Jeśli okaże się. może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów. następnie sklonowanie go i poznanie sekwencji nukleotydów. Na ogół jest to cecha poligeniczna. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. których celem jest znalezienie takich genów. W przypadku gdy oporność na chorobę jest cechą poligeniczna.

Znajomość cech określanych metodami serologicznymi. u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B. jak: • cechy eksterierowe (widoczne gołym okiem). a markerami genetycznymi. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus. umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. które mogą być wskaźnikami oporności na choroby. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei. wskazujące na większą niż u osobników białych oporność na choroby wirusowe. warunkowaną wieloma lub jednym genem. Sprzężenia takie są szczególnie korzystne w selekcji. i barwne upierzenie drobiu. Na przykład. Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech. która prowadzi do śpiączki afrykańskiej (trypanosomatoza). Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową). Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka. Y2/ D' i P'. gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. jak i techniki inżynierii genetycznej. rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. • cechy. jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi. Choroba ta dziesiątkuje populacje bydła 249 . Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB. Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów. jak i rasowe. co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu. które są określane za pomocą testów serologicznych lub elektroforezy. związana z opornością na raka oczu. takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych. Na przykład.Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne. Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze. • cechy ustalane za pomocą badań molekularnych DNA.

Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby. S. zwłaszcza u młodych kurcząt. Kokcydioza jest równocześnie przykładem choroby. które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. Ponadto świadczą one. enteritidis) sugerują. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). simentalery czy szwyce. jak i indywidualne. typhimurium. Wyniki badań wrażliwości kur na bakterie Salmonella (S. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę. Kokcydioza powoduje obniżony stopień wzrostu. gallinarum. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst. Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach).afrykańskiego. której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych. Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. Zmienność podatności zwierząt na choroby najlepiej poznano u kur. zmniejszone wykorzystanie paszy. Należą do nich stany zapalne gruczołu mlecznego (mastitis). iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. Obserwowane są zarówno różnice rasowe. S. S. Na przykład. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. z zachowaniem ich wysokiej produkcyjności. Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. nie zabezpieczając ich przed infekcją. pullorum. a także. krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej. śmiertelność. w tym przypadku jest to temperatura otoczenia. W Norwegii od 1978 roku mastitis jest już włączone jako cecha 250 . Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie.

Wiadomo. Ta metoda selekcji jest zalecana na przykład w Szwecji. Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów. Wydaje się. kształt i wielkość wymienia oraz strzyków. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. wysokość zawieszenia wymienia i szybkość oddawania mleka. iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia. iż byłoby celowe prowadzenie selekcji pośredniej. iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. w celu ograniczania występowania mastitis poprzez selekcję. Można zatem przypuszczać. Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników. Z drugiej 251 . którego leczenie jest bezskuteczne. Stwierdzono na przykład. za duże lub za małe strzyki. ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. Podstawowymi kryteriami tej selekcji są. wapń. siarę i mleko oraz. Na podstawie licznych badań można sądzić. Innym schorzeniem u bydła. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. a zwłaszcza przez chore matki. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. jest białaczka limfatyczna. niedobór niektórych pierwiastków. Wydaje się. których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy. że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby. ale także zakażenia przez łożysko. takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. która w znacznym stopniu jest uwarunkowana genetycznie. jak: magnez. Jej występowanie stwierdzono na wszystkich kontynentach. coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia. charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków.selekcyjna w programach hodowlanych. oprócz wydajności. zbyt duża wielkość i niskie zawieszenie. przez uprzednio zarażoną wirusem białaczki komórkę jajową. opartej na wskaźnikach fenotypowych oporności. jak również niekorzystnym warunkom środowiska (np. ustawienie strzyków. co zostało udowodnione. że mastitis najczęściej występuje u krów. kobalt i mangan). że skłonność do białaczki jest przekazywana przez rodziców.

. lub też jako zdolność do współżycia z pasożytem (ang. Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem.5-0. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt. że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie. Stwierdzono. przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. w odróżnieniu od genetycznej zmienności oporności. której wartość waha się w granicach 0. Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna. resistance). ale także innych schorzeń. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne. coli jest opisane w podrozdziale: Mutacje genowe. Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem. cieszy się mniejszym zainteresowniem wśród badaczy.jednak strony wielu badaczy stwierdzało. W tym miejscu należy podkreślić. co może być dowodem na dziedziczenie podatności na białaczkę. na przykład schorzeń kończyn. iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np. przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. coli i F18 E.6. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt.

antygenowe determinanty białek surowicy krwi (allotypy). stężenie nośnika — żelu itp. Przydatność markera zależy od tego. a z drugiej strony od parametrów fizycznych rozdziału (napięcie. temperatura. Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA. która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej.Rozdział W klasycznym ujęciu marker genetyczny to cecha jakościowa. przez jedną parę alleli. przydatna do celów analizy genetycznej. Metody serologiczne wymagają stosowania surowic testowych.). które nie kodują informacji genetycznej. co zachodzi wówczas. gdy w populacji występują przynajmniej dwa allele w locus tego markera. W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. a dokładniej — rozpoznające konkretną determinantę antygenową. W ten sposób badane są antygeny erytrocytarne (grupy krwi). umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych. czy jest on polimorficzny. uzyskanych metodą PCR. zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka. antygeny głównego układu zgodności tkankowej. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością. pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253 . Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. uwarunkowana w sposób prosty — tzn. wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych.

Ich efektem było wykrycie wielu układów grupowych. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych. czyli sekwencje kodujące -. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. że markery zostały podzielone na dwie klasy.1. Klasa II markerów to sekwencje niekodujące. o właściwościach antygenowych. wówczas jest rozpoznawane 254 . dotyczącej kontroli pochodzenia. a ich obecność można wykryć metodami serologicznymi.in.geny. który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. że są związane z błoną plazmatyczną erytrocytów. Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus). Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. Do pionierów tych badań należy zaliczyć m. cechujący się obecnością charakterystycznych białek. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50. Objęcie badaniami niekodujących sekwencji DNA spowodowało. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi. że mogą one być enzymami. W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. SSCP). Antygeny erytrocytarne (grupy krwi) Grupy krwi były najwcześniej wykorzystane w analizie genetycznej. czyli Ag-NOR). na powierzchni erytrocytów. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP. które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. i 60. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym. receptorami. Jeśli białko ma tylko jedną determinantę antygenową. wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne. Przez grupę krwi należy rozumieć typ krwi. polskiego badacza Ludwika Hirszfelda. single stranded conformation polymorphism). a w mniejszym stopniu sekwencje minisatelitarne. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I. np.mentu DNA genu (metoda SSCP — ang. Klasa I obejmuje klasyczne markery. Z badań prowadzonych u człowieka wynika. Wspólną ich właściwością jest to. cząsteczkami adhezyjnymi czy białkami strukturalnymi. który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych). 11.

Wreszcie może być taka sytuacja. Jeśli białko ma kilka determinant antygenowych.za pomocą jednej surowicy testowej. Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny. a przez to do utworzenia (lub zlikwidowania) 255 . może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej. Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów. to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. a to z kolei może wpłynąć na zmianę struktury białka. że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi. a w tym jego determinanty antygenowej. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych. Jeśli takie geny mają wiele alleli.

Sytuacja staje się bardziej złożona. W takiej sytuacji mutacja genu zmienia jedną Ryć. Schemat opiera się na założeniu. to wówczas każda mutacja genu. 11-2. 11-1). przykład dla białka mającego kilka determinant antygenowych. Mówi się wówczas o fenogrupach.nowej determinanty w antygenie erytrocytarnym. ab oraz a’bc). które pojawiają się w trzech fenogrupach: abc. że białko ma tylko jedną determinantę antygenową. a więc są uwarunkowane przez jeden allel. gdy białko ma więcej determinant antygenowych. Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć. Gdyby dla uproszczenia przyjąć. że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256 . czyli zespole antygenów. Mechanizm powstawania zróżnicowania antygenów erytrocytarnych. które dziedziczą się jak jednostka.

ale nie narusza struktury pozostałych (ryć. że istnieje także druga teoria tłumacząca fenomen fenogrup. że każdy antygen warunkowany jest przez jeden gen. Badania prowadzone u zwierząt wykazały. a w konsekwencji do nietypowego dziedzi- 257 . Należy jednak zaznaczyć. że występują obie sytuacje. Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. Przyjmuje ona.z determinant. Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów. 11-2).

Należy pamiętać. J. M. jak np. że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. C. Ponadto determinanty mogą 258 . które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. 11-1). Układ grupowy. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A. Q. w których wykryto dotąd tylko dwa allele (np. E. że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. D. U) oraz owcy (układy: A. D. G. Z. O). układ L bydła czy układ C świni). Wśród poznanych układów są takie. C. C. a drugi allel (allel „ —") koduje białko. T'. K. przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową. X). w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). M. B. N. 13 w genomie kury (układy: A. układ grupowy B bydła. M. 11 w genomie bydła (układy: A. P. M. E. D. L. B. D. H. I. S. K. L. K. że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. F. Biologiczna funkcja powyższych białek nie została jeszcze poznana. G. C. B. B. Można przypuszczać. Zatem możliwe jest. R.czenia antygenów krwinkowych. P) oraz 15 w genomie świni (układy: A. Na drugim biegunie są układy o olbrzymim polimorfizmie. W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. J. C. H. głównie w odniesieniu do układu grupowego B. J. F. R'). w którym występuje allel „ — " określany jest jako otwarty. Przykłady takie opisano u bydła. O. F.

charakteryzowały się identyczną swoistością. aby surowice testowe. Procedura produkcji oparta jest na immunizacji zwierząt. międzynarodowych testów porównawczych (ang. pod względem liczebności grupą markerów genetycznych klasy I. przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss.mieć wiele wariantów. które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). badanie grup krwi wymaga stosowania surowic testowych. oraz takie. Niezmiernie istotne jest. Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S. International Society for Animal Genetics — ISAG). comparison test). czyli zawierającej wiele różnych przeciwciał). pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang. które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt. W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. 11. po grupach krwi. Na uwagę zasługuje układ grupowy A świni. Za pomocą dostępnych surowic testowych należy ustalić. który ma działanie epistatyczne w stosunku do locus układu A. Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np. wyprodukowane w różnych laboratoriach. Cel ten osiąga się poprzez cykliczne przeprowadzanie. Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe. erytrocytów i leukocytów są drugą. w których zidentyfikowano kilka czy kilkanaście alleli. pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej. które powinny spełniać warunek swoistości.2. to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie). Polegają one na tym. elektroforeza w żelu poliakryloamidowym lub elektroforeza 259 . W układzie grupowym A występują dwa antygeny A oraz O. Jak to już wcześniej wspomniano. Surowice takie są produkowane przez laboratoria. Jego ekspresja zależna jest od dodatkowego locus S. które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę). Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. Gen S ma dwa allele: S oraz s. W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło. świnie. a każdy z nich jest rozpoznawany przez odrębną surowicę testową. a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej). jakie antygeny występują na erytrocytach w poszczególnych próbkach. Białka surowicy krwi. W efekcie wśród alleli będą takie. erytrocytów i leukocytów Białka surowicy krwi. że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt.

będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną. Na przykład u koni testy takie wykonywane są dla 16 systemów białek. elektrofokusing). Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych.dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt). i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Polimorfizm białek leukocytów. Spośród ponad 25 białek najbardziej polimorficzne 260 . nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC). Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III.

inhibitor α-proteaz i transferyna. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. Transferyna jest β-globuliną. Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich. PO1A. są one cennymi markerami genetycznymi. Allel ten. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. kur i bydła.są albumina. z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci. 261 . twarde i suche). Spośród białek i enzymów erytrocytarnych (tab. Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. PO1AB i PO1BY dla wielkiej białej polskiej. PIZ. Locus transferyny u świń znajduje się w chromosomie 13 (13q31). jak świnia. P/3. że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz). Z drugiej strony. przy czym jeden z alleli (ALBS) występuje u większości ras. U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych. Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. koń i koza. u owiec także w chromosomie l (Iq42q45). PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). występuje szczególnie często u zwierząt podatnych na stres. PO1B. przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. Tak więc. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków. Ze względu na to. U świń są one determinowane przez ściśle sprzężone loci (Pi1. podczas gdy allel TfA występuje przede wszystkim u yorkshire. U koni jest ono determinowane przez 13 alleli. U świń w locus ADA znanych jest sześć alleli. natomiast jest ona aktywna w leukocytach i innych tkankach. Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). Polimorficzne warianty są związane z różną aktywnością tego enzymu. Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. Najwięcej wariantów tego białka zidentyfikowano u bydła. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D. mającą dwa aktywne centra wiązania żelaza. jak np. owiec (chromosom 15). U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach. przy czym u bydła jest to enzym leukocytarny. Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej. u bydła w chromosomie l. określany jako zerowy. hampshire i duroc. niektóre allele są charakterystyczne dla danych ras. które mają skłonność do wytwarzania mięsa typu DFD (ciemne.

Warianty tego białka różnią się tylko budową łańcucha β. jest monomorficzna. bydła i kóz. są różne aminokwasy. wśród nich bydło czarno-białe i czerwono-białe. jak np. Na przykład u bydła w trzech pozycjach tego łańcucha. kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27. u rasy Jersey i niektórych ras mięsnych. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła. Większość ras bydła. U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15 262 .Hemoglobina wykazuje największy polimorfizm u owiec.

Białka mleka Głównymi białkami mleka są kazeiny αs1. bva2 oraz bvb. Ze względu na ścisłe sprzężenie loci kazein. u których najbardziej polimorficzny. 11. iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA.4. U bydła zidentyfikowano 3 allotypy. są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku. 11. U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-. U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad). Również lipoproteiny. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek. W przypadku antygenów immunoglobulin u bydła. bo liczący ponad 21 allotypów.i γ-globulinach. Największe zróżnicowanie allotypów lipoprotein. β. 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. biorące udział w transporcie cholesterolu. Większość tych allotypów jest determinowana przez kodominujące allele. stwierdzono dotychczas u świń. dotychczas zidentyfikowano 3 allotypy. Allotypy immunoglobulin i lipoprotein Antygenowe właściwości surowicy krwi. a wielkość tego wytwarzania zależy od nasilenia anemii. układ sprzężonych alleli nazywany jest haplotypem. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy). αs2. U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin. kontrolowane przez allele bval. Ciekawe jest. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku. a w piątym układzie (Lps) tylko jeden allel. 14 allotypów dla γ-globulin i 3 dla α-globulin. wykazują właściwości antygenowe. jest układ Lpb. u owiec 1.chromosom). U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki. określane terminem allotypy. oznaczonych symbolem Lp. Określenie genotypu na podstawie 263 . Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu. β i κ oraz białko serwatkowe — P-laktoglobulina. od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). Lpt i Lpu) znane są po dwa allele.3. jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). W następnych układach (Lpr.

Podobnie allel G powstał wskutek tranzycji C→T w allelu A. bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB). a u bydła indyjskiego — alleł C. przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B. polegającej na tranzycji G→A.badania białka jest możliwe tylko u samic będących w okresie laktacji. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). z których jedynie A i D są obecne w genotypie bydła ras europejskich. Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. C. Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA. tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów. determinowanych allelami: A. co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. B. której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. β-Laktoglobulina odgrywa rolę w odporności organizmu. Białko serwatkowe mleka bydła. Dotychczas u bydła wykryto 6 typów κ-kazeiny. Różnica między 264 . które powodują zmianę aminokwasu. C. B. znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny. wynikające z polimorfizmu genu kodującego to białko. Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy. będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną). β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2. β-laktoglobulina. B. D i E. a w wariancie A — izoleucyna. C i D. natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy. W pozycji 136 łańcucha polipeptydowego B jest treonina. a wariant A — alaninę. powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. Podobnie jak w przypadku κkazeiny. U bydła europejskiego najczęściej występuje wariant β-kazeiny A. Allel F powstał w wyniku mutacji punktowej w allelu A. E. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII. albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP. występuje w dwóch wariantach A i B. F i G. składają się one bowiem odpowiednio z 207 i 199 aminokwasów. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu. opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. U bydła w locus kazeiny αsl wykryto pięć alleli: A. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny. Białko β-laktoglobuliny składa się z 162 aminokwasów.

C i E różnią się między sobą kilkoma podstawieniami aminokwasów.wariantem A i B polega na tym.15 (motyw podstawowy: AGAGGTGGGCAGGTGG). to na błonie radiograficznej pojawia się układ prążków. przedstawia wysoce charakterystyczny obraz osobniczego DNA. to znaczy zawierających nie tylko sekwencję minisatelitarną. że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT). DNA fingerprint). jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. O). a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. do kontroli pochodzenia i identyfikacji śladów biologicznych. Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus. B. Polimorfizm DNA W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące. w którym są 3 allele. który może być wykorzystany m. C. że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. opisano po raz pierwszy sekwencje minisatelitarne. Podobnie u owiec. Z kolei w pozycji 118 w wariancie A jest walina (GTC).5 (motyw podstawowy: GGGAGGTGGGCAGGAGG). Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B. który reprezentuje fragmenty DNA o różnej długości. F. Do najbardziej znanych sekwencji minisatelitarnych należą: 33. a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości. W połowie lat 80. podobnie jak bydła. Sekwencje te występują w wielu miejscach (loci) genomu. W mleku kóz i owiec. wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo. Fragmenty te pochodzą z wielu loci. Ich cechą charakterystyczną jest to. E. Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną. ale także sekwencje ją otaczające. zaś w B -. który także jest już rutynowo stosowany. są cztery frakcje białek. Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A. natomiast wariant B — glicynę (GGT). Zostało to wykorzystane w opracowanym teście PCR-RFLP. 33. nazywany niekiedy „odciskiem palca" DNA (ang. w loci kontrolującym główne białka mleka występują po 2 allele. o tyle allele D i F wykazują znacznie większe różnice. polegające na delecji odpowiednio 11 i 37 aminokwasów. W pozostałych loci wykryto po 2 allele. O ile allele A. D.6 (motyw podstawowy: AGGGCTGGAGG) i 33.5. 11. Badanie takie wymaga zastosowania sond o dużej specyficzności. oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265 .alanina (GCC). B. z wyjątkiem locus P-laktoglobuliny (chromosom 3p28). Uzyskany układ prążków.in.

że ich loci są położone głównie w częściach telomerowych chromosomów. polegający na tym. Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili. CA) lub czteronukleotydowe (np. a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. także powtarzających się tandemowo. za pomocą sekwencji starterowej o losowej 266 . 11-3 wkładka kolorowa). Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika. dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych. (GT)nGAT(AG)m. polimorficznego fragmentu DNA. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. random amplified polymorphic DNA — RAPD). Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. lub dwóch fragmentów — u heterozygoty (ryć. żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. możliwe stało się analizowanie pojedynczych loci. gdy za pomocą techniki PCR. Do tej pory najczęściej opisywano dwu. po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną. Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu. Szacuje się. Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA.durą (ang. Zostały one określone terminem sekwencji mikrosatelitarnych. Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych. tzn. CATA) motywy podstawowe. (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. gdy nie są znane ani sondy molekularne. pochodzących z DNA wyizolowanego od danego osobnika. bo zawierających motyw podstawowy długości kilku nukleotydów. high stringency). że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. Warto zaznaczyć. Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji. Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego. Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów.(np. Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas. Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony. w przypadku homozygoty.

progressive rod-cone degeneration). Zamplifikowane fragmenty. Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach. określanych symbolem SNP (ang. a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). ale może od267 . Należy zaznaczyć. w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. został następnie molekularnie opisany. czyli nie wpływa na budowę polipetydu. zaowocował identyfikacją nowej klasy markerów genetycznych. seauence characterized amplified region). Dynamiczny rozwój badań. Badając grupę osobników można stwierdzić różnice w układzie prążków. amplifikowanego przez starter 5'-AGAATAGGC-3'. są poddawane elektroforezie.4 mln miejsc SNP. Wynika z tego. to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne). O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu. Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD. W ten sposób identyfikuje się markery określane skrótem SCAR (ang. charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna. allel l . wykryty za pomocą techniki RAPD. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. który zlokalizowano w chromosomie 9 u psa. w tym sekwencjonowanie. które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw. np. w której dominują nukleotydy C i G. Polimorficzny fragment. reprezentujące zazwyczaj różne loci w genomie. których celem jest sekwencjonowanie genomów różnych gatunków.AATCGGC oraz allel 2 — AATGGGC. Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP. Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I.kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów). Jeśli amplifikowany fragment jest wystarczająco duży. Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę. jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%. cichego podstawienia. Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. co doprowadziło do identyfikacji markera specyficznego SCAR. spośród których większość występuje poza strukturą genów. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP). prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1. single nucleotide polymorphism). Na przykład. Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli.

tzw. C (12 antygenów) oraz S (8 antygenów). Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek. w tym sekwencjonowania DNA. Do kontroli pochodzenia najlepsze są układy grupowe. E (17 antygenów) i L (12 antygenów). czyli markerów genetycznych klasy I. u świń układy M (12 antygenów). Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego. można wykluczyć jego ojcostwo.6. ALB-A. 268 . Podstawą tej kontroli jest to. Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik. ES-I. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. marker assisted selection). Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to. którego nie stwierdzono u jednego z rodziców. że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a. następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT). drugi od matki. Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. natomiast u koni układy A (7 antygenów). on zatem może być ojcem źrebięcia. MAS (ang. że potomek dziedziczy jeden allel z każdego locus od ojca. PHI-I. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej. 11. D-cgm. w których występuje wiele antygenów. Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. P-ad i Q-b oraz typy białek TF-O. D (17 antygenów). Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP.działywać na ekspresję genu. Warunków tych nie spełnia ogier l. ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej. Spełnia je ogier 2. u bydła są to układy B (40 antygenów). Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np. Wykorzystanie markerów genetycznych w hodowli zwierząt Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia. Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego. P (4 antygeny) i Q (3 antygeny).

druga na polimorfizmie mikrosatelitarnym. Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne. sekwencja minisatelitarna. W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą. Uzyskany obraz prążków jest charakterystyczny dla danego osobnika. Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269 . Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory. 11-4). Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia.ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć. którą jest np. jedna jest oparta na polimorfizmie minisatelitarnym. Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru: Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka.

Jak już wspomniano. łączne prawdopodobieństwo wykluczenia dla wszystkich 270 . analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia. W takim przypadku określa się tzw.

Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. matka natomiast heterozygotą (jeden allel . dodawany do każdej próby DNA analizowanej za pomocą sekwenatora. określanego symbolem SNPs (ang. Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2). sprawia. iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia.badanych loci. W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki. jak i obojgu rodzicach: Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. Dwa z nich otrzymały od matki allel długości 243 pz. Wszystkie szczenięta są heterozygotami. natomiast trzeci — allel 263 pz. których częstość szacuje się na 10-2-10-5 na pokolenie. 1300 par zasad). przy czym allel długości 235 pz odziedziczyły po ojcu. przedstawiono na rycinie 11-5 (wkładka kolorowa). szacowaniu zmienności genetycznej i dystansu genetycznego. w której stosuje się kilka markerów równocześnie. Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks. dostępności informacji zarówno o jednym. której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora.243 pz. że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych. Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA. Również to. Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów. Ojciec jest homozygotą pod względem allelu długości 235 pz. Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów. jak to jest przy cechach monogenowych — jakościowych. 271 . ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia. dokładnie tak. Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje. drugi — 263 pz). single nucleotide polymorphisms). Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków. drugi od ojca.

że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych.Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt. zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech). które mają znaczący wpływ na kształtowanie się cech użytkowych. dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach. 11-VI). o istotnym wpływie na cechy użytkowe. zwiększoną plenność świń. marker assisted selection). cechy użytkowości mlecznej). warunkujących cechy użytkowości mlecznej (tab. Prowadzone są badania w celu znalezienia takich genów. U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową. Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. wydajnością białka w mleku. Geny takie nazwano głównymi lub genami o dużym efekcie. czyli istotnych z hodowlanego punktu widzenia. brunatnego szwajcarskiego i simentali. Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. są również pomocne w doskonaleniu niektórych cech jakościowych. Markery genetyczne. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec. głównie klasy II. można dla młodej jałówki określić. 11-VII). W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych". której kryteriami są genotypy zwierząt w danych loci. Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych. Znając sprzężenie między określonym markerem genetycznym a np.99% prawdopodobieństwa wykluczenia. Identyfikacji genotypu w loci tych markerów daje 99. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. Jest to cecha dziedzicząca 272 . jaka będzie wartość tej cechy w przyszłości. a postęp genetyczny jest uzyskiwany w krótszym czasie. Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich. W przypadku tych cech jest już możliwa selekcja bezpośrednia. Okazało się.

jak również intensywnej hodowli (zasiniaczenia i ukryte 273 . której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego.się z dominacją całkowitą. w których coraz więcej uwagi poświęca się dobrostanowi zwierząt. Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała).

Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne. które mogą być wykorzystane do tego celu. Szacowanie dystansu genetycznego i wybór ras. występuje w l chromosomie. Dotychczas wiadomo jedynie. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii). ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji. w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania. a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji. Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów. ponadto jest zabiegiem kłopotliwym. kontrolujący bezrożność/rogatość u bydła. sprzężone z locus polled. Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources). które cechuje duża zmienność genetyczna. Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych. coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I. przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego.uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. 274 . Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia. Aby tego uniknąć. zwłaszcza infekcyjnych. Znane są już dwie sekwencje mikrosatelitarne. że locus polled. zanim wystąpią objawy chorobowe. Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób. jak i klasy II. w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to.

wyrażona w cM. Rozmieszczenie loci genów w genomie jest nierównomierne. Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). Organizacja DNA jądrowego W obrębie genomu występują zarówno sekwencje kodujące. że w genomie ssaków występuje około 35 tysięcy genów. jak i sekwencje niekodujące. która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów. mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). Miejsca te można wybarwić metodą barwienia prążkowego typu T. Zdecydowanie przeważają sekwencje niekodujące. Genom może być opisany za pomocą kilku parametrów. Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów. czyli geny. 12. Całkowita długość genomu u ssaków. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów. Sekwencje powtarzalne 275 . Przyjmuje się. które stanowią około 97% całego DNA (ryć. Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów.Rozdział 12 Mapy genomowe Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. 12-1).1. Po pierwsze. U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM. jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. Tam też znacznie częściej zachodzi crossing over. Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM). dlatego pojęcie genomu odnoszone jest do DNA jądrowego. Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad.

sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych.dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. że genom jest bardzo silnie nimi nasycony. którą uwidocznia się metodą barwienia prążkami C. że liczba powtórzeń danego układu podstawowego wykazuje w obrębie 276 . W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej. Oznacza to. że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu. z punktu widzenia przydatności tych sekwencji do analizy genetycznej. Szacuje się. że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad. ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim). Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. Niezależnie od tego. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to. Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów). Szczególnie cenne. jest to.

Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się. ale w danym miejscu występuje tylko jedna kopia sekwencji. z wyjątkiem sekwencji telomerowych. Inaczej mówiąc.2. jest do tej pory słabo rozpoznana. Podobnie jak poprzednio. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego. która stanowi zakończenia ramion chromosomowych. których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element). Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu. Wiadomo. której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny. sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element).populacji silne zróżnicowanie. że sekwencje te. Funkcja sekwencji powtarzalnych. których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz. w pobliżu końców ramion chromosomów. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. leżą w pobliżu białkowych struktur kompleksów. Organizacja DNA mitochondrialnego Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin). 277 . Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną. dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych. w których asocjuje heterochromatyna z kilku chromosomów. 12. przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. Elementy nukleotydowe to takie sekwencje. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. które również są rozproszone w wielu miejscach genomu. że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. podobnie jak elementy nukleotydowe. które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. jest sekwencja telomerowa (TTAGGG/AATCCC). Skróceniu ulegają właśnie sekwencje telomerowe.

mtDNA jest bowiem kolisty. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. 278 . Białka będące podjednostkami enzymów łańcucha oddechowego (np. ubichinon/koenzym Q.Mitochondria należą do organelli komórkowych przekształcających energię. Większość komórek zawiera od tysiąca do 10 tyś. W nich odbywa się większość reakcji oddychania komórkowego. cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V. Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy. że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang. kopii mtDNA. Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli. Jego długość wynosi około 16 tysięcy par zasad. Wiadomo już. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA. przy czym kompleks V jest to syntaza ATP. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka. poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. Struktura mtDNA jest inna niż DNA jądrowego. a tylko część przez mtDNA. w których być może replikacja mtDNA nie zachodzi. Całkowita liczba genów w ludzkim mtDNA wynosi 37. Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. oxidative phosphorylation — OXPHOS). zatem muszą być syntetyzowane wewnątrz mitochondriów. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie.

genów (markery klasy I). w której obrębie występuje potrójna struktura DNA. wchodzące w skład cząsteczki mtDNA. 12. że geny mitochondrialne nie zawierają intronów. b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli). Prawie cały mtDNA zawiera sekwencje kodujące. na obu łańcuchach. różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H).3. W mtDNA występuje jedno miejsce inicjujące transkrypcję. Markerowa mapa genomu Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. 279 . Z kolei mapa opisująca sprzężenia. co więcej.T niż łańcuch lekki (L). Kolejną cechą charakterystyczną mtDNA jest to. i niekodujących. a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. który stanowi dominującą część genomu. pozostający w asocjacji z cząsteczką macierzystą. Łańcuchy komplementarne. uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. która przebiega równocześnie. dlatego niejednokrotnie mówi się o markerowej mapie genomu. Mapa. a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D. Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych. c) odległościach genetycznych. wyrażonych w cM. czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego. Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech. w odróżnieniu od DNA jądrowego. tzn. uformowana przez krótki fragment nowego łańcucha H. Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA. pomiędzy sprzężo nymi loci oraz ich uszeregowaniu. który ma większy udział nukleotydów guanylowych — G i tymidylowych . ale w przeciwnych kierunkach. która wskazuje położenia loci w chromosomach. a niektóre geny nawet nakładają się na siebie.DNA występujący w mitochondriach nie jest powiązany z białkami. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących. nazywa się cytogenetyczną lub fizyczną mapą genomu. transkrypcji podlegają obie nici kolistego DNA.

która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. Jest to taka sekwencja nukleotydowa. 280 . cDNA (komplementarny DNA) genu. Często sondę stanowi tzw. ponieważ w mRNA.1. Fizyczna mapa genomu Podstawową. reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję. ale nie jedyną. Różnica między DNA genu a jego cDNA polega na tym.3. na przykład mikrosatelitę — marker klasy II. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany. sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang. na bazie którego syntetyzowano cDNA. metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym.12. że w cDNA nie występują introny. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa.

gdzie sonda hybrydyzowała z DNA chromosomu splicing). Malowanie chromosomów polega na zastosowaniu sondy. jest rozpoznawane przez obserwację mikroskopową. zgodnie z przyjętym wzorcem kariotypu. albo po hybrydyzacji. 12-3). Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu. Analizę taką określa się terminem porównawczego malowania chromosomów (ang. które stosuje się albo przed hybrydyzacją. Q lub R). (b) ta sama metafaza po hybrydyzacji. Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. chromosome painting) i mapowaniu na chromatynie jąder interfazowych. FISH) na chromosomie 3 psa. Miejsce. Trzeba podkreślić. dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów. Ponadto. związanego z barwnikiem fluorescencyjnym (ryć. Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. 12-3. malowaniu chromosomów (ang. Warto wspomnieć o dwóch: tzw. 12-4 wkładka kolorowa). comparative chromosome 281 . Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. wykorzystuje się techniki prążkowego barwienia (G. które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt. Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych. że do identyfikacji chromosomu. Hybrydyzacją in situ ma wiele odmian. jasne punkty wskazują miejsce. która zawiera unikatowe sekwencje DNA wybranego chromosomu. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. (a) chromosomy barwione metodą prążków Q. w którym sonda połączy się z DNA chromosomu. W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu.Ryć. technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków.

bydła). W ten sposób można wskazać. 12-1). są bardzo złożone. Dowodzi to. które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. Należy jednak 282 . konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych. jakie zaszły podczas ewolucji. człowieka).painting) i polega ona na tym. że sondę chromosomowo specyficzną. że zmiany na poziomie chromosomowym. że w genomach bydła. Przeprowadzone eksperymenty ujawniły. które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. utworzoną dla jednego gatunku (np.

czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów. naświetlaniu promieniami jonizującymi. podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków. które zawsze pojawiają się razem. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych. że grupa tych loci jest położona w tym samym chromosomie.6 milionów par zasad. jeżeli obejmuje segment długości co najmniej kilku milionów par zasad. naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16. to stopniowo „gubione" są chromosomy. Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. Loci takie nazywa się syntenicznymi. że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. W tym przypadku są to chromosomy bydła. którego genom jest badany — w tym przykładzie są to komórki bydlęce. że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków. które nie pochodzą z komórek nowotworowych. Okazuje się jednak. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji. Polega ona na tym. przyjmuje się bowiem. Sytuacja taka świadczy o tym. że sonda chromosomowo specyficzna da widoczny sygnał. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci. które będą się między sobą różniły liczbą zachowanych chromosomów bydła. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego. że jeżeli takie komórki są hodowane w warunkach in vitro. Na przykład. których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym. a w każdej 283 . nieznana pozostaje również wzajemna odległość między nimi. Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA. mysich komórek nowotworowych. Tak wyprowadzone klony poddawane są analizie elektroforetycznej. że metoda malowania chromosomów ma ograniczoną dokładność. np. Polega ona na poddawaniu komórek gatunku mapowanego. ale czasami może się zdarzyć tak. który jest to chromosom 1 w jakim regionie mieszczą się badane loci. Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku. utrzymywanych w hodowli. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki). a zatem fragmentacja chromosomów. której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku.zaznaczyć. komórki nowotworowe myszy). przed hybrydyzowaniem z komórkami nośnikowymi (np. że są położone w jednym chromosomie. Nie można natomiast wskazać. z fibroblastami pochodzącymi z mięśni czy skóry bydła. 0 ich umiejscowieniu wiadomo jedynie tyle.

3. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang.funkcja wiarogodności. przyjmującej niezależne dziedziczenie (r = 0. Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania. 12. ze względu na zbyt małe prawdopodobieństwo zajścia crossing over. które odzwierciedlają częstość. Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka. L . że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej. u potomstwa osobników o znanych genotypach.5) r .5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci. Dawki promieniowania jonizującego.współczynnik rekombinacji. na tyle blisko.. Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania. przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia. zawierający się w przedziale (0. Odległość taka oznacza. krzyżówka trójpunktowa). radów. Jednostką odległości genetycznej jest l cM. przy założonym współczynniku rekombinacji (r).z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa. Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie.2. służy tworzeniu genetycznej mapy genomu. wynoszą zazwyczaj 5 tyś. na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci. Kolejność postępowania jest następująca. w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego. 7 tyś. lub 12 tyś. W tym celu korzysta się z wiedzy o genotypach osobników 284 . Dalej. loci).. obliczana jako prawdopodobieństwo wystąpienia określonych genotypów. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu. z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. tym mniejsze fragmenty. że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych.. wykorzystywane w mapowaniu radiacyjnym. Najpierw poszukuje się sprzężeń pomiędzy loci. względem hipotezy alternatywnej. w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. 0. Genetyczna mapa genomu Analiza segregacji alleli w loci markerowych.

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

Warto zwrócić uwagę. 12-111). że do 2005 r. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt. zostanie ustalona sekwencja genomu bydła. a w tym i konkretnych chromosomów. Wśród tych ostatnich pierwszym genomem. Coraz więcej informacji pojawia się o mapach: kota. dla którego ustalono sekwencję nukleotydów. takie jak: lis pospolity.situ. bawoła. a także łososia i pstrąga tęczowego. comprehensive map). obok wymienionych w tabeli 12-11. świni i kury. Opublikowano ją we wrześniu 2003 r. W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r. Tak opracowane mapy określane są terminem map zintegrowanych (ang. jest genom psa. analizy hybrydowych komórek somatycznych. Przewiduje się. królika.) i domowych. są coraz lepiej poznane. Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe. są zamieszczone w internetowych bazach danych (tab. a w tym także mapowania radiacyjnego) i sprzężeniowego. 291 . że również mapy genomów innych gatunków zwierząt gospodarskich. Szczegółowe dane dotyczące map poszczególnych genomów. lis polarny oraz jenot.

ang. Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw. odporność na infekcje specyficznymi patogenami. którego celem jest identyfikacja nieznanego genu. a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych. która ma istotne znaczenie gospodarcze. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP). wydajność białka w mleku. Ogólny schemat postępowania. że allele któregoś z markerów kosegregują z określonymi fenotypami cechy. jak i genotypów w jak największej liczbie loci markerowych. Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres. Najpierw ustalono. Stwierdzenie. np. homozygot recesywnych 292 . zlokalizowanych w różnych miejscach genomu. Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu. bezrożność. że cecha ta warunkowana jest monogenowo. marmurkowatość mięsa. dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. exudative — PSE). choroby genetyczne itp. jak i jakościowe. wskazuje. który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA.5.3. Punktem wyjścia jest precyzyjne opisanie zmienności cechy. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. soft. które z hodowlanego punktu widzenia mają istotne znaczenie. że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. Mogą to być zatem zarówno cechy ilościowe. tzn. polegająca na klasyfikacji fenotypów dla interesującej cechy. które polega na opisie struktury genu. jest pokazany na rycinie 12-6. a konkretnie przez allel recesywny. Hodowca wskazuje cechę. Wykorzystanie markerowych map genomowych w hodowli Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów. gen główny w przypadku cech ilościowych). mięso blade. odpowiedzialnych za występowanie różnych alleli. pale. Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych). Następnie podejmowana jest żmudna analiza. Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali.12. wydajność rzeźna. miękkie i wodniste.

który nie rozpoznaje 293 . Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu. Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym.Ryć. Kilka lat później zidentyfikowano pierwsze markery genetyczne (m. np. Był nim gen receptora rianodyny (RYR1). 12-6.GP7. Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym. za pomocą hybrydyzacji in situ.in. która polega na zamianie argininy na cysteinę w pozycji 615. Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI. PGD i A1BG). Loci tych markerów umiejscowiono. locus układu grupowego krwi H oraz loci polimorficznych białek krwi . 12-7a). które okazały się ściśle sprzężone z locus HAL. Badania molekularne tego genu u osobników wrażliwych na stres wykazały. Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang. w chromosomie 6 świni (ryć. candidate gene). genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych (nn).

w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy sekwencji zawierającej mutację. Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN). wiadomo było. że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła. (c) BMPR-IB. że hipertrofia mięśniowa (tzw. 12-7b). (b) MSTN. wywodzących się z rasy belgijskiej 294 . podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową. Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić.Ryć. muscular hyperthrophy). Od połowy lat 80. W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech). 12-7. Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1. jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. (d) PRKAG3 oraz regionów chromosomowych. który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot.

że mutacja polegała na braku (delecji) 11 nukleotydów. które ma mniejszą wartość technologiczną. Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech.błękitnej i asturiana. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop"). Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. który odpowiada za zawartość glikogenu w mięśniach. że w chromosomie 4 świni. W 2000 r. Okazało się. W 2001 r. 295 . Analiza segregacji licznych markerów genetycznych. w którym prawdopodobnie występuje locus genu głównego. Dominujący gen RN~ powoduje większą. że gen FecB to zmutowana postać genu BMPR-IB. różnych mutacji uszkadzających funkcję białka miostatyny. a allel recesywny rn+ mniejszą zawartość glikogenu. ustalono. wpływający na plenność owiec rasy merynos booroola. który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. czyli genu głównego. Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. że jest nim zmutowany allel genu PRKAG3. pokrywających w miarę równomiernie większość genomu. Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101. Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). W 1994 roku ukazała się praca dowodząca. które w znaczący sposób wpływają na cechy użytkowe. 12-7c). Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. Przykładem może być gen FecB. wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). 12-7d). W początkowym stadium badań zakłada się. dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. kwaśnego mięsa. co fenotypowo objawia się hipertrofią mięśniową. Innym przykładem jest gen RN. Co więcej. oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego. są prowadzone w licznych ośrodkach naukowych. że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania. który jest biologicznie nieaktywny. a konkretnie kontrolujący liczbę owulujących oocytów podczas rui. które umiejscowione są w chromosomie 6 (ryć. Okazało się. nie udało się jeszcze wskazać genów kandydujących. Locus genu RN umiejscowiono w chromosomie 15. Badania zmierzające do identyfikacji genów głównych. zakończyły się wieloletnie poszukiwania genu RN.

a to upośledza funkcję kodowanego enzymu. że w chromosomie 12. czyli duży efekt fenotypowy pojawia się tylko wtedy. że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego. że również wiele krów było nosicielkami zmutowanego genu bd. który odpowiadałby za kształtowanie tych cech ilościowych. którzy również byli nosicielami tego niepożądanego genu. między markerami mikrosatelitarnymi S0083 i S0090. W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca. że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. Oznaczało to. Trzeba zaznaczyć. 296 . 12-7e). krowa nosicielka. w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja. W 2001 r. Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. wykazano.in. występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. Z badań prowadzonych w rodzinach referencyjnych wynikało.między markerami S0001 i S0067. Sugestia ta została potwierdzona także w innych badaniach. że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę. gdy zmutowany allel jest odziedziczony od ojca. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku. że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej. że gen ten podlega piętnowaniu gametycznemu. Z kolei w październiku 2003 r. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. chore cielę — homozygota recesywna). Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela. charakteryzującego się wybitną wartością hodowlaną. czego efektem jest 3-krotny wzrost ekspresji genu IGF2. Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel. że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. Odnotowano też znaczące osiągnięcie dotyczące bydła. 12-7f). określana symbolem bd (ang. bulldog disease). Można się spodziewać. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu. w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie. doniesiono. w budowie czaszki. Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym. ze względu na wywoływane zmiany m. W początkowym okresie jego użytkowania stwierdzono. Jednym z przykładów może być letalna wada rozwojowa — achondroplazja.

Wiele z tych mutacji występuje w ściśle określonych rasach. jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów). CVM — central vertebral malformation). U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów. W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. dziedziczny zanik siatkówki u owczarków francuskich). Niestety badań tych nie opublikowano. . że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt. a opracowany test molekularny skomercjalizowano. ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli.W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową. a ostatnio scharakteryzowano gen oraz mutację w nim występującą. Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej. Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne. polegającą na zniekształceniu kręgów (ang. Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują. Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów. Wśród nich są geny wywołujące takie schorzenia. narkolepsja u dobermanów i labradorów.

Węgleńskiego). Wydawnictwo Naukowe PWN. Prus-Głowackiego). Brown (przekład pod red. Brema. P. pod red. Leksykon biologiczny (1992). B. Warszawa. Nowicki i wsp. pod red. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997)..D. Genomy (2001). M. Wydawnictwo Polskiego Towarzystwa Zootechnicznego.. Cz. L. J.R. W. Filistowicza.A. D. pod red. Elementy genetyki klinicznej (2001). Poznawanie zasad dziedziczenia (1997). J. Immunologia (1996). Stansfield (przekład zbiorowy pod red. Stryer (tłum. R. A. Wydawnictwo Naukowe PWN. Roitt. Wydawnictwo Naukowe PWN. Leksykon rozrodu zwierząt (1996). z j. J. J. Genetyka człowieka. Wydawnictwo Akademii Rolniczej w Poznaniu. Augustyniaka i J. Małe (tłum. Singer (tłum. Karty z Dziejów Zootechniki Polskiej. K. ang. J. Schook i S.Literatura uzupełniająca Podręczniki Biochemia (1997). Genom człowieka. Wydawnictwo Naukowe PWN. Warszawa. Biotechnologia zwierząt (1997). z j. Waśniewska-Brzeska i J. Modlińskiego. Wydawnictwo Medyczne Słotwiński Yerlag. Krzanowskiej. Rosłanowskiego. Kłyszejko-Stefanowicz. Berg i M. Korf (przekład pod red. Jeżyk genów. K. pod red. Cytobiochemia (1995). P. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994). Wydawnictwo Naukowe PWN. L. King. Biologia molekularna w medycynie. Słownik terminów genetycznych (2002). L. pod red. Zwierzchowskiego. Warszawa. 298 . Wydawnictwo Naukowe PWN. L. Pawlaka).J. Cz. USA.B. pod red. Genetyka molekularna (1995). Brzeski). Lamont. Jury i H. Wydawnictwo Naukowe PWN. Rozwiązywanie problemów medycznych (2003). Wiedza Powszechna. I. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. W. Brostoff. pod red.C. Bala. pod red. The Major Histocompatibility Complex Region of Domestic Animal Species (1996). Jaszczaka i J. ang. Węgleńskiego. B. pod red. Poznań. T. A. Żeromskiego). ang. Juszczaka i S. Krzyżosiaka. II— lata 1972^-1997 (1997). z j. Michejdy). Prószyński i S-ka. Wydawnictwo Naukowe PWN. W. Ośrodek Wydawnictw Naukowych PAN. pod red. Wężyka. P. CRC Press Inc.

(1997). Minireview — MHC studies in domestic animals. Beattie C. Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence. Early steps in mammalian sex determination.A.P.. Long S..S. (1997). Naturę 409: 860-921. (1996). Świat Nauki 4 (128): 36-43. Pierzchała M.T.W. Keele J.M.. 12): 53-58. Medycyna Weterynaryjna 54 (2): 92-96. Kurył J. Lechniak D. Friend S.M.. (1996). Goodfellow P.. Kappes S. Crawford A. Pareek Ch. Journal of Applied Genetics 37 (3): 299-312..W. Chromosome abnormalities in domestic sheep (Ovis aries). Keele J. Charon K..J. Journal of Applied Genetics 38: 65-76. (1998). Ohta T.T.. (1996). Seminars in Reproductwe Medicine 20: 157-167. Current Opinion in Genetics & Development 6: 316-321. Population biology of antigen presentation by MHC class I molecules. Freking B.A. polimorfizmy i choroby. Prace i Materiały Zootechniczne 50: 69-78.M. (1997). 299 . (2002).W. Postępy Nauk Rolniczych 7 (nr 5): 87-97. Ellis S. (2002).. Cuthbertson R.F. Metody oraz znaczenie sterowania proporcją płci u bydła. Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Grzybowski G. International Human Genome Seąuencing Consortium (2001).. Biotechnologia 3 (38): 38-50. Magiczne mikromacierze. Dymnicki E.. (1998). Stone R. (1999)...S. Stone R. Postępy Biologii Komórki 26 (supl. (2002). Science 301: 1898-1903. (1996). Molecular genetics of sex determination. McGraw R.. Beattie C. Stoughton R. The dog genome: survey seąuencing and comparative analysis. Medycyna Weterynaryjna 52 (2): 89-93. Parham P. Bartnik E. DNA microarrays — a methodological breakthrough in genetics. Ludzki genom mitochondrialny — mutacje. (1996).Artykuły przeglądowe Barsh G. Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding. Lopez-Corrales N..L. Kirkness E. Zeszyt specjalny 8: 9-18.. (1996). Genome Research 7: 235-249. (1998). i wsp.E.P.. (1998). Sonstegard T..B. Ramikssoon Y.L.G. Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt. i wsp. Initial seąuencing and analysis of the human genome.M. Kappes S. (1996).. (2003). European Journal of Immunogenetics 21: 209-215. A second-generation linkage map of the sheep genome.H. Postępy Biologii Komórki 24 (8): 69-75. Leymaster K. Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych. Mammalian Genome 9: 204-209. The genetics of pigmentation: from fancy genes to complex traits. Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich. Trends in Genetics 12 (8): 299-305. Dodds K. Smith T. (1997). (1994). Charon K. (1997). Grzybowski G. De Gortari M. Mapa genomu świni (Sus scrofa domestica).M. Journal of Applied Genetics 37: 179-196.A. A second-generation linkage map of bovine genome. Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej. Science 272: 67-74. Geny oddziałujące na jakość tuszy i mięsa świń. Journal of Applied Genetics 43: 123-130. Krzanowska H. Prace i Materialy Zootechniczne.. Kamiński S..A. Cotinot C.W. Kamiński S. Prace i Materialy Zootechniczne 49: 7-28. Kamiński S.

Świtoński M.Rejduch B. Stranzinger G. Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt. Basics of gametic imprinting. Świtoński M. — Celera Genomics (2001). Keele J. Szwaczkowski T. Journal of Applied Genetics 38 (3): 319-328.... Noncoding RNA transcripts. Inheritance of colours in horses. (2003). Świtoński M. i wsp. Genetic aspects of mastitis resistance in cattle.J.S. Szymański M.L.H.. (1994). Waterston R. Ruvinsky A.W. Journal of Animal and Feed Sciences 2/3: 91-103. Determinacja płci u ssaków. The seąuence of the human genome. Zwierzchowski L. Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej. Medycyna Weterynaryjna 59: 847-852. Walawski K. Journal of Applied Genetics 38:195-204. Prace i Materiały Zootechniczne 50: 11-39. (1993). 10): 113-122. Zwierzchowski L. Genome Research 6: 371-391. Smith T.. Prace i Materiały Zootechniczne 52: 37-42. Journal of Applied Genetics 40 (2): 117-128. Kurył J. (2002). (1994). Antigenic markers of protein genes and their nomenclature in cattle. Science 291: 1304-1351. (1998). Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus). opasowe i rzeźne — najnowsze osiągnięcia. A comprehensive map of the porcine genome. Synaptonemal complexes in domestic mammals — a review.. Kozubska-Sobocińska A. Szydłowski M. (1999).. Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej. Słota E. Poszukiwanie genów kontrolujących cechy tuczne. Kulig H. Postępy Biologii Komórki 25 (supl. Wierzbicki H. (1997).. Biotechnologia 2 (41): 33-56.. 10): 195-217. Rosochacki S. Medycyna Weterynaryjna 50 (8): 379-382. (2003).. Journal of Dairy Science 82 (suppl. Journal of Heredity 89 (6): 473-480.. Naturę 420: 520-562.. Postępy Biologii Komórki 25 (supl. Zych S.W. (1996). Alexander L.. Sysa P. Żywiecki M. Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt. 2):288-237. Hu Z. Beattie C. (1997). Barciszewski J. (1999). (1998). Aberracje chromosomowe u bydła o użytkowości mięsnej. Świtoński M. . Rohrer G. Kwiatkowska J. Journal of Applied Genetics 44: 1-20... Skiba E. (1998).. i wsp. (1997). (1998). Danielak B. Medycyna Weterynaryjna 53 (10): 581-584.P. (1998)... Węgrzyn J. Prace i Materiały Zootechniczne 53: 35-48.J. Napierała D. Yenter C. Prace i Materiały Zootechniczne 46: 29-40.. Stachurska A. Identyfication of animal major genes in field collected data by use of statystical methods. Krajowy system kontroli cytogenetycznej buhajów. (1998).Z. Szatkowska L. Słomski R. Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka.A. Initial seąuencing and comparative analysis of the mouse genome. Barciszewska M. (1998).

są pogrubione. . Charon. Gwiazdką oznaczono numery stron.Skorowidz Opracowali: Krystyna M. na których hasła znajdują się na rysunku lub w jego podpisie. na których znajduje się główny opis. Marek Świtoński Numery stron.

Sign up to vote on this title
UsefulNot useful