Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

.. Mejoza .....5...................7. 3.............7.............................................2.......................... Translacja .... Chromosomy i podziały jądra komórkowego ......................... RNA .... Inaktywacja chromosomu X w zarodkach żeńskich ................1....... Metylacja DNA ..................... 2...... Kariotyp ...................................................................5..... 3.....2..................... 3......................7................... n 1 5 16 23 31 33 37 43 3 Gen i jego ekspresja .............................1.................. 3.... 3......................4..............1.... 3.... Budowa chromosomu ..............3...... Replikacja DNA .................................. 3.................................................................... Budowa kwasów nukleinowych .....1..................... 3................................................. 3.....................................................2.................... 2......... 2....... ......................... Kod genetyczny .............7......................4....................... 3...... Endonukleazy restrykcyjne ...7......... Mitoza...... 2...... Geny homeotyczne ...................... Gametogeneza ....................................................................................1............ 2..............................................................Spis treści 1 2 Wstęp — zarys historii genetyki .................. 3..................... Regulacja ekspresji genu ........................................... 3.... Wektory... 48 48 49 50 52 53 54 56 57 60 61 62 63 64 66 4 Metody analizy i modyfikacji genomu ... Transkrypcja ..................................................................................... Budowa genu ...... 2..................................................................................................1... DNA ...................6.................. ................................ 4...............3......................................................................................................1............................... 3.........................................5.........................4................................................... 69 69 72 ........2............................3.....7.............. Piętno gametyczne ..................................................................................... 3...............................................2............................6................ 4............. Barwienie prążkowe chromosomów ................... Czynniki transkrypcyjne .............

............4.............................. ..... 5.............. ............... Dziedziczenie cech warunkowanych jedną parą alleli ..............9............................ 6.. 4.............................................. 6..........1.......................... Rodzaje zmienności i czynniki ją wywołujące ....................... Techniki hybrydyzacji i sondy molekularne ................ 5...... Mutacje chromosomowe ............ 7...4...... Epistaza ........1.3........ Ograniczanie występowania chorób genetycznych............. Przyczyny i rodzaje mutacji genowych ...........10....5.... ....................4............2....................2............... 6........4......................... Dziedziczenie pozajądrowe .... 5..... Mutacje genowe wpływające na cechy produkcyjne zwierząt ................. 6........... 6.................... Dziedziczenie cech sprzężonych .3.......2.. 4.................1..........................................7. Mutacje genowe wywołujące choroby genetyczne .........4.. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) ...2.......................................................5............4.........3...............................................................4........... 6.................................... 6.... 5........ 4.....4.....................4................................................................... 5.. 5.........1.....4.................3................................................. Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych ... Komplementarność ...........4........................................................ 4.................................... 5........ 6. 6........................... Cechy sprzężone z płcią .......4. 6.................................... 179 179 182 182 8 .. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce ............................4............. 7............................ Penetracja i stopień ekspresji (ekspresywność) genów .........4............................4.. Współdziałanie alleli ............ 6..........................4.5.............. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny ................2...... 95 96 100 111 112 112 118 123 124 124 127 132 135 143 144 6 Podstawowe mechanizmy dziedziczenia cech ........2.... semiletalne i subwitalne .... Geny letalne..... 5...................2................2.1.. Skutki mutacji genowych ...5.................. ...............6...3..........1... 4..................................................4.....1.... Współdziałanie genów z różnych lód w kształtowaniu fenotypu ........ Mutacje genowe ......... Plejotropia ..... 5............. Mutacje w mitochondrialnym DNA .......... Miary zmienności ............................................2........................ 76 78 82 86 87 88 91 91 5 Mutacje ............................ 6...........................................................1............. 5..3............... Mutacje genomowe ..1...1... Dziedziczenie umaszczenia..................... 6...8.. 5........................... 6..............................4...2.. Sekwencjonowanie DNA .. 7............... Rekombinacja molekularna i klonowanie ... Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) ............................................5................... Badanie ekspresji genów ............ Geny modyfikujące ................ Biblioteki genomowe i genowe .......................... 4....................... Niezależne dziedziczenie cech (II prawo Mendla) ........................................................ 4.2....................................... 146 147 147 150 152 157 160 160 161 162 163 164 164 175 176 7 Zmienność cech...................1........................ Sumujące działanie genów ......................................................... Transgeneza ................... Miary skupienia ..1.... 5................................................4...4.....4............. 5...... ...........................................1..........3..............2................. Choroby monogenowe wywołujące wrodzone wady rozwojowe 5......

............ 11. 11....3....6..............................2...........1...... Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8...............3. Główny układ zgodności tkankowej człowieka ....................... Wykorzystanie markerów genetycznych w hodowli zwierząt..1.....3.................. 11.................. 7......3........ 198 198 201 201 204 205 210 9 Determinacja i różnicowanie płci oraz interseksualizm ....... 10............... 8.............2.............. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych ... ......................1..... 10... 10..............3.............3...........................6.........................1.............. ............3..... Prawo równowagi genetycznej ...............................................3. erytrocytów i leukocytów ..1................... Czynniki naruszające równowagę genetyczną ...... 10......1........................................ Główny układ zgodności tkankowej myszy .1........................ Polimorfizm DNA ....3...... Genetyczne podłoże różnorodności receptorów limfocytów T .3....2.........................3...................5.... Miary rozproszenia .. Dziedziczenie cech ilościowych .......... 10..................... 10..4................ Determinacja płci ssaków ............................ 11..................................... Zmienność cech ilościowych ..........................3........ 9.. Genetyczne podłoże różnorodności przeciwciał .1.......3...... 7........................................................3................. 9.....1.3.......... 10................ Główny układ zgodności tkankowej zwierząt gospodarskich 10. 253 254 259 263 263 265 268 9 .. 210 216 221 10 Genetyczne podstawy odporności i oporności ....3.............................2. Antygeny erytrocytarne (grupy krwi) .........5............... Białka mleka ............ Zarys przebiegu reakcji odpornościowej ........2......................... 8....... Interseksualizm ........ 10........3..... Związek MHC z odpornością na choroby ................... Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami ... ..........................1...7............ 11................................ .... Główny układ zgodności tkankowej — MHC .. 227 227 230 231 233 236 237 239 243 243 243 244 245 247 11 Markery genetyczne . Zmienność transgresywna ..........3.........................3......... 7............. 8.. 11...... Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10.....2.. 10...... Identyfikacja cząsteczek głównego układu zgodności tkankowej 10..4.......... 185 187 187 189 190 8 Podstawy genetyki populacji ................3.................. Frekwencja genów i genotypów w przypadku dominowania .............. Allotypy immunoglobulin i lipoprotein ..... 8............. 7............................. Genetyczna oporność na choroby .......................... Znaczenie głównego układu zgodności tkankowej ............................... . 8.... .............................................. Geny o dużym efekcie . Białka surowicy krwi.................... Struktura i funkcje głównego układu zgodności tkankowej .....2....................2......................4....1.................2..................5....... 10...2..........

.......................................3............................................ Genetyczna mapa genomu ............ 12.....1............... ................. ...... 301 ...........................................4..........................................2........3............ .... Strategia mapowania genomu......................................3.................... . Organizacja DNA mitochondrialnego .......1.........................3.........2....... .................... Wykorzystanie markerowych map genomowych w hodowli .................................. 275 275 277 279 280 284 287 289 292 Literatura uzupełniająca ................ 12.................................... 12.. Fizyczna mapa genomu .................5........... 12....... Markerowa mapa genomu ...........3...........................................1 2 Mapy genomowe .............. 12.................... 12......................3....... Aktualny stan map genomowych zwierząt gospodarskich ............3................... Artykuły przeglądowe ................... 12.... Podręczniki .................... Organizacja DNA jądrowego .................... 12...... 293 298 298 Skorowidz ........

komórek i ich organelli. że wszystkie rośliny i zwierzęta są zbudowane z komórek. Okazało się to niezwykle stymulujące dla rozwoju cytologii. a z drugiej formułowaniem przełomowych hipotez i teorii. chemików. które stało się początkiem nauki o ewolucji. ale także przekazanie tych korzystnych właściwości potomstwu.Rozdział 1 Wstęp . umożliwiając im nie tylko przeżycie. byli Schwann i Schleiden. O powstawaniu gatunków drogą doboru naturalnego. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum). ogłoszonej w 1838 roku. rośliny samopylnej. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty 11 . tkanek. konstruktorów.zarys historii genetyki Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych. czyli nauki o budowie i funkcji komórek. a ostatnio również informatyków. Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX. podstawą ewolucji organizmów żywych jest dobór naturalny. wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. Główną tezą tej teorii było twierdzenie. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. Autorami pierwszej z nich — teorii komórkowej budowy organizmów. Badania nad mieszańcami roślin. który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków. Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych. której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. stanowiącą zaczątek genetyki. korę mogą powstawać jedynie przez podział innych komórek. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii. W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. Zgodnie z teorią Darwina.

Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie. Mendel uzyskał pierwsze pokolenie mieszańców (F1). przy czym jedna gameta zawiera tylko jeden taki element.czerwone lub białe. Ten dział genetyki określa się często jako genetykę cech ilościowych. Opis mitozy przedstawił w 1882 roku Flemming. w tym struktur związanych z dziedziczeniem. a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. W latach 20. Dopiero wówczas zrozumiano genialność odkryć Mendla. Na początku XX wieku podjęto wiele badań. których celem było poznanie praw rządzących dziedziczeniem cech. którą można uważać za początek cytogenetyki. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. Wright i Haldane wprowadzili do genetyki metody statystyczne. że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet. Fischer. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. Przez wiele lat przypuszczano. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi. nasiona gładkie lub pomarszczone. że 12 . za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. nazwanych w 1888 roku przez Waldeyera chromosomami. Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. Stało się to za sprawą trzech badaczy: Corrensa. które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2). cech ilościowych. którzy niezależnie od siebie doszli do wniosków. Pierwsze doniesienia o „pałeczkowatych" strukturach. o których różnorodności wiedziano już wówczas dość dużo. Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne. zostały podane przez polskiego botanika Strasburgera w 1880 roku. Rok później Morgan ogłosił chromosomową teorię dziedziczenia. które kilkadziesiąt lat wcześniej podał Mendel. które okazały się bardzo istotnymi narzędziami badawczymi. Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. że można je określać tylko jednym terminem — genetyka populacji. kiedy to trzej badacze: Avery. MacLeod i McCarty wykazali. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki. Niektórzy autorzy uważają. de Yriesa i Tschermacka. że nośnikiem informacji genetycznej są białka. Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków. nasiona żółte lub zielone itd. Przełom nastąpił w 1944 roku.

) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. tzn. sekwencjonowania DNA (1975 r. liczącym ponad trzy miliardy par nukleotydów. W doświadczeniu tym można upatrywać początku genetyki molekularnej. hodowlą zwierząt i roślin. Warto podkreślić. zwierząt. Odkrycie enzymów restrykcyjnych (1962 r. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów. jak świnia. że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang. Warto zaznaczyć.) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r. to czas usilnych badań. opracowanie techniki rekombinacji i klonowania DNA (1972 r. w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. Zostały one zakończone w pierwszej połowie lat 60. Human Genome Organisation Project) 13 . że molekularne poznanie genomów człowieka. Do wniosku tego doszli na podstawie wyników eksperymentu. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw.. W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów.).) oraz enzymu odwrotnej transkryptazy (1970 r. ale również jego sekwencjonowanie. przetwórstwem żywności. W przypadku człowieka celem jest nie tylko mapowanie genomu. których celem było poznanie struktury chemicznej DNA. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków. W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości. teorii operonu. owca.). ustalenie kolejności par nukleotydów w całym DNA ludzkim. kura czy pies. Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie. ochroną środowiska itp.nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA). która wyjaśniała mechanizm ekspresji genów u bakterii. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. Program ten został urucho miony w 1987 roku. a wiodącą rolę w tych badaniach odegrali między innymi Khorana. a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna. Początek lat 50. roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych. Nirenberg i Ochoa. bydło. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego. koń. wykrywaniem 1 zwalczaniem patogenów.

dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. Wydaje się. a także człowieka powinna wywołać głębokie zastanowienie się nad tym. czego jednym z licznych przykładów jest hodowla zwierząt. Przewiduje się. Pierwsze osiągnięcia zostały już opublikowane. Ustalono. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt. a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa.oraz 2) prywatną firmę CELERA. jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła. Głównymi metodami hodowlanymi są selekcja i krzyżowanie. której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych. a ostatnio także polimorfizmu DNA. którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek. W grudniu 2002 roku ustalono sekwencję genomu myszy. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów. bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych. świni i kury. Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji. Istotnym elementem pracy hodowlanej jest kontrola pochodzenia. wysoką mięsność świń czy wydajność tłuszczu w mleku krów. wysoką plenność owiec rasy boorola i inverdale. zwierząt. że do 2005 roku zostaną zsekwencjonowane genomy bydła. . Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. gdzie jest granica. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji. a w przypadku mutacji genowych — metod genetyki molekularnej. że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. roślin. Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój.

Prokarionty nie mają wyodrębnionego jądra komórkowego. zdolnego do podziałów (kariokinezy). a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. W jądrze komórkowym występują chromosomy. Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. które podlegają podziałom (mitoza. Odpowiednikiem jądra komórkowego jest nukleoid. mejoza).Rozdział 2 Chromosomy i podziały jądra komórkowego W podziale systematycznym organizmów żywych wyróżnia się. Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu. czyli są haploidalne. dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota). Do prokariontów zalicza się bakterie i sinice. biorąc pod uwagę organizację informacji genetycznej i budowę komórki. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana. Głównymi tezami tej teorii było twierdzenie. że nie 15 . Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię. Należy jednak podkreślić. że: 1) geny zlokalizowane są w chromosomach. oprócz bakterii i sinic. Eukarionty zbudowane są z komórek mających jądra komórkowe. Tym samym organizmy te zawierają pojedynczy zestaw genów. które są zbudowane z kwasów nukleinowych i białek. Do eukariontów zalicza się wszystkie organizmy komórkowe. zbudowany z „nagiej" kolistej cząsteczki DNA. który w 1910 roku ogłosił chromosomową teorię dziedziczenia. 2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie.

M — metafaza. białek histonowych i niehistonowych. Dzięki kondensacji cząsteczki DNA. G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu. Budowa chromosomu Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA).wiedziano wówczas. z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu. Fazy (GO. Gl. Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego. Oznaczenia: P — profaza. która następuje za pomocą białek histonowych i niehistonowych. kwasów rybonukleinowych (RNA).1. S. chromosom Ryć. 2. A — anafaza i T — telofaza 16 . 2-1.

a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną. W jąderkach budowane są podjednostki rybosomów. subtelo-i akro-(telocentryczny) (ryć. Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1. Czwarta chromarydy siostrzane Ryć.osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej. 18S i 28S. O chromatydach mówi się. ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć. Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). submeta-.01-7. Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną.00) i (7. Wówczas to chromosom ma długość rzędu kilku mikrometrów. 2-2. Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej. 2-2). który jest odpowiedzialny za uformowanie jąderek podczas interfazy. określanym jako centromer. Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym. Część końcowa ramienia chromosomowego nazywana jest telomerem.00-1.8S. że są siostrzane. Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-. nucleolar organizer region).00).70). 2-1). także przewężenie wtórne. (1. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17 . (3. która obejmuje nie tylko ustalenie liczby chromosomów. określane inaczej jako obszar jąderkotwórczy — NOR (ang. ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5.01-oo). oprócz przewężenia pierwotnego. Niektóre chromosomy mają.71-3.

Podczas fazy S następuje replikacja — 18 .frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. które są w nich położone. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy. Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację. co najważniejsze — zestawu loci genów. podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X. jak i żeńskiej. nazywa się satelitą. Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y. Heterochromosomy. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału. występują w układzie XX u samic oraz XY u samców. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y). która z kolei zawiera jedną cząsteczkę DNA. W każdej parze jeden chromosom pochodzi od matki. która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny. Fragment ramienia chromosomu. morfologii. W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej. Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego. a drugi od ojca danego osobnika. układu prążków poprzecznych oraz. 2-3). który występuje za przewężeniem wtórnym. oznaczane u ssaków symbolami X oraz Y. Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć. Oznacza to.

w zakresie od 0 do 80 pz. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo.Ryć. a procesy te. ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki. Jest on zbudowany z rdzenia białkowego (oktamer histonowy. Przyjmuje się. na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów. 19 . która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt. Fragment DNA owinięty na oktamerze histonowym (1. że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. H3 i H4). 2-4). Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz. H2B. Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu. w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. charakteryzują się niezwykłą precyzją (ryć. zawierający po dwie cząsteczki histonów: H2A. inaczej par zasad (pz). PWN) samoodtworzenie DNA.8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz. 1997. 2-4.

która może ulec trwałej kondensacji. Dlatego te sekwencje DNA określane są terminem S AR (ang. czyli geny. high mobility group). Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. Chromosomy interfazowe zachowują strukturę nukleosomowa. przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego. zbudowanym z białek niehistonowych. Wiadomo jednak. Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości. W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl. Solenoid podlega dalszej spiralizacji. Podlega ona replikacji w początkowym okresie fazy S. które odpowiadają za zbliżenie się sąsiednich nukleosomów. wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20 . Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów.Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid. że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. a jej ostatecznym etapem jest utworzenie domen pętlo wych. Jej replikacja występuje w późnym okresie fazy S. Heterochromatyna konstytutywna jest frakcją chromatyny. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną. należącymi do rodziny białek HMG (ang. Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu. Heterochromatyna fakultatywna jest częścią chromatyny. z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. które są zakotwiczone w rdzeniu białkowym chromatydy. który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw. scaffold attachment region). Pojawia się ona podczas zapłodnienia. Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny. które tworzą większe chromocentra. W niej zlokalizowane są kodujące sekwencje DNA. głównie powtarzalnych sekwencji DNA. domeny. ciałka Barra. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. sekwencji nukleotydowych. która zawsze występuje w stanie skondensowanym. Zbudowana jest z niekodującycK. przykładem jest jeden z chromosomów X u osobników żeńskich. czyli regionami wiążącymi się ze szkieletem chromosomu.

Chromosomy homologiczne mają loci tych samych genów. W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych. w których jeden chromosom jest pochodzenia ojcowskiego. ale mogą zawierać w nich różne allele 21 .w oocycie drugiego rzędu (komórce jajowej). a drugi matczynego.

czyli nadliczbowe względem podstawowego ze- 22 . że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. Należy podkreślić. ryć. 2-5 i 2-6). Chromosomy B. 2-1. od 30 u norki do 78 u psa (tab. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota.Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale.

że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii. np. Konsekwencją tego jest występowanie u lisów osobników.2. Barwienie prążkowe chromosomów Zróżnicowanie wewnętrzne chromosomu. chociaż wiadomo. wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T. czyli można przypuszczać. które mogą mieć 50. Efektem tego jest zmienność ich liczby zarówno między osobnikami. fuzji centrycznej u lisów polarnych. może być uwidocznione za pomocą technik barwienia różnicującego. Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. jak i pomiędzy komórkami w obrębie jednego osobnika. Okazało się.stawu A. 2. Do tej pory nie poznano funkcji tych chromosomów. Prążki mają identycz23 . charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych. że często są zbudowane z heterochromatyny konstytutywnej. ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej.49 lub 48 chromosomów. iż są nieaktywne genetycznie.

że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów.ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku. Wynika z tego. ale także układ prążków na chromosomach. Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole. Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące 24 . po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny.

Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny). Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. Silne wiązanie barwnika kwinakryny następuje w miejscach. W efekcie na chromosomach 25 . gdzie dominują pary zasad A-T. 2-7a). a następnie barwienia roztworem Giemsy.(ryć.

które zaszły w kariotypach zwierząt. które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. w których zlokalizowane są geny. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. w których jest też najwięcej wysepek CpG. Zależność ta jest szczególnie interesująca. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych. W takich warunkach znaczna część euchromatyny zostaje usunięta. Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG). Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. 2-7b). Wskazuje to zatem. które pozwalają na uwidocznienie charakterystycznych regionów chromosomu. a pozostają trudne do usunięcia. Ponadto. gdzie przy barwieniu QFQ występuje prążek nie świecący. że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu. Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. H2 i H3. po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T. Oznacza to na przykład. są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl. Prążki R. wykorzystywanych do identyfikacji chromosomów homologicznych. ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. które się wybarwiają roztworem Giemsy. takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze. Oprócz opisanych wyżej metod prążkowych. pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. a miejscami szczególnie bogatymi w loci genów są prążki T. gdzie przy barwieniu QFQ obserwowane są prążki świecące.pojawiają się prążki ciemne i jasne (ryć. Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. znane są metody. Największe zagęszczenie genów występuje w obrębie izochor H3. Prążki ciemne występują w tych samych miejscach. wysepki CpG). są one niezbędne przy mapowaniu fizycznym genów. a prążki jasne odpowiadają nie świecącym prążkom Q. a przy barwieniu GTG prążek jasny. Heterochromatyna konstytutywna 26 . że prążki R są głównymi regionami. Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. 2-8). silnie skondensowane obszary heterochromatynowe.

2-9a). Prążki Ag-I. W miejscach tych następuje wytrącenie metalicznego srebra. czy też w częściach środkowych ramion. 27 . u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona.jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. inaczej Ag-NOR. ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć. Znane są również takie gatunki zwierząt. 2-9b). które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć. 2-10). a rzadziej na końcach. które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). to barwienie azotanem srebra. np.

Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych. 28 .Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków.

a chromosom Y jest małym metacentrykiem. Chromosom Y jest najmniejszym chromosomem metacentrycznym.60 (ryć. co odróżnia go od autosomów akrocentrycznych o podobnej wielkości. Układ prążków C. W chromosomie X brak jest centromerowego prążka C. Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych. 2n = 38 (ryć. 2-6b).Bydło. 2n = 60. Również akrocentryczny jest chromosom X. Chromosomy płci są łatwe do identyfikacji. trudnym do odróżnienia na podstawie morfologii od autosomów. Chromosom X jest dużym akrocentrykiem. a chromosom Y jest małym metacentrykiem. Chromosom X jest dużym chromosomem metacentrycznym. także koza ma wszystkie autosomy akrocentryczne. Chromosom X jest średniej wielkości metacentrykiem. 2n . a chromosom Y jest małym metacentrykiem. 2-5b). 2n = 64 (ryć. Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta. 2-10a).i submetacentrycznych) oraz 6 par akrocentrycznych. ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem. Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków. Koza. natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach. Owca. natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. 2-5a). Koń. w którym nie jest jeszcze zakończona kondensacja chromosomów. w części telomerowej ramion długich pięciu par autosomów. 2n = 54 (ryć. Wszystkie autosomy są akrocentryczne. Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków. Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. w ramionach krótkich. Obszary jąderkotwórcze występują. Podobnie jak w przypadku bydła. a chromosom Y jest akrocentrykiem. podobnie jak u bydła. a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. w pobliżu centromeru (ryć. Świnia. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów. 2-6a). W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. 2-9a). w chromosomie X widoczne są krótkie ramiona. który ma dodatkowy prążek 29 . W stadium prometafazy. Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X. Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X.

a chromosom W jest małym metacentrykiem. w okolicach centromeru. W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. Wszystkie autosomy z grupy A są chromosomami dwuramiennymi. 49 lub 48. 30 . Liczba chromosomów B waha się od O do 7. oraz w chromosomie Y. W kariotypie kury. występuje liczna grupa bardzo małych chromosomów. Lis polarny. 2-10b). Lis pospolity. przy czym najczęściej obserwowano l. Ponadto. Chromosom X jest dużym metacentrykiem. Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B. a chromosom Y bardzo małym akrocentrykiem. Chromosom Y jest w znacznej części heterochromatynowy. Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych. Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. łącznie z chromosomami płci. z grupy mikrochromosomów. a chromosomy z grupy B są akroćentryczne lub subtelocentryczne. wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne. Obszar jąderkotwórczy występuje tylko w jednej parze autosomów. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. 2 lub 3 chromosomy B. Chromosom Z jest dużym metacentrykiem. 2n = 78. 2n = 50. którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów. W grupie dużych autosomów analizuje się najczęściej 8 par. podobnie jak u innych ptaków. mają bloki heterochromatynowe w okolicy centromeru. 2-7a). a chromosom Y bardzo małym akrocentrykiem. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. 2n = 34 +B (ryć. 2-9b). Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną.interstycjalny w ramieniu długim. Wszystkie chromosomy. Kura. dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe. 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. nazywanych mikrochromosomami. Chromosom X jest dużym metacentrykiem.

Mitoza Mitoza to proces podziału jądra komórkowego. Komórki potomne mają nie tylko taką samą liczbę chromosomów. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów. że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. który prowadzi do powstania dwóch komórek potomnych. a chromosom Y jest małym metacentrykiem. a faza S jest związana z procesem samoodtworzenia się DNA (replikacja). komórki krwi. Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu. Rozpoczęcie fazy S oznacza. Wszystkie autosomy są akrocentryczne. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. a także z pierwszymi etapami gametogenezy. odnawianiem niektórych komórek u dorosłych organizmów (np.Pies. Jeżeli ilość DNA wyrazimy za 31 . W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. 2-8b).3. Chromosom X jest dużym metacentrykiem. Fazy Gl. nabłonka). 2n = 78 (ryć. Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y. w części terminalnej ramion długich. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki. chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. S i G2 tworzą okres międzypodziałowy — interfazę. jaki miała komórka rodzicielska. a czwartą fazą jest podział. mających genotyp identyczny z tym. 2. ale także identyczną sekwencję nukleotydów w DNA. W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki. proliferacją limfocytów przy reakcji odpornościowej organizmu.

Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. W końcu. W telofazie zachodzą procesy odwrotne do tych. Chromosomy ulegają dekondensacji.pomocą umownych wartości C. wychodzące z centrosomu (obszar wokół centrioli). w pary homologiczne określane jest terminem kariotyp. Istotnym zmianom podlegają również inne organelle komórkowe.4. Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. 2. W trakcie omawiania podziału mej etycznego pokazane zostanie. którego włókienka. Po zakończeniu podziału jądra komórkowego następuje cytokineza. Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. dezintegracji ulega błona jądrowa. Centriołe. występujących w jądrze komórki somatycznej. 2-12). czyli podział cytoplazmy i rozdział organelli komórkowych. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. że najmniejszą zawartość DNA (1C) mają gamety (ryć. W profazie rozpoczyna się proces kondensacji chromosomów. łączą się z centromerami chromosomów w taki sposób. rozchodzą się do przeciwległych biegunów komórki. 2-11). W obrębie jądra komórkowego zanikają jąderka. anafazy i telofazy (ryć. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. Kariotyp Uszeregowanie chromosomów. to w jądrze komórkowym po replikacji jest 4C. Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. Mitoza składa się z czterech faz: profazy. które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. metafazy. W wyniku kariokinezy w komórce powstają dwa jądra potomne. organelle komórkowe odpowiedzialne za wytwarzanie rybosomów. a centriole dzielą się na dwie parzyste struktury. a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32 . Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi. w których każdy z chromosomów jest zbudowany z jednej chromatydy. jakie występują w profazie. odbudowuje się błona jądrowa oraz jąderka. odpowiedzialne za powstanie wrzeciona podziałowego. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. W tej fazie chromosomy są rozprzestrzenione w całej komórce. mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska. Następuje formowanie się wrzeciona podziałowego.

2-12. T — telofaza. Być. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. M — metafaza. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów. Schemat przebiegu podziału mitotycznego. Wydawnictwo AR. Oznaczenia: P — profaza. a — centriole. C — cytokineza. Poznań 1988) 33 . PM — prometafaza. A — anafaza. c — dezintegrująca błona jądrowa. b— zanikające jaderko. d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt.spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce.

do których zalicza się: długość chromosomu. G lub R. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć. kozy i psa. Standaryzacji Kariotypu Świni. subtelo. 2-8a 34 . że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny.Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych. Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła.lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q. położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-. submeta-. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds. w których wszystkie Ryć. ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. Jest to spowodowane tym. 2-13.

2-14. Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds. Standaryzacji Kariotypu Świni (Hereditas 109:151-157. Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy Ryć. przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne.chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości.1988) 35 .

Ponadto. 1996 Cytogenetics and Celi Genetks 86:271-276. Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła. R Źródło Cytogenetics and Celi Genetks 92:283-299. 1985 Cytogenetics and Celi Genetks 31:240-248. obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków. opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11 Wykaz gatunków. R R G. które są numerowane (ryć. R G. Q. Natomiast w drugiej połowie lat 90. Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony. dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G. wielkość oraz wzór prążkowy (najczęściej prążki G lub R). Ag-I G G G. C. dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang. 1997 Hereditas 103:33-38. precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe. W latach 80. owcy. 2-14). 2-14). 1999 J w- Hereditas 109:151-157. Opracowanie kariotypu. która odbyła się w 1976 roku w Reading (W. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni. czasami określanego kariogramem. Przykładem może być kariotyp świni (2n = 38). Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. przyjętym dla danego gatunku. kozy i kota. w zakresie wyznaczonym przez liczbę par dla danego gatunku. i 85:317-324. Brytania). 2001 jw. w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. 1985 Hereditas 103:171-176. Q. 1988 Chromosome Research 5:433-443. świni. R G. kozy i konia. Każda para homologiczna ma opisaną morfologię. Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej. Graficzne przedstawienie kariotypu. W obrębie regionów numerowane są także kolejne prążki. 2-13). owcy. R G. konia. 1981 Chromosome Research 4:306-309. które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery. dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem. 1999 . bydła. landmarks). nazywa się idiogramem (ryć.zróżnicowane pod względem morfologicznym. C. Ag-I G.

diploten i diakinezę. gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. zygoten. pachyten. 2-15). która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. 2. zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej. z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. tzn. która mocuje chromosom do wewnętrznej strony błony jądrowej.szych par spośród 39) oraz poprawiono wzorzec kariotypu konia. komórki te mają zmniejszoną do poziomu 1C zawartość DNA.5. tzn. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych. Strukturą tą jest kompleks synaptonemalny (ang. a element centralny powstaje w miejscu. W tabeli 2-II zestawione są gatunki. pojawiającej się w zygotenie i pachytenie profazy I. metafaza. Należą do nich: kondensacja chromosomów. Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu. Każdy element lateralny zakończony jest tarczką przylegającą. polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych. Wejście komórki w podział mejotyczny poprzedzone jest. podobnie jak w przypadku podziałów mitotycznych. anafaza i telofaza (ryć. w których liczba chromosomów jest zredukowana o połowę. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten. Mejoza składa się z dwóch podziałów. synaptonemal complex — SC). Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne. które występują również w mitozie. 2-16 i 2-17). Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. dezintegracja błony jądrowej. replikacją DNA w fazie S.: profaza. Elementy lateralne 37 . które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. w których występują takie same fazy jak w mitozie. Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. dla których opracowano wzorce. Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną. czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. Ponadto. Mejoza Podział mejotyczny prowadzi do powstania komórek. Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym.

Tli Ryć. AI — anafaza I. b — centromer. Schemat przebiegu podziału mejotycznego. Z — zygoten. c — początek budowania kompleksu synaptonemalnego. P — pachyten. Pil — profaza II. TI — telofaza I. Wydawnictwo AR. Tli — telofaza II. d — guzek rekombinacyjny. Ali — anafaza II. L — leptoten. MI — metafaza I. Poznań 1988) . DL — diploten. 2-15. MII — metafaza II. e — chiazma (wg: Genetyka zwierząt. a — tarczka przylegająca. Oznaczenia: PI — profaza I. DK — diakineza.

sekwencjami DNA. mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz). Ostatnio przeprowadzone badania pokazały jednak. że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego. synaptonemal complex protein): SCP1. Badania białek SC pokazały. Wiele wskazuje na to. Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. Wynika z tego. która z kolei miała umożliwiać zajście crossing over na początku pachytenu. zanim dojdzie do koniugacji za pośrednictwem SC. że crossing over może zajść.łączą się tylko z niewielką częścią DNA chromosomów (około 1%). zależnie od gatunku. że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE). U ssaków dobrze poznano strukturę trzech białek SCP (ang. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej. Koniugacja chromosomów 39 . Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. Ponieważ koniugacja ma charakter homologiczny. występującymi w tej części domen pętlo wy ch. których długość. Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. które są zakotwiczone w rdzeniu białkowym chromatydy. chociaż jeszcze nie poznanymi. to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi. SCP2 i SCP3. domen pętlowych.

Biwalent jest także formowany przez heterochromosomy X i Y (ryć. na okładce).zostaje zakończona na początku pachytenu (ryć. Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów. 2-17b). dzięki 40 .

Przyjmuje się. W metafazie I biwalenty. poza miejscami. że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm. przy czym liczba tych zdarzeń waha się od l do 5. Należy podkreślić. Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. zachodzi w przypadkowym miejscu biwalentu. gdzie wystąpiło crossing over. a na innych brak byłoby takich wymian. jaka była przed crossing over. czyli musi zajść w obrębie każdego biwalentu. stanowiące cytologiczny dowód zajścia crossing over. że SC jest w to istotnie zaangażowany. Zjawisko to określane jest terminem interferencji. gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji. a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T. Wiadomo. w których powstają chiazmy. że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca. a w świetle ostatnich badań można przypuszczać. Ponieważ tak się nie dzieje. że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. tzn. zmierzają do płaszczyzny równikowej 41 . w przeciwieństwie do sytuacji.niewielkim regionom pseudoautosomalnym (ang. następuje rozkład kompleksów synaptonemalnych. Zasadniczo crossing over jest zdarzeniem losowym. Losowość crossing over naruszona jest również przez to. która uczestniczyła w wymianie. które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. Losowość zachodzenia crossing over jest jednak ograniczona. Chromatyda. że crossing over jest zjawiskiem obligatoryjnym. której efektem jest zmienność w świecie ożywionym. że pierwotnym źródłem zmienności są mutacje. które uruchamiają homologiczną koniugację. ponieważ brak crossing over pociąga za sobą brak chiazm. Na początku pachytenu występuje zjawisko crossing over. uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego. ich zanikania. Zasada ta dotyczy także biwalentu X-Y. Po zakończeniu pachytenu — w diplotenie. które są podklasą prążków R. Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I. Należy jednak pamiętać. Wówczas to chromosom. tzn. co wynika z zasady. miał zestaw alleli tylko jednego z rodziców. Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału). a tym samym i jego chromatydy. że zachodzi ono rzadziej w pobliżu centromeru. Potencjalnie mogłoby istnieć niebezpieczeństwo. że na jednych chromosomach liczba ta byłaby znaczna. pseudoautosomal region — PAR). a drugi od matki. dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over. składające się z maksymalnie skondensowanych chromosomów homologicznych.

że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej. 42 . że do centromeru przyłączają się włókna tylko z jednego bieguna. Oznacza to. Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób. W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. 2-18b). Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I. 2-18a). czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym. natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego. Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA.komórki (ryć. Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział. w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć. 2-18c). który nie jest poprzedzony replikacją DNA.

Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd. Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). a niektóre mają zrekombinowany układ alleli. Trzystopniowa rekombinacja sprawia. Przebieg mejozy. W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C. jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny. Po ustawieniu się chromosomów podczas metafazy II (ryć. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego. można podzielić na: chromosomowe.6. jakie występują w profazie mitotycznej. Gametogeneza Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym. 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43 . 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają. z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza). Ten fenomen. chromatydowe i wewnątrzchromatydowe. a ich chromatydy mają zrekombinowane układy alleli. obok mutacji. że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice.Drugi podział ma przebieg zgodny z mitozą. rozumiane w szerokim sensie. 2. rozpoczyna się telofaza. Rekombinacje genetyczne zachodzące podczas mejozy. przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa. w której zachodzą procesy odwrotne do tych. Ten typ określany jest jako rekombinacja chromatydowa. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy. że wśród gamet nie występują dwie o tym samym zestawie alleli. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. inne matczynego. które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. wśród których jedne są pochodzenia ojcowskiego.

podlegają głębokim przeobrażeniom podczas procesu spermiogenezy. Spermatydy. jako komórki niezróżnicowane. która stanowi przedłużenie wstawki. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. jakie zachodzą podczas spermiogenezy. które są umiejscowione po przeciwnej. który jest nazywany diktiotenem. które wykazują zdolność do samoodnawiania. a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego. Podziały te są zsynchronizowane. Pierwszy podział prowadzi do powstania dwóch spermatogoniów. Główne zmiany. która jest określana jako syncytium. W ten sposób wszystkie oogonia. wstawki znajdującej się u podstawy główki. 2) zgrupowaniu mitochondriów w pobliżu centrioli. w której jest umiejscowione jądro komórkowe i akrosom. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. w stosunku do akrosomu. będące w stadium diktiotenu. stem cells). Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. 3) wykształceniu na bazie centrioli włókna osiowego witki. w wyniku którego powstają plemniki. Dojrzały plemnik zbudowany jest z główki. który okrywa górną część jądra komórkowego znajdującego się w główce plemnika. oraz witki. Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. 44 . w których komórki linii płciowej lokują się w części korowej gonad. które niezwłocznie rozpoczynają podział mejotyczny. z których jedna komórka zajmuje miejsce pierwotnego spermatogonium. Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki. a druga podlega dalszym podziałom. 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach. Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu. czyli komórek nie w pełni zróżnicowanych. powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych. polegają na: 1) przekształceniu aparatu Golgiego w akrosom. w której zgrupowane są mitochondria. 2-19). po zakończeniu mejozy. stronie jądra komórkowego. która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. Oocyty przechodzą w stan spoczynkowy. zostają przekształcone w oocyty I rzędu. a jest ich najczęściej sześć.geneza. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu. 2-20). czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika. Ostatecznie. które rozpoczynają podział mejotyczny. nie kończą się cytokinezą. Następne podziały mitotyczne spermatogoniów. które występowały w jajniku.

pewna część pęcherzyków rozpoczyna wzrost.Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. Oocyt I rzędu kończy pierwszy podział mejotyczny. przed owulacją następuje ponowne uruchomienie podziału mejotycznego. Dzieje się to na drodze wyrzucenia przez oocyt zawartości 45 . Oocyt znajduje się w stadium metafazy II. W pęcherzykach. a w nich rozrasta się również oocyt. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. który jest wspomagany przez otaczające komórki pęcherzykowe. regulowanych hormonalnie. W kolejnych cyklach płciowych. Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki. w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu. to może nastąpić dokończenie oogenezy. których wzrost był wystarczająco intensywny. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji.

a drugie reprezentujące zestaw chromosomów żeńskich. w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego. podlega dekondensacji i powstaje przedjądrze męskie. a chromatyna plemnika. znajdujących się pod powierzchnią oocytu. Zapłodniony oocyt II rzędu przekształca się w zygotę. który zapłodnił oocyt. Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny.ziaren korowych. po czym następuje telofaza II. które pozostały w oocycie 46 . do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. która staje się barierą nie do pokonania dla plemników. Powoduje to „utwardzenie" osłonki przejrzystej. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie.

. Zawartość DNA wzrasta do poziomu 4C. Do takich oocytów. kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro). z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II). W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja). Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. samic dawczyń do rogów macicy tzw. przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. można wprowadzić techniką elektrofuzji komórkę somatyczną. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii). Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki. z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA. Warto zauważyć. Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. zygotach. inseminacja. Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu. U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów. do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy. które są określane jako enukleowane. a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów). że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne). co powoduje. pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). Na przykład. W taki właśnie sposób sklonowano słynną owcę Doiły. jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu. samic biorczyń. profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. zarodkach.po zakończeniu drugiego podziału mejotycznego. że zygota jest gotowa do rozpoczęcia podziału mitotycznego. które umożliwiają uzyskiwanie potomstwa pożądanej płci.

D. Budowa kwasów nukleinowych Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych. McCarty. Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości. przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy. a także o strukturze cząsteczek rybosomowego (rRNA). Watson i F. W 1953 roku J. które z kolei podlegają rekombinacjom podczas mejozy. a przez następne lata rozszyfrowywano kod genetyczny. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA). Po pierwsze. Badania te przeprowadzili badacze amerykańscy O. DNA charakteryzuje się trzema właściwościami. informacja o pierwszorzędowej strukturze białek.M. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA. C. czyli replikacji. za pomocą kodu genetycznego. który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. czyli procesowi generującemu pierwotną zmienność genetyczną. transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. MacLeod i M. w sekwencji nukleotydów zapisana jest. W ślad za tym odkryciem nastąpiły następne. Avery.Rozdział 3 Gen i jego ekspresja Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi. Z kolei proces ekspresji 48 . Po trzecie.1. Crick przedstawili model budowy DNA. Po drugie. które są niezbędne do pełnienia funkcji nośnika informacji genetycznej.T. DNA może podlegać mutacjom. DNA ma zdolność do samoodtwarzania się. 3.

DNA Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. i tRNA (transportujący RNA). 3-1). który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów. a rzadziej podwójny heliks. w którego skład wchodzą: zasada azotowa. Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi 49 . cukier deoksyryboza i reszta kwasu fosforowego (ryć. W DNA występują cztery zasady azotowe. helix).1. Podstawową jednostką struktury DNA jest deoksyrybonukleotyd. które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C).1. rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów. które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji.genu jest nierozerwalnie związany z RNA. 3. W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy. występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu. Struktura ta określana jest w języku polskim terminem podwójna helisa (ang.

powstaje pre-rRNA o stałej sedymentacji 45S. Podczas transkrypcji. Pomiędzy zasadami powstają słabe wiązania wodorowe. Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą. W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA). bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności. w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). 3. 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang. Przyjmuje się. Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji. Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku.2. a w parze GC trzy takie wiązania.8S.z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. prowadzonej przez polimerazę I RNA. Trzy rodzaje rRNA: 5. a w przypadku mRNA także dla procesu translacji. a naprzeciw guaniny znajduje się cytozyna. który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha. Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane. tzn. inaczej nazywanych przewężeniami wtórnymi. lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA. czyli każdy łańcuch ma koniec 3' i 5'. natomiast liczba aktyw50 . W jąderku zlokalizowane są cztery rodzaje rRNA. że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA.1. polskim lub bp od słów angielskich base pairs). RNA Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych. tak więc w parze AT są dwa wiązania wodorowe. naprzeciw adeniny zawsze występuje tymina. nucleolar organizer region — NOR). określaną wielkością S — stała sedymentacji. Przeciwna polaryzacja polega na tym. Długość cząsteczki DNA wyraża się liczbą par nukleotydów. Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla. Taka organizacja podwójnej helisy DNA sprawia. że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. które są wyróżniane ze względu na wielkość cząsteczki. którego długość wynosi około 14 000 pz.

co oznacza. która katalizuje związanie tRNA z. tzn. które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. a trzy pozostałe rodzaje. 5. 51 .nych obszarów. 5S. występujący w wielu powtórzeniach w innej części genomu. które podlegają transkrypcji. Na końcu 3' cząsteczki tRNA występuje sekwencja CCA. W nici takiej mogą jednak występować fragmenty komplementarne. zlokalizowane są w podjednostce dużej (60S). zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu. jest zmienna. Wymienione rodzaje rRNA uczestniczą w budowie rybosomu. Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów. a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć. o mało poznanej funkcji.8S i 28S. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. że przekracza liczbę znanych aminokwasów. 2) pętla II — antykodonowa. zawiera układ trzech nukleotydów. 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem. Czwarty rodzaj — 5S rRNA jest kodowany przez gen. 3) pętla III — dodatkowa. w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas.właściwym aminokwasem. Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA). W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową. który jest zaangażowany w dostarczanie aminokwasów do rybosomów. które są komplementarne do kodonu aminokwasu transportowanego przez tRNA. Geny 5S rRNA są transkrybowane przez polimerazę III RNA. czyli takich. 3-2). Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60.

52 .Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych. Replikacja DNA Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego. a także regulacji ekspresji genów. modyfikacji nukleotydów.2. Podobnie jest w przypadku mejozy. Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji. z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji. liczba replikonów w genomie ssaków szacowana jest na około 25 000. Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach. a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów. Każdy podział mitotyczny musi być poprzedzony replikacją. Na przykład. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. określana terminem niekodujący RNA (ncRNA — ang. że jest to bardzo ważna grupa RNA. Na uwagę zasługuje jeszcze jedna klasa RNA. noncoding RNA). bądź mejozy. czyli mitozy. Ostatnie badania wykazują. które określane są jako replikony. 3. która bierze udział w procesie wycinania intronów z pre-mRNA.

który ma być wbudowany w procesie biosyntezy białka. że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego. Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne. widełki replikacyjne (ryć. a nić powstająca w sposób nieciągły opóźnioną. Od tej zasady są tylko nieliczne wyjątki. Po drugie. które nie kodują żadnego aminokwasu. w obrębie danego odcinka DNA. Kod genetyczny Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego. tzn. który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). tzn. Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. Oznacza to. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów. a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. które następnie są łączone przez enzym ligazę w ciągłą nić. W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. mającego charakter trójkowy. są różne. który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym. Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. kodon UGA w kodzie uniwersalnym jest 53 . 3-3). na których w sposób komplementarny syntetyzowane są drugie łańcuchy. W ten sposób powstają tzw. Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. Wynika z tego.Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). Drugi. Po pierwsze. komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. jest on uniwersalny. 3-1).3. Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA. np. że sekwencje nukleotydów w tych łańcuchach. które dotyczą niektórych kodonów w mitochondrialnym DNA. 3. to ogółem możliwe jest utworzenie 64 trójek (tab. o czym była już mowa wyżej. tzn. fragmenty Okazaki). w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. rozpoczyna część kodującą genu. że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). takie. Tryplet AUG. kod ma charakter trójkowy. Rozplecione łańcuchy polinukleotydowe stanowią matryce. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą. tryplet) w DNA zawierają informację o aminokwasie. trzy kolejne nukleotydy (kodon.

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA. Niemniej znanych jest już wiele mechanizmów. budowa struktur komórkowych itp. replikacja DNA. że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu. Jest to bardzo złożony proces. Wśród nich znaczną grupę stanowią geny pełniące tzw. Warto pamiętać. podatność na stres itp. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji. Mechanizm ten nazywa się alternatywnym składaniem mRNA. Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu. wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. Regulacja ekspresji genu W genomie ssaków występuje około 35 tysięcy genów. poligeny. że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele. jest włączana i wyłączana ekspresja różnych genów. obok genów ulegających powszechnej ekspresji. potranskrypcyjnej modyfikacji mRNA. które są zaangażowane w kontrolę ekspresji genów. W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw. Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki. elektroforeza białek. hybrydyzacja ze znakowanym przeciwciałem itp.3.). obejmuje także inne procesy.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. takie jak: przemiany energetyczne.lub heterozygotycznym. oprócz zmian opisanych w podrozdziale poświęconym transkrypcji. Podczas rozwoju ontogenetycznego. czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. Z drugiej strony. funkcje gospodarza komórki (ang. co ma oczywiście związek z ekspresją genów. translacji i potranslacyjnej modyfikacji białka. w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. Należy jednak pamiętać. regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. w jakim kierunku różnicuje się dana komórka. które mogą występować w układzie homo. obecność rogów. umaszczenie. Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. badania serologiczne — grupy krwi. w skład którego będą wchodziły różne kombinacje eksonów. Zakończenie transkrypcji związane jest z sekwencją AAUAAA. Modyfikacja mRNA. którego całościowe poznanie wymaga jeszcze wielu lat badań. która wskazuje. czyli dobudowa60 . zależnie od tego. zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. housekeeping genes).7. Ekspresja genu obejmuje procesy: transkrypcji.

są zaliczane do następujących grup: białka zawierające tzw. Okazuje się. które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji. modyfikacjom polegającym na zmianie sekwencji nukleotydów. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. palce cynkowe (ang. czyli od jego stabilności.1. dodatkowego kodonu stop. powstałe na bazie tego samego matrycowego DNA. Wymienione struktury wchodzą w kontakt z nicią DNA. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik 61 . Forma rozpuszczalna tego białka powstaje na matrycy mRNA. zależnie od ich struktury trzeciorzędowej. przed przejściem do cytoplazmy. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang. Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. Funkcjonują wówczas dwa rodzaje mRNA. Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć.in. zinc finger). Taką formę modyfikowania mRNA opisano m. a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. 3-7).7. ogonek poliA) na końcu 3' mRNA. Efektem tego może być na przykład pojawianie się w transkryptach. 3. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych. Wreszcie mRNA powstały podczas transkrypcji może ulegać. Czynniki transkrypcyjne. w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA). takich jak hormony. Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie. powstających w niektórych tkankach. Proces ten nazywa się redagowaniem mRNA. Białka te w swojej strukturze zawierają dwa istotne obszary. leucine zipper). odpowiedzialne za syntezę polipeptydów o różnej długości. który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. Czynniki transkrypcyjne Czynnikami transkrypcyjnymi nazywane są białka. białka o strukturze typu heliks-skręt-heliks (ang.nie sekwencji poliA (tzw. że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty.

HS — hormon steroidowy. gdy do receptora jest przyłączony hormon steroidowy. R — receptor hormonu peptydowego. Domena wiążąca DNA jest aktywna tylko wówczas. Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. Wiązanie takie wywołuje wiele reakcji. Oznaczenia: HP — hormon peptydowy. Pl P2 — promotory genów. hormon wzrostu. insulina itp. co można uznać za regulację ekspresji genów na etapie potranslacyjnym. Geny homeotyczne Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych.Ryć. Gj. lub też z udziałem przekaźników modyfikujących białka w cytoplazmie. T1 T2 — przekaźniki wewnątrzkomórkowe.2. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników. G2 — części strukturalne genów transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu. 3. których mechanizm działania jest jeszcze słabo rozpoznany. Poznanie genów od62 . a jedynie wiążą się z receptorami błonowymi.7. Schemat regulacji ekspresji genów za pomocą hormonów. 3-7. RS — receptor hormonu steroidowego. Hormony peptydowe (np. a z drugiej strony od różnicowania się komórek.) nie wnikają do wnętrza komórki.

a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie. HOX3 i HOX4. Rozwój muszki owocowej przebiega pod kontrolą genów. ANT-C i BX-C. w liczbie około 30. Geny te funkcjonują w układzie hierarchicznym. które w genomie muszki owocowej występują w dwóch kompleksach. Obok wielu genów. Okazało się. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji. które odpowiadają za poszczególne etapy morfogenezy. że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się. Metylacja DNA Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA. tzn. że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów. Oznacza to. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia. Wynika z tego. zgrupowane są w czterech kompleksach: HOX1. że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej. ich ekspresja następuje w ściśle określonej kolejności. HOX2. a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. homeoboks). Trzeba jednak podkreślić. która koduje fragment białka (tzw. U ssaków geny te. że około 56% genów zawiera te sekwencje. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. Prawie cały DNA zawiera zmetylowaną cytozynę. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. czego skutkiem jest przejście DNA w stan nieaktywny. Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. Struktura tych genów wykazuje zaskakujące podobieństwo.7. domena białkowa) o długości 60 aminokwasów. Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną. położonych w jednym chromosomie. 3.powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących 63 .3. Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks. że mają one sekwencję o długości około 180 pz (tzw.

Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. typowy dla danej płci (ryć. dobrze rozwijały struktury trofoblastu. niedorozwinięty zaś był sam zarodek. Powstałe na drodze manipulacji zarodki ginogenetyczne. genotyp Aa jest równoważny genotypowi aA. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych. Piętno gametyczne W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze. W obu przypadkach dochodziło do obumarcia zarodka. rozwijały się dość dobrze. w której cytozyny nie są metylowane. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. jeśli pochodzą od ojca. zależną od tego.4. tzn. Jeden z nich -— HpaII przecina sekwencję CCGG. czy od matki. to 64 . czy niemetylowana. czyli nie wpływa na prawidłowość replikacji wysepek CpG. jak i męski rozwijały się prawidłowo. mające dwa genomy męskie.7. Dowód na to. czy allel pochodzi od ojca. 3-8). wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego. 3. od matki. tzn. gametic imprinting). czyli ze strony końca 5'. jak i genom matki. zawierające dwa genomy żeńskie. znane są liczne geny. a od którego allel a. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca. czyli nieistotne jest. w które zaangażowane są fragmenty podlegające piętnowaniu. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna. czyli uczestniczące w formowaniu łożyska. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną. Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych. a drugi — MspI przecina tę sekwencję niezależnie od tego. że do rozwoju osobniczego niezbędny jest zarówno genom ojca. dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. Jedynie zarodki zawierające zarówno genom żeński. które mogą być nieaktywne. Natomiast zarodki androgenetyczne. tzn. z tym jednak że struktury wywodzące się z trofoblastu.w części poprzedzającej gen. Zjawisko to niekiedy dotyczy całych regionów chromosomowych. gdy pochodzą np. czy cytozyna jest metylowana. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję. lub aktywne. a także w komórkach somatycznych organizmu dorosłego. a nie tylko diploidalna liczba chromosomów. od którego z rodziców pochodzi allel A. były zdecydowanie niedorozwinięte.

Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony. który nosi nazwę zespołu Pradera-Willego. brak mowy. M — chromosom pochodzący od matki wówczas rozwija się zespół zmian fenotypowych (m. Podobna sytuacja powstaje.in. Tak więc. W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego. gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). Piętnowanie gametyczne. tylko jeden gen — UBE3A nie podlega ekspresji. P — chromosom pochodzący od ojca. gen SNRPN — ang. a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m. głębokie upośledzenie umysłowe. 3-8. ubiquitin protein ligase E3) pochodzenia matczynego. otyłość i niedorozwój umysłowy). że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego. Wynika z tego. natomiast kilka genów (m. drgawki) określanych jako zespół Angelmana. a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym. Przyjmuje się.in. smali nuclear ribonucleoprotein polypep65 . W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. Wiadomo.M r ZYGOTA 2ENSKA M P ZYGOT-A MĘSKA Ryć. podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska). że fragment chromosomu 15 podlega piętnowaniu gametycznemu. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca. a inny w gametogenezie żeńskiej. jeśli pochodzi od ojca.in. że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej.

które podlegają piętnowaniu gametycznemu u myszy. a także 11 i 12 podlegają piętnowaniu. albo matczynego. do którego nie może się przyłączyć białko (represor). W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX). 66 . które są objęte zjawiskiem piętnowania gametycznego. że inaktywacją chromosomu X jest formą piętnowania. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych. W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji. czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego. Inaktywacja chromosomu X w zarodkach żeńskich Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. wywołujące zahamowanie transkrypcji. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. Okazało się. 3. Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego. W efekcie oba allele są transkrybowane. W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. W komórkach żeńskich występują dwa chromosomy X. ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. W komórkach męskich występuje tylko jeden chromosom X. obok chromosomu Y.tide N). Sytuacja ta jest spowodowana tym. duże fragmenty chromosomu 7. że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. Stan taki określany jest terminem hemizygotyczności.7. że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca. Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. które zachodzi podczas wczesnego rozwoju zarodkowego. niezbędnych do podjęcia transkrypcji. W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X. Może się jednak zdarzyć. nie ulega ekspresji. a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego.5. Przykładem może być gen Igf2 (ang. który podlega piętnowaniu podczas gametogenezy żeńskiej. które podlegają metylacji. Obecnie znane są 34 geny. W genie tym występują dwa regiony. jeśli są położone w chromosomie pochodzącym od matki. Na przykład. co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych. insulin growth factor type 2) u myszy.

.

że nieaktywny chromosom X jest replikowany w późnym okresie fazy S.Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. Później. w której część komórek ma aktywny chromosom pochodzenia ojcowskiego. Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R. a część pochodzenia matczynego (ryć. Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X. albo w chromosomie ojcowskim. W konsekwencji organizm żeński jest swoistą mozaiką. albo matczynym. ekspresja genu Xist pojawia się losowo. który to stan jest utrzymywany w komórkach potomnych. ciałka Barra. W centrum inaktywacji zidentyfikowano locus Xist (ang. które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. Spełnia on funkcję regulacyjną. X inactive specific transcript). 3-9). a jego obecność ujawnia się w postaci tzw. . w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X. Barwienie to pokazuje. Inaktywacja jest związana z metylacją DNA danego chromosomu. Warto zaznaczyć. W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X. Wiadomo. Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym. który pełni główną rolę w uruchomieniu inaktywacji. że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3. że produktem locus Xist jest niekodujący RNA (ncRNA). W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu.

w zależności od ich mechanizmu działania.Rozdział 4 4. W celu ochrony własnego DNA przed działaniem restryktaz. które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak. Nazewnictwo endonukleaz tworzone jest w ten sposób. Endonukleazy dzieli się na trzy klasy. druga i trzecia — gatunku. a także kofaktorów. nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. Do klasy I enzymów 69 . strawienia) DNA. Jeden to endonukleazy.1. System ten polega na tym. bakterie wykształciły system restrykcji-modyfikacji. Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz. Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów. drugi to metylotransferazy (zwane też metylazami). substratów i produktów. następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii. co umożliwia np. metody in situ) bądź w wyizolowanym DNA lub RNA. rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów. obce cząsteczki DNA. np. Większość metod wymaga fragmentacji (pocięcia. ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii. Ponieważ obcy. że pierwsza litera stanowi skrót nazwy rodzaju bakterii. że bakterie wytwarzają dwa rodzaje enzymów. Endonukleazy restrykcyjne Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. wirusowy. niszcząc niepożądane. by nie zostały przecięte przez endonukleazy. niszczony jest przez endonukleazy bakterii. enzym HindIII pochodzi z bakterii Haemophilus influenzae. Na przykład. serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. DNA nie jest odpowiednio oznaczony (zmetylowany).

Tabela 4-1 Przykłady enzymów restrykcyjnych 70 . że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. utrudniającą ich wykorzystywanie w analizie DNA. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I. czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna.zaliczane są te restryktazy. iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów. które wykazują aktywność nukleazy. jony magnezu (Mg2+) i S-adenozylometionina. jest to. Różnica między tymi dwiema klasami polega na tym. ale wzmacnia ich aktywność). Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1. ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. a ich działanie zależy od obecności takich kofaktorów. jak ATP. Cechą tych enzymów.

Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum) przecinają rozpoznaną sekwencję w różnych miejscach: . rozpoznają te same sekwencje DNA. rzadziej 8 nukleotydów. Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach. mogą być różne. charakteryzujące się dwustronną symetrią (tzw. w których enzymy przecinają te sekwencje. sekwencje palindromowe). czego konsekwencją jest powstawanie fragmentów DNA o tzw. Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję: Niektóre enzymy. Jednak miejsca. tępe końce. 4-1). Są to izoschizomery. dając fragmenty mające tzw. mimo że pochodzą z różnych szczepów bakterii. Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie.Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6. lepkich końcach. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej.

a tylko nieliczne enzymy (np.. Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora.. do którego fragment ten został uprzednio włączony (rekombinacja molekularna)... W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii). sekwencjonowania DNA..CCTAC(N)13.CTTCT(N)7. opisane pod względem fizycznym i genetycznym. aby wstawiając 72 . którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji. drożdżowy) jest zdolny do autonomicznej replikacji. wykorzystywanym m. fagowy. izolacji i identyfikacji genów.in.2. Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'. Niektóre enzymy potrzebują takich samych buforów... plazmidowy. do sporządzania map genomowych....3' 3'. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne.3' 3'. w której mieszanina DNA z enzymem jest inkubowana. Wektory Wektory są podstawowym narzędziem klonowania DNA.GAAGA(N)8'.5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA.GGATG(N)9'... • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców).. klonowania molekularnego i rekombinacji genów czy fragmentów genomu. • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki. diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP). mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych. Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą. Są one podstawowym narzędziem... Wektor (np. HinPI) tną jednoniciowy DNA. Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA. 4. • powinny mieć jeden lub kilka silnych promotorów tak. oraz składem buforu..5' podobnie enzym FokI (Flavobacterium okeanokoites): 5'.od rozpoznawanej sekwencji.

którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. rozkładający barwny substrat. korę mogą stanowić zagrożenie ekologiczne. Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori. Za pomocą modyfikacji molekularnych (np. • ze względów etycznych wektor nie powinien mieć genów. przedstawiony jest na rycinie 4-1. za pomocą których można je ziden tyfikować. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. np. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. np.w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów. Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych. który ma długość 2686 par zasad. • nie są zdolne do przeżycia poza komórką gospodarza. Przykładowy wektor plazmidowy pUC19. Podobnie jak 73 . • zawierają znaczniki (markery). Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. plazmidy i kosmidy. i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych. gen β-galaktozydazy oznaczony symbolem lacZ. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd. Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie. RODZAJE WEKTORÓW Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi). Wektory plazmidowe Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. Najczęściej jest to gen kodujący enzym. Kosmidy służą do klonowania większych cząsteczek DNA. „polilinker" (miejsce wielokrotnego klonowania). Kosmidy Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. geny oporności na antybiotyki. Wektory fagowe Spośród wektorów fagowych największe znaczenie ma fag λ. długości 10-40 kpz. gen oporności na antybiotyk.

Schemat wektora plazmidowego pUC19. którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu. krowianki. coli. drożdżach. wadą natomiast organiczona długość wbudowanego obcego DNA. Są one również stosowane w somatycznej terapii różnych schorzeń. Do klonowania fragmentów DNA w organizmach eukariotycznych (np. ale efektywność tego działania jest większa. 4-1. bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. Wektory drożdżowe Wektory te wykazują zdolność replikacji tak w komórkach drożdży. komórkach ssaków) stosowane są: Wektory — pochodne wirusów Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych.Ryć. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych. bakulowirusów. adenowirusów i retrowirusów. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). Najwcześniej był stosowany wirus SV40. do wektorów fagowych wprowadzono polilinkery. W przypadku komórek zwierzęcych są to pochodne wirusów SV40. Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz w przypadku wektorów plazmidowych. jak 74 . Sztuczny chromosom bakteryjny (BAC) Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang. Papilloma. geny markerowe i silne promotory.

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

przerwa. że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. Enzymem używanym do tej reakcji jest termostabilna ligaza. a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach. W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego. np. Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje. co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych). Te dwa etapy są powtarzane. amplifikując badany gen (odcinek DNA). Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami). z zastosowaniem biotyny. reverse transcription-polymerase chain reaction). Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. która łączy specyficznie dwa przyległe oligonukleotydy. wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji. mutacja punktowa). Nie może być natomiast 81 . W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C). Odwrotna transkrypcja-PCR. RT-PCR (ang. gdy są one zhybrydyzowane z komplementarną matrycą. wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. Reakcja ta stosowana jest do wykrywania mutacji punktowych. Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego.

które przyjmują określoną konformację przestrzenną. RNA: RNA i RNA: DNA istnieją wiązania wodorowe. między nićmi DNA:DNA. iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją. Konformacja ta zależy od sekwencji nukleotydów. Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod. Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA.5. Jeśli badany DNA pochodzi od nosiciela zmutowanego genu. W tych przypadkach może być stosowana metoda RT-PCR. np. Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej. Techniki hybrydyzacji i sondy molekularne Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe. to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany.wykorzystana w badaniach ekspresji genów. jak również do wykrywania wirusów. Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. które jest oczywiście najbardziej precyzyjne. Jak wiadomo. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to. bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA). Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. polegająca na tym. SSCP (ang. RFLP lub sekwencjonowania. jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością. których materiałem genetycznym jest RNA. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA. single stranded conformation polymorphism). w których określana jest ilość mRNA. Polimorfizm konformacji jednoniciowych łańcuchów DNA. a następnie jego denaturacji i elektroforezie. 4. które ułatwiają ten 82 .

Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy. takich jak hybrydyzacja Southern blotting (DNA). Zjawisko to stało się podstawą metod analizy kwasów nukleinowych. Fragmenty te są następnie zatrzymywane na filtrze. który przenikając przez żel zabiera ze sobą fragmenty DNA. by było możliwe wykrycie powstałej hybrydy. który jest nicią pojedynczą. Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy. wirusów lub organizmów wyższych). gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA.proces. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). jednak niewielką rozdzielczością. Sonda musi być odpowiednio wyznakowana. nie wymaga etapu denaturacji.3 dnia.71 MeV — megawoltów). lżejsze. Izotop ten jest stosowany do znakowania DNA i RNA. Znakowanie izotopowe charakteryzuje się dużą czułością. do 500 par zasad). że można ją stosować nawet wówczas. 83 . By była możliwa hybrydyzacja sondy z badanym DNA. Technika northern blotting. Sposób znakowania sond można podzielić na dwie główne grupy: 1. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. dCTP i UTP a 32P. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P). stosowana w hybrydyzacji kwasu rybonukleinowego. klonowane sekwencje lub syntetyczne oligomery stosowane w PCR. który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1. czyli cięższe fragmenty) lub poliakryloamidowym (krótsze. czas półtrwania 14. Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. Ogromną zaletą hybrydyzacji jest to. Znakowanie sond. Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe. Wadą sond znakowanych izotopem jest również to. a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP. Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej. kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego). iż muszą być stosowane wkrótce po ich wyznakowaniu.

Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. okres półtrwania 87. w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą. Hybrydyzacja na filtrach. ale daje mniejszą czułość detekcji. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach. Hybrydyzacja jest poprzedzona prehybrydyzacją. Hybrydyzację przeprowadza się z reguły w temperaturze 68°C. używany jest do znakowania kwasów nukleinowych. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura. 84 . Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego). głównie DNA. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji.26 roku.167 MeV). Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę. z wyjątkiem obecności sondy. Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S. iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. który emituje promieniowanie β (energia promieniowania E = 0. Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny. w zależności od zastosowanego znacznika. emitujący promieniowanie β. Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C). Hybrydyzację z wyizolowanym DNA można przeprowadzać. Podstawowym źródłem trytu jest trytowana tymidyna. 2.018 MeV). a detekcja sygnału jest poprzez autoradiografię (ryć. Znakowanie nieizotopowe zapewnia dobrą rozdzielczość.• izotop siarki (35S).1 dnia. które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0. stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+. Zaletą tej metody jest to. Na wydajność hybrydyzacji wpływają także inne czynniki. • tryt (3H). Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np. Przyjmuje się. że różnica ta powinna wynosić 20-25°C. jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg). gdy jest on unieruchomiony na filtrze. digoksygeniny). tak powstają pochodne nukleotydów. której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). w której przebiega hybrydyzacja. okres półtrwania 12. biotyny. głównie DNA. Znakowanie sond można przeprowadzać za pomocą kilku różnych metod. 4-6). Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych.

określana jako technika mikromacierzy DNA.in. W metodzie zwanej „odcisk palca" DNA (ang. Metoda hybrydyzacji służy m. do wykrywania ściśle określonych fragmentów DNA (np. Metoda ta nosi nazwę hybrydyzacji in situ (ISH). Jej różne warianty są opisane w rozdziale: Mapy genomowe. 85 . fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. również hybrydyzacja może być przeprowadzana na preparatach chromosomowych. Hybrydyzacja w zminiaturyzowanej postaci. Podobnie jak metoda PCR. Na niewielkiej płytce (ok. pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana. w diagnostyce chorób).Wykorzystanie metody hybrydyzacji. l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja).

ATAGCTT . Polimorfizm fragmentów restrykcyjnych DNA (RFLP) Polimorfizm fragmentów restrykcyjnych DNA (ang.. natomiast dalej będą prążki o zmniejszającej się masie. Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'.3' 3'. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus.... tym szybciej. Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll): GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA: GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA.5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości..6. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu. Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych.ATCCAGTCCTCGCCTGATTTCGAA. Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP).A-. Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym.4. Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału. Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego.. Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu..TTCGA.AGGCTAT 86 . czyli lżejsze.

czyli eksony. sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). Proces ten jest opisany w części dotyczącej klonowania DNA. Geny o dużym efekcie. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe. metoda rekombinacji molekularnej. Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii. W zależności od wielkości fragmentów DNA używane są różne wektory. natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory.7. wśród nich są geny determinujące cechy jakościowe. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA. Biblioteki genomowe i genowe Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe. Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów. 4. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka. Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA. Tworzenie biblioteki genowej (cDNA) Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. jak kosmidy. quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. wprowadzonych za pomocą wektorów do bakterii. omówiona wcześniej. Jest on amplifikowany 87 . Tworzenie biblioteki genomowej Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym. Tak otrzymany cDNA zawiera tylko sekwencje kodujące.Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz. 11 pz i 7 pz. Interseksualizm. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania. których budowa molekularna jest znana. Materiałem wyjściowym w tym przypadku jest RNA. Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe). a także ilościowe (ang.

Sangera. Biblioteka genomowa jest również przydatna w poszukiwaniu genu. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. o którym niewiele wiadomo. która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą). Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda. chromosome walking). W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen. Sekwencjonowanie DNA Sekwencjonowanie DNA. Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. Postępujemy tak do momentu. Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej. przeprowadzane są cztery oddzielne reakcje syntezy DNA. ddCTP. polegające na określeniu sekwencji nukleotydów. 4. Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. bufor reakcyjny. polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP. mieszaninę deoksynukleotydów. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej). której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. starter.8. wykorzystuje się bibliotekę genomową. gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen.metodą PCR. Każda z czterech probówek zawiera matrycowy DNA. W ten sposób każdy klon bakterii ma cały określony gen. nieznany jeszcze fragment. terminatorów) jest zakończenie syntezy nici 88 . 4-7). Rolą tych dideoksynukleotydów (tzw. Metoda enzymatyczna została opracowana w 1977 roku przez F. Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań. ddGTP lub ddTTP (ryć. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. a następnie rekombinowany z wektorem i wprowadzany do bakterii. przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy. Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. czyli reakcji antygen-przeciwciało. jest stosowane dość często w genetyce molekularnej.

W celu detekcji prążków DNA. kończące się odpowiednim nukleozydem. metodą autoradiografii.autoradiogram żelu sekwencyjnego Ryć. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera. Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm.6 mm). 10 :219-237. w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89 . ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany. Postępy Biologii Komórki. 4-7. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki. 1998) komplementarnej w miejscu włączenia określonego dideoksynukleotydu. W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości..2-0. grubości 0. by tylko część syntetyzowanych fragmentów DNA uległa terminacji. 25 supl. kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp. zależnie od użytego w reakcji dideoksynukleotydu.

1998) 90 . Do rozszczepiania wykorzystywane są hydrazyna. podobnie jak przy metodzie enzymatycznej. Metoda chemiczna. 4-8. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta. 10 :219-237. siarczan dimetylu (DMS) i kwas mrówkowy. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. Postępy Biologii Komórki. ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. które mają zdolność modyfikacji zasad w cząsteczce DNA. polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów. 4-8): autoradiogramżelusekwencyjnego Ryć. kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp. 25 supl. Enzymatyczna metoda sekwencjonowania ma tę zaletę.. Sekwencjonowanie metodą chemiczną przeprowadza się. która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. że jest szybka.kleotydy lub wyznakowany starter. w czterech oddzielnych probówkach. Do mieszaniny reakcyjnej dodawana jest także piperydyna. opracowana w 1977 roku przez Maxama i Gilberta.

Najnowsza metoda sekwencjonowania. pozwala także na wyróżnienie grup komórek. ale są inne pod względem biochemicznym. Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA. do zygoty myszy szczurzego genu hormonu wzrostu. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów. tzw. autoradiografia i odczytanie sekwencji nukleotydów. 4. Zwierzęta transgeniczne to takie.10. zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba). Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80. Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA. Różnią się one od innych komórek ekspresją pewnych genów. podobnie jak w metodzie enzymatycznej. przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny. Badanie ekspresji genów Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek. które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika.W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca. 4. które morfologicznie nie różnią się od sąsiednich. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego. Następnym etapem. Transgeneza Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. Podobne 91 . jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym. pyroseąuencing. Samce transgeniczne przekazywały swojemu potomstwu obcy gen. Jedna z wymienionych metod. northern blotting. RT-PCR) i translacji (western blotting). kilka firm oferuje specjalistyczną aparaturę. hybrydyzacja in situ na skrawkach tkanek. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji.9. których długość zależy od miejsca rozszczepienia łańcucha DNA. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane. nieaktywnych w komórkach zdrowych. natomiast samice były niepłodne. Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. znacznie różni się od powyższych metod.

embryonic steam cells). około 8 kpz. growth hormone — GH). w którym miejscu genomu włączy się transgen. nawet niekorzystne. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. Należy jednak zauważyć. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich. np. że w procesie transgenezy wprowadzane są konstrukty genowe. ogranicza jej stosowanie. W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro.rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu. umożliwiającej ukierunkowaną ekspresję transgenu (np. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza. blastocyst pozbawionych węzła zarodkowe go). Jak dotychczas opisana technika jest stosowana z sukcesem u myszy. w gruczole mlecznym). Wykorzystanie techniki transgenezy 1. Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost. które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu. • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. Na razie nie mamy żadnego wpływu na to. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC. który może być wprowadzony tą metodą. gen struktury hormonu wzrostu (ang. Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa. Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne. • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. najczęściej męskiego. 92 . Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. zapłodnionej komórki jajowej. które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego. Wielkość fragmentu DNA.

W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy. • modyfikacji cech biochemicznych u zwierząt. duże nadzieje wiąże się z poprawą jakości białek mleka. Odporność na choroby można uzyskać przez wprowadzenie do komórek 93 .• modyfikacji składu mleka. poprzez wprowadzenie do genomu owiec genów białek keratynowych. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie. na przykład poprawy jakości i tempa wzrostu wełny.

Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu. prowadzącej do odrzucenia przeszczepionego narządu. których celem jest ocena jego wpływu na wzrost. 2. które wykazują nadekspresję określonych genów. metabolizm węglowodanów i lipidów. Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym.zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych. Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. . Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem. ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych. ksenotransplantów) dla ludzi. świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. z powodu nadostrej reakcji układu immunologicznego biorcy. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc). świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię). 3. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw. najlepiej dominujące. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. krowy wytwarzające mleko z ludzką laktoferyną. laktację. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych. Zaletą tej metody jest to. których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii. iż samice transgeniczne wytwarzają mleko zawierające obce białko. W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. wykazujące karłowatość. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek.

obserwowanymi wśród organizmów żywych. a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. które były korzystne lub obojętne dla organizmu.Rozdział Mutacje Mutacje to nagłe i trwałe zmiany w informacji genetycznej. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji. chromosomowe i genowe. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy. przez następne pokolenia. przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji. a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych. Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. takich jak replikacja DNA czy podział jądra komórkowego. które uszkadzają DNA lub strukturę chromosomu (np. związane są z naruszeniem budowy chromosomu. cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych 95 . czyli takich. Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji. a ponadto. Dzieli się je na: genomowe. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas. Wreszcie mutacje genowe dotyczą zmian w budowie genu. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi. Mutacje chromosomowe. powstałych de novo. promieniowanie jonizujące. za pośrednictwem komórek płciowych. Należałoby zatem rozróżnić proces przenoszenia mutacji. nazywane też aberracjami chromosomowymi. Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. a poznanie ich podłoża wymaga zastosowania metod molekularnych. dlatego większość z nich jest niekorzystna dla organizmów. niektóre związki chemiczne). Mutacje mogą powstawać samoistnie. jako wynik błędów w przebiegu niektórych procesów komórkowych. W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu.

a oocyt II rzędu ma diploidalną liczbę chromosomów. 2. Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej. Na przykład. prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. pojawiające się od czasu do czasu na fermach zwierząt futerkowych.pokoleń. Znane są i inne mutacje. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik. 96 . wśród których do najważniejszych zalicza się (ryć. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. głównie żeńskiej. ponieważ obok mutacji szkodliwych (np. takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny). Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II. choroby genetyczne) znanych jest wiele przykładów pokazujących. która odbywa się już po wniknięciu plemnika do oocytu. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna. że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. z jakimi spotykamy się w hodowli zwierząt gospodarskich. Jeżeli powstają układy o większej liczbie genomów niż dwa. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów. Zaburzenie przebiegu mejozy. wysoka plenność u niektórych ras owiec (np. mutacja w genie BMPR-IB) itp. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista. to stan ten określa się jako poliploidalność. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych. Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości. zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia. monoploidia). a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. Dlatego można bez większych zastrzeżeń przyjąć. co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). Zdarzenia takie określa się mianem połispermii.1. które wpływają korzystnie na cechy produkcyjne zwierząt. W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji. Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego. 5. 5-1): 1. Mutacje genomowe Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie.

4. takich na przykład jak brak cytokinezy po podziale jądra komórkowego. Euploidie są mutacjami letalnymi. że prowadzą one do śmierci osobnika. np. Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka. czego skutkiem jest rozwój haploidalnego zarodka. to znaczy takiego. 5-1. Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności.Ryć. Mutacje te są jedną z przyczyn niepowodzeń 97 . zazwyczaj we wczesnym okresie rozwoju zarodkowego. W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo). Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym. 2n i 4n czy 2n i 3n itd. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności. tetraploidalne oogonium. np. Niektóre mechanizmy powstawania mutacji genomowych typu euploidii 3. co oznacza. Ponieważ komórki te wywodzą się z jednej zygoty. Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza). które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego. układ taki klasyfikowany jest jako mozaicyzm.

a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). Równocześnie wynika z tego. jaka jest skala tego problemu. Nieprawidłowa segregacja w jednym biwalencie. Trudno jednak określić. którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1. gdy oba chromosomy zmierzają do jednego bieguna komórki. Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela. w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. Klacz obarczona tą mutacją ma kariotyp 98 . że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych.w rozrodzie zwierząt. Tak więc brak chromosomu nazywa się monosomią (2n — 1). Jeżeli gamety takie będą uczestniczyły w zapłodnieniu. W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. 5-2a). zarodka) prowadzi do mozaicyzmu. Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. Zazwyczaj mutacje te stwierdzano w układzie mozaikowym. która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. Wskazuje to. jednak powodują powstanie licznych wad rozwojowych. Zdecydowana większość aneuploidii jest letalna. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki. Jeśli natomiast występuje brak obu chromosomów w parze. a nadmiar chromosomów to trisomia (2n +1). Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika. to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci. to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. Aneuploidia to druga kategoria mutacji genomowych. Wyjątek stanowią aneuploidie chromosomów płci. to stan taki określany jest jako nullisomia (2n —2).

2n = 63.XO/64. zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników. W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy.XY/61. dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego.X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63.XXY. Zwierzęta takie mają zasadniczo normalny eksterier.XX. Osobniki takie mają diploidalną liczbę chromosomów 61.XXY lub występuje u nich układ mozaikowy 60. 99 . Znane są również przypadki trisomii XXY u buhajów.

5-2b). translokacja wzajemna). Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu. ze względu na dość częste występowanie u klaczy monosomii chromosomu X. jest niemożliwe. albo głębokie zaburzenia rozwojowe lub bezpłodność. tandem fuzja. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni. Jest to skutek segregacji chromosomów w anafazie I. Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd 100 . to nastąpi utrata fragmentu chromosomu (delecja). Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. że osobniki mające w swoim kariotypie trzy chromosomy X są płodne. przez odpowiedzialne za to systemy naprawy komórkowej. gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela. niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy. że aneuploidie ilekroć się pojawiają. z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder.2. to zazwyczaj mają pochodzenie de novo. co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. a zatem i szerokiego rozprzestrzenienia w populacji. Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią. Mutacje chromosomowe Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych.Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością. 5. Dzięki temu. poza nielicznymi wyjątkami. Mogą powstać także inne nietypowe struktury. takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. bez zastosowania metod cytogenetycznych. W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza. Niemniej jednak. której zdiagnozowanie. Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu. podczas podziału komórkowego. Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. Przedstawione wyżej prawidłowości wskazują. Jeżeli pęknięcie nie zostanie naprawione. Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika. W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. nie ma ryzyka przeniesienia tej mutacji na następne pokolenia. a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu.

padnięcie po urodzeniu lub ubój z konieczności. inaczej centromerowe (translokacje robertsonowskie).i paracentryczne. prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. prowadzą do zmiany sąsiedztwa genów. izochromosomy). gdy występuje ona w komórkach linii płciowej. odnotowywane jako martwe urodzenie. Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje. buhaje). podobnie jak aneuploidie. że zdecydowana większość tych przypadków nie jest identyfikowana. lub też w układzie niezrównoważonym. nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych. a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. Zdarzyć się może. translokacje wzajemne i inwersje. Wynika to przede wszystkim z tego. Zaliczane są do nich: fuzje centryczne. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych. wyciszacz). Jeżeli dotknie to osobnika o dużej wartości genetycznej.niesiostrzanych podczas crossing over. czego skutkiem jest uruchomienie procesu nowotworowego. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas. fuzje tandemowe. że mutacje chromosomowe niezrównoważone. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. Mutacja chromosomowa może wystąpić w układzie zrównoważonym. translokacje wzajemne. fuzje centryczne. mają najczęściej negatywny wpływ na płodność nosiciela mutacji. jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej. których skutkiem jest przegrupowanie informacji genetycznej w kariotypie. są letalne lub prowadzą do poważnych. Z kolei mutacje zrównoważone. U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. które w momencie powstania mają charakter zrównoważony. inwersje. zauważalnych zmian fenotypowych. Znane są liczne przykłady u ludzi. Szczególna 101 . a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów. Przypadki takie. tandem fuzje. Inne — tzn. wśród których wyróżniane są inwersje peri. mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych. ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. duplikacje. Mutacje chromosomowe. bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć. występując pierwotnie w układzie zrównoważonym. jak i ze strukturą samego genu. gdy ilość informacji genetycznej w komórce została zmieniona. to szansa na wykrycie nosicielstwa mutacji jest znacznie większa. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor. wzmacniacz. bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np.

a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć.uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji. Fuzja centryczna (translokacja robertsonowska) powstaje wówczas. 5-3a. 102 . gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru.

Utrata małych fragmentów z okolicy centromeru. 5-4. zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom. buhaj. nie odbija się negatywnie na nosicielu.7). Translokacje robertsonowskie: (a) rob(l. barwienie roztworem Giemsy.29). chromosom translokacyjny oraz chromosomy pici są wskazane. (b) rob(5. Ryć. kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym. reprezentujące prawie cale ramiona długie chromosomów. który zawiera przede wszystkim niekodujące sekwencje powtarzalne. natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy).5-4a). kozioł. triwalent oraz biwalent X-Y są wskazane 103 . Duże fragmenty.

czyli ukształtuje się układ aneuploidalny. Opisano wiele różnych fuzji. W efekcie powstają gamety o zrównoważonej informacji genetycznej. że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób. 104 . Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych. to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom.). Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard. Jeżeli fuzji uległy chromosomy homologiczne. w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. Jeżeli komórka taka rozpocznie podział mejotyczny. a druga będzie miała n chromosomów.Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden. to w pachytenie profazy I uformuje się triwalent. ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. a w tym również w Polsce. że połowa gamet będzie typu n —l (układ powstający na biegunie. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. Prowadzi to oczywiście do tego. Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. jak poprzez badanie cytogenetyczne. podczas której chromosom dwuramienny przechodzi do jednego bieguna. 5-4b). Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. z tym jednak że wśród nich będzie chromosom dwuramienny. blonde d'Aquitaine itp. z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych. a oba chromosomy akrocentryczne do drugiego bieguna komórki. mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. co w rzeczywistości odpowiada układowi n + 1. W przypadku zapłodnienia powstają zygoty aneuploidalne. szczególnie ras mięsnych. do którego nie przeszedł chromosom dwuramienny). które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego. na wszystkich kontynentach. W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent. W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety. Fuzje centryczne są często identyfikowane u bydła. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła. gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. 5-4a). a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych. w których uczestniczyły chromosomy z różnych par. 5-3b. Zupełnie inaczej przedstawia się sytuacja. Pięć lat później ten sam badacz wykazał. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. podczas gdy na drugim biegunie zabraknie jednego chromosomu. W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji. Należy zaznaczyć. że jej nosiciele mają zmniejszoną płodność o około 5%.

dwóch par akrocentryków. jest lis polarny. włoskie bydło rasy podolian czy bydło korsykańskie). jedynych w kariotypie lisa. W Polsce. Przykładem może być fuzja między chromosomami z pary 5 i 22.a niekiedy także w małych izolowanych rasach lokalnych (np. Szwecja była pierwszym krajem. począwszy od 1989 roku. 5-5. który wprowadził taką regulację.29 zdiagnozowano wiele innych przypadków. Ryć. obowiązkowymi badaniami objęte są wszystkie młode buhaje. u którego fuzja centryczna występuje bardzo często. w których zaangażowane były chromosomy z innych par. nr 23 i 24). którą opisano w Polsce. Ciekawe. Chromosomy biorące udział w fuzji przedstawiono schematycznie 105 . Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. Oprócz fuzji 1. W tym przypadku można wręcz mówić o polimorfizmie kariotypowym. natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48. przed ich wprowadzeniem do stacji produkcji nasienia. a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49. Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona. Gatunkiem. białe bydło rrytyjskie.

a do drugiego przechodzą chromosomy. że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela. Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć. jest taka sama jak w dwóch nie zmienionych chromosomach. jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych. Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej. Należy zaznaczyć. 5-5). Przedstawione obserwacje wskazują. tzn. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over. prowadzą do uformowania niezrównoważonej (delecje.Należy podkreślić. że około 50% gamet wytwarzanych przez 106 . jeśli oczywiście wystąpi w linii komórek płciowych. określane jako sąsiednie. a nie częstego powstawania de novo. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję. Podobnie jak w przypadku fuzji centrycznej. duplikacje) ilości informacji genetycznej w gametach. to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60. bądź duplikacją. to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. które uczestniczyły w trans lokacji. 0 2n = 58 (ryć. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów. że suma informacji genetycznej zawarta w dwóch chromosomach. Jest to segregacja naprzeciwległa. Dwa pozostałe rodzaje segregacji. który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2. Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. 5-6a. Pokazuje to jedno cześnie. 5-6b. Przyjmuje się. jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji. że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło. a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia. pochodzących z dwóch różnych chromosomów. 5-7). Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. gdy rozród jest oparty na sztucznej inseminacji. Segregacja symetryczna (2:2) nie gwarantuje jeszcze. że powstaną gamety o zrównoważonej informacji genetycznej. w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par. także translokacją wzajemna jest mutacją dziedziczną. to podczas mejozy dojdzie do powstania gamet. które podlegały translokacji. szczególnie wówczas. które będą obarczone bądź delecją. Skutek takiej translokacji będzie zazwyczaj letalny. lisy polarne. 5-8). Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych.

5-6. w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany Ryć. Translokacja wzajemna: (a) schemat powstawania. które będą ginęły zazwyczaj w życiu płodowym.*Schemat nie uwzględnia segregacji tetrawalentu. (b) segregacja tetrawalentu podczas mejozy nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu. Hodowca odnotuje 107 . to doprowadzą do powstania zygot.

.

W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim. że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. Jedno z nich występuje w części końcowej ramienia w chromosomie jedno. Do tej pory zidentyfikowano na świecie. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. w którym wystąpią dwa translokowane chromosomy.lub dwuramiennym. Stan taki towarzyszy nosicielstwu translokacji wzajemnej. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. 5-7). że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy. ponad 90 różnych translokacji wzajemnych. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu. Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej. Trzeba podkreślić. Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia. morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie. Podobnie normalny fenotyp mają lochy nosicielki. w którą zaangażowany jest chromosom X (translokacja typu X-autosom). a obraz nasienia (koncentracja. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów. a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego. podobnie jak w przypadku translokacji typu autosom-autosom. a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione. a połowa będzie nosicielami translokacji. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie). Fuzja tandemowa jest mutacją podobną do fuzji centrycznej. która prowadzi do bezpłodności samców nosicieli. Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109 . ale wśród nich połowa będzie miała układ. Oczywiście stan taki może być spowodowany różnymi czynnikami. które były rozprzestrzenione w populacjach w różnym stopniu. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych. U samic nosicielek stwierdza się jedynie zmniejszenie płodności. w którym polowa będzie miała prawidłowy kariotyp. Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). Przypuszcza się. podobnie jak w przypadku fuzji centrycznej. Knury nosiciele mają prawidłowe libido. w rozmaitych rasach.wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo.

podczas którego dochodzi do uformowania pętli inwersyjnej. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. podobnie jak przy fuzji centrycznej. gdzie na jednym z chromosomów występuje odwrócony fragment. jest pierwszy sposób koniugowania. Jeżeli w obrębie odwróconego fragmentu występuje centromer. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu. z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). Znane są nieliczne przypadki tej mutacji u bydła. to wówczas powstaną gamety obarczone delecją lub duplikacją. tzn. Przebieg koniugacji podczas pachytenu profazy I. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna. że fragment pomiędzy punktami pęknięć został odwrócony o 180°. Najmniej korzystny. które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej. Jeżeli w obrębie pętli zajdzie crossing over. gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. było dość duże. Inwersje dość rzadko opisywano u zwierząt gospodarskich. spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie. Uwaga ta dotyczy 110 . może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków. która częściowo jest niehomologiczna. tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym. w obrębie fragmentu objętego inwersją na jednym z chromosomów. a następnie zostały one niewłaściwie naprawione w taki sposób. to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. to nieprawidłowość jest określana jako inwersja paracentryczna. chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70. dojdzie do powstania aneuploidalnych gamet. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii. że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%. oraz 3) pełna koniugacja. Oceniano wówczas.chromosomami akrocentrycznymi. z punktu widzenia skutków gametogenezy. Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu. to podczas mejozy. to wówczas inwersja jest określana jako pericentryczna. w którym wystąpiły dwa pęknięcia. może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną. Jeżeli odwrócony fragment nie obejmuje centromeru. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. 2) chromosomy częściowo pozostają nieskoniugowane — w części. analogicznie do schematu przedstawionego dla translokacji robertsonowskich. z wyjątkiem sytuacji. Mutacja ta jest dziedziczona przez połowę potomków nosiciela. Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji. która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu.

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

Skutkiem tego będzie pojawienie się pary G-C w miejscu. gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina. nazwanej dojrzewaniem. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi. należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym. Błąd włączania polega na tym. iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. Dotychczas wykryto je u ludzi w 12 loci. Im większy stopień zwielokrotnienia danej sekwencji. odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form. z których 10 powoduje choroby genetyczne. niestabilnymi sekwencjami DNA. Inną 117 . Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH). Mutacje genowe mogą być także następstwem zakłóceń w splicingu. zespół kruchego chromosomu X. Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony).i protonów w cząsteczce zasady. Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej. że enołowa forma tyminy łączy się z guanina. gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. U ludzi zdrowych liczba powtórzeń wynosi 10-36. Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. natomiast w formie enolowej łączy się trzema mostkami z cytozyną. Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka. Błąd replikacji zachodzi wówczas. guanina w normalnej formie (ketonowej) łączy się z cytozyną. a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA). przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. między innymi chorobę Huntingtona. dystrofię miotoniczną. Z kolei. tym wcześniej rejestrowany jest początek objawów chorobowych. zaś ketonowej na enolową (=C—OH). w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. czyli tzw. obróbce mRNA. Mutacje te związane są z tzw. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę. zlokalizowanego w chromosomie 4. W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). a w formie tautomerycznej z tyminą. Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). Z kolei.

Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. dlatego nazywane są cichymi podstawieniami (ang. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. gdyż kodon AAC również koduje asparaginę. restriction fragment length polymorphism). Są one wykorzystywane w analizie polimorfizmu DNA. Jeśli allel zmutowany pochodzi od matki. ani kodowanego przez ten gen białka. substitution at silent site). Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony. jak i intronu. Przypuszcza się. piętno gametyczne. Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. jest polimorfizm fragmentów restrykcyjnych — RFLP (ang. Skutki mutacji genowych Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym. Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji: 118 . Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym. Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu. Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi. Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu. gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów. mającym szczególne znaczenie dla molekularnej analizy DNA.4. różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. Należy podkreślić. identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. 5. iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. różnica w długości sekwencji może dochodzić do 50%. trypletów). Jednym ze skutków mutacji genowych.cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw.2. Natomiast jeśli ojciec przekazuje zmutowany allel. iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA. polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie. Taka sytuacja jest możliwa.

na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+. nasienia i jaj zawiera rozdział: Markery genetyczne. Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. 2. Na przykład. która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. mleka. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła. Mutacje typu nonsens (mutacja stop) . Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. warunkujący czarne umaszczenie. odnoszącym się do polimorficznych białek. skutki tego mogą być dla organizmu letalne. Jak już wcześniej wspomniano. Mutacja ta jest przedstawiona na rycinie 5-10. roku życia osobników homozygotycznych pod względem zmutowanego genu..1. Innym przykładem mutacji typu zmiany sensu. w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy. Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G. 5-10. Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła 119 . mutacje genowe nie zawsze mają niekorzystny skutek. jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę. jest locus β-laktoglobuliny (białko mleka). Mutacje typu zmiany sensu . bovine leukocyte adhesion deficiency). przejawiająca się zmniejszeniem odporności cieląt. oraz T→C (zapis dla DNA.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) - Ryć. której następstwem jest śmierć przed ukończeniem 1. w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi.

Jest ono przyczyną zamierania zarodków. czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka. w procesie translacji przyłączane są inne aminokwasy. Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna .cytrulinemia. a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. powstaje nieaktywny peptyd złożony z 85 aminokwasów. Jest to schorzenie nazwane DUMPS (ang. iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl. Podobnie jak mutacje typu zmiany sensu. Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen. przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. występuje u bydła. Począwszy od kodonu 104 (GGT) dla glicyny. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej. również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu. wykorzystujący to. Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. deficiency uridine monophosphate synthase). w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu. następnie roz120 . Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem. Bydło holsztyńskie ma umaszczenie z reguły czarno-białe. Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu. kodujący u zwierząt homozygotycznych ee umaszczenie czerwone. które nie kodują aminokwasów. Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. natomiast allel dominujący ma takie miejsce. a w konsekwencji zmniejszenia płodności krów. Cytrulinemia występuje również u ludzi. ochrę (UAA) lub opal (UGA). Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia. powstaje krótszy N-końcowy fragment tego polipeptydu. Schemat tej mutacji przedstawiono na rycinie 5-10. lecz stanowią sygnał zakończenia translacji. ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. zamiast aktywnego enzymu składającego się z 412 aminokwasów. występująca u bydła rasy holsztyńsko-fryzyjskiej. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. We wspomnianym już locus E u bydła allel recesywny e. 3.amber (UAG). W jej konsekwencji. powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady.

5-11). 4. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego. Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi. utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". jeśli trójka nukleotydów zostanie wstawiona między kodony. W obrębie tego genu wykryto wiele mutacji. przy czym najczęściej jest stwierdzana mutacja w eksonie 10. Insercja trójki może spowodować: dodanie aminokwasu – w białku. a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów). Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego. Dotyczy to przede wszystkim trzustki. zwanego CFTR (ang.dzielany elektrofor etycznie. zamianę fazy odczytu. płuc i oskrzeli. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. Mutacja ta prowadzi 121 . cystic fibrosis transmembrane conductance regulator). Częstość występowania tej wady. pełniącego funkcję kanału chlorkowego. możliwe jest także pojawienie się kodonu „stop". polegająca na zakłóceniu transportu jonów chlorkowych. oznaczona symbolem ΔF508 (ryć. prowadzącej do przedwczesnej śmierci. dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym. wynosi l: 2500 osób. a nawet śmiertelnych chorób genetycznych. jeśli trójka „rozerwie" istniejący dotychczas kodon. Mutacje te mogą prowadzić do poważnych zaburzeń.

Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej. Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. natomiast w allelu F . 122 . kodującej aminokwas glutaminę. łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny). zwanej składaniem (ang. na przykład białko determinowane przez locus Albino (C). czego konsekwencją jest synteza zmienionego białka. ale może być również rozpoznawalny w okresie późniejszym. złożonej z takiej liczby glutamin. na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). a także umaszczenie zwierząt i inne. Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe. w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. przekształcającego fenyloalaninę w tyrozynę.do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego. o czym pisano już wcześniej. Często są to zaburzenia przebiegu szlaku metabolicznego (tzw. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. Częstość tych mutacji wynosi 10-40%. 5-13). powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny. Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. 5-12 wkładka kolorowa). W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów. powoduje powstanie domeny glutaminowej. Gen C warunkuje wytwarzanie enzymu tyrozynazy. splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA. W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka. i glicyna — 509 póz. Zwielokrotnienie powtarzającej się sekwencji CAG. Mutacje zachodzące podczas obróbki potranskrypcyjnej. jaka jest zakodowana w sekwencji (CAG)n.3 eksony kodujące 37 aminokwasów. Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika. Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA. blok metaboliczny). na przykład wielopalczastość. Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. a następnie sekwencja GGT dla glicyny. najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. 5. skrócenie kręgosłupa u bydła i psów.

brak oksydazy kwasu homogentyzynowego. prze kształcającego ten kwas w kwas maleiloacetooctowy..B. Albinizm występuje także u zwierząt. brwi i rzęsy. osobniki albinotyczne mają bardzo jasną skórę.brak enzymu tyrozynazy. C. Tyrozynoza -. cukrów czy lipidów. jest gen hormonu wzrostu — somatotropiny (ang. powodujący różny stopień nasilenia niedorozwoju umysłowego. powodując jego ciemnienie na powietrzu. Mutacje genowe wpływające na cechy produkcyjne zwierząt Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. a jego nadmiar jest wydalany z moczem. 5.4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę. a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie. tęczówka oka nie jest zabarwiona. Albinizm. D. E. Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków. Jednym z genów. chrząstkach i skórze wywołując stany zapalne.niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego. np. 123 . growth hormone — GH). którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich. przekształ cającego 3. Alkaptonuria -.4. Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę).3. białe włosy. kwas homogen tyzynowy jest odkładany w stawach. czyli bielactwo . biorącego udział w przemianie tego kwasu w kwas homogentyzynowy. nie powodujący wyraźnie złych skutków dla organizmu.

wykryty u owiec rasy romney.1. Zależnie od stopnia penetracji tych genów można je podzielić na: 124 . a szczególnie wrodzonych wad rozwojowych.4. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych. że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych. kwaśne mięso (RN). metabolicznych.15 prosięcia u świń bardzo plennej rasy meishan i 0. odpornościowych. sprawia dużo trudności. Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią. np. Spośród wykrytych dotychczas mutacji.Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie. Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie).4. Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1. które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu. psychicznych itp. Inne mutacje to: gen FecJ u owiec jawajskich. O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych.42 prosięcia u wielkiej białej. Należy jednak pamiętać.4.6 jagnięcia. Stąd poznanie podłoża wielu chorób genetycznych. Geny letalne. estrogen receptor gene — ESR) a wielkością miotu. endokrynologicznych. 5.4. gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji. U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2). 5. U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA. Mutacje genowe wywołujące choroby genetyczne Mutacje genowe często prowadzą do powstania chorób genetycznych. semiletalne i subwitalne Wpływ szkodliwego działania zmutowanych genów jest różny. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw.

w których genotypach wystąpią w dawce aktywnej (np. Oba zmutowane geny w układzie homozygotycznym (WpWp. w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). powodujące śmierć ponad 90% osobników. ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. który jest letalny w podwójnej dawce. WW) działają letalnie. warunkujący umaszczenie tzw. z nie wyjaśnionych dotąd przyczyn. gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w. jest gen W. nie ograniczając na ogół przeżywalności czy sprawności życiowej. Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego. natomiast u osobników heterozygotycznych nie są letalne. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. w którym dany gen przejawia działanie letalne. będącym również wynikiem mutacji genu ω. 5-14 wkładka kolorowa). Przykładem jest gen platynowego ubarwienia u lisów. ale dają zauważalny efekt fenotypowy. • geny semiletalne. również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. powodując śmierć nie tylko homo-. które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. w którego genotypie wystąpią. powodujących poważne zakłócenia procesu trawienia. Niektóre z nich. • geny subwitalne. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych. w okresie pourodzeniowym lub u dorosłych osobników. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego. Również okres w życiu osobnika. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce. inne zaś później. w stosunku l platynowy: l srebrzysty (ryć. białopyskie. uzyskamy wówczas lisy zdolne do życia. Geny te działają letalnie w układzie homozygotycznym. może być różny. warunkującego srebrzystą barwę włosa. U kur gen achondroplazji (Cp) w układzie hetero- 125 . powodują śmierć osobnika. homozygota recesywna). powodujące w aktywnej dawce śmierć od 50 do 90% osobników. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia.• geny letalne. Innym genem. Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry.

natomiast u homozygotycznych — bardzo wyraźne. Zmienność tej cechy u krów jest duża. jak achondroplazja recesywna. jak też od interakcji ze środowiskiem. bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. Zakres działania tych genów jest różny. U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne. co obrazuje schemat: jedynie samice. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń. warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt. natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną. od niewielkich zmian (np. 126 . Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie. U samców gen ten jest letalny. Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec. w potomstwie występuje stosunek samców do samic l: 2. iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców. Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych. gdyż ich działanie zależy między innymi od czynników środowiskowych. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji. Cecha ta występuje tylko u samic. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. Niektóre geny letalne mogą także powodować śmierć matki.zygotycznym (Cpcp) warunkuje krótkonożność. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się W przypadku gdy matka jest heterozygotą. nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. Geny semiletalne często jest trudno odróżnić od genów letalnych.

nauka zajmująca się zaburzeniami rozwojowymi. Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi.4. wady te nie dziedziczą się. Zdarza się jednak. Wady takie. Niektóre z tych genów są przyczyną zaburzeń metabolicznych. 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód. Przykład takiego bloku podano już wcześniej.4. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne. powodując tzw. 2) wady — są to pewne zaburzenia w prawidłowej budowie. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. noszą nazwę fenokopii. chromosomowych lub genomowych. powstające w okresie płodowym. do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi. epilepsja u bydła). 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika.Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych. Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu. Choroby monogenowe wywołujące wrodzone wady rozwojowe Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała. Można to uczynić biorąc pod uwagę: 127 . obarczone nimi zwierzęta nazywane są potworkami. następny podrozdział dotyczy wad wrodzonych. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych. sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich. 5. że niektóre anomalie. bloki metaboliczne. inne ujawniają się w późniejszym okresie życia (np. Teratologia. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. mimo że są pochodzenia pozagenetycznego. wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała. przypominające mutanty. powodując niepłodność czy utrudniając akt kopulacji. a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe. ich rodzajów. a powstałe pod wpływem czynników środowiskowych. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego.2.

Gen karłowatości u osobnika heterozygotycznego. powodując tylko nieznaczne skrócenie kończyn. Mutacja ta powoduje powstanie kodonu terminacyjnego. polegającą na insercji 4 nukleotydów w genie. kodowany przez ten gen. 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika. u którego występuje recesywna karłowatość chondrodysplastyczna (ang. że płody dotknięte tą wadą. Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy. Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. Badania genetyczne wykazały. Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii. którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany). Nosicielstwo allelu achondroplazji. U japońskiego bydła mięsnego. u herefordów). jak i dalszych. skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy. cechująca się skróceniem kończyn. OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH Wady układu kostnego Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja. 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka.1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie. przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. bulldog disease). Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. 5-15 wkładka kolorowa). oznaczonego symbolem bd (ang. czyli zahamowanie rozwoju układu kostnego. dała początek nowej rasie bydła — dexter). homozygotyczne pod względem genu niezupełnie dominującego. Jest to prosta cecha recesywna. Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej. Do mutacji wpływających na cały kościec należy karłowatość. skrócenie lub brak żuchwy. U bydła wada ta występuje u ras mięsnych (np. japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN). charakteryzującego się wybitną wartością hodowlaną. wpływa pośrednio na zwięzłość budowy. creeper — pełzacz). 128 . ulegają poronieniu zwykle przed ósmym miesiącem (ryć. chondrodysplastic dwarfism). 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację.

polega na niezrośnięciu się kości czaszki. pęcinowego lub kolanowego.Zaburzeniem. stwierdza się osłabione zdolności rozrodcze. obserwowana głównie u bydła. central vertebral malformation). Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi". Jest ona letalna u bydła i indyków. Wadzie tej często towarzyszą: skrócenie żuchwy. a nawet niepłodność. że jest to cecha letalna dla jednej płci. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość. a nawet ludzi jest tzw. żeber i mostka oraz części pyskowej (garbaty nos). W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn. U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. Genetycznym podłożem tej wady jest autosomalny gen recesywny. Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. jest autosomalna recesywna cecha skrócenie kręgosłupa. Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka. Wada ta. brakowi gałek ocznych 129 . U owiec niektórych ras mięsnych (suffolk. a także u owiec. a nawet płci wykazuje różny stopień letalności. spider syndrome). Może ona natomiast towarzyszyć: wodogłowiu. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. rozmnażają się one prawidłowo. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw. bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie. Ogólne zesztywnienie stawów notowane jest u bydła. amputacja kończyn (akroteriaza) (ryć. świń i owiec. U jagniąt. rozdwojenie podniebienia i brak większości zębów. 5-16 wkładka kolorowa). świń.FGFR3). deformację grzbietu. przepuklinie mózgowej. fibroblast growth factor receptor 3 -. U psów skrócenie kręgosłupa nie jest letalne dla suk. która zależnie od gatunku. cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. Możliwe więc. Anomalia ta uwarunkowana jest genem recesywnym. hampshire) w Stanach Zjednoczonych w latach 80. a u tych. Anomalią układu kostnego. której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. amputacji kończyn. Jest ona wynikiem mutacji (transwersja adeniny na tyminę. które występuje u większości ras bydła. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. Natomiast samce prawdopodobnie nie osiągają dojrzałości. które przeżyły. Szczenięta obarczone tą wadą cechuje mniejsza żywotność.

oznaczonym symbolem n (ang. u bydła ayrshire. ale i takich jej wytworów. duck). Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. Cielęta dotknięte tą wadą w warunkach naturalnych giną. prowadzącą do śmierci płodów lub noworodków. 130 . U drobiu wadą układu powłokowego jest nagość. Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi. U owiec obserwowana jest również cecha recesywna — brak żuchwy. perskie lub meksykańskie) są heterozygotami. że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. Wady układu powłokowego Wady układu powłokowego odnoszą się nie tylko do skóry. Płytki te są porozdzielane rowkami. że osobniki homozygotyczne rodzą się martwe. Na podstawie szczegółowych badań można sądzić. W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. skrócenie szczęki. Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka. Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. Ptaki. w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. w których rosną włosy. psy tureckie. U psów brak owłosienia uwarunkowany jest genem dominującym. niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). u bydła rasy Jersey. Wyniki badań wskazują. a to z kolei może spowodować śmierć w pierwszych tygodniach życia. Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. U bydła. gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości. że wszystkie bezwłose psy (tzw.lub zesztywnieniu stawów. Anomalia ta polega na skróceniu dolnej części dzioba. natomiast najłagodniejszą. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu. chińskie. Inną wadą dziedziczną układu powłokowego jest brak owłosienia. jak włosy i pióra. królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu. Nienormalność ta jest prostą cechą recesywna. które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle. jak wodogłowie. Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. Schorzenie to przybiera najostrzejszą formę. uwarunkowana recesywnym genem sprzężonym z płcią. Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła. naked).

U bydła nienormalność ta dotyczy jelita biodrowego.Wady układu pokarmowego Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. Atak taki trwa około 10 sekund. następnie upadkiem. Niedorozwój móżdżku najlepiej został poznany u bydła i owiec. usztywnieniem nóg oraz drżeniem ciała. Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych. powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. Większość z tych kurcząt ginie przed 15 tygodniem życia. Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. Brak odbytu jest recesywną cechą letalną. rasy houdan i polskie czubatki). Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem. Niedrożność jelit zaś. Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe. u których jest prostą cechą recesywną. nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. przy czym u kur gen ten nie jest letalny (np. ale nie mogą stać. to prosta autosomalna cecha recesywną występująca zarówno u bydła. powodując jego rozjaśnienie. u koni natomiast okrężnicy. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy. U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. wykazują powiększenie czaszki. crest). Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. determinowana u bydła genem dominującym. Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). U indyków i kur notowane jest wrodzone zaburzenie równowagi. podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną. U świń gen warunkujący tę wadę wykazuje działanie plejotropowe. warun131 . Wady układu nerwowego Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja. Prostą autosomalna cechą występującą u bydła. natomiast u królików — recesywnym. Zwierzęta dotknięte tą wadą rodzą się żywe. jak i u koni. wpływa bowiem na umaszczenie. Obie nienormalności warunkowane są genem recesywnym. pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. sprzężone z płcią zaburzenie zwane paroksyzmem. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. U drobiu występuje również recesywne. natomiast heterozygoty mają piękny czub. świń i drobiu jest wodogłowie wewnętrzne.

jajników. Podłoże genetyczne zaburzeń natury biochemicznej. której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych. Niepłodność obserwowana jest także u buhajów. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Pisklęta obarczone tą wadą kłują się dobrze. nasieniowodów.3. Jest to prosta.4. świń i owiec. jest paraliż i przykurcz mięśni kończyn i szyi. loco).4. knurl). Obustronne wnętry są niepłodne również po takim zabiegu. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. Nienormalność tę można usunąć zabiegiem chirurgicznym. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne. Anomalią o dużej częstości występowania. 132 . takie jak: niedorozwój (hipoplazja) jąder. Wady układu rozrodczego Dość często występujące. czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny. 5. jak na przykład brak lub niedobór pewnych enzymów czy hormonów. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. szczególnie u buhajów. macicy. autosomalna cecha recesywna. czyli szczytowej części główki. pić i giną w ciągu kilku dni. iż objawy pojawiają się u zwierząt w różnym wieku. występujący u bydła. powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych.kowane recesywnym genem letalnym lo (ang. Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem. ogierów i samców innych ssaków jest wnętrostwo. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu. Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy. związanym z niedorozwojem przodomózgowia. ale nie mogą jeść. jest trudne do identyfikacji. a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego. Trudność tę powiększa to. Zaburzeniem układu nerwowego. niedrożność jajowodów czy wnętrostwo. Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu. dlatego nazwano je „gałkowatymi". ale także u knurów. Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang.

Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa). U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna. Oprócz ogromnej liczby wrodzonych wad dziedzicznych. 133 . która jest produktem rozkładu chlorofilu. ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. Uczulenie na promienie słoneczne występuje również u owiec. które są niewątpliwie dziedziczne.Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów. wytwarzany w nadmiernych ilościach i odkładany we krwi. reagują powstawaniem pęcherzy na skórze. i hemofilia B. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne. Genetycznym podłożem tej wady u bydła jest gen recesywny. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. zębach i innych częściach ciała. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła. a w skrajnych przypadkach — wrzodów. których podłoże genetyczne jest dobrze poznane. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. kościach. zroślaki (zrośnięte dwa płody). Schorzeniem notowanym u ludzi i psów. mająca łagodniejszy przebieg. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu. charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia. a także owiec. a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. Fenotypowym obrazem tej wady jest egzema na pysku i uszach. wywoływana działaniem genu recesywnego sprzężonego z płcią. niezbędnego do wytwarzania tromboplastyny osocza. istnieje wiele anomalii. który przyspiesza przemianę protrombiny w trombinę. Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. lecz jest ono jednak innej natury niż porfiria u bydła. wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. a dotycząca czynnika IX (czynnik Christmas). U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. składnika hemoglobiny. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II. Należą do nich przypadki wielokończynowości.

134 .

4. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania. Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń. które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji). Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych.5. kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana.4. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli. Terminem nosiciel określamy osobnika. W Polsce. Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli).4. ale jedynie te. który jest fenotypowo normalny. częstość jest niewielka. Ograniczanie występowania chorób genetycznych Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach. są zauważalne i łatwe do eliminacji. niestety. ale w swoim genotypie 135 .

Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. skojarzonego z normalnymi kurami. 136 . będą pochodzić wszyscy synowie fenotypowo normalni. to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. Natomiast wśród jego córek połowa będzie normalnych. fenotypowo ujawniają swą obecność wówczas. Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza. Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią. jednakże połowa z nich będzie homozygotami dominującymi. gdy homozygoty recesywne wykazujące wadę żyją i są płodne. Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników.ma gen letalny (czy semiletalny) w układzie heterozygotycznym. gdy występują w stanie homozygotycznym. głównie wykorzystywanych w sztucznej inseminacji (np. a połowa nosicielami niepożądanego genu. że aż 18% osobników jest nosicielami niepożądanego allelu. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic. to około 50% jego potomków będzie homozygotami recesywnymi. Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. 2. wśród których można się spodziewać obecności nosicielek recesywnego allelu. Schemat takiego kojarzenia jest następujący: Jeżeli testowany osobnik jest nosicielem allelu recesywnego. a u połowy ujawni się wada dziedziczna. u ptaków samce). jak już wspomniano. Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice. buhaje). Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. Testowanie takie jest możliwe jedynie wtedy. Jeśli będzie to gen letalny powodujący zamieranie zarodków. Geny te. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności.

Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus. a samiec jest heterozygotyczny. w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. to wśród córek połowa będzie miała genotyp AA. że samice matki tych córek są homozygotyczne (AA). test automatyczny). Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw. Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. jest kojarzenie samca z jego własnymi córkami. Rejestracja ta z jednej strony daje obraz częstości występowania tych wad. a połowa Aa. kojarzone są z losowo wybranymi samicami.Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. Wówczas schemat kojarzenia testowego jest następujący: Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. 137 . Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych. z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich). zakupione przez Stacje Hodowli i Unasieniania Zwierząt. Dokładną metodą identyfikacji nosicielstwa recesywnego genu. W hodowli bydła młode buhaje. Jeśli przyjmiemy. Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. lecz trudną do zaakceptowania ze względów hodowlanych. 3.

Zagadnienie to opisano niżej. DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi. Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to. w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej. Białko to odgrywa istotną rolę w odporności organizmu.Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA. głównie PCR-RFLP. Na początku lat 90. leukocyte adhesion deficiency). rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego. Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. po raz pierwszy opisano go w 1983 roku. Ponieważ jest to gen recesywny. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt. tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. W diagnostyce tych chorób stosowane są techniki biologii molekularnej. fenotypowo zdrowe). który koduje strukturalną podjednostkę CD18 p2-integryny. powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138 . Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2. Jest to choroba autosomalna recesywna. W latach 70. że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. U bydła zespół BLAD był znany od kilkunastu lat. spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych. występująca również u ludzi pod nazwą LAD (ang. która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy). szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne. Stwierdzona w pozycji 383 nukleotydu mutacja. Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. Analiza rodowodowa wykazała. w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu).

jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa. tzw. natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej.wego na glicynę. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych. jaki allel występuje w badanym DNA. Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni. który bierze udział w cyklu mocznikowym. Mutacja ta została już przedstawiona wcześniej. ciche podstawienie 775 nukleotydu. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia. Jej podłożem genetycznym jest zmutowany. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. Obraz elektroforetycznego rozdziału wygląda następująco: W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA. iż zmutowany allel nie ma miejsca restrykcyj139 . opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów. Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to. Z kolei. Za pomocą analizy fragmentów restrykcyjnych określa się. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. podejmowane są środki prewencyjne. a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach.

nazwany HYPP (ang. powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży. za140 . deficiency uridine monophosphate synthase). powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT). krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku. występujące po zmianie diety. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. hyperkalemic periodic paralysis). konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). jest recesywna mutacja genu syntazy urydynomonofosforanowej. nie dającą żadnych skutków fenotypowych. Objawami tej choroby są ataki drżenia mięśni i paraliżu. natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony. również wcześniej przedstawioną mutacją letalną. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni. Zmutowany allel genu UMPS. ale wykazują obniżony poziom aktywności enzymu. Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. okresie głodzenia. natomiast allel zmutowany (DUMPS) — nie będzie. a dla normalnej homozygoty dwa prążki 118 pz i 72 pz. Kolejną. 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym. do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz. Z drugiej jednak strony. niemożliwa jest analiza DNA osobników homozygotycznych. których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych). Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego. dlatego nazwano go „genem zamieralności zarodków". polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz. W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę. dla heterozygotycznego trzy prążki: 194 pz. Pierwsza z nich to okresowy paraliż. Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu. Osobniki heterozygotyczne są fenotypowo normalne. 118 pz i 72 pz.nego dla enzymu Avall w kodonie 86. określony symbolem DUMPS (ang. pojawiający się u koni „ąuarter" w USA. Podobnie jak w przypadku poprzednich mutacji.

natomiast u bydła i owiec w długim ramieniu chromosomu 13. Z tego powodu określane są gąbczastymi encefalopatiami (ang. na granicy prążka 12 i 13 (20pl2-pl3). co powoduje załamanie się układu immunologicznego. jego zmutowany allel. Mutacja HYPP dziedziczy się z niezupełną dominacją. Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej. którym jest białko. chorób prionowych. natomiast badania przeprowadzone w Polsce wykazały. u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji. Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). severe combined immunodeficiency disease — SCID). Jedną z najdawniej. spongiform encephalopathies). Choroba ta charakteryzuje się brakiem limfocytów T oraz B. przy czym u bydła w pozycji 13ql7. dobrze umięśnionych. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach. iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen. Podobna choroba od 50 lat znana jest u ludzi. Omawiając choroby genetyczne nie sposób pominąć tzw. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP. jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową. warunkujący białko prionowe — symbolem PrPSc. jak P 141 . Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang. u owiec — 13ql7-ql8. bo około 250 lat temu. iż przekształcają prawidłowe cząsteczki białka w szkodliwe. z zastosowaniem enzymu restrykcyjnego Tagi. Przypuszcza się.działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. namnażają się w ten sposób. Białkowe cząsteczki infekcyjne. Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20. trwającym miesiące lub lata bez żadnych objawów. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. poznanych chorób prionowych u zwierząt jest trzęsawka (ang. Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny. że nie występuje ona w polskiej populacji koni arabskich. nazwane prionami. Gen kodujący białko komórkowe oznaczono symbolem PrPc. indukując zmiany ich konformacji. scrapie — drapać) u owiec.

Wykryto już kilka mutacji w tym genie u owiec. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. że częściej występuje 6 powtórzeń. a jej rezultaty nie były zadowalające. R/Q) (tab. Białko to ma około 250 aminokwasów. Spośród trzech możliwych genotypów (6:6. U bydła chorobą prionową jest rozmiękczenie mózgu (ang. Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. 5-III). R/H) oraz 171 (arginina/glutamina. kóz i bydła. rok później została opisana jej patologia. 142 . 5-17). 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. Dotychczas stwierdzono. Gen ten koduje białko określane jako Dpl (ang. Ponadto tylko ten genotyp nie występował u krów z BSE. oznaczenia literowe V/A). Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii. Jest to choroba ośrodkowego układu nerwowego. Czynnikiem zakaźnym BSE jest to samo białko prionowe. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny. które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). bovine spongiform encephalopathy — BSE). 154 (arginina/histydyna. Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". że najbardziej odporne są owce o genotypie AA136RR154RR171. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. że w pobliżu genu białka prionowego znajduje się gen Prnd (ang.śledziona czy węzły chłonne. Ostatnie badania wykazały. prion-doppel). downstream prion-like protein) lub doppel. W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm. związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc. Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym. Wydaje się. Metoda ta okazała się jednak zbyt droga i długotrwała. które wywołuje scrapie u owiec. Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej.

powodujące rocznie padnięcie około 10 min prosiąt na świecie. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie. bydło jest szczególnie podatne na inwazje kleszczy.5.4. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny Gen odporności na kleszcze W niektórych krajach. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła. ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. jak również w Europie. Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi. bydło indyjskie jest bardzo odporne na kleszcze.5. w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli. Gen K88 i F18 U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen. determinujący odporność na kleszcze. Należą do nich biegunki okresu noworodkowego u prosiąt. Z kolei. występowanie tych 143 . głównie w północnej Australii i innych regionach tropikalnych. Z kolei. umożliwiających adhezję bakterii i ich rozwój.

Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa. coli (bakterie te mają fimbrie). Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany). mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym. Podatność jest cechą dominującą (allel B). Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA. stwierdzono bowiem. Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika. coli F18).in. a ich charakterystyczną cechą jest to. której objawami są m. 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych. z ałlelem zmutowanym M307A. warunkującego odporność na infekcje E. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E. blisko locus Tf (transferyny).5. polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę). 5. schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E. Loci receptorów dla E. wykazuje ścisłe sprzężenie z genem ECF18R. a odporność recesywną (allel b). oznaczona symbolem M307. W jednym z nich (FUT1) wykryto dwie mutacje. Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne. konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa).2-fukozylotransferazy. iż mogą 144 .receptorów warunkowane jest genem głównym (o dużym efekcie). ataksja. coli F18. Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l. coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. Mutacje te mogą być dziedziczone po matce. coli K88 zlokalizowano w chromosomie 13. W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1'. iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg. trzech prążków (93. oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. Mutacje w mitochondrialnym DNA Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra. z których jedna.

Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. inne natomiast u odpornych. kwasica mleczanowa i napady udaropodobne). że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka. polegają na substytucjach nukleotydów (głównie tranzycja).in. Wiadomo na przykład. polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki. iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom. wywoływaną przez wirus. Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to. insercji bądź delecji nukleotydów. dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną. padaczkę miokloniczną i tzw. poszarpane czerwone włókna (MERRF).dotyczyć całych tkanek. chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona. Miejsce i zasięg występowania danej mutacji powodują. Podstawienia nukleotydów w genach kodujących tRNA powodują m. Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. podobnie jak w DNA jądrowym. Skutkiem tranzycji są takie choroby u człowieka. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego. Mutacje w mitochondrialnym DNA. Z kolei. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną. ale dalszym pokoleniom cechę tę przekazują tylko córki. pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. mitochondrialną miopatię. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). Przykładem pierwszej sytuacji jest wspomniana już choroba LHON. jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP). iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach. . Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. jak i synom. Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi. drugi natomiast mutacją homoplazmatyczną. Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np.

Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy.Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu. posiadanie/brak rogów). Zjawisko to nazywa się plejotropią. w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. rzadziej kilkoma współdziałającymi ze sobą parami genów. Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. kiedy jeden gen wpływa na kształtowanie się kilku cech. a ich ujawnienie się zależy przede wszystkim od założeń genetycznych. Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym. Oznacza to. Ogólnie cechy można podzielić na jakościowe i ilościowe. Ponadto. jak: umaszczenie zwierząt. umaszczenia. Do cech jakościowych zalicza się takie. Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone. barwa umaszczenia. Wspólną właściwością tych cech jest to. Mechanizm dziedziczenia cech jakościowych jest zróżnicowany. np. 146 . Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków. Cechy jakościowe są warunkowane jedną. bowiem na ich ekspresję wpływa kilkanaście. owiec i kóz. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości. kolor upierzenia u drobiu. Znane są również przykłady. układy grupowe krwi itd. że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. rogatość lub bezrożność bydła. W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen. że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. a nawet kilkadziesiąt par genów. która jest łatwa do odróżnienia w zespole innych właściwości (np.

dając wszystkie możliwe formy danej cechy. W procesie gametogenezy allele z danej pary rozchodzą się do gamet.Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem. Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary. Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek).1. Dziedziczenie cech warunkowanych jedną parą alleli 6. 147 . Jak już wspomniano. 6. Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus. cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą.1. Współdziałanie alleli Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA. która zawiera dwa jednakowe geny z danej pary alleli. Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie. natomiast mająca dwa różne geny — heterozygotą (Aa). nazywa się homozygotą (AA lub aa). Potomek dziedziczy zatem jeden allel z danej pary od ojca. Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech. drugi natomiast — nieallelicznego (kilka par genów). I prawo Mendla. Geny te nazywane są parą alleli lub allelomorfów. drugi natomiast od matki. Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów). a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla. mówi o tym.1. Zygota. że gameta zawiera tylko jeden gen z danej pary alleli. A-a). Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. zwane prawem czystości gamet.

nazywanego również dziedziczeniem typu Zea. Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi. dominujące nad czerwonym i inne. Dominowanie niezupełne genów z jednej pary alleli polega na tym. Para rodziców. zawsze da potomstwo heterozygotyczne. Charakterystyczną cechą tego typu dziedziczenia jest to. jest poniższy przykład. Z kolei u świń rasy cornwall. Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie.Przykładem całkowitej dominacji może być bezrożność u bydła. w locus tym występuje allel be. otrzymuje się potomstwo (pokolenie Fl) mroziate. będących homozygotami alternatywnymi (PP i pp) pod względem locus polled. Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. to stosunek liczbowy osobników czerwonych. Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz. białe i stalowoniebieskie). upierzenie kur andaluzyjskich (czarne. U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. Ilustracją tego typu dziedziczenia. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane). że fenotyp zwierzęcia odzwierciedla jego genotyp. Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt. jednolitego umaszczenia. część zaś białe. Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire. Przykładem tego typu współdziałania allelicznego jest grupa 148 . W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie). kontrolowany przez allel dominujący Bew z locus Be. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. czarne umaszczenie u bydła. długość uszu u owiec rasy karakuł i inne. Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2). Stwierdzono. mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. z którego część ma umaszczenie czerwone. gdyż gen dominujący P maskuje jego ekspresję. część mroziate. wykazujące dominującą formę cechy. jednolite umaszczenie (dominuje) i łaciatość u bydła. który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. również czarno umaszczonych. że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. Są one zatem w stosunku do siebie równorzędne.

w wyniku mutacji genowych (patrz rozdział: Mutacje). Naddominowanie polega na tym. że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa). Zdarzają się również takie loci. obok dotychczasowej pary alleli pojawia się allel trzeci.krwi AB w układzie ABO u ludzi. w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu. W przypadku niektórych loci. w którym w jakiejś populacji 149 . Układ taki. który warunkuje tę samą cechę co allele pierwotne. Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. dając jedynie inną jej formę lub natężenie. w których u różnych osobników znajdują się więcej niż trzy allele.

6. Oznacza to. bezrogie. jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. czyli będą czarne.1. to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone). Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP. to ich segregacja jest praktycznie niezależna. Jeśli szereg składa się z n liczby alleli. Niezależne dziedziczenie cech (II prawo Mendla) Niezależne dziedziczenie cech stwierdził Grzegorz Mendel. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla). Zwierzęta z pokolenia Fj będą mieć genotyp EdePp. natomiast gamety osobnika rasy shorthorn (czerwone.występują więcej niż dwa allele. Wszystkie gamety osobnika aberdeen-angus (bydło czarne. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie. czerwone). że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. eP. ep. iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie. bezrogie) zawierają dominujące geny Ed i P. warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1).2. to liczba genotypów będzie się równała: Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. Allele wielokrotne charakteryzują się tym. nazywamy szeregiem (serią) alleli wielokrotnych. badając m. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku. mówiące o niezależnym dziedziczeniu się cech. Edp. rogate) — allele recesywne e i p. Dzieje się tak 150 . Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne.in.

151 .

Ponieważ każdy osobnik wytwarza 4 rodzaje gamet. sporządzając szachownicę genetyczną Punneta. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4. rogate): 3 (czerwone. cechy kontrolowane przez te geny będą się dziedziczyć razem. zwiększy się liczba możliwych fenotypów. liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n 6. dziesiątki tysięcy różnych genów. Natomiast gdy jedna cecha dziedziczy się według typu Pisum. Dziedziczenie cech sprzężonych Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to.3. Cechy takie nazywamy sprzężonymi. 6-2). Najliczniejszą grupę potomstwa stanowią osobniki o genotypie. Zatem każdy chromosom zawiera wiele genów. Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne. rogaty). bezrogie): l (czerwone. Jednak organizmy żywe mają tysiące. Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2. w którym występuje przynajmniej jeden gen dominujący z każdej pary. a druga według typu Zea. lecz 9 różnych fenotypów. inaczej mówiąc. Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie. a tylko kilka do kilkudziesięciu chromosomów. gdy obie cechy dziedziczą się z dominowaniem całkowitym. iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy.dlatego. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli. gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych. W tym przypadku można mówić o niezależnej segregacji chromosomów. bezrogie): 3 (czarne. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może 152 . istnieje możliwość ujawnienia się 6 różnych fenotypów. Jeśli będzie rozpatrywana większa liczba cech równocześnie. że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p. rogate) (ryć. to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy. a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony.1.

normalne skrzydła są dłuższe od odwłoka. W wyniku crossing over u części osobników potomnych. 153 . Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna. Częstość tej wymiany jest tym większa. mianownik drugi chromosom z tej pary. Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy. zwanej crossing over. jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom. tzw. iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty. Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). rekombinantów. Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł. została przyjęta nazwa faza sprzężenia. Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący: Natomiast genotyp podwójnej homozygoty recesywnej: W celu określenia. Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. skrzydła szczątkowe (gen recesywny v — vestigal).być stosowany do tych cech. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami. W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym. W odróżnieniu od cech segregujących niezależnie. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. genotyp dla cech sprzężonych jest zapisywany w postaci ułamka. dzikiej) każdej cechy u muszki. w którym licznik oznacza jeden chromosom. im dalej od siebie znajdują się geny. pojawią się kombinacje cech w innym układzie niż u rodziców. bądź w różnych chromosomach i jest to faza odpychania (trans). Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. złożone z homologicznych chromosomów. że są one w fazie przyciągania (cis).

Doświadczalnie zostało udowodnione. z jaką crossing over zachodzi między sprzężonymi loci. czyli l cM = 1% rekombinacji. której symbolem jest cM (centymorgan. Na przykład.Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe. Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy. jeśli pojedynczy 154 . od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana).5% całego potomstwa z tej krzyżówki. jest ona iloczynem częstości przypadków pojedynczych crossing over. iż częstość. W naszym przykładzie odległość między loci B i V wynosi 18. W danym przykładzie rekombinanty stanowią około 18. że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów. Wynika to z tego. W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over.5 cM. Można jednak przewidzieć częstość występowania podwójnego crossing over. jest stała. Procent rekombinacji przyjęto za jednostkę odległości między genami. Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu). natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami).

układ genów będzie taki. to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci. w celu lepszego uwidocznienia efektu crossing over.crossing over w obszarze I zachodzi z częstością 0. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie.001. że kolejność ułożenia loci w chromosomie jest następująca: A-B-C. U muszki owocowej dominuje czerwony kolor oczu (dziki). Jeśli przyjmiemy. By tego uniknąć. Jeśli jednak zajdzie podwójny crossing over. natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV.02x0. podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. czyli 0. to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C. Trzecią cechą rozpatrywaną będzie kolor oczu. Jest to jednak wartość przybliżona. 155 . to częstość występowania podwójnego crossing over wynosi 0.05 (5%). Z kolei.05 = 0.02 (2%). a w obszarze II — 0.1%. Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej. Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych. a nie za pomocą przyjętego dla nich symbolu „ + ". Zjawisko to nosi nazwę interferencji. Również w tej krzyżówce. iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka. allele dominujące będą oznaczone literami alfabetu. a gen recesywny c (cinnabar). krzyżówki trzypunktowe. Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych. jak przed tą wymianą i nie będzie można odróżnić rekombinantów. stosuje się tzw. umożliwiające dokładne ustalenie położenia loci względem siebie. warunkuje kolor cynobrowy. gdyż w naturze jest ona niższa. Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi. Przyczynę stanowi to. W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny: Natomiast drugi rodzic ma genotyp: W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv.

Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane. W ten sposób tworzone są mapy genetyczne. W celu okreś156 . wyrażonym w procentach: Analogicznie do tego odległość między loci C i V wynosi: Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco: Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie.W potomstwie uzyskano następujące genotypy i liczebności: Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów.

in. cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu. O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego. których geny są umieszczone w chromosomach płci. należy zastosować inne metody badania (cytogenetyczne).. iż u osobnika diploidalnego występuje tylko jeden gen z danej pary. Cechy sprzężone z płcią Cechy. Dzieje się tak dlatego. a osobnika — hemizygotą. a heterogametyczną samice (ZW). nazywamy cechami sprzężonymi z płcią. Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. a synowie po matce). psów i niektórych zwierząt gospodarskich. nazywamy hemizygotycznym. Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób: Fenotyp Samice Samce Samice Samce Jak wynika z tego zestawienia. 157 . samce nie mogą być heterozygotami (nosicielami genu hemofilii).1. że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki).lenia. Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego). 6. Powstaje wówczas mapa fizyczna. Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ). Układ genetyczny polegający na tym. Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu. U ssaków samice są homogametyczne (XX). W rozdziale tym pokazano m. a pleć homogametyczną cechę recesywną. Gdy płeć heterogametyczną ma cechę dominującą. w którym chromosomie znajduje się dana grupa genów sprzężonych.4. Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi. samce zaś heterogametyczne (XV). Cecha zmniejszonej krzepliwości krwi (hemofilia). Sposób ich dziedziczenia jest inny niż cech autosomalnych. uwarunkowana jest recesywnym genem h. a nie — jak u płci homogametycznej — od pary genów. występująca u ludzi.

Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra. w pokoleniu F. 6-4 wkładka kolorowa). Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. warunkujący cechę jastrzębiatości upierzenia. „dziedziczenie na krzyż" Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B. u których zaraz po 158 . Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią. Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce.Ryć. 6-3. takich. Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych. dominuje nad jego allelem b (gen czarnej barwy upierzenia). tj.

cechy związane z płcią. Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. Cechy te nazywane są cechami 159 . orange). Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate. Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci.wykluciu można rozróżnić płeć. 6-5 wkładka kolorowa). dwarf — karłowaty). Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech. część z nich przedstawiono w rozdziale: Mutacje. wytworzone przez polską badaczkę Laurę Kaufman. Rasą autoseksingową są polbary. Niektóre z nich to tzw. Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści. ang. Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach). Osobniki męskie i żeńskie. Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X. których założenia genetyczne znajdują się u osobników obu płci. mające gen jastrzębiatego upierzenia. zlokalizowany w chromosomie X. B (niebieskie dzikie) i b (czekoladowe). inne — rude (genotyp Oo) (ryć. U zwierząt domowych jest wiele cech sprzężonych z płcią. Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw. Samce mogą być tylko czarne (o-) lub rude (O-). U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych. rasa sussex) i złocistości upierzenia (rhode island red). geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw. warunkowana przez locus O (ang. ale ujawniają się tylko u jednej płci. mogą się różnić fenotypowo. Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia. Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego.będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach. Jest ono następstwem tego. samice zaś bezrogie. iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie. mając taki sam genotyp. natomiast osobniki homozygotyczne recesywne będą rogate. Przykładem takiej cechy jest rogatość owiec rasy dorset horn. Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone). ale ich ekspresja jest uzależniona od płci. Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym.

Z kolei ten związek ma różnorodne funkcje fizjologiczne. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt". hormonu). która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech. Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne. na tempo przemiany materii. W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt.5.1. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę. wpływa zatem na inne właściwości organizmu. nieśność samic ptaków. Należą do nich: zdolność wydzielania mleka u samic ssaków. pracę serca i aktywność procesów trawiennych. kiedy jeden gen oddziałuje na powstanie kilku cech. 6. Plejotropia może być właściwa lub rzekoma. Plejotropia właściwa występuje wtedy. opisany w podrozdziale: Dziedziczenie umaszczenia. powodują pojawienie się nowej formy cechy jakościowej. Współdziałanie genów z różnych loci w kształtowaniu fenotypu W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy. gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. 160 .2. w wyniku łącznego działania.ograniczonymi płcią lub ograniczonymi do płci. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. Przykładem jest gen warunkujący platynową barwę u lisów. wnętrostwo czy przepuklina mosznowa u samców. które nie chroni ptaka przed nadmierną utratą ciepła. Zmiany te są jednak następstwem nieprawidłowego opierzenia. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe. Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. 6. który bierze udział w syntezie jakiegoś związku (np. Plejotropia O plejotropii mówimy wówczas. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m.in. W przypadku wielu cech geny z różnych par alleli. Na przykład gen warunkuje syntezę enzymu. Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy.

Ryć. 6-6a). 6. Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161 .2. Komplementarność Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć.Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p. Jest kilka rodzajów tego współdziałania.1. 6-6a.

plymouth rock) mają upierzenie białe. nazywamy genami komplementarnymi lub dopełniającymi się. którego nie było w dwóch pokoleniach przodków.2. warunkującego wytwarzanie pigmentu (melaniny) w piórach. w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP). Gen. w którym wystąpią 4 fenotypy w stosunku 9:3:3:1. natomiast gen P powoduje powstanie grzebienia groszkowego. U białych leghornów jest inna sytuacja.Gen R warunkuje kształt różyczkowy grzebienia. 6. a jego allel r — pojedynczy. gdyż brak w ich genotypach genu C. która powstaje w wyniku działania każdego z nich osobno. pojawia się również nowy typ — grzebień pojedynczy. współdziałające razem i wytwarzające odmienną formę cechy niż ta. natomiast gen hamowany to gen hipostatyczny. nazywany jest genem epistatycznym. Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc). Dwa dominujące geny z różnych par alleli. tj. 6-6b wkładka kolorowa). Epistaza Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza. której genotyp może mieć kilka różnych wariantów. jego allel p — grzebienia pojedynczego (ryć. podobna do wspomnianej wyżej u świń. że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. Kury niektórych ras (np. gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_).2. Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. że w pokoleniu Fl pojawia się nowy fenotyp. Ptaki te są również białe. charakteryzująca się tym. ale mają 162 . W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy. który hamuje ujawnienie się genu z innej pary. Zjawisko epistazy może wyjaśnić poniższy przykład. natomiast w pokoleniu F 2 . jak i różyczkowego. warunkujący go genotyp to podwójna homozygota recesywna — rrpp. Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego. która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym. wyandotte. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy. całkowicie różny od obojga rodziców. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia. Z krzyżowania osobników o ustalonej cesze kształtu grzebienia.

Różny stopień białej plamistości spowodowany działaniem genów modyfikujących w swych genotypach gen C. Allele z locus E i A są opisane w dalszej części tego rozdziału.3. zwane modyfikatorami. Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów. Geny te. 6. rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP. natomiast czarno umaszczonych (np. psów i kotów. oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. Geny epistatyczne mogą tłumić działanie wielu innych par. które modyfikują przejawianie się jakiejś prostej cechy. mimo iż cecha łaciatości warunkowana jest inną parą alleli.2. warunkowanej zwykle jedną parą genów. Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC. dotyczącej dziedziczenia umaszczenia. Geny modyfikujące Istnieje pewna grupa genów. którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc). rasy cornwall): aa ii EE. W potomstwie F2. Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć. który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. 163 .Ryć. Gen epistatyczny nie zawsze jest dominujący w swojej parze. 6-7. 6-7). Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary. Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I. powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę.

natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej.6-dihydroksyindolu (DHI) do indolochinonu. natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. Synteza.2. nieśność itd. iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu. takich jak gonadotropiny. wydajność mleczna. Ostatnie badania wykazały. rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny). Należy pamiętać. U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych. Dziedziczenie umaszczenia Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach.4. że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. Zmiany te spowodowane są działaniem niektórych hormonów. Zjawisko to polega na tym. Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny. biała w zimie. melanocyte stimulating hormone). U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np. syntetyzowane z metabolitów DOPA-chromu. 6. Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. powodując różne jej nasilenie. kortykotropina i hormon melanotropowy — MSH (ang. ale czynniki środowiskowe mogą modyfikować umaszczenie.). Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. zależne od sumującego się ich działania. Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. i feomelaniny (kolor czerwony lub żółty). Do niedawna uważano. addytywnymi lub poligenami.4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5. iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę. że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację. Sumujące działanie genów Inną formą współdziałania nieallelicznego genów jest polimeria. 6-8): 1) hydroksylację tyrozyny do 3. wpływając na przykład na zmianę ilości wytwarzanego pigmentu.3. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych. Geny te nazywane są genami polimerycznymi. 164 .6. wytwarzane z metabolitów cysteinylo-DOPA-chinonu. a czarna lub brązowa w lecie).

Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym. które współdziałają ze sobą w sposób kompleksowy. Geny. Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów. Wiele genów. komórkowym i subkomórkowym. Receptor ten jest determinowany przez locus E (Extension).Ryć. Schemat biosyntezy melaniny Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165 . jest wytwarzany przez część pośrednią części gruczołowej przysadki. ma działanie plejotropowe na rozwój i różnicowanie organizmu. jeśli nie wszystkie związane z wytwarzaniem pigmentu. Hormon melanotropowy. Hormon ten stymuluje produkcję poszczególnych melanin na przemian. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti). Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina). 6-8. Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. REGULACJA NA POZIOMIE TKANKOWYM Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). a hamowanie produkcji feomelaniny wewnątrz melanocytów. W determinację koloru jest włączonych wiele loci. Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. Melanocyty pochodzą z rdzenia nerwowego. a podczas rozwoju embrionalnego wędrują do powstającej skóry. Jest wiele genów. zwany również intermedyną lub melanotropiną. Melaniny są wytwarzane w melanocytach. które zostały już sklonowane.

.stalowy. a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. które działają na pigmentację ssaków na poziomie subkomórkowym. przez działanie na mechanizmy włączone w funkcję melanocytu. REGULACJA NA POZIOMIE SUBKOMÓRKOWYM Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym). Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. Należą do nich geny z loci D (Dilute — rozjaśniony). 166 . brak syntezy melaniny w przypadku albinizmu). melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę. REGULACJA NA POZIOMIE KOMÓRKOWYM Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów. Mutacje w tych loci wpływają wyraźnie na kolor oczu. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych. gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów. oba typy melanin nie są więc syntetyzowane jednocześnie. A (Agouti — dziki). W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np. Dominant White Spotting (W) . Locus D koduje strukturalne białko. pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. wpływają bezpośrednio na ilość i typ wytwarzanej melaniny. E (Extension . U osobników typu dzikiego. Locus ten kontroluje ilość eumelaniny. odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). Większość z tych mutacji ma wpływ plejotropowy na rozwój. co wpływa na koloryt (układ barw).. Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) . w jednolity typowy sposób.niesieniu do myszy.plamisty. Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora. lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np. nazywanych agouti.pełna barwa). Geny. które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów. Do loci działających na poziomie tkankowym. Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu). podczas gdy locus Extension działa w melanocytach.dominujący biały nakrapiany i Steel (Sl) . Locus E (Extension) koduje przede wszystkim receptor MSH. U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego).

w którym występuje dominacja w następującej kolejności: C. skórze i tęczówce oka. a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. czyli wycinania intronów. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny. natomiast inne geny regulują typ formowanego pigmentu. Specyficzna funkcja tego białka nie jest jeszcze poznana. natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm. Mutacje w locus C powodują brak pigmentu we włosach. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną. Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino. że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. Badania poszczególnych mutacji w locus Albino u królików. a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. Warunkiem ekspresji genów z tych loci jest 167 . Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu). gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza. Takie białka nie są kompetentne katalitycznie. Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny. inhibitora) w melanocytach. wykazały. ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. Wiadomo jednak. ale dotychczas nie stwierdzono. która powoduje uwrażliwienie efektu fenotypowego na temperaturę. prowadząca do osłabienia funkcji enzymu. c (ryć. Locus C kontroluje liczbę i intensywność ziaren pigmentu. w jaki pigment ma być formowany. Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). B i E. warunkujących umaszczenie himalajskie i szynszylowate. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka. jeszcze inne — sposób. czy pełnią one jakąś rolę (np. 6-9 wkładka kolorowa). Historycznie był on uważany za locus strukturalny dla tyrozynazy. której funkcja jest decydująca dla wytwarzania pigmentu. Interesujące jest to. iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową. ale mechanizm działania tego genu dotąd nie jest znany. ale są to mutacje typu nonsens. ch. Tyrozynaza przejawia swą ekspresję w melanocytach. Geny z locus C u królików tworzą szereg alleli wielokrotnych. iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown. zmiany sensu i mutacje zmiany fazy odczytu. Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji. Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A.Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). która prowadzi do wymiany cysteiny na tyrozynę. cch.

u obu gatunków są dwa allele — E i Ed. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie. która z reguły zajmuje miejsce eumelaniny. W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny. z wyjątkiem locus W. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci. efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -. W locus E. Feomelanina. Lis polarny o genotypie aa jest czarny. jakie są geny z innych loci. Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. Natomiast u lisa polarnego zamiast allelu A jest allel A". W locus B również są dwa allele — dominujący B (czarny pigment) i b. Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1.pigment czekoladowobrązowy.oczywiście obecność odpowiednich genów z locus C. warunkujących różne odmiany umaszczenia. jak G. P. S. bez względu na to. w układzie homozygotycznym -. We wszystkich tych loci. w populacji lisa polarnego w Islandii). U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. R. Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. Allel ten odpowiedzialny jest za eliminację eumelaniny. ale genotyp ten występuje bardzo rzadko (np. u lisa 168 . w tym przypadku kolor jest determinowany allelami z locus A. W. warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny.genotyp gg. u lisa polarnego jest rozcieńczona lub usunięta w ogóle. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny.

W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna. Mutacje dominujące. który w układzie homozygotycznym warunkuje umaszczenie czerwone. Allele te powstały w wyniku mutacji punktowych. Locus A koduje syntezę białka. s (trzy allele: S. Genetyczne podłoże umaszczenia u bydła Wyniki wielu badań sugerują. że u bydła umaszczenie czarne. Allele z tego locus mogą wykazać ekspresję tylko wtedy. Locus E koduje syntezę białka MSH-R (ang. W3 (biały Georgian) i W M (gen marble). Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. umiejscowionym w chromosomie 18. Mutacja w locus s (Shadow) charakteryzuje się heterochromią. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy. natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. a drugie brązowe. melanocyte stimulating hormon receptor). U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe. W (białopyski). przy czym genotyp ww występuje u lisa rudego i srebrzystego. natomiast gen marble daje inny efekt fenotypowy u tych odmian. w układzie homozygotycznym mają efekt letalny. złożonego z około 350 aminokwasów. Allel dominujący Ed. brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). jest homologiczny do allelu ES0 u myszy. są 3 allele: Ed warunkujący umaszczenie czarne dominujące. której skutkiem może być różny kolor oczu u tego samego osobnika. natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. kodujący czarny kolor. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a.perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. SJ i SH) i t (T). 169 . W locus W są następujące allele: w. recesywny allel e. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny. gdy w locus E jest genotyp E+_. DD — niebieski). jedno oko niebieskie. F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia). Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. takie jak W i W. W locus tym. natomiast allel a w układzie homozygotycznym — recesywne czarne.. W (platynowy). opisanych w rozdziale: Mutacje. Niestety dotychczas nie przeprowadzano badań molekularnych locus A. Letalny jest także genotyp WW. oraz allel E+ umożliwiający ekspresję alleli z locus A.srebrzystego: genotyp pp . będącego antagonistą białka MSH-R. np.

U ras bydła (np. wskazują. U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic. i allel i — recesywny (kolorowy).nieagouti. obserwowana jest zmienność w ekspresji cechy łaciatości. U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę. bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. kora jest efektem plejotropowego oddziaływania allelu R na płodność. W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej. cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie. ale recesywny w stosunku do białego (I). że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension. blisko telomerowego regionu ramienia p. iż locus ten jest umiejscowiony w chromosomie 6. poland-china i pietrain. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica. locus I (biały dominujący) i locus Be (Belted opasany). locus E (Extension). a mała allelu e (czerwone umaszczenie). który dominuje nad s. u których allel s jest utrwalony. cornwall i hampshire. Genetyczne podłoże umaszczenia u świń U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti). Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego. recesywny s — łaciatość. w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8). Kolejność dominowania tych alleli jest następująca: E-Ep-e. Badania. Na przykład. Wśród 170 . także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey. W tym samym locus u bydła tej rasy znajduje się allel Sc. odpowiedzialny za umaszczenie dominujące białe.Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire. natomiast u shorthornów jest odwrotnie. warunkujący fenotyp nazwany colorsided — łaciaty. Podobnie jak u myszy i bydła. ale jest recesywny w stosunku do allelu S. powodując różne zaburzenia. W locus I są dwa główne allele: 7 (inhibicja koloru). W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a . niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. w których do analizy sprzężeń użyto ponad 230 markerów genetycznych. mroziate). belgijskie błękitne). Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Większość ras świń udomowionych ma allel recesywny a — nieagouti..

Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita. We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele. jak np. overo (O). takie jak tobiano (TO). I p (czarne łaty) oraz im (brudny szary). Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. charakterystyczny dla niektórych ras. G (Gray — siwy) i RN (Roan — deresz). są determinowane przez geny z innych loci. cremello). D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). wykazujący niepełną dominację. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus. Genetyczne podłoże umaszczenia u koni Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony). hannover-braunschweig. natomiast inne rasy są homozygotami recesywnymi (ii). Locus I został zlokalizowany w chromosomie 8. występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace. oznaczonych symbolem Id (deresz). Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"'. wessex saddleback. zatem wystarczy jeden allel W. by było 171 . Allele z tego locus wpływają na ekspresję genów z locus A. ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. jest kodowany przez allel Be w z locus Be. w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. 6-10 wkładka kolorowa). siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały). Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina). Locus E warunkuje wytwarzanie określonego rodzaju melaniny. Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. sabino (SB) czy tarantowate (LP). który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. Biały pas. W locus C u koni nie występuje allel recesywny c. hampshire (ryć. W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. trzeciego allelu w locus Extension — ED). Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). Umaszczenie białe. allel dominujący E determinuje syntezę eumelaniny.świń domowych dominujący biały jest przeważający. dominujący w stosunku do jednolitego umaszczenia. Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. Wzory umaszczenia. Genotyp tego knura jest następujący: aa U EE BewBew.

na skutek braku części jelita. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_). w locus W mają genotyp homozygoty recesywnej (ww). Allel G (w homo.umaszczenie białe). Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww). wobec którego jest hipostatyczny. osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd). znacznie rzadziej. Wszystkie rodzaje umaszczenia. który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny. z wyjątkiem allelu W. Natomiast umaszczenie siwe kontroluje allel dominujący z locus G. który jest epistatyczny w stosunku do wszystkich alleli z innych loci. Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina.i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. 172 . polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub. O i RN. z wyjątkiem białego. zestawiono w tabeli 6-II. Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny. Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" . Genotypy w 7 loci.LWFS (ang. lethal white foal syndrome). Allel D z locus Dun wykazuje zupełną dominację. Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. Należą do nich allele dominujące z loci W. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. determinujące wybrane rodzaje umaszczenia koni.

Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów. natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. warunkuje białe umaszczenie owiec. Niektóre allele z tego locus mają efekt plejotropowy. Brw — czekoladowobrązowej eumelaniny. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała. 173 . Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny. Bw. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab. np. podczas gdy feomelanina może być syntetyzowana.Genetyczne podłoże umaszczenia u owiec U owiec stwierdzono trzy typy pigmentu: czarna eumelanina. bądź też oba efekty występują łącznie. allel Awh zmniejsza płodność owiec o około 0. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny. czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina. Allel typu dzikiego. bądź mieszaniny jasnych i ciemnych włókien wełny. inne wpływają na typ włókien. 6-III). Przykładem tego jest brązowoczerwony kolor wełny karakułów. Allel A wh . Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia.15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. w których genotypach jest allel Awh. wzór koloru i obecność lub brak białych znaków. od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. warunkuje wytwarzanie czarnej eumelaniny. Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. który w fenotypie ujawnia się ze zmienną intensywnością. Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu. Owce biało umaszczone są zwykle prawie pozbawione pigmentu. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec. że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. natomiast recesywny allel. ale mogą mieć pigment tan. Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała. Badania specjalistyczne wykazały. będący pierwszym w kolejności dominowania z szeregu alleli z tego locus. natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny.

Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. Allel typu dzikiego. U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. Owce ras wełnistych. AwhAwh. natomiast homozygoty SSSS są całkowicie białe. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy). łaciate afgańskie) jest kontrolowane przez allel W a z locus White. recesywny. Ew umożliwia normalną ekspresję alleli z locus Agouti. Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. a także homozygotyczne białe. Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej. ale epistatyczny do dominującej brązowej (tan). Umaszczenie białe dominujące (białe perskie. Allel ten jest epistatyczny 174 . z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS).Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension.

jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników. Penetracja określonego genu może być różna zależnie od płci. wykazują charakterystyczny dla niego fenotyp. że jego penetracja wynosi 80%. Z drugiej strony. Na przykład. Pierwsze z tych zjawisk określane jest jako penetracja genu. warunkuje dominującą szarość u karakułów. mające taki sam genotyp. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. mówimy o penetracji niezupełnej. Natomiast jeśli nie wszystkie osobniki. Penetracja i stopień ekspresji (ekspresywność) genów Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika. natomiast drugie jako ekspresywność genu. Penetracja może być całkowita lub niezupełna. w przypadkach krańcowych. Natężenie drgań jest bardzo zróżnicowane. Wrn. 6. to mówimy. współdziałania tych genów między sobą oraz współdziałania ze środowiskiem. Penetracja. kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy. ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. inne zaś jej nie mają. gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. jest to częstość. 175 . O penetracji całkowitej mówimy wówczas. iż działanie genów może wywoływać różnorodne efekty. a nawet. również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny.w stosunku do wszystkich innych genów umaszczenia. z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą. Często zdarzają się przypadki. ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość. inaczej określana jako przenikliwość. Stwierdzono to na podstawie wyników doświadczenia. która w formie homozygotycznej jest letalna. Inny allel z tego locus. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym. zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów.4.

Pojęcie stopień ekspresji (ekspresywność. Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach. iż mamy do czynienia ze zmiennością przejawiania się tego samego genu. sole mineralne oraz inne związki krążące we krwi. Z kolei. geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji. Należy jednak pamiętać o tym. Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych.5. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. Zarówno stopień penetracji. stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. jak: wiek. Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością. Już na początku naszego stulecia zauważono. gdy jest ona obserwowana u osobników spokrewnionych ze sobą. dziedziczą się różnie. a także położenie zarodka w macicy i nawet obecność innych płodów. Geny z różnych loci mogą dawać podobne fenotypy. w którym pojawiają się pierwsze objawy. a także chloroplas176 . 6. Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki. a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. zależnie od kierunku krzyżowania. Nie bez znaczenia jest stan zdrowotny matki. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony. ujawniające się w różnym stopniu. Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu. docierające przez łożysko do rozwijającego się płodu). że niektóre cechy nie podporządkowują się temu terminowi. możemy mieć wtedy. czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne). Dziedziczenie pozajądrowe Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym. Pewność. jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). które nie są dziedziczne.

+26 ±99 kg. O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je. Plemnik zawiera od 50 do 100 mitochondriów. Natomiast allele charakteryzujące się niską frekwencją (^ 0. u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca.tach roślin wyjaśniło podłoże tego zjawiska. natomiast komórka jajowa ma ich około 100 tysięcy. Jak dotąd. w przeciwieństwie do DNA jądrowego. -879 ±114 kg mleka. że warunkuje on od 2 do 10% zmienności tych cech. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały.4. tli . Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg. średnią i niską wydajnością mleka. Powstał nowy termin dziedziczenie pozachromosomowe. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała.3 do 0. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację. Przyczyną tego. której wartość zawiera się w granicach od 0.9. Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika).1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce. Mitochondrialny DNA. co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka. Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0. w świetle wyników najnowszych badań. analizowanego metodą RFLP. między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką. jest przekazywany następnemu pokoleniu wyłącznie przez matki. może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. inaczej pozajądrowe lub cytoplazmatyczne. ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA.

Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe..Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności. wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu. Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej. Stwierdzono bowiem istotny wpływ zamiany (tranzycji . .rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka. U owiec badania mitochondrialnego DNA. Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła. prowadzone za pomocą technik molekularnych (RFLP). Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA.

Istnieje także zmienność grupowa. tzw. wydajność mleczna w kolejnych laktacjach).1. Na zmienność fenotypową. Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej. lub S2 w przypadku próby losowej pochodzącej z tej populacji. W przypadku cech. 179 . występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa). Zmienność oznaczamy symbolem S2. jeśli rozpatrujemy populację zwierząt. interakcja genotyp-środowisko. mamy do czynienia ze zmiennością wewnątrzosobniczą. które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np.Rozdział 7. czyli indywidualna. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa). zwaną także ogólną. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza. Rodzaje zmienności i czynniki ją wywołujące Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników. może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi.

i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu. ale także fenotypu (bezrogie i rogate). Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. Głównymi składnikami zmienności genetycznej są: zmienność addytywna. są przyczyną powstawania różnych genotypów. Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą. Zmienność dominacyjna jest to część zmienności genetycznej. będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie. która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów. Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest 180 . które kontrolują występowanie danej cechy. Osobniki fenotypowo identyczne (bezrogie). Poniższy schemat krzyżowania bydła obrazuje to odchylenie. ale różniące się pod względem założeń genetycznych (homo. w którego genotypie funkcjonuje jeden gen dominujący. Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym. Mutacje prowadzą do powstawania nowych genów.Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. innych układów w obrębie chromosomu lub między chromosomami. Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych. odchylenie dominacyjne i odchylenie epistatyczne. Natomiast rekombinacje. i osobnikami homozygotycznymi — dominującym i recesywnym.

Do szacowania tego udziału stosowane są parametry genetyczne. Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny. genotypów i fenotypów w danej populacji (stadzie). W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej. Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału 181 . Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami. np. warunkowanych zwykle jedną parą alleli. a zwłaszcza jej składnika — zmienności addytywnej. do których należy odziedziczalność. Z krzyżowania osobników 0 białym upierzeniu. należy także efekt matki pre-i postnatalny. Zmienność skokowa odnosi się przede wszystkim do cech jakościowych. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. upierzenie biafe).). jak 1barwnie upierzone. w zmienności fenotypowej danej cechy ilościowej. uzyskuje się mieszańce biało upierzone.białe upierzenie kur rasy leghorn i whiterock. liczba prosiąt w miocie. mających istotne znaczenie. Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży. sposób utrzymania itp. Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. czynniki klimatyczne) lub okresowo (żywienie. należących do tych ras. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych. Zmienność skokowa występuje również w przypadku pewnych cech ilościowych. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało. których wartość wyrażana jest za pomocą liczb naturalnych. Do czynników środowiskowych.

procentowa zawartość tłuszczu w mleku itp. a niektóre wartości powtarzają się. Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt.2. szereg rozdzielczy. wydajność mleka w kilogramach. Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej. Miary skupienia Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna. dane zestawia się w tzw. ważona. Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych. harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta). zwanej próbą. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy. w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. według wartości rosnących lub malejących (szereg statystyczny uporządkowany).1. którego elementami są poszczególne osobniki. Miary zmienności Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników.2. które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji). Jeśli liczba obserwacji jest duża. ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru: . wysokość w kłębie w centymetrach. zmierzyć) u wszystkich osobników stanowiących próbę.charakterystycznego dla danej cechy. Średnia arytmetyczna nie odzwierciedla zmienności. 7. 7. np. W celu określenia zmienności cechy musimy ją oznaczyć (np. Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np.

W pierwszej minucie uzyskano 4 kg mleka. np. Wzór na jej obliczanie jest następujący: Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu. a w trzeciej l kg. do obliczania średniej prędkości. jaka była średnia szybkość oddawania mleka: 183 . 7-1): Średnią ważoną obliczamy wówczas.Średnia arytmetyczna charakteryzuje się następującymi właściwościami: Przykład (dane z tab. w drugiej 2 kg. gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. Wzór na obliczanie średniej harmonicznej jest następujący: Przykład: Ważono mleko oddawane przez krowę w kolejnych minutach doju. Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący.

Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy. Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu. odbiega od rozkładu normalnego.Średnią geometryczną stosuje się wtedy. tzn. W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną: . gdy rozkład zmienności cechy jest asymetryczny.

która najczęściej powtarza się w szeregu liczbowym.0294. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną: Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1.0864. standardowe odchylenie i współczynnik zmienności. ale podniesione do kwadratu.1239.2.. 0. Ma ona miano takie jak analizowana cecha. czyli 128%. w którym licznik jest sumą kwadratów odchyleń: Jeśli próbę stanowi mała liczba obserwacji.0414. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji. 0. Wariancja nie może mieć wartości ujemnej. 0. a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie).28. 0. natomiast ich suma = 0. Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej Biorąc pod uwagę. w celu ułatwienia obliczeń stosuje się wzór roboczy. że najczęściej średnia arytmetyczna nie jest liczbą całkowitą. Miary rozproszenia Podstawowe miary rozproszenia to wariancja.2. 185 . 0. Wartość modalna (średnia modalna) jest to wartość cechy.3010. 7.6518.Przykład: Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych. która dzieli szereg uporządkowany malejąco lub rosnąco na połowę.0697. ale przez N—1. Wartości zlogarytmowane tego współczynnika wyniosły: 0. w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji. Wartość środkowa (mediana) jest to wartość cechy.

Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona. np. Dobór zwierząt do grup doświadczalnych powinien być losowy. Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt. dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach. wykorzystując dane liczbowe zawarte w tabeli 7-1. Sposób obliczania miar rozproszenia przedstawiono niżej.Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji. Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru: gdzie: Współczynnik zmienności wyraża zmienność w procentach. dotyczące masy ciała owiec w wieku 10 miesięcy. a także zmienności tej samej cechy w różnych populacjach (np. wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji. Wariancja: .

Dziedziczenie cech ilościowych Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. Liczba poligenów kontrolujących cechy ilościowe jest nieznana. czyli obojętne dla wartości cechy. a drugi neutralne. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc). natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. addytywnymi lub kumulatywnymi. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. uzyskujemy przedstawiony niżej obraz graficzny: 187 . U potomstwa w pokoleniu F2 nastąpiło rozszczepienie.7. Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej. niosącymi 120 jaj rocznie. czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. że nieśność kur warunkowana jest trzema parami alleli z różnych loci. Kolejnym założeniem jest to.3. specyficznie ze sobą współdziałają. Koguty o genotypach AABBCC. zwiększające wartość cechy). nazywane inaczej genami polimerycznymi. Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę. Założono również. pomiędzy którymi zachodzi dziedziczenie pośrednie. Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny). Najczęściej występują genotypy warunkujące wartości fenotypowe cechy.1. Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie. B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. mające założenia genetyczne warunkujące nieśność 240 jaj rocznie. że każdy poligen ma dwa allele. Zmienność cech ilościowych 7. natomiast zmniejsza się częstość występowania form skrajnych. w którym hipotetycznie przyjęto. Przyjmuje się. które skupiają się wokół wartości średniej. przy czym jeden z nich ma działanie pozytywne (tzn. że efekty genów A. skrzyżowano z kurami o genotypach aabbcc. warunkujące 7 poziomów nieśności (fenotypów tej cechy). że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. Poligeny. że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy.3. uzyskano 64 genotypy. Zakłada się. Zagadnienie to obrazuje przykład.

w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej. 188 . • rozkład ten jest symetryczny. iż: • jest to rozkład. a najmniej skrajne wartości. zwana krzywą Gaussa. determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy: W podanym przykładzie celowo pominięto wpływ czynników środowiskowych. w którym jest średnia wartość cechy. gdyż zacierają one różnice między fenotypami. Rozkład normalny charakteryzuje się tym. Znaczenie tych czynników jest istotne. poniżej i powyżej średniej. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. a oś symetrii przechodzi przez punkt.Po zestawieniu wartości fenotypowych cechy. że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego. co w przypadku cech ilościowych o zmienności ciągłej powoduje.

Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów. Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka. nawet ras o ustalonym genotypie. ilości substancji odżywczych dostarczanych płodowi (lub płodom).6% wszystkich obserwacji cechy. Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang.4% wszystkich obserwacji. • w przedziale x±3 S znajduje się ok. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189 . • w przedziale x ±2 S znajduje się ok. dziedziczenie pozajądrowe. wielkości matki oraz jej stanu fizjologicznego i zdrowotnego. a także wielu czynników środowiskowych. Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw. co wartość średniej arytmetycznej. 95. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np. 68. są heterozygotyczne pod względem znacznej liczby loci. wpływ matki na potomstwo jest większy od wpływu ojcowskiego. rasy. behawior matczyny). z innych ras). maternal effect). że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia.2% wszystkich obserwacji. jak i mitochondrialnym DNA. • w przedziale x±S znajduje się ok. U trzody chlewnej.• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie. 7.3. Jak już wspomniano. na przykład. Zmienność transgresywna Zwierzęta gospodarskie. omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech). 99. stwierdzono. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy. na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. Wielkość efektu matki prę. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym.i postnatalnego zależy od gatunku. Mogą one maskować oddziaływanie poligenów. Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw.2. • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny). procent tłuszczu w mleku oraz wartość energetyczną mleka.

Niektóre geny o dużym efekcie zostały wykryte przypadkowo. równą wartości cechy u rodziców. W przypadku niektórych cech zaobserwowano zmienność. spłaszczony albo nadmiernie uwypuklony. Ilustruje je przykład: Załóżmy. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna. Zjawisko to nosi nazwę transgresji. Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang. czyli wykazujące większą zmienność cechy. warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka). Cechy takie charakteryzują się rozkładem normalnym.3. natomiast heterozygotyczny DdEeFf— 3600 kg mleka. Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. E i F są identyczne (D = E = F). W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot). W badaniach prowadzonych na simentalerach stwierdzono. wykorzystywanej w pracy hodowlanej. Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np. Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy.3. Jest to wynikiem dziedziczenia. 7. zwany inaczej genem głównym.wartości cechy takie. której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty. growth hormone). U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25). quantitative trait locus). Genotyp ddeeff warunkuje wydajność 2400 kg mleka. Geny o dużym efekcie W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). bądź wartości wyższe lub niższe niż u rodziców. a każdy z nich zwiększa produkcję mleka o 400 kg. Efekty genów D. genotyp DDEEFF. Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. warunkujące różną wydajność mleczną. Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej. w którym obok poligenów działa gen o dużym efekcie. iż zwierzęta homozygotyczne pod względem allelu B hormonu 190 . DDEEFF — 4800 kg. E i F. jakie obserwowano u rodziców. gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie. Gen o dużym efekcie jest identyfikowany wówczas. że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D.

Dalsze badania zmierzają do ustalenia. Dotychczas wykazano. bydła i szczura. warunkami termicznymi i niektórymi czynnikami chemicznymi. Hormon wzrostu reguluje rozwój mięśni. jak zawartość mięsa w tuszy i powierzchnia oka polędwicy. iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe. które allele mają związek z użytkowością mięsną. powodowane transportem.5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA.3. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej. Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni. z równoczesnym zmniejszeniem otłuszczenia. Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. 191 . iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe). Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt. porcine stress syndrome). a najnowsze osiągnięcia są omówione w rozdziale 12. Gen receptora rianodyny (KYR1). Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena. W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka.wzrostu charakteryzowały się o 382 + 18. iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu. prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. Stwierdzono także. Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie. Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną. Badania cytogenetyczne wykazały. a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała.5. a IGF-1 wspomaga jego działanie. jak karłowatość i akromegalia. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych. Świnie U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie. będących nosicielami zmutowanego allelu. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. Zwierzęta takie są więc dobrym materiałem do tuczu. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu.

Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. początkowo oznaczono go symbolem Haln. W innym.Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan. z których najistotniejsza jest mutacja w 1843 nukleotydzie. opatentowanym przez badaczy kanadyjskich. Procedurę tego testu przedstawiono na rycinie 7-1. fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. co umożliwiło opracowanie molekularnych testów diagnostycznych. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI). natomiast w zmutowanym 192 . Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T. Mutacja ta likwiduje miejsce trawienia niektórymi enzymami. powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. W obrębie genu RYR1 stwierdzono 18 mutacji punktowych. Badania przeprowadzone przez naukowców kanadyjskich wykazały. W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1).

dla homozygotycznego (nn) . Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych. ale tylko tranzycja G-»A w kodonie 200. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19. Stwierdzono.. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3). 32 pz. U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce). że enzym nie znajduje miejsca cięcia. Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi. W genie tym stwierdzono siedem mutacji. 49 pz. W pracy hodowlanej należy prowadzić kojarzenia tak. Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). u bydła w 18. estrogen receptor gene) może mieć istotny wpływ na wielkość miotu. występujący w chińskiej plennej rasie meishan. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy. a u koni w 10 chromosomie.5-2. yorkshire. iż zlokalizowany w chromosomie l (1p2. Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością.allelu zmiana tej sekwencji powoduje.4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang. czego wynikiem jest uzyskanie nie strawionego fragmentu genu. Test molekularny wykrywający mutację genu PRKAG3 został opatentowany. warunkuje cechę kwaśnego mięsa. by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. duroc). Wyniki tych badań wskazują. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz. Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1. wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie 193 . Gen wpływający na wielkość miotu (ESR). Pierwsze sugestie co do istnienia genu o dużym efekcie.jeden prążek długości 81 pz. Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. natomiast dla heterozygoty trzy prążki: 81 pz. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu.4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym. że jeden z alleli tego genu. prowadzone u świń innych ras (niemiecka landrace. wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę.

zawiera 7 eksonów. podobnie jak κ-kazeiny. przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. 7-2). Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. identyfikowanych w mleku córek. zlokalizowany w chromosomie 6. Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT). wpływa na wydajność mleka i jego składników. ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. Gen β-laktoglobuliny ma długość około 7800 par zasad. wariant A alaninę (GCT). gdyż określony wariant tego białka. W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC).1754). Białko wariantu A różni się od B dwoma aminokwasami. Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII. Bydło Geny białek mleka. Gen β-laktoglobuliny uważany jest za gen o dużym efekcie. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć. Jest to konsekwencja różnic w sekwencji nukleo- 194 . wykorzystywanych jako dodatkowe kryterium selekcji buhajów. utrzymywanych w zakładach unasieniania. Gen κ-kazeiny. podczas gdy w wariancie B — treonina (w DNA kodon ACC). ekonomicznie ważne cechy. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń. Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny. tłuszczu i kazein oraz lepszą przydatnością technologiczną. jak wzrost i grubość słoniny na grzbiecie. Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy. Opracowana została metoda identyfikacji genotypów κ-kazeiny. Gen ten nie wykazuje plejotropowego negatywnego działania na inne. Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. białka i tłuszczu). W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. wyprowadzanych z udziałem rasy meishan.

b — produkt nie strawiony. jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). dlatego mutacja ta jest oznaczona jako nt821(del11). mniejszy obwód i masa jąder. 7-2. l — trawienie enzymem restrykcyjnym Hinfi. zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi. należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci. transforming growth factor β). a — marker. Gen miostatyny należy do rodziny TGFβ (ang. Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa. Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem. jak i ich mieszańców.AB AA BB Ryć. Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne. Duża masa płodu stwarza wyraźne trudności naturalnego porodu. 2 — trawienie enzymem restrykcyjnym Hindlll tydowej obu alleli. muscular hypertrophy). Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras. Rozwiązaniem 195 . Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. natomiast u krów dłuższa ciąża. Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2. spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej. Gen hipertrofii mięśniowej (MH — ang.

Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. mutacje te są charakterystyczne dla określonych ras bydła mięsnego. Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. pyge -. przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia. który pełni nieznaną jeszcze funkcję regulacyjną. która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy.symbol CLPG. Co ciekawe. Hipertrofia ujawnia się u potomka wówczas. które uszkadzają funkcję kodowanego białka. Ostatnio ustalono. cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. warunkujące zwiększony stopień owulacji.pośladki) -. czy od matki.ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938. natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. Przypuszcza się. Owce Gen hipertrofii mięśniowej (CLPG). Jest to pojedynczy autosomalny gen. b) tranzycja C→T w 610 nukleotydzie. w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego. Gen CLPG pochodzący od matki jest nieaktywny. gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). U owiec występuje mutacja powodująca hipertrofię mięśniową. Przypuszcza się. zlokalizowany w chromosomie płci X) 196 . noncoding RNA). czy gen CLPG pochodzi od ojca. począwszy od pozycji 419 nukleotydu. Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji. c) transwersja G → T w nukleotydzie 676. 7-3 wkładka kolorowa). Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. a jego produkt to niekodujący RNA (ncRNA ang. która jest odpowiedzialna za substytucję cysteiny przez tyrozynę. Prowadzone są badania w celu jego izolacji. że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. Pomimo ujemnych następstw związanych z hipertrofią mięśni. Jak wykazały ostatnie badania. b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). Mutacje a) i c) występują u bydła francuskiego maine-anjou. że istnieją dwa allele — CLPG i clpg. takie jak gen Inverdale (FecXI. że locus ten podlega transkrypcji. nazwany callipyge (z greckiego calli — piękne. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów. U owiec wykryto geny główne.

polegającą na tranzycji adeniny na guaninę. wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz. trzy prążki (110 pz. W przeciwieństwie do owiec ras wysokopiennych (owca romanowska.u owiec rasy romney. . Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych. połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II). której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego. zawierającego miejsce mutacyjne. W locus BMPR-IB wykryto mutację w 830 nukleotydzie. uwarunkowaną genami o addytywnym efekcie. że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to. ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang. gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. produkt PCR nie strawiony) dla homozygoty typu dzikiego. Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB. „Thoka" u owiec islandskich. Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB. fecundity gene of booroola). w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. owca fińska). będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego. Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie). u których zwiększona plenność jest cechą poligeniczną. odpowiedzialnej za dużą plenność owiec rasy merynos booroola. Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80.

że każdy osobnik ma określony fenotyp. mimo iż dotyczyły nieraz grupy zwierząt. mogące się rozmnażać i występować na danym obszarze. 8. jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G.Rozdział Podstawy genetyki populacji Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia. Podstawowym prawem genetyki populacji. 198 .H. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. Hardy'ego i niemieckego lekarza W. tak więc w populacji występuje określona liczba fenotypów. Hodowla jest działalnością genetyczno-populacyjną. Weinberga. prawo to nosi nazwę Hardy' ego-Weinberga. Rozpatrując daną cechę można powiedzieć. Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników. teoretycznie nieskończona liczba osobników. w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki. Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową. opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej. Ponieważ badacze ci działali niezależnie od siebie. lecz zbiorowości określonej jako populacja. Populację stanowią zwierzęta należące do jednego gatunku.1. Prawo równowagi genetycznej Struktura genetyczna populacji Populację tworzy określona.

Oba te elementy są od siebie zależne. podobnie frekwencja allelu a = 1000/2000 = 0.5 (50%). inaczej frekwencja danego fenotypu. każdy ma dwa allele). ptaki niebieskie mają 500 genów A i 500 genów a. Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca: Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków. Częstość występowania. W genotypach 250 ptaków białych jest 500 alleli a. to: 199 .5 (50%). W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych. które ten allel mógłby zająć w badanej populacji. Zatem w stadzie tym jest 1000 alleli A i 1000 a. Sposób postępowania obrazuje poniższy przykład. Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. a allelu recesywnego symbolem q. Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu. 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim). Jeśli frekwencję allelu dominującego oznaczymy symbolem p. Suma frekwencji obu alleli wynosi l (100%). Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). Suma frekwencji wszystkich fenotypów równa się l lub 100%. natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów. Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów.z których każdy reprezentowany jest przez pewną liczbę osobników. Częstość występowania (frekwencja) allelu A = 1000/2000 = 0. 250 ptaków czarnych ma w swych genotypach 500 genów A. oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego.

Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga. frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie. że: w dużej. w której frekwencje genów u obu płci są jednakowe. wówczas struktura genetyczna w pokoleniu potomnym będzie następująca: czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci. a osobniki charakteryzują się równą płodnością i żywotnością. losowo kojarzącej się populacji. Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci. które wpływają na zmianę struktury genetycznej populacji. zatem rozkład fenotypów i genotypów w tej populacji wynosi: Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna. a' zdarzają się również migracje i mutacje. O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej. jeśli nie działają czynniki naruszające równowagę. 200 .Rozpatrywana cecha dziedziczy się z niezupełną dominacją. które mówi o tym.

(EdEd) lub heterozygotyczne (Ede).7. że w przypadku losowych kojarzeń rozkład genotypów jest następujący: łatwo jest obliczyć frekwencję pozostałych genotypów: W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych. 8. Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q. Wiedząc. jak i genów stwarza pewne trudności. Pozostałe 910 krów ma genotypy homo. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych.3. łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q. że zawierają jedynie allele recesywne.8. Frekwencja genów i genotypów w przypadku dominowania W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący: 201 .2. Wiedząc. która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0.09. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0. że frekwencja homozygot recesywnych wynosi q2. a 90 czerwonych. Zatem obliczanie frekwencji zarówno tych genotypów.3 = 0. gdyż w ich przypadku wiadomo na pewno. W stadzie tym prowadzone są kojarzenia losowe.

r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc). 13 himalajskich i 2 albinosy. 8-1): 202 . Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). W populacji tej. q dla genu dla genu c. w której są kojarzenia losowe. W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa). Frekwencja poszczególnych fenotypów wynosi zatem: Frekwencję genów oznaczono symbolem p dla genu C. genotypy i ich frekwencja są następujące (tab. Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli.q.przy czym p. fenotypy. U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C.

znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc). że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi: Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego.Po dodaniu takich samych genotypów uzyska się rozkład: Z zestawienia tego wynika. W danym przykładzie r2 = 0.013. Podstawiając dane liczbowe. Frekwencję genu można obliczyć następująco: W badanej populacji królików frekwencja genów umaszczenia jest więc następująca: 203 . stąd r = = 0.114. (q + r) równa się: Frekwencję genu c = r można obliczyć.

natomiast a — jego recesywnym allelem.4. U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi: U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu: 204 . lecz przyjmie postać: przy czym A jest genem dominującym. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet. jak i u mężczyzn. Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym. czyli zgodna z rozkładem dwumianowym. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0. U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm. Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu.ogółem = 1. U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych.08. geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej. który ją warunkuje).000 8. których liczba w genotypach jest jednakowa bez względu na płeć osobnika.

może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji.= p = 0. O ile mutacje i dryf genetyczny nie zależą od hodowcy. W rozdziale dotyczącym mutacji podano. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus.D. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej).5. Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD). o tyle pozostałe czynniki są związane z jego świadomą działalnością. Analogicznie. w której mutacja wystąpiła. pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ). mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq. która może wpłynąć na zmianę struktury genetycznej populacji. Mutacje Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. wpływają na zmianę frekwencji genów i genotypów. Czynniki naruszające równowagę genetyczną Do czynników naruszających równowagę genetyczną populacji należą: mutacje. np. jego frekwencja zmaleje o wartość równą up. z wyjątkiem doboru.= q = 0. mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji. 1472 kobiety będą rozróżniały barwy. W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ). Jeśli zmutuje allel dominujący.08 Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64. umaszczenie zwierząt futerkowych. 8. Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie: 205 . selekcja. Ekspresja fenotypowa mutacji. Wszystkie te czynniki. zależy od genetycznego uwarunkowania danej cechy. dobór par do kojarzeń i dryf genetyczny. powodująca pojawienie się nowej barwy okrywy włosowej. migracje. ale także mogą się pojawić nowe allele. natomiast częstość mutacji odwrotnej symbolem v.92 d. ale będą nosicielkami genu daltonizmu (Dd). Jeśli zmutuje jeden z genów addytywnych. kontrolujących cechę ilościową. Natomiast mutacja genu warunkującego cechę jakościową. iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u.

Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji) 206 . krzyżowanie wypierające). Ede = 2pq = 0. a 6 alleli e w kierunku allelu Ed. Przy krzyżowaniu różnych ras w zależności od tego. wielkość zmian frekwencji genów i genotypów jest różna. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. W wyniku mutacji genowej.66.4356.09. czyli ustali się nowy układ genetyczny.1156. Migracje Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu. allelu czerwonego umaszczenia e = q = 0.34. które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną. Zmianie uległa także frekwencja genotypów. W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja. zatem migracja nie zawsze wiąże się z wprowadzaniem osobników. doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw. ee = q2 = 0. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0.Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0. może ona dotyczyć wprowadzania nasienia.7. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów.1.14 alleli Ed zmutowało w kierunku allelu e. ee = q = 0. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0.49. ile razy dokonywane jest to krzyżowanie.4488. Może nawet. po mutacji: EdEd = p2 = 0. natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0. i wyniosła 0. powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. w przypadku wielokrotnego krzyżowania.3. Jeśli jest to zabieg jednorazowy. Natomiast krzyżowanie uszlachetniające.42. Ede = 2pq = 0. po pewnym czasie populacja wróci do równowagi.

a eliminuje z populacji zwierząt geny niepożądane. ee = q2 = 0.5476.74 czyli wzrosła o 0.7 = 0. wprowadzono 20 krów.49.74) = 0. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej.4. Ede = 2pq = 0.2 • 0. jakie geny czy genotypy są preferowane.18.09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0.01. Zmiany w strukturze genetycznej populacji zależą od tego.3848.9 + (l -0. E'e = 2pq = 0. ee = q = 0. z frekwencją allelu Ed wynoszącą 0.oznaczymy literą m. nazywany jest selekcją.9.2) • 0. że do omawianego wcześniej stada liczącego 100 krów. zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy.26. Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p. zmalała osobników heterozygotycznyh Ede i homozygotycznych ee.42. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku. ee = q= 0. Nowa frekwencja allelu e wynosi (1 — 0.0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy. które hodowca zamierza pozostawić do hodowli. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0. w którym frekwencja allelu Ed wynosiła 0. 207 . to część osobników rodzimych będzie równa (1 —m). Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0.81. E d e = 2pq = 0. obniżenia płodności i produkcyjności lub niepożądanego genotypu. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji.7. Hodowca preferuje geny korzystne. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0. Selekcja Wybór zwierząt. stanu zdrowotnego. a frekwencję genu u osobników wprowadzonych do stada literą p'.

Współczynnik ten może przybierać wartość od O do l. Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji. wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym. prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. w którym frekwencja allelu bezrożności wynosi 0. Zmiana frekwencji genu. gdy nie ma w ogóle selekcji. zmianę częstości genu recesywnego. to oznacza. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie.Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. że wartość O jest wówczas. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego: Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0. co oznacza.8. będąca konsekwencją selekcji. Dobór par do kojarzeń W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe. Załóżmy.187. zastosowano kojarzenia w obrębie takich samych 208 . zależy od rodzaju tej selekcji. wówczas frekwencja genu tworzącego ten genotyp wyniesie: wzoru: Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną. Jeśli współczynnik selekcji będzie wynosić 0. czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled). prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. Cecha ta dziedziczy się z dominacją zupełną. można obliczyć ze Jeśli natomiast selekcja preferuje genotyp recesywny. wartość l współczynnik osiąga. W pewnym stadzie. gdy usuwane są wszystkie niepożądane genotypy.013 i wyniesie 0.4. Efekt selekcji zostanie zachowany. że w omawianym już wcześniej stadzie kur andaluzyjskich. będącą jej konsekwencją. złożonym z 1000 ptaków.

Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi. maleje natomiast częstość genotypów heterozygotycznych. ojca z córką czy matki z synem. pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt. Odwrotna sytuacja zaistniałaby. można przeprowadzić obliczenia: Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji.5 (allel a). W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0. np. na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji. stado powróci do stanu równowagi genetycznej. W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej 209 . Niekiedy. gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami.genotypów. W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0.25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie Frekwencja genów pozostała nie zmieniona. Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych. stosowane są kojarzenia osobników spokrewnionych. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych. Aby się o tym przekonać. iż kojarzono koguty czarne z kurami czarnymi.5 (allel A) i q = 0.25 AA + 0.5 Aa + 0. Oznacza to.

Szczepy wsobne są wykorzystywane w badaniach biomedycznych. zjawisko tak nazwane przez Wrighta w 1931 roku. zwłaszcza w małych populacjach. w których stopień homozygotyczności jest bliski 100%. w której frekwencja genu dominującego wyraźnie wzrośnie.brat x siostra) prowadzą do wytworzenia tzw. szczepów wsobnych. jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. żywotności czy ujawnienie się wad dziedzicznych. Im większa jest pula genów w jakiejś populacji. to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach. Biorąc pod uwagę. która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. szczególnie niebezpieczny może być wzrost homozygot recesywnych. w których działa on najsilniej. to w następnym pokoleniu ustali się nowa równowaga genetyczna. Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt. Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej. Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego. którego skutkiem będzie zmniejszenie płodności. Może jednak się zdarzyć tak. iż w potomstwie uzyskamy 5 osobników homozygot dominujących.6. tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210 . iż allele niekorzystne z reguły są recesywne. Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać. Jeśli było to jednorazowe zaburzenie. 8. że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych. polega na zmianie frekwencji genów i genotypów w małych populacjach. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. Dryf genetyczny Dryf genetyczny. 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus.

wych. esterazy. które zachodzą w wyniku pracy hodowlanej. Na skutek długotrwałej selekcji. ceruloplazminy czy anhydrazy węglanowej. albuminy. Wartość tego parametru zawiera się w granicach od O do l.i mikrosatelitarny. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych. różne typy białek surowicy krwi czy enzymy erytrocytarne. na przykład warunkujących antygeny erytrocytarne. może dojść do znacznego ograniczenia puli genów. czyli markery genetyczne klasy II). amylazy. zalecane jest monitorowanie zmian w strukturze genetycznej populacji. opisanych w rozdziale: Markery genetyczne. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru: 211 . czego wynikiem będzie utrata zdolności adaptacyjnych. można także przedstawiać ją w procentach. Mogą to być loci kontrolujące syntezę transferyny. By temu niekorzystnemu zjawisku zapobiec. Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini. zwłaszcza w małych populacjach. należące do markerów genetycznych klasy I. Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności.

należy znać frekwencję wszystkich alleli w danym locus: Dystans genetyczny Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw. na przykład: najbliższego sąsiedztwa — SLM (ang. które cechuje duża zmienność genetyczna. By obliczyć wartość PIĆ. Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi. Do szacowania dystansu genetycznego (Dr). tak na podstawie polimorfizmu sekwencji mikrosatelitarnych. complete linkage method) lub skupienia parami — UPGM (ang. a także między populacjami w obrębie gatunku. single linkage method). jak i polimorfizmu białek i antygenów erytrocytarnych. O markerach genetycznych jest mowa w innym rozdziale. unweighted pair group method). Szacowanie dystansu genetycznego i wybór ras. Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci. polymorphic Information content). najdalszego sąsiedztwa — CLM (ang.Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. najczęściej stosowany jest wzór: Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. 212 . obliczonych różnymi metodami.

wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0. najmniejszy między linią Celebesa a Probata. 8-1). Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa. Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych. a także między linią Banata a Celebesa i Probata.37 (ryć. 369 z linii Probata. 213 . Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III.32.Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp. Na przykład. 150 z linii Banata. 146 z linii Celebesa. Prace i Materiały Zootechniczne.39 oraz Palasa a Partnera 0.. 219 z linii Palasa. 50:111-120. Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM. Palasa a Partnera. 1997). Analizą objęto 141 koni z linii El Paso. Partnera a Banata 0. 146 z linii Partnera i 202 z linii Bandosa.

.

wykorzystując wzór: gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1. W wyniku analizy polimorfizmu minisatelitarnego (tzw. że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA. opisaną w rozdziale: Metody analizy i modyfikacji genomu. tym większa wartość tego współczynnika. . Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS . odcisk palca DNA. określający prawdopodobieństwo.Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne). opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji).ang. Im mniejsza zmienność genetyczna w danej populacji. W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej. band sharing). a także metodę RAPD.

Ten typ determinacji płci obserwuje się u wielu gatunków gadów. które są hermafrodytami sekwencyjnymi. a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. U ssaków płcią heterogametyczną są samce (układ XY). głównie temperatury. tzn. wielu gatunków żółwi i niektórych gatunków jaszczurek. czyli zmieniają one płeć w ciągu życia. płeć chromosomowa. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. W przypadku ssaków wyróżnia się chromosomy X oraz Y. Płeć może zależeć od warunków środowiska zewnętrznego. Wśród ryb spotyka się również gatunki. Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie. w tym u wszystkich krokodyli. mają gonady męskie i żeńskie. a płcią homogametyczną są samice (układ XX). Zwierzęta takie są zazwyczaj obojnakami. Determinacja płci ssaków Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw. a samice heterogametyczne (układ Z W). a w przypadku ptaków Z oraz W.1. płci gonadowej i 3) uformowanie się wewnętrznych 216 . U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ). U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci. 9.Rozdział 9 Determinacja i różnicowanie płci oraz interseksualizm Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów. behawioralna determinacji płci. 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. Z kolei u niektórych gatunków ryb zachodzi tzw. w jakich rozwijają się zarodki.

W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe.i zewnętrznych cech płciowych — powstanie tzw. Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym. Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. 217 . które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego. 9-1). Pojawiają się one w endodermie pęcherzyka żółtkowego. Pleć fenotypowa obejmuje również zmiany powstające w mózgu. a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. pici fenotypowej (ryć.

że funkcja tego genu jest tożsama z funkcją genu SRY (ang. high mobility group). SRY. Od końca lat 50. steroidogenic factor 1) koduje białko receptora jądrowego. polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej. oprócz kory nadnerczy. gdzie obserwuje się zanik jego ekspresji. testis determining factor) — czynnik determinujący jądro. Produktem tego genu jest białko zawierające tzw. 9-2). a część korowa w jajniku. Białko kodowane przez ten gen składa się z trzech regionów (ryć.Dotychczasowe badania wykazały. SOX9. czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y. którego produkt należy. regulującego ekspresję hydroksylaz steroidowych. które pełni rolę czynnika transkrypcyjnego. że pełnią funkcję czynników transkrypcyjnych. Gen ten podlega ekspresji. Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. ZFX i FOXL2. Wiadomo o nich. którego locus występuje w chromosomie Y. przełączenie rozwojowe. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra. wiadomo było. Przyjęto. że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. SF1. że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów. Badania cytogenetyczne prowadzone u ludzi dowiodły. podobnie jak białko SRY. a w tym: WT1. W rosnącej gonadzie wyróżnia się część korową i rdzeniową. do grupy białek określanych skrótem HMG (ang. Fgf9. w przeciwieństwie do jajnika. Gen WT2 (ang. 218 . sex determining region Y). Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. Produkt tego genu miał odpowiadać za tzw. palce cynkowe. że jest tam zlokalizowany gen TDF (ang. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9. także w niezróżnicowanej gonadzie. Gen SF1 (ang. Badania molekularne pokazały.

Miillerian inhibitor substance). Z przewodów Wolffa rozwinąć się mogą nasieniowody. określanego także jako hormon antymiillerowski (ang. tak jak białka WT1 i SOX9. a drugi rozwija się. Białko SRY. niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik. wysepka CpG). że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. składający się z 79 aminokwasów.Region środkowy. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron. Wiadomo. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza. Gdy gen SRY jest nieobecny. w momencie kiedy rozpoczyna się proces formowania gonady męskiej. Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać. że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9. a jego produktem jest jądrowy receptor dla hormonów. Ekspresja tego genu zachodzi w komórkach Sertolego. Początkowo przypuszczano. a z przewodów Miillera — jajowody i macica. Z testosteronu powstaje dihydrotestosteron. Kaskadowe włączanie tych genów. Bardzo ciekawe jest również to. odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. ma strukturę podobną do białek z grupy HMG. że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. po pojawieniu się produktu genu SRY. które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne. który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu 219 . Obecnie większą rolę przypisuje się genowi ZFX (tzw. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. odpowiada za prawidłowe różnicowanie się gonady męskiej. również położonemu w chromosomie X. że jego locus występuje w chromosomie X. Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika. omówiony wcześniej. a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9). Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej). który podtrzymuje rozwój przewodów Wolffa. że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego. w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1. pełni funkcję czynnika transkrypcyjnego. aniżeli w odniesieniu do jądra. anti-Mullerian hormone — AMH). oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). Bardziej szczegółowe dane wskazują. gen palca cynkowego).

z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X. lub do zahamowania podziału mejotycznego. to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. W regionie tym występują geny. który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej. Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY. jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. gen RBM (ang. gen Ube1Y (ang. Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y. Gen ten umiejscowiony jest w obu chromosomach płci. U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. takich jak całkowity brak spermatogoniów. samic biorczyń. występują także inne geny. Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1). Zakłada się. W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa. Jeśli w genotypie wystąpi delecja tego locus. np. RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. macicę i górną część pochwy. splicing) mRNA. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. np. Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). Należy również zwrócić uwagę. Znane są też geny położone w innych częściach chromosomu Y.kodującego testosteron. których ekspresja związana jest z przebiegiem spermatogenezy. w których genotypie występuje duplikacja locus DSS (DAX1). że w chromosomie Y poza genem SRY. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. czyli brak plemników w ejakulacie. 220 . Szczególnie istotną częścią chromosomu Y jest region AZF. Jego nazwa pochodzi od słów angielskich azoospermia factor. to rozwój w kierunku męskim nie jest zakłócony. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci. oznaczających czynnik odpowiedzialny za powstanie azoospermii. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro). czy też klonowania.

w którym kształtują się jajniki. Połączenie krwiobiegów bliźniąt różnopłciowych sprawia. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian. W rozwoju embrionalnym różnicowanie się jąder poprzedza okres. frymartynizm). Z przedstawionych wyżej informacji można wyciągnąć wniosek. niż to wcześniej zakładano. Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów. to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony. Jeśli połączenie łożysk dotyczy płodów różnopłciowych. często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy. że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. które określa się terminem interseksualizmu lub obojnactwa. Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy. Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego.2. 9. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. co w konsekwencji prowadzi prawie zawsze do niepłodności. który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach. że informacja genetyczna zawarta w chromosomie Y jest bogatsza. kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych. głównie przeżuwaczy. Interseksualizm Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego. to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci 221 .ubiąuitin activating enzyme-1). w którym powstały połączenia naczyniowe. Frymartynizm Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych. ze względu na bardzo duże zróżnicownie obserwowanych zmian. kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu. co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników.

Linie te różnią się układem chromosomów płci — w jednej występuje układ XX. a często u owiec (od 40 do blisko 100% ciąż. których łożyska są połączone anastomozami. że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż). że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy. to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych. Wówczas dihydrotestosteron. przy jednoczesnym ich braku np. że prawie we wszystkich przypadkach. Identyfikacja sekwencji typowych dla chromosomu Y (np. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy. Powstawanie anastomoz jest bardzo często stwierdzane u bydła. w mniejszym lub większym zakresie. w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę. w komórkach błony śluzowej. polegające na ustaleniu zestawu chromosomów płci w leukocytach. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. że rozwinie się nawet gonada męska. a drugiej współbłiźniaka. niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych. dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych. które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo. Ze względu na wspólną cyrkulację krwi u płodów. że badania kliniczne samic są niewystarczające. gdy zewnętrzne narządy płciowe są prawidłowo uformowane. sekwencje mikrosatelitarne). wskaźnik niepowtarzalności rui itp. dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie. Bardzo pomocne okazało się badanie cytogenetyczne. obraz nasienia. stwierdza się obecność dwóch linii komórkowych — jednej własnej. szczególnie wówczas. Z tego powodu we krwi frymartynów. proces kształtowania się zewnętrznych narządów płciowych.żeńskiej w takim stopniu. może być wskazówką. może zakłócić. a także samców będących bliźniętami frymartynów. Trzeba podkreślić. powstający z wydzielanego przez komórki Leydiga testosteronu. Biorąc jednak pod uwagę. Znacznie rzadziej zdarza się to u owiec (od l do 10%. a w drugiej układ XY. zależnie od rasy). stwierdza się niepłodność samic frymartynów. Ponieważ linie te pochodzą od dwóch różnych genotypów. Okazuje się. że badany osobnik jest frymartynem. Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany.) są często obniżone. Chimeryzm dotyczy również erytrocytów. a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. Możliwe jest również powstanie połączeń. ale także molekularnych (np. chociaż parametry określające ich przydatność rozpłodową (np. Buhaje takie mogą być wykorzystywane w rozrodzie. zależnie od 222 . Szacuje się. a w ślad za tym drogi płciowe będą miały charakter męski.

Mutacje chromosomów płci Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. XYY lub XXX). a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych. w które są zaangażowane chromosomy płci. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników. Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. Zespół niewrażliwości na androgeny Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. Z drugiej strony ważną rolę odgrywają mutacje strukturalne. że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). miały niedorozwinięte jądra.rasy). Z jednej strony mogą to być aneuploidie. U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera. Charakteryzowały się one gorszym tempem wzrostu. które są fenotypowo prawidłowo rozwinięte. wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY. Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie. w zakresie od 0. Kilkanaście takich przypadków opisano u buhajów. Z badań przeprowadzonych na owcach wynika. Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych. w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie.5% (bydło) do kilku procent (niektóre rasy owiec. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad. niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. merynos booroola). Konsekwencją występowania 223 . Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. np. co oczywiście prowadziło do bezpłodności. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY.

a w ich genotypie nie stwierdza się genu SRY. U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX. W genotypie tych zwierząt nie ma genu SRY. które mają układ chromosomów płci XX. który polega na niezgodności między płcią fenotypową i chromosomową. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte. częściowa lub całkowita delecja). Zespół odwróconej płci u koni W hodowli koni częstym typem interseksualizmu jest tzw. Najczęściej zespół ten diagnozowany jest u fenotypowych samic. Interseksualizm bezrogich kóz Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz. Osobniki takie powinny być samicami. Przyczyny takiego stanu mogą być różne. z wykorzystaniem techniki PCR. świń i psów. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie. Okazało się. w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego. co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim. a wśród nich należy wymienić: mutację w locus SRY (np. Bezrożność kóz uwarunkowana jest przez dominujący allel P. a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. jak i wewnętrznych cech płciowych. zespół odwróconej płci (ang. Taki typ odwrócenia płci spotykany jest również u kóz. ZFY. chociaż zdarzają się zwierzęta z powiększoną łechtaczką. przy jednoczesnym braku kluczowego genu SRY. STS). przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem.nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu. sex reversal). a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp. ale z powiększoną łechtaczką. Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder. a stopień 224 . ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL. Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane. od prawie typowo samczych do samiczych. które mają układ chromosomów XY. który uznawany jest za niezbędny do rozwoju gonady męskiej. Badania molekularne genów położonych w chromosomie Y. że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze. tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych.

jest allel R genu Roan (umaszczenie dereszowate) u bydła. Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym. W 2001 r. tzn. również w zakresie układu loci w chromosomach. ale w części proksymalnej (w pobliżu centromeru). a w ich genotypie występuje gen SRY. że jest on położony w chromosomie l — w części dystalnej. Z badań porównawczych wiadomo. że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. szyjki macicy i macicy. allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). czyli mających układ chromosomów płci XY. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. Zespół tych zmian jest określany jako choroba białych jałowic 225 . co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym). Gonady zazwyczaj mają strukturę jądra. Co więcej należy podkreślić. polledness and intersexuality syndrome). Można z tego wyciągnąć wniosek. Allel R odpowiada za powstanie białego umaszczenia.nasilenia tych zmian jest bardzo zróżnicowany. które mają zdecydowanie samczy fenotyp. Okazało się. Wreszcie mogą występować również osobniki. których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. że kariotypy obu gatunków są prawie identyczne. że odpowiedzialna za to jest delecja 11 700 par zasad. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. gen PIS — ang. a rzadko jajnikojądra. że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek. ukończono wieloletnie badania. Zaburzenia te polegają na braku lub niedorozwoju pochwy. W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono. Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. natomiast jajniki są rozwinięte prawidłowo. z tym jednak że genotyp Rr+ wykazuje niepełną penetrację. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej. że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci. U obu ras bydła stwierdzono. Choroba białych jałowic Innym przykładem genu o działaniu plejotropowym. zlokalizowana w niekodującym fragmencie DNA. że locus genu bezrożności bydła został umiejscowiony również w chromosomie l. Ciekawe jest. Allele te prezentują typ dziedziczenia pośredniego. który jest odpowiedzialny za rozwój interseksualny. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm.

Przypuszcza się. w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe. a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38. bowiem ponad 90% chorych jałówek ma umaszczenie białe. 9-3 wkładka kolorowa). który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. Dotychczasowe obserwacje dowodzą.XY. w których kariotypie występowały dwa chromosomy X. Można natomiast przypuszczać. z tym jednak że łechtaczka była bardzo powiększona.(ang. W potomstwie jednego knura pojawiło się kilkanaście obojnaków. a srom tworzył z odbytem wspólny otwór (ryć. white heifer disease). Badania chromosomowe wykazują. . a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny. Sytuacja taka wskazuje. Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym. a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny). Interseksualizm u świń Przypadki interseksualizmu u świń obserwuje się z częstością około 0.XX/38.3%. że choroba białych jałowic ma złożone podłoże. gdzie gonady mają strukturę jądra lub jajnikojądra. W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej. Locus tego genu został wcześniej zmapowany w regionie. że powstanie gonady męskiej może nastąpić pomimo braku genu SRY. że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła. w którym ostatnio umiejscowiono locus genu Roan. że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38. Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. Wśród nich niejednokrotnie zdarzają się przypadki. że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm. Zakłada się. pomimo nieobecności genu SRY. Tło genetyczne tych przypadków jest słabo poznane. że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego. że genem roan może być gen kodujący czynnik wzrostu komórek tucznych.XX. U zwierząt tych stwierdzano obecność jąder. pomimo braku genu SRY w ich genotypie. macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich.

delta. ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego. Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. Ma on.epsilon. α . zapamiętywania. Jest pięć typów łańcuchów ciężkich (gr. adaptatywnej).alfa. iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje. podobnie jak układ nerwowy.. 10. ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np. Są one elementem odporności swoistej (nabytej... są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. γ . reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm.Rozdział 10 Genetyczne podstawy odporności i oporności Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał. bakterii czy wirusów).gamma 227 . heavy — H). Zastanawiające jest. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). ε . jakim jest główny układ zgodności tkankowej. wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato. po 50 kDa każdy. której celem jest zwalczenie. o masie po 25 kDa. Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna. czyli przeciwciała. mimo że ma tylko pięć klas przeciwciał. light — L). zdolność uczenia się. Genetyczne podłoże różnorodności przeciwciał Immunoglobuliny. usunięcie tych obcych białek. δ .. połączonych z dwoma łańcuchami lekkimi (ang.1.

. Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA. które mają łańcuch lekki typu κ. IgG i IgM. utworzonej przez łańcuchy ciężkie. 10-1). u ludzi wynosi on 70:30. między domeną CH1 i CH2. Przeciwciało ma kształt litery Y (ryć. complementarity determining regions CDR). D. E. hypervariable). jak i lekkie mają części zmienne (ang. w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie.i μ . u koni l: 25). Stosunek przeciwciał. iż informacja genetyczna 228 . których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. G i M od symboli łańcuchów ciężkich. oznaczone HV1. HV2 i HV3.mi) i dwa typy lekkich (κ— kappa i λ. IgE. znajduje się tzw. Zarówno łańcuchy ciężkie. — lambda). Ponieważ regiony te determinują swoistość przeciwciał. region zawiasowy (ang. Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku. W części stałej łańcucha ciężkiego. Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin. IgD. constant — C). W części zmiennej znajdują się trzy regiony hiperzmienne (ang. natomiast A. hinge region). a wzdłuż jej ramion znajdują się łańcuchy lekkie. Badacz ten odkrył. u myszy l: 20. do łańcucha λ zależy od gatunku (np. Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi. nazywane są także regionami determinującymi dopasowanie (ang. variable — V) oraz części stałe (ang.

natomiast łańcucha ciężkiego przez trzy geny: V. 10-2). Rekombinacyjne łączenie się genów. Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt. dla lekkiego — kilka. Przypuszczalnie jest wiele genów kodujących region V. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D. D. 6 i 16. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. może kilkaset). że wpływają na funkcję przeciwciała. 229 . Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. Geny determinujące region C różnią się od pozostałych tym. u myszy natomiast odpowiednio w chromosomach 2. następnie z genem V. przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V.. kilkadziesiąt genów D i kilka genów J. natomiast geny łańcucha lekkiego typu κ w 2. diversity) i J. a nie na jego powinowactwo do antygenu. zachodzące dzięki aktywności enzymu — rekombinazy. Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla. czyli połączeniu się segmentów po jednym z każdej grupy minigenów. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang. ich swoistość wynikają z tego. Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów. jest głównym źródłem różnorodności przeciwciał. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie.immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów". iż dziedziczone są nie całe geny immunogłobulinowe. 6 genów funkcjonalnych i 3 pseudogeny regionu J. ale ich segmenty. Różnorodność przeciwciał. variable) i J (ang. typu λ w 22 chromosomie. Różnorodność przeciwciał wynika z wielu przyczyn. J i C. a łańcuchów lekkich z rekombinacji regionów V. D (ang. natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A. Część stała obu rodzajów łańcuchów jest kodowana przez gen C. Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. które nazwał segmentami. joining). których kolejność łączenia się jest następująca: gen D z genem J. ] i C. Proces syntezy przeciwciała następuje po skompletowaniu genów. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen.

oraz odpowiedzi typu humoralnego 230 . przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego. insercje lub konwersje. Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu. Ponieważ są to nowo powstałe odcinki DNA. które razem stanowią przeciwciało. powodujące zmianę pojedynczego aminokwasu. bądź też usuwane (do około 20 nukleotydów). atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T). Najczęściej są to mutacje punktowe. tym samym liczba wariantów genu D] może być zwiększona około 10 razy. 10. będące specyficznym receptorem tego limfocytu. Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). natomiast genu VDJ następne 10 razy.Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J. rzadziej natomiast delecje. Genetyczne podłoże różnorodności receptorów limfocytów J W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B. V-D i D-J) mogą być wstawiane nukleotydy (od l do 15). Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego.2. prowadzi to do zmienności na złączach i utworzenia nowego genu. Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu).

Poprzez proces rearanżacji genów. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T. które odpowiadają za syntezę przeciwciał. liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. 10. Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I. II i III. Limfocyty pomocnicze mają receptory CD4. Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. 2 regionów D i 12 genów dla łańcucha β-J. doprowadziły do wykrycia grup (klas) antygenów oznaczonych I. który kontroluje ich syntezę. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ). Główny układ zgodności tkankowej — MHC Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2. Badania polegające na przeszczepach skórnych 231 . około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi. zachodzi podobnie jak rekombinacja genów przeciwciał. Oczywiście jest mało prawdopodobne.5 x 106 α-β heterodimerów. że wszystkie elementy genów są włączone w rearanżacje. odpowiedzialnych za przyjęcie przeszczepu.3. przez Petera Gorera poszukiwania innych antygenów grupowych krwi. Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V.(Th — pomocnicze limfocyty T). Prowadzone w latach 30. cytotoksyczne CD8. jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie. podobnie jak limfocyty B. Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ. Podobnie. który następuje podczas dojrzewania komórek T w grasicy. Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej. D i J (łańcuchy p i §). Proces rearanżacji elementów genów receptorowych.

jak i ilościowej. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców). być może dlatego. wykazały. major histocompatibility complex — MHC). Antygeny te są istotną barierą podczas transplantacji tkanek. U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo. a tylko w niewielkim stopniu od innych loci. Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. Nawet wówczas. gdyż gen kodujący go jest zlokalizowany w chromosomie Y. iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. H-l. ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech). H-5 i inne. Natomiast inny antygen. Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej. Tabela 10-1 Lokalizacja MHC i nazwa u poszczególnych gatunków 232 . często ich efekt jest niedoceniany. nazwanych słabymi antygenami zgodności tkankowej (ang. że większość z nich znajduje się w chromosomie 2. natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC.między tymi liniami. podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. zwłaszcza transplantacji szpiku kostnego. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i. maternally transmitted antigen). W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał. słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. pochodzi tylko od matki. Zatem jest on przekazywany przez ojca męskim potomkom. wykonywanych dla kilkunastu kolejnych pokoleń. minor histocompatibility loci). H-3. gdy biorca i dawca są zgodni pod względem haplotypów MHC. nazwany Mta (ang. Antygen H-Y występuje tylko u samców. Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska.

często są one nazywane antygenami MHC. Zwłaszcza niektóre geny MHC. U drobiu nie stwierdzono regionu klasy III. regionu K. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. II i III. nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku. Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka. układ ten cechuje ogromny polimorfizm. jak już wspomniano. rzadziej mutacji punktowych. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych. leukocyte antigens — LA). Ponieważ MHC zawiera wiele genów oraz. jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin. D i L u myszy i B. a drugim podstawową funkcję — LA (tab. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA.Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. należące do klasy I i II (np. MHC u drobiu nazwano kompleksem B. w populacji istnieje bardzo duża liczba różnych haplotypów. C i A u ludzi). iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu.3. Wykryto natomiast specyficzny region klasy IV.1. będących glikoproteinami. kodujący białka zlokalizowane na krwinkach czerwonych. 10. crossing over czy rekombinacji wewnątrzgenowych. są wysoce polimorficzne. w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów 233 . Z powodu powiązań tego układu z układem grupowym krwi B. W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów. Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną. powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I). 10-1). Struktura i funkcje głównego układu zgodności tkankowej U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku. jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt. a wraz z nim — haploidalny genotyp MHC (haplotyp).

że MHC pełni funkcję tylko w odrzucaniu przeszczepu. Jest on kodowany przez geny MHC i ma trzy koliste domeny. Łańcuch ciężki składa się z trzech części: • Najdłuższy. których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC. który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. 234 . Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach. że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego. α2 i α3. a więc w tych. co zostało już udowodnione. które kodują miejsce wiązania peptydów. Mimo iż początkowo uważano. wpływa na możliwość immunologicznego rozpoznania obcych białek. biorąc tym samym udział w reakcji przeciwko infekcji wirusowej. każda złożona z około 90 aminokwasów. oznaczone symbolami αl. Łańcuch ciężki jest kodowany przez geny MHC. Domeny αl i α2 odznaczają się polimorfizmem. stanowi około 80% jego długości i znajduje się na zewnątrz komórki. Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny.• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie. a także w odrzucaniu przeszczepu. Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T. Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. obecnie wiadomo. N-końcowy fragment łańcucha ciężkiego. 10-3). W domenach tych występują alloantygeniczne miejsca.

stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi. 235 . Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β. Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin. składają się z trzech części: zewnątrzkomórkowej N-końcowej. regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. podobnie jak łańcuch ciężki cząsteczki klasy I.zawierające determinanty specyficzne dla osobników. W rowku tym wiązane są antygeny. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I. przechodzący przez błonę komórkową. oznaczonych symbolami α i β. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. • Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy. Cząsteczki MHC klasy II. śródbłonowej i wewnątrzkomórkowej. które są między nim a błoną komórkową. Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. który leży w cytoplazmie komórki. które następnie są prezentowane limfocytom T. kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. 10-4). komórki den-drytyczne i limfocyty B). • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy). Łańcuchy te. Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie.

1. Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). Późniejsze badania ujawniły. Pierwotnie w MHC u myszy zidentyfikowano regiony K. Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości. od kilkunastu do ponad 20 aminokwasów. Dotychczas wykryto co najmniej 15 genów klasy la. Główny układ zgodności tkankowej myszy Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy. Jednak cząsteczki klasy I mogą wiązać jedynie krótki. oznaczane symbolem la). W jego skład wchodzą białka surowicy i płynów tkankowych. że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC. Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu. które określono symbolem H-2 (ryć. Badania sekwencji genu Qa-2.1. complement) i liczbą. klasyczne cząsteczki klasy I. a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka. jak i klasy II prezentują obcy peptyd (antygen) limfocytom T. Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. ponieważ mają zamknięte miejsce wiążące. 10. złożony z kilku aminokwasów peptyd. Białka te są oznaczane literą C (ang.3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. S i D. Białka C2.3. 10-5).Zarówno białka MHC klasy I. I. gdyż ich miejsce wiążące pozostaje otwarte z obu stron. Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I. C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III. niektóre z nich też biorą udział w odpowiedzi immunologicznej. Natomiast produkty genów kompleksu Tlą i Qa wyka- 236 . z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib). kontrolujących syntezę klasycznych białek MHC klasy I. a potem również zwierząt gospodarskich. u myszy natomiast przez loci regionu S w obrębie H-2. których jest łącznie z czynnikami regulującymi około 30.

w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom). Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E. bardzo istotny dla ekspresji produktów genów klasy I. DOB/DNA i DM. -F i -G należą do nieklasycznych cząsteczek klasy I.1% całego genomu. immune response). Każda podklasa ma co najmniej jeden gen łańcucha α i β. W regionie Qa-2. u myszy w 2. Geny klasy II HLA znajdują się w pięciu podklasach: DQ. Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I. natomiast cząsteczki kontrolowane przez loci HLA-E. u człowieka w 15 chromosomie. który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. zajmuje łącznie około 4 mpz DNA (4 miliony par zasad).1. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny.2. 10-6). natomiast u myszy z trzech eksonów. oznaczone symbolem Ir (ang. Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A. 10. DR. Główny układ zgodności tkankowej człowieka • U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6.żują wiele różnic w porównaniu z antygenami transplantacyjnymi. -O/N oraz -M. -P. przy czym trzy pierwsze . w grupie sprzężeniowej z locus dehydrogenazy sorbitolu. znajduje się poza MHC. Struktura HLA przedstawiona jest na liniowym diagramie (ryć. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%. z wyjątkiem H2-P.3 i Tla zmapowano dotychczas 31 genów.3. Białka klasy III są kontrolowane przez geny regionu S. Gen ten u ludzi składa się z ośmiu eksonów. czyli ponad 0. Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S). -B i -C. Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. DP.

DOB/DNA. że geny HLA-A. Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów. bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I. region klasy II HLA zawiera także geny.in. HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka. które strukturalnie nie należą do genów klasy II. białek transkrypcyjnych oraz białek nieprawidłowych. Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów. Są to geny TAP1 i TAP2 kodujące peptydowe transportery. Odkryty niedawno locus DM jest nieco inny niż pozostałe.in. Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC. Jest pewnym paradoksem. co potwierdza fakt. mają tylko 2 allele. nie podlegających transkrypcji (np. Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych. geny dla 21-hydroksylazy (CYP21).kodują klasyczne cząsteczki klasy II. 314 alleli klasy II i 40 alłeli klasy III. -B. na przykład DRA. białek szoku 238 . m. determinuje syntezę nieklasycznych cząsteczek klasy II. podczas gdy czwarta podklasa. Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. m. -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". Biorą one udział w proteolizie białek. Podobnie jak u myszy. 10-11). iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC. Stwierdzono na przykład. jak i do genów klasy II. Dotychczas wykryto 267 allełi klasy I HLA. Nieliczne z genów MHC.

Główny układ zgodności tkankowej bydła Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie. Struktura BoLA przedstawiona jest na rycinie 10-7. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany. Na przykład homologia genów klasy II u ludzi i myszy jest następująca: myszy: ludzie: Aa Aβ DQα DQβ Eα Eβ DKα DRβ P O/N DP DOB/DNA M DM 10. Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami. Jak wspomniano na początku tego podrozdziału. Geny klasy I należą do dwóch grup — A i B.cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB). w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych. Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111. Jest to najlepiej poznany chromosom bydła. iż homologia między poszczególnymi gatunkami i człowiekiem jest duża.1.3. różniących się delecją 6 par zasad w eksonie 5. Wiadomo jednak.3. Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa. który koduje krótki fragment transbłonowy łańcucha cząsteczki 239 . główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt. Produkty genów klasy I są to klasyczne cząsteczki MHC.

Homologia między genami BoLA i HLA jest stosunkowo duża. W locus DRB wykryto pseudogen (DRB1).4 cM. że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. Główny układ zgodności tkankowej świni Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. Region klasy II zawiera wiele genów. że jest ich około 7-10. Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1. mają dużą homologię. Nie jest znana dokładna liczba genów klasy I SLA. i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. W obrębie klasy II obserwowany jest duży polimorfizm genów. których homologia wynosi około 80-85%. Regiony klasy I i II znajdują się blisko siebie. z odpowiadającymi im genami HLA. Wydaje się. odległość między nimi wynosi 0. w granicach 75-87%. Niektóre geny. DQB. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś. PD7 i PD14. szacuje się. DRĄ i DRB. różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC. spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. par zasad mniejsza niż w MHC u ludzi. natomiast DQA bydła i człowieka — 75% homologii. Podobnie jak u innych gatunków. w SLA 240 . DQA. Są to PD1.MHC. Tylko kilka genów regionu klasy I wykazuje ekspresję. 26 DQB i 31 DQA.

10-8). a częstość rekombinacji między nimi wynosi 0. powodujące. przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ. które wykryto w tym pseudogenie. 1996.6 cM. W regionie klasy II. Główny układ zgodności tkankowej owcy Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA. obok genów MHC znajdują się pseudogeny. zmodyfikowano) znajdują się także pseudogeny. ovine aries). ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. W wyniku mutacji. ma długość 5.6%. W regionie klasy III. ale można również spotkać określenie Ovar (ang. C2 i C4. W regionie tym są także inne geny typowe dla tego układu (ryć. w którym znajduje się główny układ zgodności tkankowej.Ryć. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B. w przeciwieństwie do innych gatunków. Geny klasy II wykazują duży polimorfizm. Najlepiej poznany jest pseudogen DRB2. iż nie jest on funkcjonalny. Dotąd nie sporządzono mapy fizycznej tego układu. w eksonach 3 i 4 znajdują się kodony „stop". Mapa sprzężeniowa owczego chromosomu 20. znajdują się po jednym genie CYP22. 241 . 10-8. Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont. w którym stwierdzono delecję nukleotydu w kodonie 53. podobnie jak u bydła. Jest nim na przykład gen DRB2.

par zasad.około 0. O ile funkcje regionów B-F i B-L są znane. Jak już wspomniano przy omawianiu budowy cząsteczki klasy I. 10-9). Z kolei. przypuszcza się natomiast. Kompleks B znajduje się w 16 mikrochromosomie. Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21). Za typowy MHC uważany jest kompleks B. U drobiu nie ma regionu klasy III. Region klasy I oznaczony jest symbolem B-F.Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. klasy II — B-L. które są klasyfikowane niezależnie. a klasy IV — B-G. o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. Badania MHC u drobiu koncentrują się na kompleksie B. Długość tego regionu u owiec wynosi około 150 tyś. częstość rekombinacji między skrajnymi loci tego układu -.5%. Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz. chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA. Główny układ zgodności tkankowej kury U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y. gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem 242 . częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców. że jest on zlokalizowany również w tym chromosomie (ryć. natomiast w odniesieniu do Rfp-Y większość badaczy uważa.

243 . Na przykład. Znaczenie głównego układu zgodności tkankowej 10. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej. tuberkulozę.2. dzięki której możliwe jest wykrycie obecności danego allelu MHC.1. 10. przeciwciała monoklonalne. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości). poprzedzona amplifikacją danego frag mentu DNA (PCR). inwazję kleszczy i pasożytów oraz trypanosomatozę (tab.3.3. • metoda RFLP. U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane. Identyfikacja cząsteczek głównego układu zgodności tkankowej Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych. Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis.zgodności tkankowej.3. od pewnego czasu. 10.3. antygenu) MHC. Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań. Do badań serologicznych wykorzystywane są surowice lub. jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. 10-IV). Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC). Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii. Związek MHC z odpornością na choroby Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe. w którym używane są homozygotyczne komórki stymulujące. białaczkę. pozwalających na identyfikację określonej cząsteczki (białka. Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej. 2) poprzez analizę molekularną DNA.3. ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby. Udoskonaleniem tej techniki jest test HTC. allele specific oligonucleotides — ASO).

2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3.3. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis. ale stwierdzono już jego związek z odpornością na raka skóry. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej. Na przykład.3. Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje. oprócz szczególnej roli w reakcji immunologicznej. kokcydiozę. haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3.2.2*8 — podatność 10. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany. mięsaka Rousa i cholerę ptasią. oddziałuje także na inne cechy (produkcyjne i reprodukcyjne).U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej. U bydła mlecznego stwierdzono istotne oddziaływanie niektórych 244 .

obniżać stopień przeżywalności i masę ciała cieląt. po czym powstały kompleks transportowany jest na powierzchnię komórki. zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. Wykazano wyraźny wpływ haplotypu rodziców na te cechy. gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe.cząsteczek MHC klasy I na cechy związane z użytkowością mleczną. 10. reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech. zależnie od rodzaju patogenu i miejsca infekcji. przeżywalność zarodków i płodów oraz liczebność miotu. czyli są degradowane do peptydów. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków. 245 . jak dotychczas. U koni natomiast stwierdzono. Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością. iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. Dotyczyły one wpływu MHC na stopień owulacji. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń. odgrywają cząsteczki głównego układu zgodności tkankowej. nie do końca został poznany. bez względu na to. Tutaj też następuje związanie cząsteczki MHC z peptydem. Zasadniczą rolę w ich rozpoznaniu. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu). W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i. natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC.4. Zarys przebiegu reakcji odpornościowej W odpowiedzi na wniknięcie patogenów (wirusy. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji.

Peptydy te wiążą się z cząsteczkami MHC klasy II. jeśli bakterie zostaną pochłonięte przez makrofagi. Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej. Powstały Ryc. prezentując przede wszystkim obce antygeny. Podczas infekcji bakteryjnej. 10-10. 10-10a).nazywane inaczej zabijającymi. (b) prezentacja antygenu przez cząsteczki MHC klasy II 246 . są rozkładane na peptydy w wakuolach (endosomach). które zabijają zakażoną komórkę (ryć. przedostającymi się z siateczki śródplazmatycznej. Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I. mające na powierzchni cząsteczkę CD8. Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny. makrofagi lub limfocyty B. które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne.

Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów. Następnie peptydy te są wiązane przez cząsteczki klasy II. czyli jej fizjologiczna śmierć.5. chromatyna ulega kondensacji na obrzeżach jądra. które dotarły tu z siateczki śródplazmatycznej. ale także oporności/podatności na choroby zakaźne i inwazyjne.). degradują i prezentują wszystkie antygeny (ryć. nieśność itd. natomiast cząsteczka klasy II może ich związać dwa razy więcej. w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG.kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247 . 10-10b). które uległy apoptozie. jest rozpoznawany przez limfocyt pomocniczy T. wkrótce potem jądro. Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek. Jeśli bakterie zostaną pochłonięte przez limfocyty B. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek. Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD. 10. makrofagi mogą pełnić rolę pośrednią. a następnie cała komórka pęka. Zdolność cząsteczek MHC do wiązania peptydów. po przedostaniu się na powierzchnię komórki. ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć. 10-10b). Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8). prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. które służą jako receptory antygenów. Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. W określonych przypadkach. Genetyczna oporność na choroby Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność. apoptosis opadanie) jest to programowana śmierć komórki. IgE lub IgA). gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów. Utworzony kompleks. a jej fragmenty są trawione przez sąsiadujące komórki. a raczej ich pojemność jest różna. określane jako Th2. Makrofagi wchłaniają. 10-10b). Apoptoza (gr. które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć.

Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną. Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów. 10-11). np. następnie sklonowanie go i poznanie sekwencji nukleotydów. Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć. czyli określenie jego położenia w chromosomie. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową. może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów. Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. Jeśli okaże się. Na ogół jest to cecha poligeniczna. W przypadku gdy oporność na chorobę jest cechą poligeniczna. celowe jest zmapowanie tego genu. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania. których celem jest znalezienie takich genów.kowanej oporności na choroby. iż cecha oporności jest warunkowana pojedynczym genem. Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. iż oporność na nie zależy od pojedynczego genu o dużym efekcie. następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. należy oszacować jej zmienność genetyczną. Umożliwi to poznanie sposobu jej dziedziczenia. 248 . Gdy cecha — wskaźnik oporności jest już wybrana. chociaż w przypadku niektórych schorzeń stwierdzono.

jak: • cechy eksterierowe (widoczne gołym okiem). Y2/ D' i P'.Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością. W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych. u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne. jak i rasowe. która prowadzi do śpiączki afrykańskiej (trypanosomatoza). Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów. jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze. gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. Na przykład. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei. takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu. które są określane za pomocą testów serologicznych lub elektroforezy. i barwne upierzenie drobiu. Choroba ta dziesiątkuje populacje bydła 249 . • cechy. które mogą być wskaźnikami oporności na choroby. Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka. wskazujące na większą niż u osobników białych oporność na choroby wirusowe. Znajomość cech określanych metodami serologicznymi. Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi. warunkowaną wieloma lub jednym genem. a markerami genetycznymi. jak i techniki inżynierii genetycznej. Na przykład. Sprzężenia takie są szczególnie korzystne w selekcji. • cechy ustalane za pomocą badań molekularnych DNA. związana z opornością na raka oczu. Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB. umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową). Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus.

nie zabezpieczając ich przed infekcją. krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej. Ponadto świadczą one. W Norwegii od 1978 roku mastitis jest już włączone jako cecha 250 . że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby.afrykańskiego. S. Należą do nich stany zapalne gruczołu mlecznego (mastitis). Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach). Kokcydioza jest równocześnie przykładem choroby. typhimurium. a także. Kokcydioza powoduje obniżony stopień wzrostu. S. Zmienność podatności zwierząt na choroby najlepiej poznano u kur. które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. z zachowaniem ich wysokiej produkcyjności. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę. Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków. zmniejszone wykorzystanie paszy. Na przykład. w tym przypadku jest to temperatura otoczenia. jak i indywidualne. S. iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). zwłaszcza u młodych kurcząt. Wyniki badań wrażliwości kur na bakterie Salmonella (S. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie. śmiertelność. której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych. simentalery czy szwyce. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. enteritidis) sugerują. Obserwowane są zarówno różnice rasowe. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. gallinarum. pullorum. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst.

Na podstawie licznych badań można sądzić. Wydaje się. jest białaczka limfatyczna. Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników.selekcyjna w programach hodowlanych. że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby. Wydaje się. Podstawowymi kryteriami tej selekcji są. ustawienie strzyków. Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia. siarę i mleko oraz. Ta metoda selekcji jest zalecana na przykład w Szwecji. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków. kształt i wielkość wymienia oraz strzyków. co zostało udowodnione. opartej na wskaźnikach fenotypowych oporności. przez uprzednio zarażoną wirusem białaczki komórkę jajową. że mastitis najczęściej występuje u krów. Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów. która w znacznym stopniu jest uwarunkowana genetycznie. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. ale także zakażenia przez łożysko. iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. za duże lub za małe strzyki. których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy. Stwierdzono na przykład. Jej występowanie stwierdzono na wszystkich kontynentach. niedobór niektórych pierwiastków. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. Można zatem przypuszczać. zbyt duża wielkość i niskie zawieszenie. w celu ograniczania występowania mastitis poprzez selekcję. kobalt i mangan). którego leczenie jest bezskuteczne. Z drugiej 251 . a zwłaszcza przez chore matki. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. wysokość zawieszenia wymienia i szybkość oddawania mleka. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek. że skłonność do białaczki jest przekazywana przez rodziców. jak: magnez. oprócz wydajności. charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. Wiadomo. iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. iż byłoby celowe prowadzenie selekcji pośredniej. ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia. jak również niekorzystnym warunkom środowiska (np. Innym schorzeniem u bydła. wapń.

na przykład schorzeń kończyn. co może być dowodem na dziedziczenie podatności na białaczkę. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt. coli jest opisane w podrozdziale: Mutacje genowe. że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie.jednak strony wielu badaczy stwierdzało. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę. . przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. lub też jako zdolność do współżycia z pasożytem (ang. coli i F18 E. Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie. której wartość waha się w granicach 0. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta. resistance). W tym miejscu należy podkreślić.5-0. Stwierdzono. przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np.6. Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne. ale także innych schorzeń. Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna. cieszy się mniejszym zainteresowniem wśród badaczy. w odróżnieniu od genetycznej zmienności oporności.

Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA. które nie kodują informacji genetycznej. Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych. uwarunkowana w sposób prosty — tzn.). co zachodzi wówczas. a z drugiej strony od parametrów fizycznych rozdziału (napięcie. która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej. a dokładniej — rozpoznające konkretną determinantę antygenową. gdy w populacji występują przynajmniej dwa allele w locus tego markera. zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka. W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. uzyskanych metodą PCR. stężenie nośnika — żelu itp. pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253 . antygenowe determinanty białek surowicy krwi (allotypy). przydatna do celów analizy genetycznej. Metody serologiczne wymagają stosowania surowic testowych. Przydatność markera zależy od tego. temperatura. antygeny głównego układu zgodności tkankowej. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych. czy jest on polimorficzny. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością. Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. W ten sposób badane są antygeny erytrocytarne (grupy krwi). przez jedną parę alleli.Rozdział W klasycznym ujęciu marker genetyczny to cecha jakościowa.

mentu DNA genu (metoda SSCP — ang. wówczas jest rozpoznawane 254 . a w mniejszym stopniu sekwencje minisatelitarne. single stranded conformation polymorphism). który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych). SSCP). 11. Klasa II markerów to sekwencje niekodujące. który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50. i 60. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi. Przez grupę krwi należy rozumieć typ krwi. Ich efektem było wykrycie wielu układów grupowych. Z badań prowadzonych u człowieka wynika. cząsteczkami adhezyjnymi czy białkami strukturalnymi.1. a ich obecność można wykryć metodami serologicznymi. np. Antygeny erytrocytarne (grupy krwi) Grupy krwi były najwcześniej wykorzystane w analizie genetycznej. czyli sekwencje kodujące -. Wspólną ich właściwością jest to. Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus). że mogą one być enzymami. cechujący się obecnością charakterystycznych białek. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP. czyli Ag-NOR). Jeśli białko ma tylko jedną determinantę antygenową. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym. Do pionierów tych badań należy zaliczyć m.in. polskiego badacza Ludwika Hirszfelda. Klasa I obejmuje klasyczne markery. o właściwościach antygenowych. dotyczącej kontroli pochodzenia. W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. na powierzchni erytrocytów. receptorami. Objęcie badaniami niekodujących sekwencji DNA spowodowało. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. że markery zostały podzielone na dwie klasy. wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne. że są związane z błoną plazmatyczną erytrocytów.geny.

Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów. a przez to do utworzenia (lub zlikwidowania) 255 . Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny. a to z kolei może wpłynąć na zmianę struktury białka. Jeśli białko ma kilka determinant antygenowych. to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych. że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi. Wreszcie może być taka sytuacja. a w tym jego determinanty antygenowej. Jeśli takie geny mają wiele alleli. może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej.za pomocą jednej surowicy testowej.

które pojawiają się w trzech fenogrupach: abc. Schemat opiera się na założeniu. Mechanizm powstawania zróżnicowania antygenów erytrocytarnych. prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć. że białko ma tylko jedną determinantę antygenową. to wówczas każda mutacja genu. W takiej sytuacji mutacja genu zmienia jedną Ryć. Gdyby dla uproszczenia przyjąć. 11-2. ab oraz a’bc). Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. a więc są uwarunkowane przez jeden allel. gdy białko ma więcej determinant antygenowych. 11-1). Sytuacja staje się bardziej złożona. przykład dla białka mającego kilka determinant antygenowych.nowej determinanty w antygenie erytrocytarnym. że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256 . które dziedziczą się jak jednostka. Mówi się wówczas o fenogrupach. czyli zespole antygenów.

Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. 11-2). a w konsekwencji do nietypowego dziedzi- 257 . Przyjmuje ona. Badania prowadzone u zwierząt wykazały. że istnieje także druga teoria tłumacząca fenomen fenogrup. ale nie narusza struktury pozostałych (ryć.z determinant. że występują obie sytuacje. że każdy antygen warunkowany jest przez jeden gen. Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów. Należy jednak zaznaczyć.

M. układ L bydła czy układ C świni). O). Q. C. K. 13 w genomie kury (układy: A. P. D. L. F. O. J. C. N. P) oraz 15 w genomie świni (układy: A. głównie w odniesieniu do układu grupowego B. że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową. J. G. Przykłady takie opisano u bydła. E. Z. w którym występuje allel „ — " określany jest jako otwarty. Biologiczna funkcja powyższych białek nie została jeszcze poznana. D. F. 11-1). X). które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. C. że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. B. L. G. D. Ponadto determinanty mogą 258 . K. Należy pamiętać. M. I. 11 w genomie bydła (układy: A. B. T'. F. M. Można przypuszczać. układ grupowy B bydła. Zatem możliwe jest. Układ grupowy. U) oraz owcy (układy: A. w których wykryto dotąd tylko dwa allele (np. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A. J. K.czenia antygenów krwinkowych. S. w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). E. R. C. jak np. H. M. Wśród poznanych układów są takie. W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. C. Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. B. D. a drugi allel (allel „ —") koduje białko. B. Na drugim biegunie są układy o olbrzymim polimorfizmie. R'). H.

które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę). przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss. Gen S ma dwa allele: S oraz s. Za pomocą dostępnych surowic testowych należy ustalić. pod względem liczebności grupą markerów genetycznych klasy I. czyli zawierającej wiele różnych przeciwciał).mieć wiele wariantów. Na uwagę zasługuje układ grupowy A świni. które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt. charakteryzowały się identyczną swoistością. Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S. wyprodukowane w różnych laboratoriach. 11. W układzie grupowym A występują dwa antygeny A oraz O. erytrocytów i leukocytów Białka surowicy krwi. Niezmiernie istotne jest. międzynarodowych testów porównawczych (ang. to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. świnie. International Society for Animal Genetics — ISAG). comparison test). Jego ekspresja zależna jest od dodatkowego locus S. Cel ten osiąga się poprzez cykliczne przeprowadzanie. w których zidentyfikowano kilka czy kilkanaście alleli. Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. po grupach krwi. W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło. Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe. Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np.2. że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt. Surowice takie są produkowane przez laboratoria. elektroforeza w żelu poliakryloamidowym lub elektroforeza 259 . konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie). W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej). jakie antygeny występują na erytrocytach w poszczególnych próbkach. a każdy z nich jest rozpoznawany przez odrębną surowicę testową. erytrocytów i leukocytów są drugą. aby surowice testowe. pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang. Polegają one na tym. badanie grup krwi wymaga stosowania surowic testowych. Procedura produkcji oparta jest na immunizacji zwierząt. W efekcie wśród alleli będą takie. który ma działanie epistatyczne w stosunku do locus układu A. oraz takie. które powinny spełniać warunek swoistości. Jak to już wcześniej wspomniano. pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej. które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). Białka surowicy krwi.

i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Na przykład u koni testy takie wykonywane są dla 16 systemów białek. Polimorfizm białek leukocytów. Spośród ponad 25 białek najbardziej polimorficzne 260 . Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych. Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III. Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt).dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną. nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC). elektrofokusing).

Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). U koni jest ono determinowane przez 13 alleli. Locus transferyny u świń znajduje się w chromosomie 13 (13q31). Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich. U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli. podczas gdy allel TfA występuje przede wszystkim u yorkshire. PO1AB i PO1BY dla wielkiej białej polskiej. PO1B. Spośród białek i enzymów erytrocytarnych (tab. Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej. Allel ten. przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków. kur i bydła. U świń w locus ADA znanych jest sześć alleli. Ze względu na to. Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). P/3. Polimorficzne warianty są związane z różną aktywnością tego enzymu. określany jako zerowy. jak świnia. inhibitor α-proteaz i transferyna. występuje szczególnie często u zwierząt podatnych na stres. są one cennymi markerami genetycznymi. U świń są one determinowane przez ściśle sprzężone loci (Pi1. twarde i suche). U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D. przy czym u bydła jest to enzym leukocytarny. niektóre allele są charakterystyczne dla danych ras. PIZ. przy czym jeden z alleli (ALBS) występuje u większości ras. owiec (chromosom 15). PO1A. u bydła w chromosomie l. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. u owiec także w chromosomie l (Iq42q45). w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. natomiast jest ona aktywna w leukocytach i innych tkankach. PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). które mają skłonność do wytwarzania mięsa typu DFD (ciemne. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. hampshire i duroc. jak np. 261 .są albumina. Z drugiej strony. z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci. koń i koza. Najwięcej wariantów tego białka zidentyfikowano u bydła. Transferyna jest β-globuliną. że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz). Tak więc. mającą dwa aktywne centra wiązania żelaza.

Warianty tego białka różnią się tylko budową łańcucha β. U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15 262 . Na przykład u bydła w trzech pozycjach tego łańcucha. wśród nich bydło czarno-białe i czerwono-białe. jest monomorficzna.Hemoglobina wykazuje największy polimorfizm u owiec. kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła. u rasy Jersey i niektórych ras mięsnych. bydła i kóz. są różne aminokwasy. Większość ras bydła. jak np.

U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-. W przypadku antygenów immunoglobulin u bydła. 11. bva2 oraz bvb. U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad). U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki.4. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy). β i κ oraz białko serwatkowe — P-laktoglobulina.i γ-globulinach. iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA. Największe zróżnicowanie allotypów lipoprotein. Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu. Określenie genotypu na podstawie 263 . a wielkość tego wytwarzania zależy od nasilenia anemii. αs2. jest układ Lpb. jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). U bydła zidentyfikowano 3 allotypy. od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). u owiec 1. Białka mleka Głównymi białkami mleka są kazeiny αs1. określane terminem allotypy. kontrolowane przez allele bval. biorące udział w transporcie cholesterolu. U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin. dotychczas zidentyfikowano 3 allotypy. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin. oznaczonych symbolem Lp. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku.3. bo liczący ponad 21 allotypów. stwierdzono dotychczas u świń. Ciekawe jest. układ sprzężonych alleli nazywany jest haplotypem. Również lipoproteiny. są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku.chromosom). 11. a w piątym układzie (Lps) tylko jeden allel. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek. 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. u których najbardziej polimorficzny. W następnych układach (Lpr. wykazują właściwości antygenowe. β. Lpt i Lpu) znane są po dwa allele. Większość tych allotypów jest determinowana przez kodominujące allele. Allotypy immunoglobulin i lipoprotein Antygenowe właściwości surowicy krwi. Ze względu na ścisłe sprzężenie loci kazein. 14 allotypów dla γ-globulin i 3 dla α-globulin.

β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2. Różnica między 264 . Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. a u bydła indyjskiego — alleł C. Dotychczas u bydła wykryto 6 typów κ-kazeiny. a wariant A — alaninę. C i D. składają się one bowiem odpowiednio z 207 i 199 aminokwasów. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. D i E. pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP. Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA. Białko serwatkowe mleka bydła. polegającej na tranzycji G→A. β-laktoglobulina. Allel F powstał w wyniku mutacji punktowej w allelu A. a w wariancie A — izoleucyna. powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. F i G. B. C. B. Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy. przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B. opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. U bydła europejskiego najczęściej występuje wariant β-kazeiny A. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A. E. B. Podobnie allel G powstał wskutek tranzycji C→T w allelu A. U bydła w locus kazeiny αsl wykryto pięć alleli: A. znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny. wynikające z polimorfizmu genu kodującego to białko. bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB).badania białka jest możliwe tylko u samic będących w okresie laktacji. C. Białko β-laktoglobuliny składa się z 162 aminokwasów. występuje w dwóch wariantach A i B. będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną). Podobnie jak w przypadku κkazeiny. determinowanych allelami: A. natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy. które powodują zmianę aminokwasu. W pozycji 136 łańcucha polipeptydowego B jest treonina. z których jedynie A i D są obecne w genotypie bydła ras europejskich. co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII. β-Laktoglobulina odgrywa rolę w odporności organizmu. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu. tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów.

wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo.5. 33.alanina (GCC). z wyjątkiem locus P-laktoglobuliny (chromosom 3p28). E. W mleku kóz i owiec. że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT). który może być wykorzystany m. Ich cechą charakterystyczną jest to.5 (motyw podstawowy: GGGAGGTGGGCAGGAGG). C i E różnią się między sobą kilkoma podstawieniami aminokwasów. D. W połowie lat 80. zaś w B -. Badanie takie wymaga zastosowania sond o dużej specyficzności. Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną. to na błonie radiograficznej pojawia się układ prążków. C. Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A. F. a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości. podobnie jak bydła. o tyle allele D i F wykazują znacznie większe różnice. to znaczy zawierających nie tylko sekwencję minisatelitarną.wariantem A i B polega na tym. który także jest już rutynowo stosowany. a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. W pozostałych loci wykryto po 2 allele. DNA fingerprint). B.in. natomiast wariant B — glicynę (GGT). ale także sekwencje ją otaczające. do kontroli pochodzenia i identyfikacji śladów biologicznych. Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B. Polimorfizm DNA W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące. Podobnie u owiec. Uzyskany układ prążków. w którym są 3 allele. nazywany niekiedy „odciskiem palca" DNA (ang. że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. opisano po raz pierwszy sekwencje minisatelitarne.6 (motyw podstawowy: AGGGCTGGAGG) i 33. są cztery frakcje białek. Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus. w loci kontrolującym główne białka mleka występują po 2 allele. O). O ile allele A. przedstawia wysoce charakterystyczny obraz osobniczego DNA. Z kolei w pozycji 118 w wariancie A jest walina (GTC). B. Zostało to wykorzystane w opracowanym teście PCR-RFLP. Do najbardziej znanych sekwencji minisatelitarnych należą: 33.15 (motyw podstawowy: AGAGGTGGGCAGGTGG). polegające na delecji odpowiednio 11 i 37 aminokwasów. Fragmenty te pochodzą z wielu loci. który reprezentuje fragmenty DNA o różnej długości. oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265 . jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. Sekwencje te występują w wielu miejscach (loci) genomu. 11.

Do tej pory najczęściej opisywano dwu. po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną. Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. tzn. Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. random amplified polymorphic DNA — RAPD).(np. Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu. lub dwóch fragmentów — u heterozygoty (ryć. w przypadku homozygoty. Warto zaznaczyć. polimorficznego fragmentu DNA. Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji. Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili. Zostały one określone terminem sekwencji mikrosatelitarnych. gdy nie są znane ani sondy molekularne. że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas. CATA) motywy podstawowe. także powtarzających się tandemowo. Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA. za pomocą sekwencji starterowej o losowej 266 . Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony. że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. gdy za pomocą techniki PCR. pochodzących z DNA wyizolowanego od danego osobnika.durą (ang. 11-3 wkładka kolorowa). high stringency). bo zawierających motyw podstawowy długości kilku nukleotydów. a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. Szacuje się. że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). (GT)nGAT(AG)m. polegający na tym. (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika. Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów. żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych. CA) lub czteronukleotydowe (np. Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych. że ich loci są położone głównie w częściach telomerowych chromosomów. możliwe stało się analizowanie pojedynczych loci. ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego.

w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). np. że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna. w tym sekwencjonowanie. reprezentujące zazwyczaj różne loci w genomie. w której dominują nukleotydy C i G. który zlokalizowano w chromosomie 9 u psa. Należy zaznaczyć.kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów). W ten sposób identyfikuje się markery określane skrótem SCAR (ang. Dynamiczny rozwój badań. że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw. charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. ale może od267 . Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP). to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne). prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1.AATCGGC oraz allel 2 — AATGGGC. cichego podstawienia. Jeśli amplifikowany fragment jest wystarczająco duży. został następnie molekularnie opisany. czyli nie wpływa na budowę polipetydu.4 mln miejsc SNP. zaowocował identyfikacją nowej klasy markerów genetycznych. określanych symbolem SNP (ang. Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. seauence characterized amplified region). wykryty za pomocą techniki RAPD. których celem jest sekwencjonowanie genomów różnych gatunków. Badając grupę osobników można stwierdzić różnice w układzie prążków. O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu. są poddawane elektroforezie. Wynika z tego. które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. Zamplifikowane fragmenty. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP. Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach. progressive rod-cone degeneration). single nucleotide polymorphism). allel l . Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli. amplifikowanego przez starter 5'-AGAATAGGC-3'. a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%. spośród których większość występuje poza strukturą genów. co doprowadziło do identyfikacji markera specyficznego SCAR. Na przykład. Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę. Polimorficzny fragment. Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD.

działywać na ekspresję genu. on zatem może być ojcem źrebięcia. ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego. którego nie stwierdzono u jednego z rodziców. Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. P-ad i Q-b oraz typy białek TF-O. Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek. ES-I. Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np. można wykluczyć jego ojcostwo. drugi od matki. D-cgm. marker assisted selection). w których występuje wiele antygenów. Warunków tych nie spełnia ogier l. 268 . w tym sekwencjonowania DNA. że potomek dziedziczy jeden allel z każdego locus od ojca. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej. tzw. czyli markerów genetycznych klasy I.6. Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP. Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. Do kontroli pochodzenia najlepsze są układy grupowe. C (12 antygenów) oraz S (8 antygenów). PHI-I. Wykorzystanie markerów genetycznych w hodowli zwierząt Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia. u świń układy M (12 antygenów). natomiast u koni układy A (7 antygenów). że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a. Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to. Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). D (17 antygenów). Spełnia je ogier 2. E (17 antygenów) i L (12 antygenów). Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik. Podstawą tej kontroli jest to. Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. ALB-A. u bydła są to układy B (40 antygenów). ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej. 11. P (4 antygeny) i Q (3 antygeny). MAS (ang. następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT).

ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć. którą jest np. W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory. W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą. Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne. jedna jest oparta na polimorfizmie minisatelitarnym. Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. Uzyskany obraz prążków jest charakterystyczny dla danego osobnika. Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia. 11-4). prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269 . W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru: Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka.ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. sekwencja minisatelitarna. Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. druga na polimorfizmie mikrosatelitarnym.

analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia. W takim przypadku określa się tzw.Jak już wspomniano. łączne prawdopodobieństwo wykluczenia dla wszystkich 270 .

których częstość szacuje się na 10-2-10-5 na pokolenie. drugi — 263 pz). szacowaniu zmienności genetycznej i dystansu genetycznego. Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. sprawia.badanych loci. Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA. W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki. określanego symbolem SNPs (ang. jak to jest przy cechach monogenowych — jakościowych. Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków. single nucleotide polymorphisms). Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks. iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia. przedstawiono na rycinie 11-5 (wkładka kolorowa). Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia.243 pz. drugi od ojca. matka natomiast heterozygotą (jeden allel . Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje. Również to. dodawany do każdej próby DNA analizowanej za pomocą sekwenatora. Ojciec jest homozygotą pod względem allelu długości 235 pz. Dwa z nich otrzymały od matki allel długości 243 pz. że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych. natomiast trzeci — allel 263 pz. dostępności informacji zarówno o jednym. 1300 par zasad). której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora. dokładnie tak. W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów. Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów. 271 . Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2). przy czym allel długości 235 pz odziedziczyły po ojcu. jak i obojgu rodzicach: Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. Wszystkie szczenięta są heterozygotami. w której stosuje się kilka markerów równocześnie.

11-VI). warunkujących cechy użytkowości mlecznej (tab. a postęp genetyczny jest uzyskiwany w krótszym czasie. W przypadku tych cech jest już możliwa selekcja bezpośrednia. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych". Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich.99% prawdopodobieństwa wykluczenia. Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. której kryteriami są genotypy zwierząt w danych loci. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt. głównie klasy II. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła. wydajnością białka w mleku. że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. są również pomocne w doskonaleniu niektórych cech jakościowych. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych. 11-VII). marker assisted selection). U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. o istotnym wpływie na cechy użytkowe. W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową. dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. czyli istotnych z hodowlanego punktu widzenia. Prowadzone są badania w celu znalezienia takich genów. Markery genetyczne. Identyfikacji genotypu w loci tych markerów daje 99.Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego. Okazało się. W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną. zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech). można dla młodej jałówki określić. Znając sprzężenie między określonym markerem genetycznym a np. Jest to cecha dziedzicząca 272 . brunatnego szwajcarskiego i simentali. cechy użytkowości mlecznej). Geny takie nazwano głównymi lub genami o dużym efekcie. Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach. jaka będzie wartość tej cechy w przyszłości. zwiększoną plenność świń. które mają znaczący wpływ na kształtowanie się cech użytkowych.

której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego. jak również intensywnej hodowli (zasiniaczenia i ukryte 273 . Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała). w których coraz więcej uwagi poświęca się dobrostanowi zwierząt.się z dominacją całkowitą.

uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji. jak i klasy II. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to. że locus polled. Dotychczas wiadomo jedynie. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii). kontrolujący bezrożność/rogatość u bydła. że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources). występuje w l chromosomie. jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia. Aby tego uniknąć. Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji. Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania. Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów. w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. które mogą być wykorzystane do tego celu. coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani. zanim wystąpią objawy chorobowe. ponadto jest zabiegiem kłopotliwym. zwłaszcza infekcyjnych. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I. Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych. Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób. przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego. ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. Szacowanie dystansu genetycznego i wybór ras. Znane są już dwie sekwencje mikrosatelitarne. Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. które cechuje duża zmienność genetyczna. w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. sprzężone z locus polled. 274 .

Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów. Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). Organizacja DNA jądrowego W obrębie genomu występują zarówno sekwencje kodujące. mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). Genom może być opisany za pomocą kilku parametrów. Przyjmuje się.Rozdział 12 Mapy genomowe Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM). 12. Miejsca te można wybarwić metodą barwienia prążkowego typu T. Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. dlatego pojęcie genomu odnoszone jest do DNA jądrowego. Rozmieszczenie loci genów w genomie jest nierównomierne. jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. Po pierwsze. Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad. wyrażona w cM. U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM. Całkowita długość genomu u ssaków. Sekwencje powtarzalne 275 . które stanowią około 97% całego DNA (ryć. 12-1). że w genomie ssaków występuje około 35 tysięcy genów. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów.1. która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów. Zdecydowanie przeważają sekwencje niekodujące. Tam też znacznie częściej zachodzi crossing over. Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów. czyli geny. jak i sekwencje niekodujące.

sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych. że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad.dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. Oznacza to. jest to. ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim). Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów). W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej. Szacuje się. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to. którą uwidocznia się metodą barwienia prążkami C. że liczba powtórzeń danego układu podstawowego wykazuje w obrębie 276 . Szczególnie cenne. że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu. Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. że genom jest bardzo silnie nimi nasycony. z punktu widzenia przydatności tych sekwencji do analizy genetycznej. Niezależnie od tego.

Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. jest sekwencja telomerowa (TTAGGG/AATCCC). leżą w pobliżu białkowych struktur kompleksów. dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych. które również są rozproszone w wielu miejscach genomu. 277 . Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. Elementy nukleotydowe to takie sekwencje. Funkcja sekwencji powtarzalnych. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów. ale w danym miejscu występuje tylko jedna kopia sekwencji. Inaczej mówiąc. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną. jest do tej pory słabo rozpoznana. sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element). w pobliżu końców ramion chromosomów. których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element). że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego.populacji silne zróżnicowanie. Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu.2. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. Wiadomo. 12. Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny. podobnie jak elementy nukleotydowe. z wyjątkiem sekwencji telomerowych. że sekwencje te. Organizacja DNA mitochondrialnego Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin). w których asocjuje heterochromatyna z kilku chromosomów. Skróceniu ulegają właśnie sekwencje telomerowe. przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. która stanowi zakończenia ramion chromosomowych. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się. Podobnie jak poprzednio. Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz.

Struktura mtDNA jest inna niż DNA jądrowego. mtDNA jest bowiem kolisty. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka. Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy. Większość komórek zawiera od tysiąca do 10 tyś. w których być może replikacja mtDNA nie zachodzi. poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. kopii mtDNA. W nich odbywa się większość reakcji oddychania komórkowego. 278 . Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. Jego długość wynosi około 16 tysięcy par zasad. Białka będące podjednostkami enzymów łańcucha oddechowego (np. oxidative phosphorylation — OXPHOS). a tylko część przez mtDNA. cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V. Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli. Wiadomo już. Całkowita liczba genów w ludzkim mtDNA wynosi 37.Mitochondria należą do organelli komórkowych przekształcających energię. ubichinon/koenzym Q. przy czym kompleks V jest to syntaza ATP. zatem muszą być syntetyzowane wewnątrz mitochondriów. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang.

a niektóre geny nawet nakładają się na siebie. b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli). w której obrębie występuje potrójna struktura DNA. genów (markery klasy I). Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA. pozostający w asocjacji z cząsteczką macierzystą. która wskazuje położenia loci w chromosomach. Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych. na obu łańcuchach. a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. Łańcuchy komplementarne. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego. Kolejną cechą charakterystyczną mtDNA jest to. nazywa się cytogenetyczną lub fizyczną mapą genomu. co więcej. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących. transkrypcji podlegają obie nici kolistego DNA. która przebiega równocześnie. Prawie cały mtDNA zawiera sekwencje kodujące. uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. który stanowi dominującą część genomu. Z kolei mapa opisująca sprzężenia. dlatego niejednokrotnie mówi się o markerowej mapie genomu. tzn. w odróżnieniu od DNA jądrowego. Markerowa mapa genomu Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach. uformowana przez krótki fragment nowego łańcucha H. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D. Mapa. wyrażonych w cM.DNA występujący w mitochondriach nie jest powiązany z białkami. wchodzące w skład cząsteczki mtDNA. Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech. ale w przeciwnych kierunkach. i niekodujących. różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H). W mtDNA występuje jedno miejsce inicjujące transkrypcję. pomiędzy sprzężo nymi loci oraz ich uszeregowaniu. 279 . a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA. który ma większy udział nukleotydów guanylowych — G i tymidylowych .3. c) odległościach genetycznych.T niż łańcuch lekki (L). że geny mitochondrialne nie zawierają intronów. 12.

280 .3. Różnica między DNA genu a jego cDNA polega na tym. ale nie jedyną. że w cDNA nie występują introny. na przykład mikrosatelitę — marker klasy II. która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. cDNA (komplementarny DNA) genu. na bazie którego syntetyzowano cDNA. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa. Często sondę stanowi tzw. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany. Jest to taka sekwencja nukleotydowa. reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję. Fizyczna mapa genomu Podstawową.12. ponieważ w mRNA. sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang. metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym.1.

które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt. 12-3. Q lub R). która zawiera unikatowe sekwencje DNA wybranego chromosomu. Trzeba podkreślić. Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. wykorzystuje się techniki prążkowego barwienia (G. które stosuje się albo przed hybrydyzacją. 12-4 wkładka kolorowa). Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów. Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków. Malowanie chromosomów polega na zastosowaniu sondy. Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. jest rozpoznawane przez obserwację mikroskopową. malowaniu chromosomów (ang. że do identyfikacji chromosomu. Ponadto. gdzie sonda hybrydyzowała z DNA chromosomu splicing). Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu. FISH) na chromosomie 3 psa. Hybrydyzacją in situ ma wiele odmian. Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych. zgodnie z przyjętym wzorcem kariotypu. W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu. w którym sonda połączy się z DNA chromosomu. (b) ta sama metafaza po hybrydyzacji. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. comparative chromosome 281 . świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. 12-3). chromosome painting) i mapowaniu na chromatynie jąder interfazowych. (a) chromosomy barwione metodą prążków Q. Warto wspomnieć o dwóch: tzw. albo po hybrydyzacji. związanego z barwnikiem fluorescencyjnym (ryć. Analizę taką określa się terminem porównawczego malowania chromosomów (ang.Ryć. Miejsce. jasne punkty wskazują miejsce.

człowieka). że zmiany na poziomie chromosomowym. Należy jednak 282 . są bardzo złożone. jakie zaszły podczas ewolucji. Dowodzi to. że w genomach bydła. utworzoną dla jednego gatunku (np. 12-1). stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. że sondę chromosomowo specyficzną. które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. Przeprowadzone eksperymenty ujawniły. bydła). konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych.painting) i polega ona na tym. W ten sposób można wskazać.

Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku. który jest to chromosom 1 w jakim regionie mieszczą się badane loci. 0 ich umiejscowieniu wiadomo jedynie tyle. że sonda chromosomowo specyficzna da widoczny sygnał. podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. Tak wyprowadzone klony poddawane są analizie elektroforetycznej. Loci takie nazywa się syntenicznymi. którego genom jest badany — w tym przykładzie są to komórki bydlęce. np. Nie można natomiast wskazać. że są położone w jednym chromosomie. że metoda malowania chromosomów ma ograniczoną dokładność. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków. ale czasami może się zdarzyć tak. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci. Okazuje się jednak. utrzymywanych w hodowli. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych. W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki). Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA. naświetlaniu promieniami jonizującymi. jeżeli obejmuje segment długości co najmniej kilku milionów par zasad.zaznaczyć. W tym przypadku są to chromosomy bydła. które będą się między sobą różniły liczbą zachowanych chromosomów bydła. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. komórki nowotworowe myszy). które nie pochodzą z komórek nowotworowych. przed hybrydyzowaniem z komórkami nośnikowymi (np. które zawsze pojawiają się razem. czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów.6 milionów par zasad. że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków. że grupa tych loci jest położona w tym samym chromosomie. Polega ona na poddawaniu komórek gatunku mapowanego. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji. Polega ona na tym. nieznana pozostaje również wzajemna odległość między nimi. Na przykład. a zatem fragmentacja chromosomów. przyjmuje się bowiem. Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. Sytuacja taka świadczy o tym. z fibroblastami pochodzącymi z mięśni czy skóry bydła. której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku. że jeżeli takie komórki są hodowane w warunkach in vitro. a w każdej 283 . mysich komórek nowotworowych. to stopniowo „gubione" są chromosomy. których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym. naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16.

. Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka. na tyle blisko. 12..3. tym mniejsze fragmenty. wykorzystywane w mapowaniu radiacyjnym.2. Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania. loci). radów.współczynnik rekombinacji. wynoszą zazwyczaj 5 tyś.funkcja wiarogodności. względem hipotezy alternatywnej. obliczana jako prawdopodobieństwo wystąpienia określonych genotypów. 7 tyś. Najpierw poszukuje się sprzężeń pomiędzy loci. ze względu na zbyt małe prawdopodobieństwo zajścia crossing over. w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. Odległość taka oznacza. krzyżówka trójpunktowa). z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. Dalej.5) r . lub 12 tyś.z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa. przy założonym współczynniku rekombinacji (r). W tym celu korzysta się z wiedzy o genotypach osobników 284 . które odzwierciedlają częstość. Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania. przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia. że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych.5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci. Jednostką odległości genetycznej jest l cM. Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie.. że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang. Kolejność postępowania jest następująca. u potomstwa osobników o znanych genotypach. przyjmującej niezależne dziedziczenie (r = 0. na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci. Dawki promieniowania jonizującego. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu. zawierający się w przedziale (0. służy tworzeniu genetycznej mapy genomu. L . Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego. 0. w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. Genetyczna mapa genomu Analiza segregacji alleli w loci markerowych.

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

situ. bawoła.) i domowych. Przewiduje się. są coraz lepiej poznane. Tak opracowane mapy określane są terminem map zintegrowanych (ang. 12-111). Warto zwrócić uwagę. Opublikowano ją we wrześniu 2003 r. Szczegółowe dane dotyczące map poszczególnych genomów. analizy hybrydowych komórek somatycznych. królika. jest genom psa. zostanie ustalona sekwencja genomu bydła. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt. dla którego ustalono sekwencję nukleotydów. świni i kury. a w tym i konkretnych chromosomów. a także łososia i pstrąga tęczowego. Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe. że do 2005 r. 291 . comprehensive map). obok wymienionych w tabeli 12-11. Wśród tych ostatnich pierwszym genomem. są zamieszczone w internetowych bazach danych (tab. takie jak: lis pospolity. Coraz więcej informacji pojawia się o mapach: kota. lis polarny oraz jenot. że również mapy genomów innych gatunków zwierząt gospodarskich. W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r. a w tym także mapowania radiacyjnego) i sprzężeniowego.

marmurkowatość mięsa. jest pokazany na rycinie 12-6. ang. odpowiedzialnych za występowanie różnych alleli. tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali. Ogólny schemat postępowania. pale. który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA. zlokalizowanych w różnych miejscach genomu. Najpierw ustalono. Stwierdzenie. bezrożność.5. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. mięso blade. Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw. które polega na opisie struktury genu. tzn. jak i jakościowe. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP). że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. która ma istotne znaczenie gospodarcze. a konkretnie przez allel recesywny. Punktem wyjścia jest precyzyjne opisanie zmienności cechy. wydajność rzeźna. odporność na infekcje specyficznymi patogenami. Hodowca wskazuje cechę. wydajność białka w mleku. homozygot recesywnych 292 . dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych). gen główny w przypadku cech ilościowych). np. wskazuje. polegająca na klasyfikacji fenotypów dla interesującej cechy. którego celem jest identyfikacja nieznanego genu. że allele któregoś z markerów kosegregują z określonymi fenotypami cechy. Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres.12.3. które z hodowlanego punktu widzenia mają istotne znaczenie. jak i genotypów w jak największej liczbie loci markerowych. że cecha ta warunkowana jest monogenowo. Mogą to być zatem zarówno cechy ilościowe. Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. choroby genetyczne itp. a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych. miękkie i wodniste. Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu. Wykorzystanie markerowych map genomowych w hodowli Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów. Następnie podejmowana jest żmudna analiza. Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. soft. exudative — PSE).

Loci tych markerów umiejscowiono. 12-7a).in. np. które okazały się ściśle sprzężone z locus HAL. Kilka lat później zidentyfikowano pierwsze markery genetyczne (m. Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym. candidate gene). za pomocą hybrydyzacji in situ. Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI. który nie rozpoznaje 293 . że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym. którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu.Ryć. która polega na zamianie argininy na cysteinę w pozycji 615. Badania molekularne tego genu u osobników wrażliwych na stres wykazały. PGD i A1BG). w chromosomie 6 świni (ryć. locus układu grupowego krwi H oraz loci polimorficznych białek krwi . Był nim gen receptora rianodyny (RYR1).GP7. genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych (nn). 12-6. Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang.

(b) MSTN. 12-7b). (c) BMPR-IB. wiadomo było. który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot. Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową. muscular hyperthrophy). Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić.Ryć. jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. (d) PRKAG3 oraz regionów chromosomowych. Od połowy lat 80. że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła. Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN). że hipertrofia mięśniowa (tzw. wywodzących się z rasy belgijskiej 294 . 12-7. w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy sekwencji zawierającej mutację. W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech). Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1.

Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego. Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. są prowadzone w licznych ośrodkach naukowych. Dominujący gen RN~ powoduje większą. W 2001 r. W 1994 roku ukazała się praca dowodząca. które w znaczący sposób wpływają na cechy użytkowe. który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania. Okazało się. ustalono. Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). że mutacja polegała na braku (delecji) 11 nukleotydów.błękitnej i asturiana. Analiza segregacji licznych markerów genetycznych. Co więcej. co fenotypowo objawia się hipertrofią mięśniową. Przykładem może być gen FecB. a allel recesywny rn+ mniejszą zawartość glikogenu. 295 . że w chromosomie 4 świni. które umiejscowione są w chromosomie 6 (ryć. który odpowiada za zawartość glikogenu w mięśniach. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. kwaśnego mięsa. wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. które ma mniejszą wartość technologiczną. Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech. Innym przykładem jest gen RN. który jest biologicznie nieaktywny. że jest nim zmutowany allel genu PRKAG3. W początkowym stadium badań zakłada się. a konkretnie kontrolujący liczbę owulujących oocytów podczas rui. Locus genu RN umiejscowiono w chromosomie 15. które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. Okazało się. 12-7d). pokrywających w miarę równomiernie większość genomu. czyli genu głównego. wpływający na plenność owiec rasy merynos booroola. w którym prawdopodobnie występuje locus genu głównego. zakończyły się wieloletnie poszukiwania genu RN. Badania zmierzające do identyfikacji genów głównych. że gen FecB to zmutowana postać genu BMPR-IB. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop"). 12-7c). Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi. nie udało się jeszcze wskazać genów kandydujących. W 2000 r. różnych mutacji uszkadzających funkcję białka miostatyny.

określana symbolem bd (ang. 296 . że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę. W początkowym okresie jego użytkowania stwierdzono. charakteryzującego się wybitną wartością hodowlaną. czyli duży efekt fenotypowy pojawia się tylko wtedy. Oznaczało to. że również wiele krów było nosicielkami zmutowanego genu bd. czego efektem jest 3-krotny wzrost ekspresji genu IGF2. Z kolei w październiku 2003 r. że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej. chore cielę — homozygota recesywna). Jednym z przykładów może być letalna wada rozwojowa — achondroplazja. Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel. występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. doniesiono. którzy również byli nosicielami tego niepożądanego genu. w budowie czaszki. Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela. 12-7e). a to upośledza funkcję kodowanego enzymu. że gen ten podlega piętnowaniu gametycznemu. Odnotowano też znaczące osiągnięcie dotyczące bydła. w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. Można się spodziewać. występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują. który odpowiadałby za kształtowanie tych cech ilościowych. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego. Z badań prowadzonych w rodzinach referencyjnych wynikało. ze względu na wywoływane zmiany m. w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie.in. bulldog disease). że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka. Sugestia ta została potwierdzona także w innych badaniach. krowa nosicielka. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja. między markerami mikrosatelitarnymi S0083 i S0090. wykazano. W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca. 12-7f). W 2001 r. że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. Trzeba zaznaczyć.między markerami S0001 i S0067. Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym. że w chromosomie 12. że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. gdy zmutowany allel jest odziedziczony od ojca.

ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli. Wśród nich są geny wywołujące takie schorzenia. narkolepsja u dobermanów i labradorów. Niestety badań tych nie opublikowano. jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów). CVM — central vertebral malformation). Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów. że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt. . a opracowany test molekularny skomercjalizowano. W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. polegającą na zniekształceniu kręgów (ang. a ostatnio scharakteryzowano gen oraz mutację w nim występującą. Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują. Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej. Wiele z tych mutacji występuje w ściśle określonych rasach.W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową. U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów. Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne. dziedziczny zanik siatkówki u owczarków francuskich).

Nowicki i wsp. Juszczaka i S. Leksykon rozrodu zwierząt (1996). 298 . Augustyniaka i J. L. K. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997). Krzyżosiaka. II— lata 1972^-1997 (1997). z j. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994). Rosłanowskiego. pod red. Leksykon biologiczny (1992). W. Bala. W. A. z j. Brown (przekład pod red. Węgleńskiego. Pawlaka). Genetyka człowieka. pod red. Warszawa. pod red. J. Żeromskiego). Zwierzchowskiego. Brema. pod red. pod red. Stryer (tłum. J. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. Berg i M. P. Genetyka molekularna (1995). Prus-Głowackiego).B. Wydawnictwo Naukowe PWN. Ośrodek Wydawnictw Naukowych PAN. T. pod red. Genom człowieka. King. Prószyński i S-ka. Rozwiązywanie problemów medycznych (2003). K. Wydawnictwo Naukowe PWN. J. R. Wiedza Powszechna. W. P. pod red. Węgleńskiego). Kłyszejko-Stefanowicz..Literatura uzupełniająca Podręczniki Biochemia (1997). pod red. Wydawnictwo Naukowe PWN. Filistowicza. Wydawnictwo Naukowe PWN. The Major Histocompatibility Complex Region of Domestic Animal Species (1996). Waśniewska-Brzeska i J. L. J. M. Cz. Brzeski). Modlińskiego. Roitt. Karty z Dziejów Zootechniki Polskiej.R. Genomy (2001). Stansfield (przekład zbiorowy pod red.A. J. Małe (tłum. pod red.D. Cytobiochemia (1995). Krzanowskiej. Brostoff. Słownik terminów genetycznych (2002). Singer (tłum. Poznawanie zasad dziedziczenia (1997).. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. B. z j. Immunologia (1996). ang. Poznań. Wężyka. A. Michejdy). D. pod red. ang. Wydawnictwo Naukowe PWN. Jaszczaka i J.J. Wydawnictwo Naukowe PWN. Warszawa. Elementy genetyki klinicznej (2001). Schook i S. P. USA. L. B. Wydawnictwo Akademii Rolniczej w Poznaniu. ang. L. Biologia molekularna w medycynie. Warszawa. Lamont.C. Jury i H. Wydawnictwo Naukowe PWN. Cz. I. Wydawnictwo Medyczne Słotwiński Yerlag. Wydawnictwo Naukowe PWN. CRC Press Inc. Jeżyk genów. Biotechnologia zwierząt (1997). Korf (przekład pod red.

W. (1996).. (1996).L. Leymaster K. Lechniak D.G. European Journal of Immunogenetics 21: 209-215. (1996). Bartnik E.W.. Ludzki genom mitochondrialny — mutacje.. Magiczne mikromacierze. Journal of Applied Genetics 37: 179-196.H. Postępy Biologii Komórki 26 (supl. Kamiński S. Ohta T. Sonstegard T. (2002). Charon K. The dog genome: survey seąuencing and comparative analysis. Charon K. Goodfellow P. Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Krzanowska H. Journal of Applied Genetics 43: 123-130. Freking B. Kamiński S.. (1996). Medycyna Weterynaryjna 52 (2): 89-93.. Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych.P. Beattie C. (1994). i wsp. Geny oddziałujące na jakość tuszy i mięsa świń.E. Early steps in mammalian sex determination. (1997). (1998). Trends in Genetics 12 (8): 299-305. Journal of Applied Genetics 37 (3): 299-312. (1997). Zeszyt specjalny 8: 9-18.A. (1997). Beattie C. DNA microarrays — a methodological breakthrough in genetics. Stoughton R. A second-generation linkage map of bovine genome. A second-generation linkage map of the sheep genome. 299 . Science 272: 67-74. Molecular genetics of sex determination.. Prace i Materialy Zootechniczne.W. Minireview — MHC studies in domestic animals. Postępy Nauk Rolniczych 7 (nr 5): 87-97. Seminars in Reproductwe Medicine 20: 157-167.P. (1998).M.. (1999). McGraw R. Long S. Lopez-Corrales N. Friend S..W. (1998).L.F. Journal of Applied Genetics 38: 65-76. Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding.. Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich. (2002).. De Gortari M. Genome Research 7: 235-249. Dodds K. Keele J.A. 12): 53-58. Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej. Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence.Artykuły przeglądowe Barsh G. Cotinot C. Postępy Biologii Komórki 24 (8): 69-75.J. Mammalian Genome 9: 204-209.S.M. Dymnicki E. Parham P. (1996). polimorfizmy i choroby. (2003). Kappes S. Chromosome abnormalities in domestic sheep (Ovis aries).M. Grzybowski G. (2002).M.. Ramikssoon Y.M. (1997). Stone R. Population biology of antigen presentation by MHC class I molecules. Kamiński S. Ellis S. Mapa genomu świni (Sus scrofa domestica). The genetics of pigmentation: from fancy genes to complex traits.A. Kirkness E. Grzybowski G.. Naturę 409: 860-921. Current Opinion in Genetics & Development 6: 316-321. Pareek Ch. Kappes S. (1996). Kurył J. Science 301: 1898-1903. International Human Genome Seąuencing Consortium (2001). Keele J. Prace i Materiały Zootechniczne 50: 69-78.. Initial seąuencing and analysis of the human genome.. Medycyna Weterynaryjna 54 (2): 92-96. Biotechnologia 3 (38): 38-50.... Metody oraz znaczenie sterowania proporcją płci u bydła. Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt..T. Cuthbertson R. Stone R.T. (1998). (1997). Smith T..A.. Crawford A. (1996). i wsp. Świat Nauki 4 (128): 36-43.. Pierzchała M. Prace i Materialy Zootechniczne 49: 7-28.S.B.

.. Barciszewski J. Journal of Applied Genetics 44: 1-20. Beattie C. Journal of Applied Genetics 40 (2): 117-128. Zwierzchowski L.. Basics of gametic imprinting. Aberracje chromosomowe u bydła o użytkowości mięsnej. (1998). Synaptonemal complexes in domestic mammals — a review.P.. (1993). Kulig H. Biotechnologia 2 (41): 33-56. Kurył J. Walawski K. 10): 113-122. (1997).. Stachurska A.. Barciszewska M. Naturę 420: 520-562. (2003). Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej.W. Żywiecki M. Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus). (1999). Świtoński M. Kozubska-Sobocińska A. i wsp. Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt. Prace i Materiały Zootechniczne 50: 11-39. Krajowy system kontroli cytogenetycznej buhajów... Keele J. Szatkowska L. (2002).Z. (1998). Stranzinger G. (1998).J.. Ruvinsky A. (1998). Świtoński M. Smith T.L. Prace i Materiały Zootechniczne 53: 35-48. (1998). The seąuence of the human genome. (1996). Yenter C. (2003). Journal of Dairy Science 82 (suppl. Science 291: 1304-1351. Rohrer G. Prace i Materiały Zootechniczne 52: 37-42. Szydłowski M. Journal of Applied Genetics 38:195-204. Szwaczkowski T.. Hu Z. Noncoding RNA transcripts.W. Wierzbicki H. Zwierzchowski L. Napierała D. Rosochacki S. (1999). Węgrzyn J. Poszukiwanie genów kontrolujących cechy tuczne. Genome Research 6: 371-391. Kwiatkowska J. Initial seąuencing and comparative analysis of the mouse genome.Rejduch B. Journal of Heredity 89 (6): 473-480. Postępy Biologii Komórki 25 (supl.S. Szymański M.. (1997). Postępy Biologii Komórki 25 (supl. Determinacja płci u ssaków. (1994). Słota E. Journal of Animal and Feed Sciences 2/3: 91-103. i wsp... 10): 195-217.. (1998). Antigenic markers of protein genes and their nomenclature in cattle.. Słomski R. Skiba E.. 2):288-237. Danielak B.A.. (1998). . Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej. (1997). Sysa P. Świtoński M. Alexander L. Identyfication of animal major genes in field collected data by use of statystical methods. Medycyna Weterynaryjna 53 (10): 581-584. Medycyna Weterynaryjna 59: 847-852. Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt. A comprehensive map of the porcine genome. Świtoński M. Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka. opasowe i rzeźne — najnowsze osiągnięcia. — Celera Genomics (2001). Prace i Materiały Zootechniczne 46: 29-40. Genetic aspects of mastitis resistance in cattle. Journal of Applied Genetics 38 (3): 319-328.H. Waterston R. Inheritance of colours in horses... Medycyna Weterynaryjna 50 (8): 379-382. (1994).J. Zych S.

są pogrubione. Gwiazdką oznaczono numery stron.Skorowidz Opracowali: Krystyna M. Charon. na których hasła znajdują się na rysunku lub w jego podpisie. Marek Świtoński Numery stron. na których znajduje się główny opis. .

Sign up to vote on this title
UsefulNot useful