Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

.............. 3........... Czynniki transkrypcyjne ..................................................................3................................................................................................................ 3. ....... 3...2........................................................................... Budowa kwasów nukleinowych ...................................................4............ DNA ................. Translacja ......................5.................................. 3............................................ 2..................................... 69 69 72 ........ Chromosomy i podziały jądra komórkowego ....................................................................2....... 3........................... 4..........................2......... Replikacja DNA ...... 2............5... ....................................................6.................................................................................................1.......6........................... 48 48 49 50 52 53 54 56 57 60 61 62 63 64 66 4 Metody analizy i modyfikacji genomu ........ 2.............7........... 3...................7....4........ Endonukleazy restrykcyjne ............... 2.......................... Piętno gametyczne ........... Mitoza.... 3...........2................. Kariotyp .........1..................1........1.....................................Spis treści 1 2 Wstęp — zarys historii genetyki ......................... Inaktywacja chromosomu X w zarodkach żeńskich ..............3...................................................................................... 2..... Barwienie prążkowe chromosomów ................3..............1...............................7.......................... 3............................ Regulacja ekspresji genu ........................................................................................ 3.... Transkrypcja ......................... 3........................... 2............................. RNA ..................... 3................ Kod genetyczny ................ Budowa chromosomu ..1............................................. Geny homeotyczne .........7..............1..................5........... 3..... Metylacja DNA ........... Gametogeneza ................ Wektory.................4.................... 3.....7..... n 1 5 16 23 31 33 37 43 3 Gen i jego ekspresja .......7....................... 4......... Mejoza ........................ Budowa genu .............................................. 3.......................................2..............................

..... 6............. 6.................. Plejotropia ..... 6.................. Ograniczanie występowania chorób genetycznych.....1..2................ Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) .. 4..... 5...................................................3........ 4.. Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych ........... Dziedziczenie cech sprzężonych .....2.........10.... Transgeneza ................................................................4.......5....... Techniki hybrydyzacji i sondy molekularne ..........2................4............ Mutacje w mitochondrialnym DNA ... ............ 5........................................... Miary skupienia ..............4.3............... Miary zmienności ...........3.............. Skutki mutacji genowych ....................... 5................................. Współdziałanie alleli ..... Penetracja i stopień ekspresji (ekspresywność) genów ..................................1...............................1...............1..... .......7.................................................1........... 5.................................3..... Rodzaje zmienności i czynniki ją wywołujące ......................... 4...1...............2.................... Mutacje genomowe . 5..........8.. Mutacje genowe .... 5....... 4. 4..............5........ 6.....................................................................4. 5.......... Geny letalne...... Sekwencjonowanie DNA .....4......................................3...................4......................................................... 7........................ 95 96 100 111 112 112 118 123 124 124 127 132 135 143 144 6 Podstawowe mechanizmy dziedziczenia cech ............................ Przyczyny i rodzaje mutacji genowych ..... 6.. semiletalne i subwitalne ............ Komplementarność ...4... 6.... Biblioteki genomowe i genowe ..............4......................... 5.............. 7............. Mutacje genowe wpływające na cechy produkcyjne zwierząt ................ 5......................1.................. 6....................... Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny ..4..........................4.2. 6...................................................2.................................. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) .........5............5................................................ 4.....................4...................4..3..............4... 5..................................................................1......4............... Dziedziczenie umaszczenia......2......................2........................................................ 6..... 6.................. Choroby monogenowe wywołujące wrodzone wady rozwojowe 5........... 6.......2. Dziedziczenie cech warunkowanych jedną parą alleli ...4......... Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce ........................ 5................ 5....... Niezależne dziedziczenie cech (II prawo Mendla) .......................4......... Mutacje chromosomowe ..... Epistaza ...... 6.........1.......................................................... 146 147 147 150 152 157 160 160 161 162 163 164 164 175 176 7 Zmienność cech.........................1..5.......... 4.... 7.. Sumujące działanie genów ...................................4....4......................... Współdziałanie genów z różnych lód w kształtowaniu fenotypu ............................... Mutacje genowe wywołujące choroby genetyczne .1............................6. ....... 76 78 82 86 87 88 91 91 5 Mutacje .......................... Rekombinacja molekularna i klonowanie ..............................4..2.3............ 6.............................................. 6..................2. ..9....... ........... Dziedziczenie pozajądrowe ...........................1........4.......4............1..2...... Badanie ekspresji genów ...................................................... 5.............................................. Geny modyfikujące ........ 179 179 182 182 8 ....... Cechy sprzężone z płcią ...........

.......................3....................5............... Zmienność cech ilościowych ... 11.................1.................. 11... .. 10....3.............................4....... Allotypy immunoglobulin i lipoprotein . Zmienność transgresywna .................................. Białka surowicy krwi...........2..............3..... 11. 10.3.. 7............... 11.....2................ Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10....... Genetyczne podłoże różnorodności przeciwciał ........ .......... . Polimorfizm DNA .................... Determinacja płci ssaków .... Struktura i funkcje głównego układu zgodności tkankowej .............................. Związek MHC z odpornością na choroby . 227 227 230 231 233 236 237 239 243 243 243 244 245 247 11 Markery genetyczne ...3.. 7........ 7.................... Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami ................. Główny układ zgodności tkankowej — MHC .... 10.3..6........................... 11............ Interseksualizm .........3........... .........2....3........... Główny układ zgodności tkankowej zwierząt gospodarskich 10...... 8.............................. 185 187 187 189 190 8 Podstawy genetyki populacji .... 210 216 221 10 Genetyczne podstawy odporności i oporności ... 8.........3....2.6.............................. 10............2....... Miary rozproszenia ......3............1.................. Białka mleka ... 10............................................................1...... erytrocytów i leukocytów ................................................ 10....... 253 254 259 263 263 265 268 9 ...... Czynniki naruszające równowagę genetyczną ....... 8.......................3.......... 7....................................2. Frekwencja genów i genotypów w przypadku dominowania .. Znaczenie głównego układu zgodności tkankowej ............3......... Zarys przebiegu reakcji odpornościowej .. Identyfikacja cząsteczek głównego układu zgodności tkankowej 10.................. 10......3..............................1...............1............................. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych .... Główny układ zgodności tkankowej człowieka ... Główny układ zgodności tkankowej myszy ..3................ Genetyczna oporność na choroby ......................... Wykorzystanie markerów genetycznych w hodowli zwierząt.. Prawo równowagi genetycznej .........7......................1.5.................................... 11...................2..3. Genetyczne podłoże różnorodności receptorów limfocytów T ......... 9...............5........2............. 8................................. Dziedziczenie cech ilościowych ..... 9.........1......4...3.......... Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8.. 8............. Geny o dużym efekcie .................................................... ..........................1.....3.. 10.............3...............1.....2.............. 198 198 201 201 204 205 210 9 Determinacja i różnicowanie płci oraz interseksualizm ..................3.......3......................... Antygeny erytrocytarne (grupy krwi) ........................1.................... . 10.....2.............1.........4........... 10....................

............................................ 293 298 298 Skorowidz .................... Genetyczna mapa genomu ............................ .................. .......3.........................4............. Markerowa mapa genomu .............3.................... Podręczniki ................ 12.... Organizacja DNA mitochondrialnego .................................. 12..............2..............1 2 Mapy genomowe ...... 12.............................................................. ..............3.....1..............1............................3...........3.......3............................... 275 275 277 279 280 284 287 289 292 Literatura uzupełniająca .... 12..... Aktualny stan map genomowych zwierząt gospodarskich ..... 301 ......... Wykorzystanie markerowych map genomowych w hodowli . 12................................... 12.....................................5......2..................3..... Strategia mapowania genomu.. 12............. Fizyczna mapa genomu ............................................................. Artykuły przeglądowe .. ........................... Organizacja DNA jądrowego .......................... 12............ ......

byli Schwann i Schleiden. stanowiącą zaczątek genetyki. chemików. tkanek. podstawą ewolucji organizmów żywych jest dobór naturalny. której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty 11 .zarys historii genetyki Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych. Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX. Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów. rośliny samopylnej. O powstawaniu gatunków drogą doboru naturalnego. korę mogą powstawać jedynie przez podział innych komórek. a ostatnio również informatyków. Zgodnie z teorią Darwina. Autorami pierwszej z nich — teorii komórkowej budowy organizmów. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii. które stało się początkiem nauki o ewolucji.Rozdział 1 Wstęp . W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. komórek i ich organelli. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum). Badania nad mieszańcami roślin. który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania. że wszystkie rośliny i zwierzęta są zbudowane z komórek. czyli nauki o budowie i funkcji komórek. ogłoszonej w 1838 roku. Okazało się to niezwykle stymulujące dla rozwoju cytologii. wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. konstruktorów. a z drugiej formułowaniem przełomowych hipotez i teorii. ale także przekazanie tych korzystnych właściwości potomstwu. Główną tezą tej teorii było twierdzenie. umożliwiając im nie tylko przeżycie. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych.

de Yriesa i Tschermacka. za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie. Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2).czerwone lub białe. których celem było poznanie praw rządzących dziedziczeniem cech. Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków. nasiona żółte lub zielone itd. w tym struktur związanych z dziedziczeniem. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. że można je określać tylko jednym terminem — genetyka populacji. Fischer. Przełom nastąpił w 1944 roku. Pierwsze doniesienia o „pałeczkowatych" strukturach. że 12 . nasiona gładkie lub pomarszczone. MacLeod i McCarty wykazali. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. zostały podane przez polskiego botanika Strasburgera w 1880 roku. Niektórzy autorzy uważają. Rok później Morgan ogłosił chromosomową teorię dziedziczenia. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki. Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. Ten dział genetyki określa się często jako genetykę cech ilościowych. Wright i Haldane wprowadzili do genetyki metody statystyczne. o których różnorodności wiedziano już wówczas dość dużo. a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. Na początku XX wieku podjęto wiele badań. którą można uważać za początek cytogenetyki. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. W latach 20. do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. nazwanych w 1888 roku przez Waldeyera chromosomami. cech ilościowych. Stało się to za sprawą trzech badaczy: Corrensa. że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet. którzy niezależnie od siebie doszli do wniosków. Mendel uzyskał pierwsze pokolenie mieszańców (F1). że nośnikiem informacji genetycznej są białka. Dopiero wówczas zrozumiano genialność odkryć Mendla. kiedy to trzej badacze: Avery. które okazały się bardzo istotnymi narzędziami badawczymi. Przez wiele lat przypuszczano. które kilkadziesiąt lat wcześniej podał Mendel. przy czym jedna gameta zawiera tylko jeden taki element. Opis mitozy przedstawił w 1882 roku Flemming.

nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA). Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie. owca. że molekularne poznanie genomów człowieka.). W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów. W doświadczeniu tym można upatrywać początku genetyki molekularnej. ale również jego sekwencjonowanie..) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r. która wyjaśniała mechanizm ekspresji genów u bakterii. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna. wykrywaniem 1 zwalczaniem patogenów. zwierząt. kura czy pies. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. hodowlą zwierząt i roślin. Warto podkreślić. W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości.) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. Program ten został urucho miony w 1987 roku. Do wniosku tego doszli na podstawie wyników eksperymentu. jak świnia. W przypadku człowieka celem jest nie tylko mapowanie genomu. Początek lat 50. opracowanie techniki rekombinacji i klonowania DNA (1972 r. ustalenie kolejności par nukleotydów w całym DNA ludzkim. Nirenberg i Ochoa. a wiodącą rolę w tych badaniach odegrali między innymi Khorana. koń. tzn. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw. Zostały one zakończone w pierwszej połowie lat 60. Warto zaznaczyć. Human Genome Organisation Project) 13 . których celem było poznanie struktury chemicznej DNA. ochroną środowiska itp. przetwórstwem żywności. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego. sekwencjonowania DNA (1975 r. teorii operonu. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków.). Odkrycie enzymów restrykcyjnych (1962 r. w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. bydło. liczącym ponad trzy miliardy par nukleotydów.) oraz enzymu odwrotnej transkryptazy (1970 r. a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań. że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang. to czas usilnych badań. roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych.

Istotnym elementem pracy hodowlanej jest kontrola pochodzenia. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt.oraz 2) prywatną firmę CELERA. Pierwsze osiągnięcia zostały już opublikowane. . że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. gdzie jest granica. jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła. wysoką plenność owiec rasy boorola i inverdale. czego jednym z licznych przykładów jest hodowla zwierząt. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych. świni i kury. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji. Głównymi metodami hodowlanymi są selekcja i krzyżowanie. bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych. zwierząt. Ustalono. Przewiduje się. którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek. a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa. a w przypadku mutacji genowych — metod genetyki molekularnej. wysoką mięsność świń czy wydajność tłuszczu w mleku krów. W grudniu 2002 roku ustalono sekwencję genomu myszy. dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój. że do 2005 roku zostaną zsekwencjonowane genomy bydła. roślin. której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć. a ostatnio także polimorfizmu DNA. Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji. Wydaje się. a także człowieka powinna wywołać głębokie zastanowienie się nad tym. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów.

Należy jednak podkreślić. Głównymi tezami tej teorii było twierdzenie. Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. mejoza). Odpowiednikiem jądra komórkowego jest nukleoid.Rozdział 2 Chromosomy i podziały jądra komórkowego W podziale systematycznym organizmów żywych wyróżnia się. Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. biorąc pod uwagę organizację informacji genetycznej i budowę komórki. Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu. Do prokariontów zalicza się bakterie i sinice. 2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie. Tym samym organizmy te zawierają pojedynczy zestaw genów. dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota). który w 1910 roku ogłosił chromosomową teorię dziedziczenia. W jądrze komórkowym występują chromosomy. Prokarionty nie mają wyodrębnionego jądra komórkowego. zbudowany z „nagiej" kolistej cząsteczki DNA. zdolnego do podziałów (kariokinezy). czyli są haploidalne. Do eukariontów zalicza się wszystkie organizmy komórkowe. że: 1) geny zlokalizowane są w chromosomach. Eukarionty zbudowane są z komórek mających jądra komórkowe. że nie 15 . oprócz bakterii i sinic. a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. które podlegają podziałom (mitoza. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię. które są zbudowane z kwasów nukleinowych i białek. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana.

Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego. która następuje za pomocą białek histonowych i niehistonowych. chromosom Ryć. Fazy (GO. kwasów rybonukleinowych (RNA). 2. Gl. G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu. M — metafaza.wiedziano wówczas. Oznaczenia: P — profaza. Budowa chromosomu Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA). S. z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu.1. białek histonowych i niehistonowych. A — anafaza i T — telofaza 16 . 2-1. Dzięki kondensacji cząsteczki DNA.

(1. określanym jako centromer. W jąderkach budowane są podjednostki rybosomów. ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć. 18S i 28S. także przewężenie wtórne. W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5.osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej.01-oo). Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17 . oprócz przewężenia pierwotnego. Niektóre chromosomy mają. który jest odpowiedzialny za uformowanie jąderek podczas interfazy. Wówczas to chromosom ma długość rzędu kilku mikrometrów. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną. 2-1). O chromatydach mówi się. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej.71-3.01-7. subtelo-i akro-(telocentryczny) (ryć. nucleolar organizer region).00) i (7. ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-.70). Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC. 2-2). Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu. która obejmuje nie tylko ustalenie liczby chromosomów. Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1. określane inaczej jako obszar jąderkotwórczy — NOR (ang. submeta-. Część końcowa ramienia chromosomowego nazywana jest telomerem.00-1.8S. a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną. (3. Czwarta chromarydy siostrzane Ryć. 2-2. że są siostrzane.00).

Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć. Fragment ramienia chromosomu. która z kolei zawiera jedną cząsteczkę DNA. która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny. co najważniejsze — zestawu loci genów. które są w nich położone.frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. oznaczane u ssaków symbolami X oraz Y. Heterochromosomy. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y). a drugi od ojca danego osobnika. W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej. Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. który występuje za przewężeniem wtórnym. 2-3). Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego. nazywa się satelitą. układu prążków poprzecznych oraz. występują w układzie XX u samic oraz XY u samców. Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału. W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy. Oznacza to. że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację. morfologii. jak i żeńskiej. Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). Podczas fazy S następuje replikacja — 18 . podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. W każdej parze jeden chromosom pochodzi od matki.

na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów. a procesy te. zawierający po dwie cząsteczki histonów: H2A. Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu.8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz. Przyjmuje się. Jest on zbudowany z rdzenia białkowego (oktamer histonowy.Ryć. 19 . PWN) samoodtworzenie DNA. 2-4. Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz. 1997. 2-4). Fragment DNA owinięty na oktamerze histonowym (1. ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki. w zakresie od 0 do 80 pz. która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. inaczej par zasad (pz). H3 i H4). Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom. charakteryzują się niezwykłą precyzją (ryć. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo. w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. H2B. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt.

która zawsze występuje w stanie skondensowanym.Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid. Dlatego te sekwencje DNA określane są terminem S AR (ang. Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu. który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw. że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. Jej replikacja występuje w późnym okresie fazy S. Heterochromatyna konstytutywna jest frakcją chromatyny. która może ulec trwałej kondensacji. W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl. należącymi do rodziny białek HMG (ang. które są zakotwiczone w rdzeniu białkowym chromatydy. Zbudowana jest z niekodującycK. wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20 . Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny. Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. głównie powtarzalnych sekwencji DNA. scaffold attachment region). rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego. sekwencji nukleotydowych. czyli regionami wiążącymi się ze szkieletem chromosomu. Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. Pojawia się ona podczas zapłodnienia. domeny. W niej zlokalizowane są kodujące sekwencje DNA. zbudowanym z białek niehistonowych. high mobility group). a jej ostatecznym etapem jest utworzenie domen pętlo wych. które odpowiadają za zbliżenie się sąsiednich nukleosomów. przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. czyli geny. ciałka Barra. Wiadomo jednak. które tworzą większe chromocentra. Heterochromatyna fakultatywna jest częścią chromatyny. przykładem jest jeden z chromosomów X u osobników żeńskich. Chromosomy interfazowe zachowują strukturę nukleosomowa. Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości. Solenoid podlega dalszej spiralizacji. Podlega ona replikacji w początkowym okresie fazy S. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną.

Chromosomy homologiczne mają loci tych samych genów. ale mogą zawierać w nich różne allele 21 . W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych.w oocycie drugiego rzędu (komórce jajowej). w których jeden chromosom jest pochodzenia ojcowskiego. a drugi matczynego.

Chromosomy B. że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. od 30 u norki do 78 u psa (tab. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota. 2-5 i 2-6). ryć.Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale. Należy podkreślić. 2-1. czyli nadliczbowe względem podstawowego ze- 22 .

może być uwidocznione za pomocą technik barwienia różnicującego. Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej. Do tej pory nie poznano funkcji tych chromosomów. ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. chociaż wiadomo. że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii. Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. Konsekwencją tego jest występowanie u lisów osobników. że często są zbudowane z heterochromatyny konstytutywnej. fuzji centrycznej u lisów polarnych. wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T. 2. które mogą mieć 50. jak i pomiędzy komórkami w obrębie jednego osobnika. Barwienie prążkowe chromosomów Zróżnicowanie wewnętrzne chromosomu. Efektem tego jest zmienność ich liczby zarówno między osobnikami. np. czyli można przypuszczać. charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych.49 lub 48 chromosomów. Okazało się.stawu A. iż są nieaktywne genetycznie.2. Prążki mają identycz23 .

Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące 24 . że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów. Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole.ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku. po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny. ale także układ prążków na chromosomach. Wynika z tego.

gdzie dominują pary zasad A-T. Silne wiązanie barwnika kwinakryny następuje w miejscach. 2-7a). Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. a następnie barwienia roztworem Giemsy.(ryć. W efekcie na chromosomach 25 . Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny).

a miejscami szczególnie bogatymi w loci genów są prążki T.pojawiają się prążki ciemne i jasne (ryć. w których zlokalizowane są geny. Heterochromatyna konstytutywna 26 . Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. które pozwalają na uwidocznienie charakterystycznych regionów chromosomu. Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG). Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. Prążki R. Prążki ciemne występują w tych samych miejscach. gdzie przy barwieniu QFQ obserwowane są prążki świecące. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. Największe zagęszczenie genów występuje w obrębie izochor H3. wysepki CpG). 2-8). Zależność ta jest szczególnie interesująca. są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl. Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych. po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. że prążki R są głównymi regionami. Oprócz opisanych wyżej metod prążkowych. silnie skondensowane obszary heterochromatynowe. które się wybarwiają roztworem Giemsy. a przy barwieniu GTG prążek jasny. a pozostają trudne do usunięcia. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. są one niezbędne przy mapowaniu fizycznym genów. H2 i H3. znane są metody. Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach. 2-7b). Ponadto. ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. wykorzystywanych do identyfikacji chromosomów homologicznych. w których jest też najwięcej wysepek CpG. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T. gdzie przy barwieniu QFQ występuje prążek nie świecący. Wskazuje to zatem. W takich warunkach znaczna część euchromatyny zostaje usunięta. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. a prążki jasne odpowiadają nie świecącym prążkom Q. Oznacza to na przykład. że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu. które zaszły w kariotypach zwierząt. takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze.

Prążki Ag-I. czy też w częściach środkowych ramion. to barwienie azotanem srebra. które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). inaczej Ag-NOR. 27 . ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć.jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. W miejscach tych następuje wytrącenie metalicznego srebra. 2-9a). 2-10). Znane są również takie gatunki zwierząt. a rzadziej na końcach. 2-9b). u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona. np. które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć.

28 .Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków. Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych.

Koza. także koza ma wszystkie autosomy akrocentryczne. W stadium prometafazy. Owca. Świnia. W chromosomie X brak jest centromerowego prążka C. w części telomerowej ramion długich pięciu par autosomów. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów. natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. podobnie jak u bydła. Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków.i submetacentrycznych) oraz 6 par akrocentrycznych. Układ prążków C. Chromosom Y jest najmniejszym chromosomem metacentrycznym. w ramionach krótkich. co odróżnia go od autosomów akrocentrycznych o podobnej wielkości.60 (ryć. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach. Podobnie jak w przypadku bydła. Chromosomy płci są łatwe do identyfikacji. Chromosom X jest dużym akrocentrykiem. Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych. a chromosom Y jest małym metacentrykiem. a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. w chromosomie X widoczne są krótkie ramiona. Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. w pobliżu centromeru (ryć. w którym nie jest jeszcze zakończona kondensacja chromosomów. Chromosom X jest średniej wielkości metacentrykiem. W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim. Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. trudnym do odróżnienia na podstawie morfologii od autosomów. ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem. 2-6b). 2n = 64 (ryć. Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X. 2n . 2-6a). 2-5a). Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta. 2n = 54 (ryć. 2-5b). 2-9a). Chromosom X jest dużym chromosomem metacentrycznym. Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków. Również akrocentryczny jest chromosom X. 2n = 60. 2n = 38 (ryć. 2-10a). a chromosom Y jest małym metacentrykiem. a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. a chromosom Y jest akrocentrykiem. Obszary jąderkotwórcze występują. który ma dodatkowy prążek 29 . Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X. Koń. a chromosom Y jest małym metacentrykiem. Wszystkie autosomy są akrocentryczne.Bydło.

2 lub 3 chromosomy B. którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B. Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. a chromosom Y bardzo małym akrocentrykiem. Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych.interstycjalny w ramieniu długim. oraz w chromosomie Y. a chromosom W jest małym metacentrykiem. występuje liczna grupa bardzo małych chromosomów. Lis polarny. w okolicach centromeru. Kura. Liczba chromosomów B waha się od O do 7. Chromosom X jest dużym metacentrykiem. Lis pospolity. przy czym najczęściej obserwowano l. W kariotypie kury. Obszar jąderkotwórczy występuje tylko w jednej parze autosomów. dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe. podobnie jak u innych ptaków. 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. Wszystkie autosomy z grupy A są chromosomami dwuramiennymi. 30 . 2-7a). W grupie dużych autosomów analizuje się najczęściej 8 par. mają bloki heterochromatynowe w okolicy centromeru. 49 lub 48. 2-10b). Ponadto. 2n = 34 +B (ryć. 2n = 50. Chromosom Z jest dużym metacentrykiem. W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. 2n = 78. Wszystkie chromosomy. nazywanych mikrochromosomami. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów. U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną. z grupy mikrochromosomów. a chromosom Y bardzo małym akrocentrykiem. 2-9b). Chromosom Y jest w znacznej części heterochromatynowy. Chromosom X jest dużym metacentrykiem. łącznie z chromosomami płci. wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne. a chromosomy z grupy B są akroćentryczne lub subtelocentryczne.

a chromosom Y jest małym metacentrykiem. że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. odnawianiem niektórych komórek u dorosłych organizmów (np. a także z pierwszymi etapami gametogenezy. a czwartą fazą jest podział. Rozpoczęcie fazy S oznacza. Komórki potomne mają nie tylko taką samą liczbę chromosomów. nabłonka). 2-8b). S i G2 tworzą okres międzypodziałowy — interfazę. ale także identyczną sekwencję nukleotydów w DNA.3. Jeżeli ilość DNA wyrazimy za 31 . Mitoza Mitoza to proces podziału jądra komórkowego. proliferacją limfocytów przy reakcji odpornościowej organizmu. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów. mających genotyp identyczny z tym. W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. komórki krwi. Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu. W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki. w części terminalnej ramion długich. który prowadzi do powstania dwóch komórek potomnych. a faza S jest związana z procesem samoodtworzenia się DNA (replikacja). Wszystkie autosomy są akrocentryczne. 2n = 78 (ryć. jaki miała komórka rodzicielska. Chromosom X jest dużym metacentrykiem. 2. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. Fazy Gl. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki.Pies. chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y.

organelle komórkowe odpowiedzialne za wytwarzanie rybosomów. Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi. Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32 . wychodzące z centrosomu (obszar wokół centrioli). Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. anafazy i telofazy (ryć. którego włókienka. Chromosomy ulegają dekondensacji. Po zakończeniu podziału jądra komórkowego następuje cytokineza. łączą się z centromerami chromosomów w taki sposób. a centriole dzielą się na dwie parzyste struktury. Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. czyli podział cytoplazmy i rozdział organelli komórkowych. w pary homologiczne określane jest terminem kariotyp. W wyniku kariokinezy w komórce powstają dwa jądra potomne. mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska. które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. w których każdy z chromosomów jest zbudowany z jednej chromatydy. W telofazie zachodzą procesy odwrotne do tych.4. 2. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. metafazy. Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. rozchodzą się do przeciwległych biegunów komórki. 2-12). W końcu. Istotnym zmianom podlegają również inne organelle komórkowe. W tej fazie chromosomy są rozprzestrzenione w całej komórce. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych. Mitoza składa się z czterech faz: profazy. to w jądrze komórkowym po replikacji jest 4C. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. Centriołe. a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. W trakcie omawiania podziału mej etycznego pokazane zostanie.pomocą umownych wartości C. dezintegracji ulega błona jądrowa. 2-11). odbudowuje się błona jądrowa oraz jąderka. odpowiedzialne za powstanie wrzeciona podziałowego. Następuje formowanie się wrzeciona podziałowego. występujących w jądrze komórki somatycznej. że najmniejszą zawartość DNA (1C) mają gamety (ryć. jakie występują w profazie. W obrębie jądra komórkowego zanikają jąderka. W profazie rozpoczyna się proces kondensacji chromosomów. Kariotyp Uszeregowanie chromosomów.

Wydawnictwo AR. M — metafaza. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. C — cytokineza. Być. Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów. b— zanikające jaderko. Oznaczenia: P — profaza.spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce. A — anafaza. 2-12. T — telofaza. Poznań 1988) 33 . c — dezintegrująca błona jądrowa. Schemat przebiegu podziału mitotycznego. a — centriole. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt. PM — prometafaza.

że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny.lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q. submeta-. G lub R. subtelo. ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. kozy i psa. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć. Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu. 2-13. do których zalicza się: długość chromosomu. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds.Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych. Standaryzacji Kariotypu Świni. w których wszystkie Ryć. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła. Jest to spowodowane tym. położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-. 2-8a 34 .

chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości. przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne.1988) 35 . 2-14. Standaryzacji Kariotypu Świni (Hereditas 109:151-157. Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds. Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy Ryć.

która odbyła się w 1976 roku w Reading (W. Ag-I G. które są numerowane (ryć. Opracowanie kariotypu.zróżnicowane pod względem morfologicznym. Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony. wielkość oraz wzór prążkowy (najczęściej prążki G lub R). kozy i konia. Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej. Przykładem może być kariotyp świni (2n = 38). Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła. bydła. kozy i kota. 1985 Cytogenetics and Celi Genetks 31:240-248. dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem. dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang. owcy. 1988 Chromosome Research 5:433-443. 1997 Hereditas 103:33-38. Ag-I G G G. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery. landmarks). które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G. opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11 Wykaz gatunków. obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków. 2-14). 1981 Chromosome Research 4:306-309. przyjętym dla danego gatunku. 2-13). 2-14). świni. R G. W obrębie regionów numerowane są także kolejne prążki. 1999 . Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. R G. czasami określanego kariogramem. Brytania). R R G. Natomiast w drugiej połowie lat 90. nazywa się idiogramem (ryć. Q. w zakresie wyznaczonym przez liczbę par dla danego gatunku. R G. w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. 1999 J w- Hereditas 109:151-157. 1996 Cytogenetics and Celi Genetks 86:271-276. Q. Każda para homologiczna ma opisaną morfologię. Graficzne przedstawienie kariotypu. R Źródło Cytogenetics and Celi Genetks 92:283-299. owcy. konia. precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe. i 85:317-324. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni. C. W latach 80. Ponadto. C. 2001 jw. 1985 Hereditas 103:171-176.

replikacją DNA w fazie S. który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. zygoten. anafaza i telofaza (ryć. komórki te mają zmniejszoną do poziomu 1C zawartość DNA. Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym. zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. 2-15). w których występują takie same fazy jak w mitozie. Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej. dezintegracja błony jądrowej. która mocuje chromosom do wewnętrznej strony błony jądrowej. Wejście komórki w podział mejotyczny poprzedzone jest. tzn. Elementy lateralne 37 . tzn. Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną. Strukturą tą jest kompleks synaptonemalny (ang.: profaza. Mejoza składa się z dwóch podziałów. która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. podobnie jak w przypadku podziałów mitotycznych. z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów. Należą do nich: kondensacja chromosomów. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. dla których opracowano wzorce. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten. Mejoza Podział mejotyczny prowadzi do powstania komórek. Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych.szych par spośród 39) oraz poprawiono wzorzec kariotypu konia. 2-16 i 2-17).5. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu. Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne. diploten i diakinezę. metafaza. a element centralny powstaje w miejscu. pachyten. polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych. W tabeli 2-II zestawione są gatunki. które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. Każdy element lateralny zakończony jest tarczką przylegającą. Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału. pojawiającej się w zygotenie i pachytenie profazy I. Ponadto. gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. w których liczba chromosomów jest zredukowana o połowę. 2. które występują również w mitozie. czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. synaptonemal complex — SC).

a — tarczka przylegająca. Poznań 1988) . Tli — telofaza II. L — leptoten. e — chiazma (wg: Genetyka zwierząt. DL — diploten. Oznaczenia: PI — profaza I. DK — diakineza. Ali — anafaza II. c — początek budowania kompleksu synaptonemalnego. Pil — profaza II. Z — zygoten. 2-15. P — pachyten. AI — anafaza I. MII — metafaza II. Schemat przebiegu podziału mejotycznego. d — guzek rekombinacyjny. Wydawnictwo AR.Tli Ryć. MI — metafaza I. TI — telofaza I. b — centromer.

Ostatnio przeprowadzone badania pokazały jednak. U ssaków dobrze poznano strukturę trzech białek SCP (ang. Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. chociaż jeszcze nie poznanymi. występującymi w tej części domen pętlo wy ch. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej. zależnie od gatunku. zanim dojdzie do koniugacji za pośrednictwem SC.łączą się tylko z niewielką częścią DNA chromosomów (około 1%). Wiele wskazuje na to. to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi. Koniugacja chromosomów 39 . Wynika z tego. które są zakotwiczone w rdzeniu białkowym chromatydy. sekwencjami DNA. Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego. Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. Badania białek SC pokazały. Ponieważ koniugacja ma charakter homologiczny. domen pętlowych. że crossing over może zajść. że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. która z kolei miała umożliwiać zajście crossing over na początku pachytenu. synaptonemal complex protein): SCP1. mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz). których długość. SCP2 i SCP3. że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE).

na okładce).zostaje zakończona na początku pachytenu (ryć. Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów. 2-17b). dzięki 40 . Biwalent jest także formowany przez heterochromosomy X i Y (ryć.

gdzie wystąpiło crossing over. które uruchamiają homologiczną koniugację. zmierzają do płaszczyzny równikowej 41 . że SC jest w to istotnie zaangażowany. a w świetle ostatnich badań można przypuszczać. Zasadniczo crossing over jest zdarzeniem losowym. czyli musi zajść w obrębie każdego biwalentu. w których powstają chiazmy. Ponieważ tak się nie dzieje. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm. następuje rozkład kompleksów synaptonemalnych. składające się z maksymalnie skondensowanych chromosomów homologicznych.niewielkim regionom pseudoautosomalnym (ang. Na początku pachytenu występuje zjawisko crossing over. ich zanikania. gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. że na jednych chromosomach liczba ta byłaby znaczna. Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I. Zasada ta dotyczy także biwalentu X-Y. Przyjmuje się. które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. W metafazie I biwalenty. a na innych brak byłoby takich wymian. Po zakończeniu pachytenu — w diplotenie. a tym samym i jego chromatydy. Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału). Potencjalnie mogłoby istnieć niebezpieczeństwo. tzn. co wynika z zasady. że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. pseudoautosomal region — PAR). Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji. Wiadomo. dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over. które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. poza miejscami. że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. Losowość crossing over naruszona jest również przez to. że zachodzi ono rzadziej w pobliżu centromeru. że pierwotnym źródłem zmienności są mutacje. jaka była przed crossing over. uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego. miał zestaw alleli tylko jednego z rodziców. Należy jednak pamiętać. której efektem jest zmienność w świecie ożywionym. a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T. przy czym liczba tych zdarzeń waha się od l do 5. Losowość zachodzenia crossing over jest jednak ograniczona. że crossing over jest zjawiskiem obligatoryjnym. Należy podkreślić. w przeciwieństwie do sytuacji. stanowiące cytologiczny dowód zajścia crossing over. ponieważ brak crossing over pociąga za sobą brak chiazm. Chromatyda. która uczestniczyła w wymianie. że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca. Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. tzn. zachodzi w przypadkowym miejscu biwalentu. które są podklasą prążków R. a drugi od matki. Zjawisko to określane jest terminem interferencji. Wówczas to chromosom.

który nie jest poprzedzony replikacją DNA. 2-18b). Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób. czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym.komórki (ryć. Oznacza to. Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział. Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I. 2-18c). W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć. że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej. 42 . natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego. 2-18a). Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA. że do centromeru przyłączają się włókna tylko z jednego bieguna.

Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). rozpoczyna się telofaza. obok mutacji. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza). rozumiane w szerokim sensie. 2. że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice. Po ustawieniu się chromosomów podczas metafazy II (ryć. 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43 . Trzystopniowa rekombinacja sprawia. chromatydowe i wewnątrzchromatydowe. Ten fenomen. które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. a niektóre mają zrekombinowany układ alleli. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego. Przebieg mejozy. a ich chromatydy mają zrekombinowane układy alleli. jakie występują w profazie mitotycznej. inne matczynego. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C. 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy. że wśród gamet nie występują dwie o tym samym zestawie alleli. wśród których jedne są pochodzenia ojcowskiego. Gametogeneza Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym.6. jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów. Ten typ określany jest jako rekombinacja chromatydowa. w której zachodzą procesy odwrotne do tych. Rekombinacje genetyczne zachodzące podczas mejozy. przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny. można podzielić na: chromosomowe. Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki. a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają.Drugi podział ma przebieg zgodny z mitozą.

Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu. 2-19). w wyniku którego powstają plemniki. Spermatydy. zostają przekształcone w oocyty I rzędu. 3) wykształceniu na bazie centrioli włókna osiowego witki. powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi. Główne zmiany. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. w której zgrupowane są mitochondria. Oocyty przechodzą w stan spoczynkowy. 2) zgrupowaniu mitochondriów w pobliżu centrioli. 44 .geneza. Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki. podlegają głębokim przeobrażeniom podczas procesu spermiogenezy. Ostatecznie. W ten sposób wszystkie oogonia. a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. stem cells). będące w stadium diktiotenu. 2-20). a jest ich najczęściej sześć. która jest określana jako syncytium. Następne podziały mitotyczne spermatogoniów. czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika. po zakończeniu mejozy. a druga podlega dalszym podziałom. w których komórki linii płciowej lokują się w części korowej gonad. która stanowi przedłużenie wstawki. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych. polegają na: 1) przekształceniu aparatu Golgiego w akrosom. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu. które rozpoczynają podział mejotyczny. Podziały te są zsynchronizowane. która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. Dojrzały plemnik zbudowany jest z główki. który jest nazywany diktiotenem. które są umiejscowione po przeciwnej. w której jest umiejscowione jądro komórkowe i akrosom. który okrywa górną część jądra komórkowego znajdującego się w główce plemnika. wstawki znajdującej się u podstawy główki. które niezwłocznie rozpoczynają podział mejotyczny. Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego. które występowały w jajniku. stronie jądra komórkowego. nie kończą się cytokinezą. Pierwszy podział prowadzi do powstania dwóch spermatogoniów. jakie zachodzą podczas spermiogenezy. oraz witki. w stosunku do akrosomu. jako komórki niezróżnicowane. 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach. czyli komórek nie w pełni zróżnicowanych. Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. które wykazują zdolność do samoodnawiania. z których jedna komórka zajmuje miejsce pierwotnego spermatogonium.

Oocyt I rzędu kończy pierwszy podział mejotyczny. Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki. a w nich rozrasta się również oocyt. przed owulacją następuje ponowne uruchomienie podziału mejotycznego. przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu. Dzieje się to na drodze wyrzucenia przez oocyt zawartości 45 . który jest wspomagany przez otaczające komórki pęcherzykowe. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji. których wzrost był wystarczająco intensywny. pewna część pęcherzyków rozpoczyna wzrost.Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. to może nastąpić dokończenie oogenezy. regulowanych hormonalnie. w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. W pęcherzykach. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. Oocyt znajduje się w stadium metafazy II. W kolejnych cyklach płciowych. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej.

w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika. Zapłodniony oocyt II rzędu przekształca się w zygotę. a drugie reprezentujące zestaw chromosomów żeńskich. Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny. który zapłodnił oocyt. a chromatyna plemnika.ziaren korowych. Powoduje to „utwardzenie" osłonki przejrzystej. która staje się barierą nie do pokonania dla plemników. do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie. które pozostały w oocycie 46 . znajdujących się pod powierzchnią oocytu. po czym następuje telofaza II. podlega dekondensacji i powstaje przedjądrze męskie.

profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II). pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). inseminacja. kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro). Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu. do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy. jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu. zarodkach.po zakończeniu drugiego podziału mejotycznego. U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich. Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki. samic biorczyń. można wprowadzić techniką elektrofuzji komórkę somatyczną. zygotach. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii). Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja). Zawartość DNA wzrasta do poziomu 4C. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów. samic dawczyń do rogów macicy tzw. które są określane jako enukleowane. że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne). Warto zauważyć. W taki właśnie sposób sklonowano słynną owcę Doiły. a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. Do takich oocytów. który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów). przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. Na przykład. które umożliwiają uzyskiwanie potomstwa pożądanej płci. co powoduje. . że zygota jest gotowa do rozpoczęcia podziału mitotycznego. z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA.

M. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA. a także o strukturze cząsteczek rybosomowego (rRNA).1. które z kolei podlegają rekombinacjom podczas mejozy. które są niezbędne do pełnienia funkcji nośnika informacji genetycznej. czyli replikacji. 3. Z kolei proces ekspresji 48 . Po pierwsze. Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości. informacja o pierwszorzędowej strukturze białek. Crick przedstawili model budowy DNA.T. czyli procesowi generującemu pierwotną zmienność genetyczną. transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. DNA charakteryzuje się trzema właściwościami. w sekwencji nukleotydów zapisana jest. C.D. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA). W ślad za tym odkryciem nastąpiły następne. DNA ma zdolność do samoodtwarzania się. przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy. Badania te przeprowadzili badacze amerykańscy O. Po trzecie. Avery. Watson i F. W 1953 roku J. MacLeod i M. McCarty. który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. za pomocą kodu genetycznego. a przez następne lata rozszyfrowywano kod genetyczny. Po drugie. DNA może podlegać mutacjom. Budowa kwasów nukleinowych Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych.Rozdział 3 Gen i jego ekspresja Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi.

rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów. W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy. a rzadziej podwójny heliks.1. DNA Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C).genu jest nierozerwalnie związany z RNA. 3. które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji. Podstawową jednostką struktury DNA jest deoksyrybonukleotyd. 3-1). i tRNA (transportujący RNA). helix).1. który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów. w którego skład wchodzą: zasada azotowa. Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi 49 . Struktura ta określana jest w języku polskim terminem podwójna helisa (ang. cukier deoksyryboza i reszta kwasu fosforowego (ryć. występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu. W DNA występują cztery zasady azotowe.

Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. RNA Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych. Taka organizacja podwójnej helisy DNA sprawia. Długość cząsteczki DNA wyraża się liczbą par nukleotydów. Trzy rodzaje rRNA: 5.8S. że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha.2. w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). a w parze GC trzy takie wiązania. powstaje pre-rRNA o stałej sedymentacji 45S. Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą. Przeciwna polaryzacja polega na tym. lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla. określaną wielkością S — stała sedymentacji. 3. naprzeciw adeniny zawsze występuje tymina. tak więc w parze AT są dwa wiązania wodorowe. inaczej nazywanych przewężeniami wtórnymi.1.z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. tzn. prowadzonej przez polimerazę I RNA. a w przypadku mRNA także dla procesu translacji. 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang. polskim lub bp od słów angielskich base pairs). który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA. Podczas transkrypcji. a naprzeciw guaniny znajduje się cytozyna. natomiast liczba aktyw50 . Przyjmuje się. W jąderku zlokalizowane są cztery rodzaje rRNA. którego długość wynosi około 14 000 pz. Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane. z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA. Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji. W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA). które są wyróżniane ze względu na wielkość cząsteczki. czyli każdy łańcuch ma koniec 3' i 5'. Pomiędzy zasadami powstają słabe wiązania wodorowe. że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku. bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności. nucleolar organizer region — NOR).

Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów. a trzy pozostałe rodzaje. występujący w wielu powtórzeniach w innej części genomu. który jest zaangażowany w dostarczanie aminokwasów do rybosomów.nych obszarów. 3) pętla III — dodatkowa. Czwarty rodzaj — 5S rRNA jest kodowany przez gen.8S i 28S. o mało poznanej funkcji. w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas. Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60. które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA). zlokalizowane są w podjednostce dużej (60S). że przekracza liczbę znanych aminokwasów. co oznacza. 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem. Wymienione rodzaje rRNA uczestniczą w budowie rybosomu. 3-2). Na końcu 3' cząsteczki tRNA występuje sekwencja CCA. jest zmienna. W nici takiej mogą jednak występować fragmenty komplementarne. tzn. zawiera układ trzech nukleotydów. zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu. 2) pętla II — antykodonowa. które podlegają transkrypcji. która katalizuje związanie tRNA z.właściwym aminokwasem. Geny 5S rRNA są transkrybowane przez polimerazę III RNA. W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową. które są komplementarne do kodonu aminokwasu transportowanego przez tRNA. 5. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. czyli takich. 51 . a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć. 5S.

Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji. noncoding RNA). Ostatnie badania wykazują. Na przykład.Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych. Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach. Każdy podział mitotyczny musi być poprzedzony replikacją. a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów. Podobnie jest w przypadku mejozy. które określane są jako replikony. modyfikacji nukleotydów. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. Na uwagę zasługuje jeszcze jedna klasa RNA. czyli mitozy. liczba replikonów w genomie ssaków szacowana jest na około 25 000. bądź mejozy. która bierze udział w procesie wycinania intronów z pre-mRNA. Replikacja DNA Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego.2. a także regulacji ekspresji genów. z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji. że jest to bardzo ważna grupa RNA. 3. określana terminem niekodujący RNA (ncRNA — ang. 52 .

który ma być wbudowany w procesie biosyntezy białka. Kod genetyczny Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego. takie. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów. Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA. a nić powstająca w sposób nieciągły opóźnioną. rozpoczyna część kodującą genu. kod ma charakter trójkowy. to ogółem możliwe jest utworzenie 64 trójek (tab. Po pierwsze. tryplet) w DNA zawierają informację o aminokwasie. Rozplecione łańcuchy polinukleotydowe stanowią matryce. Po drugie. Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. o czym była już mowa wyżej. które dotyczą niektórych kodonów w mitochondrialnym DNA. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą. że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. fragmenty Okazaki). 3-3). są różne. Oznacza to. który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). trzy kolejne nukleotydy (kodon. tzn. W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. kodon UGA w kodzie uniwersalnym jest 53 . Wynika z tego. w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. 3. komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym. 3-1).3. Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. Od tej zasady są tylko nieliczne wyjątki. w obrębie danego odcinka DNA. Drugi. tzn. że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego. np. Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). jest on uniwersalny. Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne. Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. widełki replikacyjne (ryć. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia.Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. które następnie są łączone przez enzym ligazę w ciągłą nić. W ten sposób powstają tzw. tzn. że sekwencje nukleotydów w tych łańcuchach. mającego charakter trójkowy. na których w sposób komplementarny syntetyzowane są drugie łańcuchy. Tryplet AUG. które nie kodują żadnego aminokwasu.

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA. umaszczenie. podatność na stres itp. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. która wskazuje. takie jak: przemiany energetyczne. Niemniej znanych jest już wiele mechanizmów. jest włączana i wyłączana ekspresja różnych genów. translacji i potranslacyjnej modyfikacji białka. czyli dobudowa60 . Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki. elektroforeza białek. Modyfikacja mRNA. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji. Regulacja ekspresji genu W genomie ssaków występuje około 35 tysięcy genów. hybrydyzacja ze znakowanym przeciwciałem itp. replikacja DNA. w skład którego będą wchodziły różne kombinacje eksonów. Warto pamiętać. co ma oczywiście związek z ekspresją genów. Zakończenie transkrypcji związane jest z sekwencją AAUAAA. badania serologiczne — grupy krwi. czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. które mogą występować w układzie homo. funkcje gospodarza komórki (ang. housekeeping genes). że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu. wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych.). poligeny.lub heterozygotycznym. Podczas rozwoju ontogenetycznego. potranskrypcyjnej modyfikacji mRNA.7. w jakim kierunku różnicuje się dana komórka. regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek. Ekspresja genu obejmuje procesy: transkrypcji. Z drugiej strony. że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele. zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. które są zaangażowane w kontrolę ekspresji genów.3. zależnie od tego. Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu. Jest to bardzo złożony proces. obok genów ulegających powszechnej ekspresji. Wśród nich znaczną grupę stanowią geny pełniące tzw. Należy jednak pamiętać. obejmuje także inne procesy. W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw. Mechanizm ten nazywa się alternatywnym składaniem mRNA. w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. obecność rogów. oprócz zmian opisanych w podrozdziale poświęconym transkrypcji. Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. budowa struktur komórkowych itp.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. którego całościowe poznanie wymaga jeszcze wielu lat badań.

w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA). Okazuje się. Forma rozpuszczalna tego białka powstaje na matrycy mRNA. białka o strukturze typu heliks-skręt-heliks (ang. palce cynkowe (ang. zależnie od ich struktury trzeciorzędowej. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych. są zaliczane do następujących grup: białka zawierające tzw. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik 61 .1. ogonek poliA) na końcu 3' mRNA.nie sekwencji poliA (tzw. Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć. Białka te w swojej strukturze zawierają dwa istotne obszary. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza. Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie. Czynniki transkrypcyjne. które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji.7. takich jak hormony. 3-7). zinc finger). że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty. Wymienione struktury wchodzą w kontakt z nicią DNA. powstających w niektórych tkankach. Funkcjonują wówczas dwa rodzaje mRNA. a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang. Taką formę modyfikowania mRNA opisano m. odpowiedzialne za syntezę polipeptydów o różnej długości. Proces ten nazywa się redagowaniem mRNA. modyfikacjom polegającym na zmianie sekwencji nukleotydów. powstałe na bazie tego samego matrycowego DNA. W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. Czynniki transkrypcyjne Czynnikami transkrypcyjnymi nazywane są białka.in. Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. czyli od jego stabilności. który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. Efektem tego może być na przykład pojawianie się w transkryptach. dodatkowego kodonu stop. Wreszcie mRNA powstały podczas transkrypcji może ulegać. przed przejściem do cytoplazmy. 3. leucine zipper).

Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. Pl P2 — promotory genów. Oznaczenia: HP — hormon peptydowy. Schemat regulacji ekspresji genów za pomocą hormonów. HS — hormon steroidowy. 3. Poznanie genów od62 . RS — receptor hormonu steroidowego. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników. insulina itp. Domena wiążąca DNA jest aktywna tylko wówczas. Hormony peptydowe (np. co można uznać za regulację ekspresji genów na etapie potranslacyjnym. lub też z udziałem przekaźników modyfikujących białka w cytoplazmie.7.Ryć. G2 — części strukturalne genów transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu.2. gdy do receptora jest przyłączony hormon steroidowy. Geny homeotyczne Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych. których mechanizm działania jest jeszcze słabo rozpoznany. a z drugiej strony od różnicowania się komórek. R — receptor hormonu peptydowego. hormon wzrostu. T1 T2 — przekaźniki wewnątrzkomórkowe. Gj. Wiązanie takie wywołuje wiele reakcji. a jedynie wiążą się z receptorami błonowymi.) nie wnikają do wnętrza komórki. 3-7.

które odpowiadają za poszczególne etapy morfogenezy. Geny te funkcjonują w układzie hierarchicznym. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną.powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. położonych w jednym chromosomie. których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących 63 . zgrupowane są w czterech kompleksach: HOX1. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji. HOX2. że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się. ANT-C i BX-C. Metylacja DNA Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA. a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. Wynika z tego. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia. Struktura tych genów wykazuje zaskakujące podobieństwo. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. Obok wielu genów. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne. HOX3 i HOX4. Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks.3. tzn. homeoboks). Oznacza to. Prawie cały DNA zawiera zmetylowaną cytozynę. że mają one sekwencję o długości około 180 pz (tzw. a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie.7. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. w liczbie około 30. że około 56% genów zawiera te sekwencje. Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu. Okazało się. Trzeba jednak podkreślić. domena białkowa) o długości 60 aminokwasów. Rozwój muszki owocowej przebiega pod kontrolą genów. U ssaków geny te. ich ekspresja następuje w ściśle określonej kolejności. która koduje fragment białka (tzw. czego skutkiem jest przejście DNA w stan nieaktywny. które w genomie muszki owocowej występują w dwóch kompleksach. 3. że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów.

gametic imprinting). a także w komórkach somatycznych organizmu dorosłego. jak i męski rozwijały się prawidłowo. tzn. były zdecydowanie niedorozwinięte. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji. czyli ze strony końca 5'. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. Jedynie zarodki zawierające zarówno genom żeński. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna. Dowód na to. niedorozwinięty zaś był sam zarodek. od matki. znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. rozwijały się dość dobrze. czy cytozyna jest metylowana. Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. z tym jednak że struktury wywodzące się z trofoblastu. 3-8).w części poprzedzającej gen. tzn. od którego z rodziców pochodzi allel A. jeśli pochodzą od ojca. a od którego allel a. zależną od tego. mające dwa genomy męskie. Powstałe na drodze manipulacji zarodki ginogenetyczne.4. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca. Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego. 3. dobrze rozwijały struktury trofoblastu. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych. czyli nie wpływa na prawidłowość replikacji wysepek CpG. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną. że do rozwoju osobniczego niezbędny jest zarówno genom ojca. W obu przypadkach dochodziło do obumarcia zarodka. jak i genom matki. Zjawisko to niekiedy dotyczy całych regionów chromosomowych. czyli uczestniczące w formowaniu łożyska. Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych. tzn. a nie tylko diploidalna liczba chromosomów. Jeden z nich -— HpaII przecina sekwencję CCGG. czyli nieistotne jest.7. w które zaangażowane są fragmenty podlegające piętnowaniu. gdy pochodzą np. które mogą być nieaktywne. to 64 . dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. a drugi — MspI przecina tę sekwencję niezależnie od tego. genotyp Aa jest równoważny genotypowi aA. czy niemetylowana. w której cytozyny nie są metylowane. znane są liczne geny. Natomiast zarodki androgenetyczne. czy allel pochodzi od ojca. typowy dla danej płci (ryć. lub aktywne. Piętno gametyczne W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze. zawierające dwa genomy żeńskie. czy od matki. wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję.

smali nuclear ribonucleoprotein polypep65 . głębokie upośledzenie umysłowe. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m. ubiquitin protein ligase E3) pochodzenia matczynego. że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej. że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego. Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony. Wynika z tego.in. W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego. a inny w gametogenezie żeńskiej. podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. M — chromosom pochodzący od matki wówczas rozwija się zespół zmian fenotypowych (m. a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska). W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym. a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. Piętnowanie gametyczne.M r ZYGOTA 2ENSKA M P ZYGOT-A MĘSKA Ryć. tylko jeden gen — UBE3A nie podlega ekspresji. który nosi nazwę zespołu Pradera-Willego. że fragment chromosomu 15 podlega piętnowaniu gametycznemu. Wiadomo.in. Tak więc. P — chromosom pochodzący od ojca. jeśli pochodzi od ojca. drgawki) określanych jako zespół Angelmana. otyłość i niedorozwój umysłowy). gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). brak mowy. gen SNRPN — ang.in. Podobna sytuacja powstaje. Przyjmuje się. 3-8. natomiast kilka genów (m.

66 . co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych. które zachodzi podczas wczesnego rozwoju zarodkowego. Przykładem może być gen Igf2 (ang. W komórkach męskich występuje tylko jeden chromosom X. który podlega piętnowaniu podczas gametogenezy żeńskiej. które podlegają piętnowaniu gametycznemu u myszy. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego.5. W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X.7. Sytuacja ta jest spowodowana tym. Inaktywacja chromosomu X w zarodkach żeńskich Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. które podlegają metylacji. Może się jednak zdarzyć. wywołujące zahamowanie transkrypcji. Stan taki określany jest terminem hemizygotyczności. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych.tide N). ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. W efekcie oba allele są transkrybowane. niezbędnych do podjęcia transkrypcji. nie ulega ekspresji. że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca. Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. do którego nie może się przyłączyć białko (represor). W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji. obok chromosomu Y. Na przykład. Okazało się. że inaktywacją chromosomu X jest formą piętnowania. insulin growth factor type 2) u myszy. jeśli są położone w chromosomie pochodzącym od matki. że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. W komórkach żeńskich występują dwa chromosomy X. duże fragmenty chromosomu 7. W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX). czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego. Obecnie znane są 34 geny. W genie tym występują dwa regiony. a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego. a także 11 i 12 podlegają piętnowaniu. które są objęte zjawiskiem piętnowania gametycznego. 3. albo matczynego.

.

albo matczynym. Warto zaznaczyć. W centrum inaktywacji zidentyfikowano locus Xist (ang. W konsekwencji organizm żeński jest swoistą mozaiką. Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R. które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. Wiadomo. albo w chromosomie ojcowskim. a część pochodzenia matczynego (ryć. w której część komórek ma aktywny chromosom pochodzenia ojcowskiego. Później. X inactive specific transcript). że produktem locus Xist jest niekodujący RNA (ncRNA). który pełni główną rolę w uruchomieniu inaktywacji. 3-9). ciałka Barra. że nieaktywny chromosom X jest replikowany w późnym okresie fazy S. który to stan jest utrzymywany w komórkach potomnych. Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym. ekspresja genu Xist pojawia się losowo. W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu. W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). Inaktywacja jest związana z metylacją DNA danego chromosomu. Spełnia on funkcję regulacyjną. Barwienie to pokazuje. że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3.Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. a jego obecność ujawnia się w postaci tzw. . Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X. w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X. Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X.

Do klasy I enzymów 69 . W celu ochrony własnego DNA przed działaniem restryktaz. np. że bakterie wytwarzają dwa rodzaje enzymów. bakterie wykształciły system restrykcji-modyfikacji. Endonukleazy restrykcyjne Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. strawienia) DNA. DNA nie jest odpowiednio oznaczony (zmetylowany). Endonukleazy dzieli się na trzy klasy. niszcząc niepożądane. które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak. Na przykład. metody in situ) bądź w wyizolowanym DNA lub RNA. Ponieważ obcy. enzym HindIII pochodzi z bakterii Haemophilus influenzae. rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów. następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii. obce cząsteczki DNA. nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. niszczony jest przez endonukleazy bakterii. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. druga i trzecia — gatunku. że pierwsza litera stanowi skrót nazwy rodzaju bakterii.Rozdział 4 4. a także kofaktorów. ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii. w zależności od ich mechanizmu działania. Jeden to endonukleazy. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne. co umożliwia np.1. substratów i produktów. Większość metod wymaga fragmentacji (pocięcia. System ten polega na tym. drugi to metylotransferazy (zwane też metylazami). by nie zostały przecięte przez endonukleazy. Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów. Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz. wirusowy. serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. Nazewnictwo endonukleaz tworzone jest w ten sposób.

Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1. że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. Cechą tych enzymów. jony magnezu (Mg2+) i S-adenozylometionina.zaliczane są te restryktazy. a ich działanie zależy od obecności takich kofaktorów. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I. Różnica między tymi dwiema klasami polega na tym. które wykazują aktywność nukleazy. jak ATP. ale wzmacnia ich aktywność). iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów. jest to. utrudniającą ich wykorzystywanie w analizie DNA. czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna. ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. Tabela 4-1 Przykłady enzymów restrykcyjnych 70 .

Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach. mogą być różne. charakteryzujące się dwustronną symetrią (tzw. czego konsekwencją jest powstawanie fragmentów DNA o tzw. Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję: Niektóre enzymy. Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie. Jednak miejsca. mimo że pochodzą z różnych szczepów bakterii. rozpoznają te same sekwencje DNA.Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. w których enzymy przecinają te sekwencje. 4-1). Są to izoschizomery. Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6. rzadziej 8 nukleotydów. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej. dając fragmenty mające tzw. Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum) przecinają rozpoznaną sekwencję w różnych miejscach: . tępe końce. sekwencje palindromowe). lepkich końcach.

w której mieszanina DNA z enzymem jest inkubowana.in. którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji. mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne..5' podobnie enzym FokI (Flavobacterium okeanokoites): 5'.. a tylko nieliczne enzymy (np. Są one podstawowym narzędziem. W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii). 4.3' 3'... plazmidowy.od rozpoznawanej sekwencji. Niektóre enzymy potrzebują takich samych buforów.... drożdżowy) jest zdolny do autonomicznej replikacji. • powinny mieć jeden lub kilka silnych promotorów tak.3' 3'. wykorzystywanym m.. aby wstawiając 72 .. Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora.. do sporządzania map genomowych. oraz składem buforu.5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych. fagowy.. • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców). Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą. Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'. Wektor (np. Wektory Wektory są podstawowym narzędziem klonowania DNA. • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki.. izolacji i identyfikacji genów... HinPI) tną jednoniciowy DNA. do którego fragment ten został uprzednio włączony (rekombinacja molekularna). sekwencjonowania DNA. diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP).GGATG(N)9'. klonowania molekularnego i rekombinacji genów czy fragmentów genomu. Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA..CTTCT(N)7.GAAGA(N)8'..CCTAC(N)13.2. opisane pod względem fizycznym i genetycznym.

Kosmidy Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie. • ze względów etycznych wektor nie powinien mieć genów. plazmidy i kosmidy. • zawierają znaczniki (markery). którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. • nie są zdolne do przeżycia poza komórką gospodarza. umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. Wektory fagowe Spośród wektorów fagowych największe znaczenie ma fag λ. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd. i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych. korę mogą stanowić zagrożenie ekologiczne. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. RODZAJE WEKTORÓW Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi). eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. np. np. za pomocą których można je ziden tyfikować.w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów. Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. gen oporności na antybiotyk. Podobnie jak 73 . który ma długość 2686 par zasad. Wektory plazmidowe Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. gen β-galaktozydazy oznaczony symbolem lacZ. przedstawiony jest na rycinie 4-1. Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych. Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori. rozkładający barwny substrat. długości 10-40 kpz. „polilinker" (miejsce wielokrotnego klonowania). Najczęściej jest to gen kodujący enzym. geny oporności na antybiotyki. Za pomocą modyfikacji molekularnych (np. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. Przykładowy wektor plazmidowy pUC19. Kosmidy służą do klonowania większych cząsteczek DNA.

do wektorów fagowych wprowadzono polilinkery. W przypadku komórek zwierzęcych są to pochodne wirusów SV40. 4-1. Najwcześniej był stosowany wirus SV40.Ryć. komórkach ssaków) stosowane są: Wektory — pochodne wirusów Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych. jak 74 . którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu. adenowirusów i retrowirusów. ale efektywność tego działania jest większa. wadą natomiast organiczona długość wbudowanego obcego DNA. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych. bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. drożdżach. bakulowirusów. coli. krowianki. Są one również stosowane w somatycznej terapii różnych schorzeń. Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz w przypadku wektorów plazmidowych. Do klonowania fragmentów DNA w organizmach eukariotycznych (np. Papilloma. Schemat wektora plazmidowego pUC19. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). Sztuczny chromosom bakteryjny (BAC) Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang. geny markerowe i silne promotory. Wektory drożdżowe Wektory te wykazują zdolność replikacji tak w komórkach drożdży.

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji.przerwa. co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych). która łączy specyficznie dwa przyległe oligonukleotydy. z zastosowaniem biotyny. że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego. Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami). RT-PCR (ang. W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego. a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach. Enzymem używanym do tej reakcji jest termostabilna ligaza. amplifikując badany gen (odcinek DNA). gdy są one zhybrydyzowane z komplementarną matrycą. Odwrotna transkrypcja-PCR. reverse transcription-polymerase chain reaction). Reakcja ta stosowana jest do wykrywania mutacji punktowych. O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje. wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. mutacja punktowa). Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. np. Te dwa etapy są powtarzane. Nie może być natomiast 81 . W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C).

między nićmi DNA:DNA. RFLP lub sekwencjonowania. w których określana jest ilość mRNA. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością. single stranded conformation polymorphism).wykorzystana w badaniach ekspresji genów.5. podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA). które jest oczywiście najbardziej precyzyjne. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to. Konformacja ta zależy od sekwencji nukleotydów. Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. RNA: RNA i RNA: DNA istnieją wiązania wodorowe. Techniki hybrydyzacji i sondy molekularne Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe. które ułatwiają ten 82 . np. Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA. to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany. jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. 4. Jeśli badany DNA pochodzi od nosiciela zmutowanego genu. Polimorfizm konformacji jednoniciowych łańcuchów DNA. iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją. których materiałem genetycznym jest RNA. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod. a następnie jego denaturacji i elektroforezie. Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. które przyjmują określoną konformację przestrzenną. Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. Jak wiadomo. bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. jak również do wykrywania wirusów. W tych przypadkach może być stosowana metoda RT-PCR. SSCP (ang. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA. Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ. polegająca na tym. że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej.

Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. jednak niewielką rozdzielczością. Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. Znakowanie sond. Ogromną zaletą hybrydyzacji jest to. By była możliwa hybrydyzacja sondy z badanym DNA. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. by było możliwe wykrycie powstałej hybrydy. a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP. iż muszą być stosowane wkrótce po ich wyznakowaniu. który jest nicią pojedynczą. Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej. czyli cięższe fragmenty) lub poliakryloamidowym (krótsze. dCTP i UTP a 32P. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. Fragmenty te są następnie zatrzymywane na filtrze. Technika northern blotting. Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy. nie wymaga etapu denaturacji. Sposób znakowania sond można podzielić na dwie główne grupy: 1. który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1. Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy.71 MeV — megawoltów). 83 . takich jak hybrydyzacja Southern blotting (DNA). klonowane sekwencje lub syntetyczne oligomery stosowane w PCR. do 500 par zasad). Izotop ten jest stosowany do znakowania DNA i RNA. Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe. Zjawisko to stało się podstawą metod analizy kwasów nukleinowych. Wadą sond znakowanych izotopem jest również to. który przenikając przez żel zabiera ze sobą fragmenty DNA. gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA. Sonda musi być odpowiednio wyznakowana. czas półtrwania 14. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego).3 dnia. wirusów lub organizmów wyższych). northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P).proces. stosowana w hybrydyzacji kwasu rybonukleinowego. Znakowanie izotopowe charakteryzuje się dużą czułością. że można ją stosować nawet wówczas. lżejsze.

której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych.1 dnia. iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. Hybrydyzację przeprowadza się z reguły w temperaturze 68°C. że różnica ta powinna wynosić 20-25°C. z wyjątkiem obecności sondy. Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). Hybrydyzację z wyizolowanym DNA można przeprowadzać. okres półtrwania 87. Znakowanie sond można przeprowadzać za pomocą kilku różnych metod. w zależności od zastosowanego znacznika.26 roku. w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą. jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg). • tryt (3H). tak powstają pochodne nukleotydów. Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny. a detekcja sygnału jest poprzez autoradiografię (ryć. Hybrydyzacja jest poprzedzona prehybrydyzacją.• izotop siarki (35S). gdy jest on unieruchomiony na filtrze. w której przebiega hybrydyzacja. Przyjmuje się. Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę. Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S. Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach.167 MeV). głównie DNA. digoksygeniny). który emituje promieniowanie β (energia promieniowania E = 0. Podstawowym źródłem trytu jest trytowana tymidyna. stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+. Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C). okres półtrwania 12. 2. Hybrydyzacja na filtrach. używany jest do znakowania kwasów nukleinowych. 4-6). 84 . ale daje mniejszą czułość detekcji. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji.018 MeV). Znakowanie nieizotopowe zapewnia dobrą rozdzielczość. głównie DNA. biotyny. Na wydajność hybrydyzacji wpływają także inne czynniki. emitujący promieniowanie β. Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np. Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego). które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0. Zaletą tej metody jest to.

w diagnostyce chorób). fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. Podobnie jak metoda PCR. Hybrydyzacja w zminiaturyzowanej postaci. W metodzie zwanej „odcisk palca" DNA (ang. również hybrydyzacja może być przeprowadzana na preparatach chromosomowych.in. Metoda ta nosi nazwę hybrydyzacji in situ (ISH). Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. 85 . l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja). określana jako technika mikromacierzy DNA. Metoda hybrydyzacji służy m. Jej różne warianty są opisane w rozdziale: Mapy genomowe. Na niewielkiej płytce (ok.Wykorzystanie metody hybrydyzacji. do wykrywania ściśle określonych fragmentów DNA (np. Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana.

Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu.AGGCTAT 86 .ATCCAGTCCTCGCCTGATTTCGAA. Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP).A-. Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu.4. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego. Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym.. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) Polimorfizm fragmentów restrykcyjnych DNA (ang.ATAGCTT ...6. Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'. Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll): GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA: GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus.TTCGA.. tym szybciej.. Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych.5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości.. czyli lżejsze.3' 3'. Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze.. natomiast dalej będą prążki o zmniejszającej się masie.

Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania. W zależności od wielkości fragmentów DNA używane są różne wektory. metoda rekombinacji molekularnej.7. Tak otrzymany cDNA zawiera tylko sekwencje kodujące. Proces ten jest opisany w części dotyczącej klonowania DNA. natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory. jak kosmidy. których budowa molekularna jest znana. sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). Jest on amplifikowany 87 .Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz. Biblioteki genomowe i genowe Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA. omówiona wcześniej. wśród nich są geny determinujące cechy jakościowe. Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów. quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe. Interseksualizm. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe. czyli eksony. Geny o dużym efekcie. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest. Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii. 4. 11 pz i 7 pz. Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe). Materiałem wyjściowym w tym przypadku jest RNA. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka. Tworzenie biblioteki genowej (cDNA) Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. a także ilościowe (ang. Tworzenie biblioteki genomowej Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym. wprowadzonych za pomocą wektorów do bakterii.

chromosome walking). Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. ddCTP. Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda. 4. nieznany jeszcze fragment. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą). Sangera. przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy. 4-7). ddGTP lub ddTTP (ryć. wykorzystuje się bibliotekę genomową. Biblioteka genomowa jest również przydatna w poszukiwaniu genu. Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej. Każda z czterech probówek zawiera matrycowy DNA. Postępujemy tak do momentu. Sekwencjonowanie DNA Sekwencjonowanie DNA. która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący. Metoda enzymatyczna została opracowana w 1977 roku przez F. o którym niewiele wiadomo.metodą PCR. przeprowadzane są cztery oddzielne reakcje syntezy DNA. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej). czyli reakcji antygen-przeciwciało. polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP. W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen. Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem. jest stosowane dość często w genetyce molekularnej. gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen. starter. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. a następnie rekombinowany z wektorem i wprowadzany do bakterii. mieszaninę deoksynukleotydów. Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. bufor reakcyjny. polegające na określeniu sekwencji nukleotydów. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. Rolą tych dideoksynukleotydów (tzw. W ten sposób każdy klon bakterii ma cały określony gen.8. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań. której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. terminatorów) jest zakończenie syntezy nici 88 .

w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89 . W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera.autoradiogram żelu sekwencyjnego Ryć. Postępy Biologii Komórki. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki.6 mm). by tylko część syntetyzowanych fragmentów DNA uległa terminacji. W celu detekcji prążków DNA. ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany. 1998) komplementarnej w miejscu włączenia określonego dideoksynukleotydu. grubości 0. 25 supl. kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp. 10 :219-237. kończące się odpowiednim nukleozydem. Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm. 4-7. zależnie od użytego w reakcji dideoksynukleotydu. metodą autoradiografii..2-0.

kleotydy lub wyznakowany starter. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. 10 :219-237. opracowana w 1977 roku przez Maxama i Gilberta. podobnie jak przy metodzie enzymatycznej. Metoda chemiczna. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. 4-8. Do mieszaniny reakcyjnej dodawana jest także piperydyna. 25 supl. 1998) 90 . kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp. Enzymatyczna metoda sekwencjonowania ma tę zaletę. w czterech oddzielnych probówkach.. że jest szybka. ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów. Postępy Biologii Komórki. które mają zdolność modyfikacji zasad w cząsteczce DNA. Sekwencjonowanie metodą chemiczną przeprowadza się. polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów. 4-8): autoradiogramżelusekwencyjnego Ryć. która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta. siarczan dimetylu (DMS) i kwas mrówkowy. Do rozszczepiania wykorzystywane są hydrazyna.

Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80. Transgeneza Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. Zwierzęta transgeniczne to takie. które morfologicznie nie różnią się od sąsiednich. Samce transgeniczne przekazywały swojemu potomstwu obcy gen. Najnowsza metoda sekwencjonowania. RT-PCR) i translacji (western blotting). Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA. Badanie ekspresji genów Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek. których długość zależy od miejsca rozszczepienia łańcucha DNA. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego. znacznie różni się od powyższych metod. pyroseąuencing. 4. Następnym etapem. 4. które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika. natomiast samice były niepłodne. do zygoty myszy szczurzego genu hormonu wzrostu. northern blotting. nieaktywnych w komórkach zdrowych. podobnie jak w metodzie enzymatycznej. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji. jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym. pozwala także na wyróżnienie grup komórek. tzw. Podobne 91 . Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA. hybrydyzacja in situ na skrawkach tkanek. kilka firm oferuje specjalistyczną aparaturę. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane. Różnią się one od innych komórek ekspresją pewnych genów. autoradiografia i odczytanie sekwencji nukleotydów. przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny.9. ale są inne pod względem biochemicznym. Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. Jedna z wymienionych metod.W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów. zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba).10.

Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). który może być wprowadzony tą metodą. Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. 92 . ogranicza jej stosowanie. w gruczole mlecznym). Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost. nawet niekorzystne. blastocyst pozbawionych węzła zarodkowe go). Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. że w procesie transgenezy wprowadzane są konstrukty genowe. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne. gen struktury hormonu wzrostu (ang. które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu. Jak dotychczas opisana technika jest stosowana z sukcesem u myszy. Na razie nie mamy żadnego wpływu na to. umożliwiającej ukierunkowaną ekspresję transgenu (np. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich. W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro. w którym miejscu genomu włączy się transgen.rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu. najczęściej męskiego. growth hormone — GH). Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC. zapłodnionej komórki jajowej. Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa. które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego. Wykorzystanie techniki transgenezy 1. które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. około 8 kpz. • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. Wielkość fragmentu DNA. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza. embryonic steam cells). • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. Należy jednak zauważyć. np.

duże nadzieje wiąże się z poprawą jakości białek mleka. poprzez wprowadzenie do genomu owiec genów białek keratynowych.• modyfikacji składu mleka. • modyfikacji cech biochemicznych u zwierząt. Odporność na choroby można uzyskać przez wprowadzenie do komórek 93 . na przykład poprawy jakości i tempa wzrostu wełny. W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie.

W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. iż samice transgeniczne wytwarzają mleko zawierające obce białko. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych. metabolizm węglowodanów i lipidów. kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii. których celem jest ocena jego wpływu na wzrost. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym. wykazujące karłowatość. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek. Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. laktację. krowy wytwarzające mleko z ludzką laktoferyną. których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. ksenotransplantów) dla ludzi. prowadzącej do odrzucenia przeszczepionego narządu. które wykazują nadekspresję określonych genów. Zaletą tej metody jest to. 3. Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych. Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc). świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw. Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny.zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych. . z powodu nadostrej reakcji układu immunologicznego biorcy. Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu. świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię). 2. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. najlepiej dominujące.

Wreszcie mutacje genowe dotyczą zmian w budowie genu. Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji. które były korzystne lub obojętne dla organizmu. jako wynik błędów w przebiegu niektórych procesów komórkowych. a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych. dlatego większość z nich jest niekorzystna dla organizmów. Mutacje mogą powstawać samoistnie. cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych 95 . Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji. związane są z naruszeniem budowy chromosomu.Rozdział Mutacje Mutacje to nagłe i trwałe zmiany w informacji genetycznej. a ponadto. czyli takich. W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu. przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji. nazywane też aberracjami chromosomowymi. które uszkadzają DNA lub strukturę chromosomu (np. obserwowanymi wśród organizmów żywych. a poznanie ich podłoża wymaga zastosowania metod molekularnych. a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi. za pośrednictwem komórek płciowych. Dzieli się je na: genomowe. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy. Należałoby zatem rozróżnić proces przenoszenia mutacji. Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas. promieniowanie jonizujące. Mutacje chromosomowe. powstałych de novo. niektóre związki chemiczne). chromosomowe i genowe. takich jak replikacja DNA czy podział jądra komórkowego. przez następne pokolenia.

Zaburzenie przebiegu mejozy. Na przykład. 5-1): 1. 96 . Mutacje genomowe Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie.1. która odbywa się już po wniknięciu plemnika do oocytu. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista. Dlatego można bez większych zastrzeżeń przyjąć. monoploidia). Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna. prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. wśród których do najważniejszych zalicza się (ryć. że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). Zdarzenia takie określa się mianem połispermii. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów. zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik.pokoleń. że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych. które wpływają korzystnie na cechy produkcyjne zwierząt. a oocyt II rzędu ma diploidalną liczbę chromosomów. 2. Znane są i inne mutacje. a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. to stan ten określa się jako poliploidalność. takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny). ponieważ obok mutacji szkodliwych (np. głównie żeńskiej. mutacja w genie BMPR-IB) itp. pojawiające się od czasu do czasu na fermach zwierząt futerkowych. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. z jakimi spotykamy się w hodowli zwierząt gospodarskich. Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości. 5. Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej. choroby genetyczne) znanych jest wiele przykładów pokazujących. wysoka plenność u niektórych ras owiec (np. W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji. Jeżeli powstają układy o większej liczbie genomów niż dwa. Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego.

Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka. takich na przykład jak brak cytokinezy po podziale jądra komórkowego. tetraploidalne oogonium. np. W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. 5-1. Euploidie są mutacjami letalnymi. np. Mutacje te są jedną z przyczyn niepowodzeń 97 . Ponieważ komórki te wywodzą się z jednej zygoty. Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności.Ryć. gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności. Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym. co oznacza. że prowadzą one do śmierci osobnika. 2n i 4n czy 2n i 3n itd. które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego. układ taki klasyfikowany jest jako mozaicyzm. Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza). 4. to znaczy takiego. zazwyczaj we wczesnym okresie rozwoju zarodkowego. Niektóre mechanizmy powstawania mutacji genomowych typu euploidii 3. czego skutkiem jest rozwój haploidalnego zarodka. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo).

jednak powodują powstanie licznych wad rozwojowych. to stan taki określany jest jako nullisomia (2n —2). Aneuploidia to druga kategoria mutacji genomowych. zarodka) prowadzi do mozaicyzmu. gdy oba chromosomy zmierzają do jednego bieguna komórki. że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. jaka jest skala tego problemu. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. a nadmiar chromosomów to trisomia (2n +1). Jeśli natomiast występuje brak obu chromosomów w parze. Klacz obarczona tą mutacją ma kariotyp 98 . Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. Trudno jednak określić. 5-2a). że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych. Wskazuje to. a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika. w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). Równocześnie wynika z tego.w rozrodzie zwierząt. Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela. Zazwyczaj mutacje te stwierdzano w układzie mozaikowym. Jeżeli gamety takie będą uczestniczyły w zapłodnieniu. to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). Nieprawidłowa segregacja w jednym biwalencie. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci. Zdecydowana większość aneuploidii jest letalna. Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki. że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. Wyjątek stanowią aneuploidie chromosomów płci. Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). Tak więc brak chromosomu nazywa się monosomią (2n — 1). która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów. prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1.

99 . dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego. Znane są również przypadki trisomii XXY u buhajów.XO/64.XXY lub występuje u nich układ mozaikowy 60.2n = 63.XX.X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63. Zwierzęta takie mają zasadniczo normalny eksterier. Osobniki takie mają diploidalną liczbę chromosomów 61.XXY.XY/61. W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy. zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników.

to zazwyczaj mają pochodzenie de novo. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni. nie ma ryzyka przeniesienia tej mutacji na następne pokolenia. Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna. Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć. Przedstawione wyżej prawidłowości wskazują. Jest to skutek segregacji chromosomów w anafazie I. ze względu na dość częste występowanie u klaczy monosomii chromosomu X. poza nielicznymi wyjątkami. a zatem i szerokiego rozprzestrzenienia w populacji. gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela. 5. wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych. Mutacje chromosomowe Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). podczas podziału komórkowego. Niemniej jednak. bez zastosowania metod cytogenetycznych. Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd 100 . W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza. tandem fuzja. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika. Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. że aneuploidie ilekroć się pojawiają. jest niemożliwe. że osobniki mające w swoim kariotypie trzy chromosomy X są płodne.2. z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder. w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. albo głębokie zaburzenia rozwojowe lub bezpłodność. 5-2b). takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. Mogą powstać także inne nietypowe struktury. Jeżeli pęknięcie nie zostanie naprawione. Dzięki temu. niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy.Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością. to nastąpi utrata fragmentu chromosomu (delecja). W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. przez odpowiedzialne za to systemy naprawy komórkowej. której zdiagnozowanie. a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu. Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu. Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią. translokacja wzajemna).

U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. podobnie jak aneuploidie. izochromosomy). lub też w układzie niezrównoważonym. gdy ilość informacji genetycznej w komórce została zmieniona. a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów. że mutacje chromosomowe niezrównoważone. Wynika to przede wszystkim z tego. Szczególna 101 . ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych. że zdecydowana większość tych przypadków nie jest identyfikowana. zauważalnych zmian fenotypowych. Inne — tzn. Mutacje chromosomowe. Przypadki takie. są letalne lub prowadzą do poważnych. translokacje wzajemne i inwersje. a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. translokacje wzajemne. inaczej centromerowe (translokacje robertsonowskie). buhaje). padnięcie po urodzeniu lub ubój z konieczności. że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć. prowadzą do zmiany sąsiedztwa genów. jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej. fuzje centryczne.niesiostrzanych podczas crossing over. jak i ze strukturą samego genu. Jeżeli dotknie to osobnika o dużej wartości genetycznej. to szansa na wykrycie nosicielstwa mutacji jest znacznie większa. Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje. wśród których wyróżniane są inwersje peri. bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np. Z kolei mutacje zrównoważone. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. mają najczęściej negatywny wpływ na płodność nosiciela mutacji. inwersje. których skutkiem jest przegrupowanie informacji genetycznej w kariotypie. czego skutkiem jest uruchomienie procesu nowotworowego. wyciszacz). prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. które w momencie powstania mają charakter zrównoważony. Mutacja chromosomowa może wystąpić w układzie zrównoważonym. występując pierwotnie w układzie zrównoważonym. gdy występuje ona w komórkach linii płciowej. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor. Zdarzyć się może. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych. tandem fuzje. nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych. Znane są liczne przykłady u ludzi. duplikacje. Zaliczane są do nich: fuzje centryczne. odnotowywane jako martwe urodzenie. fuzje tandemowe. wzmacniacz.i paracentryczne.

a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć. 5-3a.uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji. 102 . gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru. Fuzja centryczna (translokacja robertsonowska) powstaje wówczas.

triwalent oraz biwalent X-Y są wskazane 103 . chromosom translokacyjny oraz chromosomy pici są wskazane. Duże fragmenty. Utrata małych fragmentów z okolicy centromeru.5-4a).7).29). Translokacje robertsonowskie: (a) rob(l. kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym. 5-4. natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy). reprezentujące prawie cale ramiona długie chromosomów. Ryć. (b) rob(5. nie odbija się negatywnie na nosicielu. barwienie roztworem Giemsy. buhaj. zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom. który zawiera przede wszystkim niekodujące sekwencje powtarzalne. kozioł.

to w pachytenie profazy I uformuje się triwalent. Jeżeli komórka taka rozpocznie podział mejotyczny. natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom. to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. co w rzeczywistości odpowiada układowi n + 1. 104 . Należy zaznaczyć. a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych. do którego nie przeszedł chromosom dwuramienny). Zupełnie inaczej przedstawia się sytuacja. Fuzje centryczne są często identyfikowane u bydła.Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden. że jej nosiciele mają zmniejszoną płodność o około 5%. w których uczestniczyły chromosomy z różnych par. blonde d'Aquitaine itp. szczególnie ras mięsnych. Pięć lat później ten sam badacz wykazał. a druga będzie miała n chromosomów. W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji. W efekcie powstają gamety o zrównoważonej informacji genetycznej. W przypadku zapłodnienia powstają zygoty aneuploidalne. czyli ukształtuje się układ aneuploidalny. które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego. gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. podczas której chromosom dwuramienny przechodzi do jednego bieguna. 5-3b. Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard. podczas gdy na drugim biegunie zabraknie jednego chromosomu. Jeżeli fuzji uległy chromosomy homologiczne. W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent. że połowa gamet będzie typu n —l (układ powstający na biegunie. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła. ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. na wszystkich kontynentach. Opisano wiele różnych fuzji. z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych. że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób. Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. 5-4a). Prowadzi to oczywiście do tego.). mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. jak poprzez badanie cytogenetyczne. w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. 5-4b). a w tym również w Polsce. W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety. a oba chromosomy akrocentryczne do drugiego bieguna komórki. z tym jednak że wśród nich będzie chromosom dwuramienny. Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych.

którą opisano w Polsce. Gatunkiem. Chromosomy biorące udział w fuzji przedstawiono schematycznie 105 . u którego fuzja centryczna występuje bardzo często. Oprócz fuzji 1. który wprowadził taką regulację.29 zdiagnozowano wiele innych przypadków. bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona. Szwecja była pierwszym krajem. dwóch par akrocentryków. Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. obowiązkowymi badaniami objęte są wszystkie młode buhaje. jedynych w kariotypie lisa. nr 23 i 24). natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48. Ciekawe. Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. W Polsce. że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49. jest lis polarny. włoskie bydło rasy podolian czy bydło korsykańskie).a niekiedy także w małych izolowanych rasach lokalnych (np. przed ich wprowadzeniem do stacji produkcji nasienia. począwszy od 1989 roku. Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. białe bydło rrytyjskie. Przykładem może być fuzja między chromosomami z pary 5 i 22. a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. Ryć. 5-5. w których zaangażowane były chromosomy z innych par. W tym przypadku można wręcz mówić o polimorfizmie kariotypowym.

Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych. tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych. to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60. które podlegały translokacji. jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji. 5-6a. a do drugiego przechodzą chromosomy. lisy polarne. który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2. Skutek takiej translokacji będzie zazwyczaj letalny. także translokacją wzajemna jest mutacją dziedziczną. a nie częstego powstawania de novo. a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia. określane jako sąsiednie. że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło. że około 50% gamet wytwarzanych przez 106 . Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. Segregacja symetryczna (2:2) nie gwarantuje jeszcze. Przyjmuje się. to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. które uczestniczyły w trans lokacji. jeśli oczywiście wystąpi w linii komórek płciowych. że powstaną gamety o zrównoważonej informacji genetycznej. Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć.Należy podkreślić. tzn. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. jest taka sama jak w dwóch nie zmienionych chromosomach. prowadzą do uformowania niezrównoważonej (delecje. duplikacje) ilości informacji genetycznej w gametach. szczególnie wówczas. 0 2n = 58 (ryć. Dwa pozostałe rodzaje segregacji. 5-6b. które będą obarczone bądź delecją. to podczas mejozy dojdzie do powstania gamet. Przedstawione obserwacje wskazują. Pokazuje to jedno cześnie. że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela. Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej. Podobnie jak w przypadku fuzji centrycznej. W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par. gdy rozród jest oparty na sztucznej inseminacji. 5-5). Jest to segregacja naprzeciwległa. Należy zaznaczyć. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over. że suma informacji genetycznej zawarta w dwóch chromosomach. 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję. 5-8). 5-7). jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. bądź duplikacją. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów. Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. pochodzących z dwóch różnych chromosomów.

5-6. to doprowadzą do powstania zygot. które będą ginęły zazwyczaj w życiu płodowym. Translokacja wzajemna: (a) schemat powstawania. w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany Ryć. (b) segregacja tetrawalentu podczas mejozy nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu.*Schemat nie uwzględnia segregacji tetrawalentu. Hodowca odnotuje 107 .

.

Oczywiście stan taki może być spowodowany różnymi czynnikami. Przypuszcza się. która prowadzi do bezpłodności samców nosicieli. podobnie jak w przypadku translokacji typu autosom-autosom.wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika. Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. w którym polowa będzie miała prawidłowy kariotyp. a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione. Trzeba podkreślić. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie.lub dwuramiennym. Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych. a połowa będzie nosicielami translokacji. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu. w rozmaitych rasach. Knury nosiciele mają prawidłowe libido. a obraz nasienia (koncentracja. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo. a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego. U samic nosicielek stwierdza się jedynie zmniejszenie płodności. ponad 90 różnych translokacji wzajemnych. Fuzja tandemowa jest mutacją podobną do fuzji centrycznej. Jedno z nich występuje w części końcowej ramienia w chromosomie jedno. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. w którym wystąpią dwa translokowane chromosomy. W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim. ale wśród nich połowa będzie miała układ. Do tej pory zidentyfikowano na świecie. które były rozprzestrzenione w populacjach w różnym stopniu. Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). podobnie jak w przypadku fuzji centrycznej. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. Stan taki towarzyszy nosicielstwu translokacji wzajemnej. w którą zaangażowany jest chromosom X (translokacja typu X-autosom). Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej. Podobnie normalny fenotyp mają lochy nosicielki. że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. 5-7). Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109 . że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy. po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie).

a następnie zostały one niewłaściwie naprawione w taki sposób.chromosomami akrocentrycznymi. Inwersje dość rzadko opisywano u zwierząt gospodarskich. w obrębie fragmentu objętego inwersją na jednym z chromosomów. to nieprawidłowość jest określana jako inwersja paracentryczna. tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym. Jeżeli w obrębie odwróconego fragmentu występuje centromer. podczas którego dochodzi do uformowania pętli inwersyjnej. Jeżeli w obrębie pętli zajdzie crossing over. że fragment pomiędzy punktami pęknięć został odwrócony o 180°. w którym wystąpiły dwa pęknięcia. Oceniano wówczas. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. oraz 3) pełna koniugacja. Przebieg koniugacji podczas pachytenu profazy I. to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji. podobnie jak przy fuzji centrycznej. że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%. z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). tzn. to wówczas powstaną gamety obarczone delecją lub duplikacją. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. dojdzie do powstania aneuploidalnych gamet. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu. analogicznie do schematu przedstawionego dla translokacji robertsonowskich. Uwaga ta dotyczy 110 . Jeżeli odwrócony fragment nie obejmuje centromeru. spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie. było dość duże. Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu. jest pierwszy sposób koniugowania. to wówczas inwersja jest określana jako pericentryczna. która częściowo jest niehomologiczna. z punktu widzenia skutków gametogenezy. gdzie na jednym z chromosomów występuje odwrócony fragment. która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii. może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków. z wyjątkiem sytuacji. to podczas mejozy. może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną. gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej. Znane są nieliczne przypadki tej mutacji u bydła. chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70. Najmniej korzystny. Mutacja ta jest dziedziczona przez połowę potomków nosiciela. 2) chromosomy częściowo pozostają nieskoniugowane — w części.

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

obróbce mRNA. Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. Z kolei. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). Z kolei. prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA). Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka. w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony). tym wcześniej rejestrowany jest początek objawów chorobowych. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę. U ludzi zdrowych liczba powtórzeń wynosi 10-36. Skutkiem tego będzie pojawienie się pary G-C w miejscu. zespół kruchego chromosomu X. Błąd replikacji zachodzi wówczas. nazwanej dojrzewaniem. guanina w normalnej formie (ketonowej) łączy się z cytozyną. między innymi chorobę Huntingtona. czyli tzw. Mutacje te związane są z tzw. W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). natomiast w formie enolowej łączy się trzema mostkami z cytozyną. Inną 117 . gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. z których 10 powoduje choroby genetyczne. Błąd włączania polega na tym. a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. a w formie tautomerycznej z tyminą. należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym. w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. że enołowa forma tyminy łączy się z guanina. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi. Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne. zlokalizowanego w chromosomie 4. Im większy stopień zwielokrotnienia danej sekwencji. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. niestabilnymi sekwencjami DNA. Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej. odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form. Mutacje genowe mogą być także następstwem zakłóceń w splicingu.i protonów w cząsteczce zasady. dystrofię miotoniczną. iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. zaś ketonowej na enolową (=C—OH). gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina. Dotychczas wykryto je u ludzi w 12 loci. Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH).

dlatego nazywane są cichymi podstawieniami (ang. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np. identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. gdyż kodon AAC również koduje asparaginę. Skutki mutacji genowych Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. Natomiast jeśli ojciec przekazuje zmutowany allel.2. Jednym ze skutków mutacji genowych. substitution at silent site). Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji: 118 .cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw. Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi. gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów. iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA. Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu. polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie. iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. różnica w długości sekwencji może dochodzić do 50%. restriction fragment length polymorphism). Przypuszcza się. Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony. 5. trypletów). piętno gametyczne. Jeśli allel zmutowany pochodzi od matki. Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu. mającym szczególne znaczenie dla molekularnej analizy DNA. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym. Są one wykorzystywane w analizie polimorfizmu DNA. Należy podkreślić. ani kodowanego przez ten gen białka. Taka sytuacja jest możliwa. Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym. różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4.4. jak i intronu. jest polimorfizm fragmentów restrykcyjnych — RFLP (ang.

Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. odnoszącym się do polimorficznych białek. 2. Na przykład.. bovine leukocyte adhesion deficiency). Jak już wcześniej wspomniano.1. której następstwem jest śmierć przed ukończeniem 1. w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi. Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła 119 .na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) - Ryć. jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę. w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy. nasienia i jaj zawiera rozdział: Markery genetyczne. która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. mutacje genowe nie zawsze mają niekorzystny skutek. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka. jest locus β-laktoglobuliny (białko mleka). Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. skutki tego mogą być dla organizmu letalne. 5-10. roku życia osobników homozygotycznych pod względem zmutowanego genu. Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G. Innym przykładem mutacji typu zmiany sensu. przejawiająca się zmniejszeniem odporności cieląt. oraz T→C (zapis dla DNA. Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła. Mutacje typu nonsens (mutacja stop) . warunkujący czarne umaszczenie. Mutacja ta jest przedstawiona na rycinie 5-10. mleka. Mutacje typu zmiany sensu .

amber (UAG). Bydło holsztyńskie ma umaszczenie z reguły czarno-białe. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej. kodujący u zwierząt homozygotycznych ee umaszczenie czerwone. We wspomnianym już locus E u bydła allel recesywny e. Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. 3. W jej konsekwencji. ochrę (UAA) lub opal (UGA). Jest ono przyczyną zamierania zarodków. a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy. powstaje nieaktywny peptyd złożony z 85 aminokwasów. ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna . Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. Podobnie jak mutacje typu zmiany sensu. w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu. Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu. Począwszy od kodonu 104 (GGT) dla glicyny. Cytrulinemia występuje również u ludzi. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. natomiast allel dominujący ma takie miejsce. lecz stanowią sygnał zakończenia translacji. czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka. a w konsekwencji zmniejszenia płodności krów. deficiency uridine monophosphate synthase). następnie roz120 .cytrulinemia. występuje u bydła. zamiast aktywnego enzymu składającego się z 412 aminokwasów. iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl. przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen. Schemat tej mutacji przedstawiono na rycinie 5-10. również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu. powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady. występująca u bydła rasy holsztyńsko-fryzyjskiej. powstaje krótszy N-końcowy fragment tego polipeptydu. Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem. Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia. w procesie translacji przyłączane są inne aminokwasy. wykorzystujący to. Jest to schorzenie nazwane DUMPS (ang. które nie kodują aminokwasów.

zamianę fazy odczytu. a nawet śmiertelnych chorób genetycznych. jeśli trójka nukleotydów zostanie wstawiona między kodony. Mutacja ta prowadzi 121 . Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. prowadzącej do przedwczesnej śmierci. Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego. cystic fibrosis transmembrane conductance regulator). 4. Mutacje te mogą prowadzić do poważnych zaburzeń. 5-11). polegająca na zakłóceniu transportu jonów chlorkowych. wynosi l: 2500 osób.dzielany elektrofor etycznie. W obrębie tego genu wykryto wiele mutacji. zwanego CFTR (ang. dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym. jeśli trójka „rozerwie" istniejący dotychczas kodon. oznaczona symbolem ΔF508 (ryć. a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów). Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego. Częstość występowania tej wady. utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". płuc i oskrzeli. Insercja trójki może spowodować: dodanie aminokwasu – w białku. możliwe jest także pojawienie się kodonu „stop". Dotyczy to przede wszystkim trzustki. pełniącego funkcję kanału chlorkowego. przy czym najczęściej jest stwierdzana mutacja w eksonie 10.

Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej. Mutacje zachodzące podczas obróbki potranskrypcyjnej. na przykład białko determinowane przez locus Albino (C). W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów. a także umaszczenie zwierząt i inne. W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka. powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny. blok metaboliczny). Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. 5-13). Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika. łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny). 5-12 wkładka kolorowa). Gen C warunkuje wytwarzanie enzymu tyrozynazy. zwanej składaniem (ang. jaka jest zakodowana w sekwencji (CAG)n. w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. czego konsekwencją jest synteza zmienionego białka. Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA. oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). powoduje powstanie domeny glutaminowej. natomiast w allelu F .3 eksony kodujące 37 aminokwasów. Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. i glicyna — 509 póz. kodującej aminokwas glutaminę. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe. o czym pisano już wcześniej. przekształcającego fenyloalaninę w tyrozynę. skrócenie kręgosłupa u bydła i psów. ale może być również rozpoznawalny w okresie późniejszym. Zwielokrotnienie powtarzającej się sekwencji CAG. 122 . Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. 5. najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. na przykład wielopalczastość. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA. a następnie sekwencja GGT dla glicyny. Częstość tych mutacji wynosi 10-40%. Często są to zaburzenia przebiegu szlaku metabolicznego (tzw.do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego. złożonej z takiej liczby glutamin.

3. C. Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę). przekształ cającego 3. biorącego udział w przemianie tego kwasu w kwas homogentyzynowy. białe włosy. czyli bielactwo . E.niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego. tęczówka oka nie jest zabarwiona. powodując jego ciemnienie na powietrzu. 123 . a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie. Albinizm. cukrów czy lipidów. nie powodujący wyraźnie złych skutków dla organizmu. growth hormone — GH). Mutacje genowe wpływające na cechy produkcyjne zwierząt Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. brwi i rzęsy.4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę. Albinizm występuje także u zwierząt.4. Tyrozynoza -. Alkaptonuria -.brak oksydazy kwasu homogentyzynowego. którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich. osobniki albinotyczne mają bardzo jasną skórę.B. kwas homogen tyzynowy jest odkładany w stawach. jest gen hormonu wzrostu — somatotropiny (ang. Jednym z genów.. prze kształcającego ten kwas w kwas maleiloacetooctowy. powodujący różny stopień nasilenia niedorozwoju umysłowego. np. Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków. D. a jego nadmiar jest wydalany z moczem.brak enzymu tyrozynazy. chrząstkach i skórze wywołując stany zapalne. 5.

15 prosięcia u świń bardzo plennej rasy meishan i 0. O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0. U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA. Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie). semiletalne i subwitalne Wpływ szkodliwego działania zmutowanych genów jest różny. U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową.4. że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych.Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. Stąd poznanie podłoża wielu chorób genetycznych. gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji. Mutacje genowe wywołujące choroby genetyczne Mutacje genowe często prowadzą do powstania chorób genetycznych. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych. U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang. Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią. wykryty u owiec rasy romney. psychicznych itp. 5. które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu. 5.4. Zależnie od stopnia penetracji tych genów można je podzielić na: 124 . Geny letalne. Należy jednak pamiętać.4. odpornościowych. metabolicznych. sprawia dużo trudności. największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. kwaśne mięso (RN). wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. a szczególnie wrodzonych wad rozwojowych.42 prosięcia u wielkiej białej. Spośród wykrytych dotychczas mutacji. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw. np.1. Inne mutacje to: gen FecJ u owiec jawajskich.6 jagnięcia. Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1. estrogen receptor gene — ESR) a wielkością miotu.4. endokrynologicznych. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2).

który jest letalny w podwójnej dawce. uzyskamy wówczas lisy zdolne do życia. Niektóre z nich. nie ograniczając na ogół przeżywalności czy sprawności życiowej. powodując śmierć nie tylko homo-. w okresie pourodzeniowym lub u dorosłych osobników. białopyskie.• geny letalne. warunkującego srebrzystą barwę włosa. powodujące w aktywnej dawce śmierć od 50 do 90% osobników. może być różny. jest gen W. będącym również wynikiem mutacji genu ω. inne zaś później. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego. Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry. powodują śmierć osobnika. ale dają zauważalny efekt fenotypowy. Również okres w życiu osobnika. również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. U kur gen achondroplazji (Cp) w układzie hetero- 125 . homozygota recesywna). WW) działają letalnie. które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w. Oba zmutowane geny w układzie homozygotycznym (WpWp. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia. powodujące śmierć ponad 90% osobników. w których genotypach wystąpią w dawce aktywnej (np. Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego. 5-14 wkładka kolorowa). w stosunku l platynowy: l srebrzysty (ryć. w którym dany gen przejawia działanie letalne. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym. • geny subwitalne. gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. z nie wyjaśnionych dotąd przyczyn. w którego genotypie wystąpią. natomiast u osobników heterozygotycznych nie są letalne. • geny semiletalne. ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. Innym genem. Przykładem jest gen platynowego ubarwienia u lisów. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce. w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). powodujących poważne zakłócenia procesu trawienia. Geny te działają letalnie w układzie homozygotycznym. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. warunkujący umaszczenie tzw. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych.

natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń. co obrazuje schemat: jedynie samice. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. Geny semiletalne często jest trudno odróżnić od genów letalnych. Zmienność tej cechy u krów jest duża. U samców gen ten jest letalny. jak achondroplazja recesywna. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31. Niektóre geny letalne mogą także powodować śmierć matki. bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami. 126 . U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne. Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych. gdyż ich działanie zależy między innymi od czynników środowiskowych. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się W przypadku gdy matka jest heterozygotą. Cecha ta występuje tylko u samic.zygotycznym (Cpcp) warunkuje krótkonożność. Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie. iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców. od niewielkich zmian (np. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt. nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. natomiast u homozygotycznych — bardzo wyraźne. Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec. jak też od interakcji ze środowiskiem. w potomstwie występuje stosunek samców do samic l: 2. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji. warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. Zakres działania tych genów jest różny. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują.

5. następny podrozdział dotyczy wad wrodzonych. Choroby monogenowe wywołujące wrodzone wady rozwojowe Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała. Niektóre z tych genów są przyczyną zaburzeń metabolicznych. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne. Teratologia. obarczone nimi zwierzęta nazywane są potworkami. noszą nazwę fenokopii. powstające w okresie płodowym.4. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego. Można to uczynić biorąc pod uwagę: 127 . wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała. sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich. inne ujawniają się w późniejszym okresie życia (np. Zdarza się jednak. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne. Wady takie. mimo że są pochodzenia pozagenetycznego. a powstałe pod wpływem czynników środowiskowych. 2) wady — są to pewne zaburzenia w prawidłowej budowie. przypominające mutanty. a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe.4. bloki metaboliczne. że niektóre anomalie.2. chromosomowych lub genomowych. wady te nie dziedziczą się.Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych. do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika. 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód. ich rodzajów. powodując tzw. Przykład takiego bloku podano już wcześniej. Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu. Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi. nauka zajmująca się zaburzeniami rozwojowymi. 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia. powodując niepłodność czy utrudniając akt kopulacji. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych. epilepsja u bydła).

Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. 128 . skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy. Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. Jest to prosta cecha recesywna. czyli zahamowanie rozwoju układu kostnego. U japońskiego bydła mięsnego. U bydła wada ta występuje u ras mięsnych (np. stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej. homozygotyczne pod względem genu niezupełnie dominującego. japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN). Mutacja ta powoduje powstanie kodonu terminacyjnego. cechująca się skróceniem kończyn. creeper — pełzacz). Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy. przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. ulegają poronieniu zwykle przed ósmym miesiącem (ryć. 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka. Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii. Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. charakteryzującego się wybitną wartością hodowlaną. u herefordów). W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację. polegającą na insercji 4 nukleotydów w genie.1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH Wady układu kostnego Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja. wpływa pośrednio na zwięzłość budowy. Badania genetyczne wykazały. Gen karłowatości u osobnika heterozygotycznego. dała początek nowej rasie bydła — dexter). że płody dotknięte tą wadą. powodując tylko nieznaczne skrócenie kończyn. Nosicielstwo allelu achondroplazji. chondrodysplastic dwarfism). jak i dalszych. 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich. skrócenie lub brak żuchwy. kodowany przez ten gen. którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany). Do mutacji wpływających na cały kościec należy karłowatość. bulldog disease). 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika. oznaczonego symbolem bd (ang. u którego występuje recesywna karłowatość chondrodysplastyczna (ang. 5-15 wkładka kolorowa).

amputacji kończyn. świń. której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. Wadzie tej często towarzyszą: skrócenie żuchwy. które występuje u większości ras bydła. W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn. stwierdza się osłabione zdolności rozrodcze. a nawet niepłodność. jest autosomalna recesywna cecha skrócenie kręgosłupa. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. która zależnie od gatunku. Wada ta.Zaburzeniem. deformację grzbietu. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego. któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. obserwowana głównie u bydła.FGFR3). żeber i mostka oraz części pyskowej (garbaty nos). a także u owiec. spider syndrome). cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka. Anomalia ta uwarunkowana jest genem recesywnym. brakowi gałek ocznych 129 . 5-16 wkładka kolorowa). Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. Jest ona wynikiem mutacji (transwersja adeniny na tyminę. polega na niezrośnięciu się kości czaszki. a u tych. Szczenięta obarczone tą wadą cechuje mniejsza żywotność. fibroblast growth factor receptor 3 -. Możliwe więc. że jest to cecha letalna dla jednej płci. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego. U owiec niektórych ras mięsnych (suffolk. rozdwojenie podniebienia i brak większości zębów. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. Ogólne zesztywnienie stawów notowane jest u bydła. Jest ona letalna u bydła i indyków. bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie. Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. U jagniąt. Natomiast samce prawdopodobnie nie osiągają dojrzałości. rozmnażają się one prawidłowo. Może ona natomiast towarzyszyć: wodogłowiu. pęcinowego lub kolanowego. U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi". a nawet płci wykazuje różny stopień letalności. przepuklinie mózgowej. świń i owiec. a nawet ludzi jest tzw. Anomalią układu kostnego. amputacja kończyn (akroteriaza) (ryć. hampshire) w Stanach Zjednoczonych w latach 80. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość. które przeżyły. Genetycznym podłożem tej wady jest autosomalny gen recesywny. central vertebral malformation). U psów skrócenie kręgosłupa nie jest letalne dla suk. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw.

Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. psy tureckie. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu. jak włosy i pióra. Nienormalność ta jest prostą cechą recesywna. perskie lub meksykańskie) są heterozygotami. u bydła ayrshire. Wyniki badań wskazują. królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. Inną wadą dziedziczną układu powłokowego jest brak owłosienia. że osobniki homozygotyczne rodzą się martwe. Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. że wszystkie bezwłose psy (tzw. naked). U psów brak owłosienia uwarunkowany jest genem dominującym. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu. u bydła rasy Jersey. a to z kolei może spowodować śmierć w pierwszych tygodniach życia. Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. U drobiu wadą układu powłokowego jest nagość. w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. skrócenie szczęki. Płytki te są porozdzielane rowkami. natomiast najłagodniejszą. U bydła. Cielęta dotknięte tą wadą w warunkach naturalnych giną. ale i takich jej wytworów. niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. uwarunkowana recesywnym genem sprzężonym z płcią. chińskie. oznaczonym symbolem n (ang. W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. Na podstawie szczegółowych badań można sądzić. które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle. Wady układu powłokowego Wady układu powłokowego odnoszą się nie tylko do skóry. jak wodogłowie. duck). prowadzącą do śmierci płodów lub noworodków. 130 .lub zesztywnieniu stawów. która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka. Ptaki. Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. U owiec obserwowana jest również cecha recesywna — brak żuchwy. że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. w których rosną włosy. gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości. Anomalia ta polega na skróceniu dolnej części dzioba. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi. Schorzenie to przybiera najostrzejszą formę. Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła.

natomiast heterozygoty mają piękny czub. U bydła nienormalność ta dotyczy jelita biodrowego. usztywnieniem nóg oraz drżeniem ciała. Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. u koni natomiast okrężnicy. Prostą autosomalna cechą występującą u bydła. Niedrożność jelit zaś. to prosta autosomalna cecha recesywną występująca zarówno u bydła. U drobiu występuje również recesywne. Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. sprzężone z płcią zaburzenie zwane paroksyzmem.Wady układu pokarmowego Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. warun131 . Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja. przy czym u kur gen ten nie jest letalny (np. Brak odbytu jest recesywną cechą letalną. U indyków i kur notowane jest wrodzone zaburzenie równowagi. crest). wpływa bowiem na umaszczenie. natomiast u królików — recesywnym. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem. Wady układu nerwowego Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. Większość z tych kurcząt ginie przed 15 tygodniem życia. Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. Obie nienormalności warunkowane są genem recesywnym. ale nie mogą stać. podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną. nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe. rasy houdan i polskie czubatki). świń i drobiu jest wodogłowie wewnętrzne. Zwierzęta dotknięte tą wadą rodzą się żywe. Atak taki trwa około 10 sekund. jak i u koni. u których jest prostą cechą recesywną. Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. determinowana u bydła genem dominującym. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy. powodując jego rozjaśnienie. U świń gen warunkujący tę wadę wykazuje działanie plejotropowe. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych. Niedorozwój móżdżku najlepiej został poznany u bydła i owiec. następnie upadkiem. wykazują powiększenie czaszki.

jak na przykład brak lub niedobór pewnych enzymów czy hormonów. czyli szczytowej części główki. ale także u knurów.kowane recesywnym genem letalnym lo (ang. świń i owiec. powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu. jajników. knurl). jest paraliż i przykurcz mięśni kończyn i szyi. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. ogierów i samców innych ssaków jest wnętrostwo. Wady układu rozrodczego Dość często występujące. dlatego nazwano je „gałkowatymi".3. 5. ale nie mogą jeść. Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem. Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu. pić i giną w ciągu kilku dni. czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny. takie jak: niedorozwój (hipoplazja) jąder. autosomalna cecha recesywna. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. jest trudne do identyfikacji. iż objawy pojawiają się u zwierząt w różnym wieku. której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych. loco). Jest to prosta. Obustronne wnętry są niepłodne również po takim zabiegu. Niepłodność obserwowana jest także u buhajów. niedrożność jajowodów czy wnętrostwo. macicy. występujący u bydła. Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów. a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego. Zaburzeniem układu nerwowego. 132 .4. Pisklęta obarczone tą wadą kłują się dobrze. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy. szczególnie u buhajów. Trudność tę powiększa to. Anomalią o dużej częstości występowania. Nienormalność tę można usunąć zabiegiem chirurgicznym. Podłoże genetyczne zaburzeń natury biochemicznej. związanym z niedorozwojem przodomózgowia. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm.4. nasieniowodów. Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang.

których podłoże genetyczne jest dobrze poznane. Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. lecz jest ono jednak innej natury niż porfiria u bydła. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła. ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. Należą do nich przypadki wielokończynowości. zroślaki (zrośnięte dwa płody). Uczulenie na promienie słoneczne występuje również u owiec. Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa).Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. 133 . U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. wytwarzany w nadmiernych ilościach i odkładany we krwi. mająca łagodniejszy przebieg. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne. a w skrajnych przypadkach — wrzodów. U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna. Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu. niezbędnego do wytwarzania tromboplastyny osocza. Fenotypowym obrazem tej wady jest egzema na pysku i uszach. istnieje wiele anomalii. składnika hemoglobiny. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. Genetycznym podłożem tej wady u bydła jest gen recesywny. a dotycząca czynnika IX (czynnik Christmas). Schorzeniem notowanym u ludzi i psów. reagują powstawaniem pęcherzy na skórze. zębach i innych częściach ciała. i hemofilia B. a także owiec. który przyspiesza przemianę protrombiny w trombinę. Oprócz ogromnej liczby wrodzonych wad dziedzicznych. wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej. które są niewątpliwie dziedziczne. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia. wywoływana działaniem genu recesywnego sprzężonego z płcią. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych. która jest produktem rozkładu chlorofilu. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II. kościach. powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów.

134 .

5. ale w swoim genotypie 135 . są zauważalne i łatwe do eliminacji.4.4. Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń. kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana. Ograniczanie występowania chorób genetycznych Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach. który jest fenotypowo normalny. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania. częstość jest niewielka. Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych. Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli). W Polsce.4. Terminem nosiciel określamy osobnika. niestety. które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji). ale jedynie te.

buhaje). Schemat takiego kojarzenia jest następujący: Jeżeli testowany osobnik jest nosicielem allelu recesywnego. gdy homozygoty recesywne wykazujące wadę żyją i są płodne. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności. wśród których można się spodziewać obecności nosicielek recesywnego allelu. skojarzonego z normalnymi kurami. a połowa nosicielami niepożądanego genu. u ptaków samce). Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic. Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. Testowanie takie jest możliwe jedynie wtedy. 136 . 2. to około 50% jego potomków będzie homozygotami recesywnymi. fenotypowo ujawniają swą obecność wówczas. Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników. jak już wspomniano. Natomiast wśród jego córek połowa będzie normalnych. jednakże połowa z nich będzie homozygotami dominującymi. Geny te. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza. to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. głównie wykorzystywanych w sztucznej inseminacji (np.ma gen letalny (czy semiletalny) w układzie heterozygotycznym. Jeśli będzie to gen letalny powodujący zamieranie zarodków. Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice. Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. będą pochodzić wszyscy synowie fenotypowo normalni. gdy występują w stanie homozygotycznym. Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią. Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. że aż 18% osobników jest nosicielami niepożądanego allelu. a u połowy ujawni się wada dziedziczna.

137 . Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych.Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. Jeśli przyjmiemy. Wówczas schemat kojarzenia testowego jest następujący: Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw. Dokładną metodą identyfikacji nosicielstwa recesywnego genu. W hodowli bydła młode buhaje. lecz trudną do zaakceptowania ze względów hodowlanych. jest kojarzenie samca z jego własnymi córkami. Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus. że samice matki tych córek są homozygotyczne (AA). 3. test automatyczny). to wśród córek połowa będzie miała genotyp AA. kojarzone są z losowo wybranymi samicami. z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich). Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. a samiec jest heterozygotyczny. a połowa Aa. Rejestracja ta z jednej strony daje obraz częstości występowania tych wad. Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. zakupione przez Stacje Hodowli i Unasieniania Zwierząt.

spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych. że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. po raz pierwszy opisano go w 1983 roku. który koduje strukturalną podjednostkę CD18 p2-integryny. Na początku lat 90. W diagnostyce tych chorób stosowane są techniki biologii molekularnej. powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138 . DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi. występująca również u ludzi pod nazwą LAD (ang. w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej. rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego. leukocyte adhesion deficiency). Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. Stwierdzona w pozycji 383 nukleotydu mutacja. Ponieważ jest to gen recesywny. Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2. W latach 70. które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. Białko to odgrywa istotną rolę w odporności organizmu.Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA. Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to. szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne. U bydła zespół BLAD był znany od kilkunastu lat. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt. głównie PCR-RFLP. która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy). Jest to choroba autosomalna recesywna. Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych. tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. Analiza rodowodowa wykazała. iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. fenotypowo zdrowe). w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu). Zagadnienie to opisano niżej.

Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to. Za pomocą analizy fragmentów restrykcyjnych określa się. tzw. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych. który bierze udział w cyklu mocznikowym. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia. Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni. które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. podejmowane są środki prewencyjne. Jej podłożem genetycznym jest zmutowany. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA. Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej. ciche podstawienie 775 nukleotydu. natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. jaki allel występuje w badanym DNA. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów. opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa. a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. Mutacja ta została już przedstawiona wcześniej. Z kolei. iż zmutowany allel nie ma miejsca restrykcyj139 . Obraz elektroforetycznego rozdziału wygląda następująco: W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację.wego na glicynę.

Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. hyperkalemic periodic paralysis). polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). Osobniki heterozygotyczne są fenotypowo normalne. pojawiający się u koni „ąuarter" w USA. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. określony symbolem DUMPS (ang.nego dla enzymu Avall w kodonie 86. Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz. Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu. dlatego nazwano go „genem zamieralności zarodków". Pierwsza z nich to okresowy paraliż. za140 . nie dającą żadnych skutków fenotypowych. natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. nazwany HYPP (ang. Zmutowany allel genu UMPS. których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych). deficiency uridine monophosphate synthase). konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży. dla heterozygotycznego trzy prążki: 194 pz. 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym. powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT). W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę. Objawami tej choroby są ataki drżenia mięśni i paraliżu. Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony. Podobnie jak w przypadku poprzednich mutacji. 118 pz i 72 pz. jest recesywna mutacja genu syntazy urydynomonofosforanowej. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. Z drugiej jednak strony. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni. a dla normalnej homozygoty dwa prążki 118 pz i 72 pz. Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz. do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. występujące po zmianie diety. krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku. Kolejną. również wcześniej przedstawioną mutacją letalną. występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego. ale wykazują obniżony poziom aktywności enzymu. okresie głodzenia. natomiast allel zmutowany (DUMPS) — nie będzie. niemożliwa jest analiza DNA osobników homozygotycznych.

severe combined immunodeficiency disease — SCID). Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang. warunkujący białko prionowe — symbolem PrPSc. nazwane prionami. u owiec — 13ql7-ql8. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. indukując zmiany ich konformacji. Jedną z najdawniej. W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach. że nie występuje ona w polskiej populacji koni arabskich. a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). Choroba ta charakteryzuje się brakiem limfocytów T oraz B. Przypuszcza się. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. Mutacja HYPP dziedziczy się z niezupełną dominacją. Gen kodujący białko komórkowe oznaczono symbolem PrPc. Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA.działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP. chorób prionowych. z zastosowaniem enzymu restrykcyjnego Tagi. dobrze umięśnionych. jego zmutowany allel. Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji. natomiast badania przeprowadzone w Polsce wykazały. scrapie — drapać) u owiec. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20. iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen. którym jest białko. poznanych chorób prionowych u zwierząt jest trzęsawka (ang. Białkowe cząsteczki infekcyjne. Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej. bo około 250 lat temu. na granicy prążka 12 i 13 (20pl2-pl3). namnażają się w ten sposób. jak P 141 . Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny. spongiform encephalopathies). Omawiając choroby genetyczne nie sposób pominąć tzw. natomiast u bydła i owiec w długim ramieniu chromosomu 13. iż przekształcają prawidłowe cząsteczki białka w szkodliwe. przy czym u bydła w pozycji 13ql7. co powoduje załamanie się układu immunologicznego. Podobna choroba od 50 lat znana jest u ludzi. Z tego powodu określane są gąbczastymi encefalopatiami (ang. u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. trwającym miesiące lub lata bez żadnych objawów. jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową.

które wywołuje scrapie u owiec. R/Q) (tab. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. oznaczenia literowe V/A). Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc. które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. Białko to ma około 250 aminokwasów. 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. że najbardziej odporne są owce o genotypie AA136RR154RR171. Gen ten koduje białko określane jako Dpl (ang. Metoda ta okazała się jednak zbyt droga i długotrwała. U bydła chorobą prionową jest rozmiękczenie mózgu (ang. które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym. Dotychczas stwierdzono. że częściej występuje 6 powtórzeń. prion-doppel). rok później została opisana jej patologia. Spośród trzech możliwych genotypów (6:6. bovine spongiform encephalopathy — BSE). Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. Ponadto tylko ten genotyp nie występował u krów z BSE. związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. Wydaje się. Czynnikiem zakaźnym BSE jest to samo białko prionowe. Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii. 142 . 5-17). kóz i bydła. 5-III). Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny.śledziona czy węzły chłonne. Wykryto już kilka mutacji w tym genie u owiec. 154 (arginina/histydyna. R/H) oraz 171 (arginina/glutamina. że w pobliżu genu białka prionowego znajduje się gen Prnd (ang. Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej. a jej rezultaty nie były zadowalające. Jest to choroba ośrodkowego układu nerwowego. Ostatnie badania wykazały. downstream prion-like protein) lub doppel.

4. Z kolei. Należą do nich biegunki okresu noworodkowego u prosiąt. ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. głównie w północnej Australii i innych regionach tropikalnych. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny Gen odporności na kleszcze W niektórych krajach. występowanie tych 143 . determinujący odporność na kleszcze. powodujące rocznie padnięcie około 10 min prosiąt na świecie. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi.5. umożliwiających adhezję bakterii i ich rozwój. jak również w Europie.5. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie. w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli. bydło indyjskie jest bardzo odporne na kleszcze. Gen K88 i F18 U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła. Z kolei. bydło jest szczególnie podatne na inwazje kleszczy. Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt.

5. iż mogą 144 . stwierdzono bowiem. iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg. konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa). U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa. Mutacje te mogą być dziedziczone po matce. coli K88 zlokalizowano w chromosomie 13. Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra. Mutacje w mitochondrialnym DNA Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. wykazuje ścisłe sprzężenie z genem ECF18R. coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. z których jedna. Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne. znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. coli F18).in. której objawami są m. oznaczona symbolem M307. schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E. Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA. coli F18. Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany). Podatność jest cechą dominującą (allel B). Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika.2-fukozylotransferazy. z ałlelem zmutowanym M307A. W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1'. Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. a odporność recesywną (allel b). coli (bakterie te mają fimbrie). oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. trzech prążków (93. blisko locus Tf (transferyny). a ich charakterystyczną cechą jest to. ataksja. 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych. Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l. mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym.receptorów warunkowane jest genem głównym (o dużym efekcie). W jednym z nich (FUT1) wykryto dwie mutacje.5. polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę). Loci receptorów dla E. warunkującego odporność na infekcje E. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E.

Wiadomo na przykład. insercji bądź delecji nukleotydów. Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi. Skutkiem tranzycji są takie choroby u człowieka. polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki.dotyczyć całych tkanek. Przykładem pierwszej sytuacji jest wspomniana już choroba LHON. której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona. jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP). ale dalszym pokoleniom cechę tę przekazują tylko córki. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego.in. padaczkę miokloniczną i tzw. iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom. Mutacje w mitochondrialnym DNA. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. Miejsce i zasięg występowania danej mutacji powodują. pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to. że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka. Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np. Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). podobnie jak w DNA jądrowym. iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną. jak i synom. dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną. . inne natomiast u odpornych. kwasica mleczanowa i napady udaropodobne). drugi natomiast mutacją homoplazmatyczną. wywoływaną przez wirus. Podstawienia nukleotydów w genach kodujących tRNA powodują m. poszarpane czerwone włókna (MERRF). polegają na substytucjach nukleotydów (głównie tranzycja). Z kolei. mitochondrialną miopatię.

Oznacza to. Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości. w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. 146 . Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków. Ogólnie cechy można podzielić na jakościowe i ilościowe. Znane są również przykłady. kiedy jeden gen wpływa na kształtowanie się kilku cech. barwa umaszczenia. rogatość lub bezrożność bydła. Mechanizm dziedziczenia cech jakościowych jest zróżnicowany. a nawet kilkadziesiąt par genów. Wspólną właściwością tych cech jest to. umaszczenia. posiadanie/brak rogów). Cechy jakościowe są warunkowane jedną. Ponadto. a ich ujawnienie się zależy przede wszystkim od założeń genetycznych. bowiem na ich ekspresję wpływa kilkanaście. rzadziej kilkoma współdziałającymi ze sobą parami genów. Zjawisko to nazywa się plejotropią. Do cech jakościowych zalicza się takie. układy grupowe krwi itd. jak: umaszczenie zwierząt. kolor upierzenia u drobiu. która jest łatwa do odróżnienia w zespole innych właściwości (np. W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen.Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu. Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy. np. owiec i kóz. że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym.

Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus. W procesie gametogenezy allele z danej pary rozchodzą się do gamet. I prawo Mendla.Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem. nazywa się homozygotą (AA lub aa). że gameta zawiera tylko jeden gen z danej pary alleli. Zygota. a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. Dziedziczenie cech warunkowanych jedną parą alleli 6. W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA. Potomek dziedziczy zatem jeden allel z danej pary od ojca. 147 . Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla.1. 6.1. Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. która zawiera dwa jednakowe geny z danej pary alleli. Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie.1. Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów). Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. A-a). cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą. Jak już wspomniano. natomiast mająca dwa różne geny — heterozygotą (Aa). mówi o tym. Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary. Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek). drugi natomiast od matki. Współdziałanie alleli Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu. drugi natomiast — nieallelicznego (kilka par genów). zwane prawem czystości gamet. Geny te nazywane są parą alleli lub allelomorfów. dając wszystkie możliwe formy danej cechy.

Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. w locus tym występuje allel be. Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt. wykazujące dominującą formę cechy. kontrolowany przez allel dominujący Bew z locus Be. część zaś białe. Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. Charakterystyczną cechą tego typu dziedziczenia jest to. Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire. że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. jednolite umaszczenie (dominuje) i łaciatość u bydła. otrzymuje się potomstwo (pokolenie Fl) mroziate. część mroziate. iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie).Przykładem całkowitej dominacji może być bezrożność u bydła. U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. Są one zatem w stosunku do siebie równorzędne. zawsze da potomstwo heterozygotyczne. jednolitego umaszczenia. również czarno umaszczonych. Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz. białe i stalowoniebieskie). czarne umaszczenie u bydła. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane). Dominowanie niezupełne genów z jednej pary alleli polega na tym. Z kolei u świń rasy cornwall. że fenotyp zwierzęcia odzwierciedla jego genotyp. będących homozygotami alternatywnymi (PP i pp) pod względem locus polled. to stosunek liczbowy osobników czerwonych. nazywanego również dziedziczeniem typu Zea. długość uszu u owiec rasy karakuł i inne. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2). Ilustracją tego typu dziedziczenia. upierzenie kur andaluzyjskich (czarne. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi. który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie. Przykładem tego typu współdziałania allelicznego jest grupa 148 . dominujące nad czerwonym i inne. mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. Para rodziców. Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. jest poniższy przykład. gdyż gen dominujący P maskuje jego ekspresję. Stwierdzono. z którego część ma umaszczenie czerwone.

Zdarzają się również takie loci. w wyniku mutacji genowych (patrz rozdział: Mutacje). W przypadku niektórych loci. że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa). w których u różnych osobników znajdują się więcej niż trzy allele. Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. dając jedynie inną jej formę lub natężenie. w którym w jakiejś populacji 149 . Naddominowanie polega na tym. obok dotychczasowej pary alleli pojawia się allel trzeci. który warunkuje tę samą cechę co allele pierwotne. Układ taki.krwi AB w układzie ABO u ludzi. w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu.

iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu. Allele wielokrotne charakteryzują się tym. Edp. Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne. to liczba genotypów będzie się równała: Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. mówiące o niezależnym dziedziczeniu się cech. Zwierzęta z pokolenia Fj będą mieć genotyp EdePp. Wszystkie gamety osobnika aberdeen-angus (bydło czarne. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla). badając m. że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. Jeśli szereg składa się z n liczby alleli. Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP. bezrogie.2. 6. to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone).1. ep. Dzieje się tak 150 . Niezależne dziedziczenie cech (II prawo Mendla) Niezależne dziedziczenie cech stwierdził Grzegorz Mendel.występują więcej niż dwa allele. Oznacza to. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie. Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku. czerwone). rogate) — allele recesywne e i p. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie. bezrogie) zawierają dominujące geny Ed i P. czyli będą czarne. eP. to ich segregacja jest praktycznie niezależna.in. warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1). natomiast gamety osobnika rasy shorthorn (czerwone. nazywamy szeregiem (serią) alleli wielokrotnych.

151 .

dlatego. rogaty). Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może 152 . Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4.3. lecz 9 różnych fenotypów. Dziedziczenie cech sprzężonych Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to. iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy. gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych. że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p.1. a druga według typu Zea. sporządzając szachownicę genetyczną Punneta. cechy kontrolowane przez te geny będą się dziedziczyć razem. dziesiątki tysięcy różnych genów. Jednak organizmy żywe mają tysiące. Cechy takie nazywamy sprzężonymi. w którym występuje przynajmniej jeden gen dominujący z każdej pary. a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony. Jeśli będzie rozpatrywana większa liczba cech równocześnie. 6-2). gdy obie cechy dziedziczą się z dominowaniem całkowitym. zwiększy się liczba możliwych fenotypów. Ponieważ każdy osobnik wytwarza 4 rodzaje gamet. Natomiast gdy jedna cecha dziedziczy się według typu Pisum. bezrogie): 3 (czarne. a tylko kilka do kilkudziesięciu chromosomów. to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. istnieje możliwość ujawnienia się 6 różnych fenotypów. Najliczniejszą grupę potomstwa stanowią osobniki o genotypie. Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli. Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne. rogate) (ryć. rogate): 3 (czerwone. W tym przypadku można mówić o niezależnej segregacji chromosomów. Zatem każdy chromosom zawiera wiele genów. liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n 6. bezrogie): l (czerwone. inaczej mówiąc.

W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym. jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom. bądź w różnych chromosomach i jest to faza odpychania (trans). Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami. Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna. że są one w fazie przyciągania (cis). Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. normalne skrzydła są dłuższe od odwłoka. pojawią się kombinacje cech w innym układzie niż u rodziców. Częstość tej wymiany jest tym większa. im dalej od siebie znajdują się geny. genotyp dla cech sprzężonych jest zapisywany w postaci ułamka. W wyniku crossing over u części osobników potomnych. w którym licznik oznacza jeden chromosom. rekombinantów. Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący: Natomiast genotyp podwójnej homozygoty recesywnej: W celu określenia. skrzydła szczątkowe (gen recesywny v — vestigal). mianownik drugi chromosom z tej pary. Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). złożone z homologicznych chromosomów. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy. została przyjęta nazwa faza sprzężenia. dzikiej) każdej cechy u muszki. U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł. tzw.być stosowany do tych cech. W odróżnieniu od cech segregujących niezależnie. iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty. 153 . zwanej crossing over.

Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy. której symbolem jest cM (centymorgan. czyli l cM = 1% rekombinacji. Doświadczalnie zostało udowodnione. W danym przykładzie rekombinanty stanowią około 18. jeśli pojedynczy 154 . W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over. Na przykład.5% całego potomstwa z tej krzyżówki. jest ona iloczynem częstości przypadków pojedynczych crossing over. z jaką crossing over zachodzi między sprzężonymi loci.5 cM. iż częstość. od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana). jest stała. Procent rekombinacji przyjęto za jednostkę odległości między genami.Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe. Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu). że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów. Wynika to z tego. natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami). W naszym przykładzie odległość między loci B i V wynosi 18. Można jednak przewidzieć częstość występowania podwójnego crossing over.

Z kolei. a nie za pomocą przyjętego dla nich symbolu „ + ". w celu lepszego uwidocznienia efektu crossing over.crossing over w obszarze I zachodzi z częstością 0. Jeśli jednak zajdzie podwójny crossing over. Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie. W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny: Natomiast drugi rodzic ma genotyp: W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv. krzyżówki trzypunktowe.05 (5%). to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C. a gen recesywny c (cinnabar). to częstość występowania podwójnego crossing over wynosi 0. stosuje się tzw.1%. warunkuje kolor cynobrowy. iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka. że kolejność ułożenia loci w chromosomie jest następująca: A-B-C. czyli 0. natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV. By tego uniknąć. umożliwiające dokładne ustalenie położenia loci względem siebie.001. Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych. Trzecią cechą rozpatrywaną będzie kolor oczu. Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej. Przyczynę stanowi to. Również w tej krzyżówce. to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci. układ genów będzie taki.02x0. Jeśli przyjmiemy. Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi. allele dominujące będą oznaczone literami alfabetu. jak przed tą wymianą i nie będzie można odróżnić rekombinantów.02 (2%). podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. U muszki owocowej dominuje czerwony kolor oczu (dziki). Jest to jednak wartość przybliżona. a w obszarze II — 0. gdyż w naturze jest ona niższa.05 = 0. Zjawisko to nosi nazwę interferencji. 155 .

wyrażonym w procentach: Analogicznie do tego odległość między loci C i V wynosi: Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco: Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie. Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane. W celu okreś156 .W potomstwie uzyskano następujące genotypy i liczebności: Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów. W ten sposób tworzone są mapy genetyczne.

Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. Sposób ich dziedziczenia jest inny niż cech autosomalnych. iż u osobnika diploidalnego występuje tylko jeden gen z danej pary. Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ).lenia. Cechy sprzężone z płcią Cechy. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu. a osobnika — hemizygotą. Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład. w którym chromosomie znajduje się dana grupa genów sprzężonych. samce zaś heterogametyczne (XV). Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego). Układ genetyczny polegający na tym. Dzieje się tak dlatego. występująca u ludzi. O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. psów i niektórych zwierząt gospodarskich.1. 6.. cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób: Fenotyp Samice Samce Samice Samce Jak wynika z tego zestawienia. ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. W rozdziale tym pokazano m. samce nie mogą być heterozygotami (nosicielami genu hemofilii). których geny są umieszczone w chromosomach płci. Gdy płeć heterogametyczną ma cechę dominującą. a synowie po matce). a pleć homogametyczną cechę recesywną. nazywamy hemizygotycznym. a heterogametyczną samice (ZW). nazywamy cechami sprzężonymi z płcią. a nie — jak u płci homogametycznej — od pary genów.in. obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu. uwarunkowana jest recesywnym genem h. 157 .4. U ssaków samice są homogametyczne (XX). że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki). że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego. Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi. Cecha zmniejszonej krzepliwości krwi (hemofilia). Powstaje wówczas mapa fizyczna. należy zastosować inne metody badania (cytogenetyczne).

6-4 wkładka kolorowa). w pokoleniu F. u których zaraz po 158 . tj. Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią. 6-3. „dziedziczenie na krzyż" Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B. Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra. takich. warunkujący cechę jastrzębiatości upierzenia. Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce.Ryć. dominuje nad jego allelem b (gen czarnej barwy upierzenia). Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych.

Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści. zlokalizowany w chromosomie X. Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech. dwarf — karłowaty). inne — rude (genotyp Oo) (ryć. ang. Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X. Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw. Samce mogą być tylko czarne (o-) lub rude (O-). warunkowana przez locus O (ang.będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach. Jest ono następstwem tego. ale ich ekspresja jest uzależniona od płci. Przykładem takiej cechy jest rogatość owiec rasy dorset horn. iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie. mające gen jastrzębiatego upierzenia. Osobniki męskie i żeńskie. mając taki sam genotyp. Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. mogą się różnić fenotypowo. cechy związane z płcią. geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw. U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych. ale ujawniają się tylko u jednej płci.wykluciu można rozróżnić płeć. B (niebieskie dzikie) i b (czekoladowe). część z nich przedstawiono w rozdziale: Mutacje. Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci. co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego. wytworzone przez polską badaczkę Laurę Kaufman. Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym. Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. rasa sussex) i złocistości upierzenia (rhode island red). orange). których założenia genetyczne znajdują się u osobników obu płci. U zwierząt domowych jest wiele cech sprzężonych z płcią. Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone). Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia. Cechy te nazywane są cechami 159 . Rasą autoseksingową są polbary. Niektóre z nich to tzw. Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. natomiast osobniki homozygotyczne recesywne będą rogate. Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate. Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach). samice zaś bezrogie. 6-5 wkładka kolorowa).

W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt. W przypadku wielu cech geny z różnych par alleli. 6. w wyniku łącznego działania. nieśność samic ptaków. Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. hormonu). Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne. Zmiany te są jednak następstwem nieprawidłowego opierzenia. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m.in. które nie chroni ptaka przed nadmierną utratą ciepła. który bierze udział w syntezie jakiegoś związku (np. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę. Współdziałanie genów z różnych loci w kształtowaniu fenotypu W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy.5. kiedy jeden gen oddziałuje na powstanie kilku cech. opisany w podrozdziale: Dziedziczenie umaszczenia. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. Z kolei ten związek ma różnorodne funkcje fizjologiczne.1. Plejotropia O plejotropii mówimy wówczas. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe. powodują pojawienie się nowej formy cechy jakościowej. Plejotropia może być właściwa lub rzekoma.ograniczonymi płcią lub ograniczonymi do płci. 6. pracę serca i aktywność procesów trawiennych.2. Należą do nich: zdolność wydzielania mleka u samic ssaków. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt". Przykładem jest gen warunkujący platynową barwę u lisów. Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy. Na przykład gen warunkuje syntezę enzymu. wpływa zatem na inne właściwości organizmu. gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. wnętrostwo czy przepuklina mosznowa u samców. Plejotropia właściwa występuje wtedy. która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech. na tempo przemiany materii. 160 .

Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161 .2. Ryć. 6-6a). Jest kilka rodzajów tego współdziałania. W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p.1. 6.Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. 6-6a. Komplementarność Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć.

która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. tj. Dwa dominujące geny z różnych par alleli. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia. Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc). W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy. którego nie było w dwóch pokoleniach przodków. podobna do wspomnianej wyżej u świń. nazywamy genami komplementarnymi lub dopełniającymi się. który hamuje ujawnienie się genu z innej pary. pojawia się również nowy typ — grzebień pojedynczy. charakteryzująca się tym. natomiast gen P powoduje powstanie grzebienia groszkowego. w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy. gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_). Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego. a jego allel r — pojedynczy. całkowicie różny od obojga rodziców. Ptaki te są również białe. że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. gdyż brak w ich genotypach genu C.2. wyandotte. Z krzyżowania osobników o ustalonej cesze kształtu grzebienia. Kury niektórych ras (np. której genotyp może mieć kilka różnych wariantów. 6-6b wkładka kolorowa).Gen R warunkuje kształt różyczkowy grzebienia. plymouth rock) mają upierzenie białe.2. ale mają 162 . U białych leghornów jest inna sytuacja. Gen. Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym. warunkującego wytwarzanie pigmentu (melaniny) w piórach. w którym wystąpią 4 fenotypy w stosunku 9:3:3:1. jak i różyczkowego. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy. Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. natomiast gen hamowany to gen hipostatyczny. Zjawisko epistazy może wyjaśnić poniższy przykład. 6. nazywany jest genem epistatycznym. natomiast w pokoleniu F 2 . współdziałające razem i wytwarzające odmienną formę cechy niż ta. warunkujący go genotyp to podwójna homozygota recesywna — rrpp. że w pokoleniu Fl pojawia się nowy fenotyp. jego allel p — grzebienia pojedynczego (ryć. która powstaje w wyniku działania każdego z nich osobno. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP). Epistaza Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza.

Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne. 6-7). powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę. rasy cornwall): aa ii EE. W potomstwie F2. 163 . Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. Geny te. Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów. Allele z locus E i A są opisane w dalszej części tego rozdziału. W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). natomiast czarno umaszczonych (np. Geny epistatyczne mogą tłumić działanie wielu innych par. dotyczącej dziedziczenia umaszczenia. oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć.3.Ryć. mimo iż cecha łaciatości warunkowana jest inną parą alleli. którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc). psów i kotów. 6. Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary.2. które modyfikują przejawianie się jakiejś prostej cechy. Różny stopień białej plamistości spowodowany działaniem genów modyfikujących w swych genotypach gen C. Geny modyfikujące Istnieje pewna grupa genów. Gen epistatyczny nie zawsze jest dominujący w swojej parze. zwane modyfikatorami. rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP. Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC. który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I. 6-7. warunkowanej zwykle jedną parą genów.

Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. takich jak gonadotropiny. 164 . Dziedziczenie umaszczenia Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach. Do niedawna uważano. Ostatnie badania wykazały. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych. Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np.4. że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację. wytwarzane z metabolitów cysteinylo-DOPA-chinonu. melanocyte stimulating hormone). addytywnymi lub poligenami. natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. zależne od sumującego się ich działania.). Sumujące działanie genów Inną formą współdziałania nieallelicznego genów jest polimeria. Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny.6. wpływając na przykład na zmianę ilości wytwarzanego pigmentu. 6-8): 1) hydroksylację tyrozyny do 3. Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. powodując różne jej nasilenie.6-dihydroksyindolu (DHI) do indolochinonu. biała w zimie. Geny te nazywane są genami polimerycznymi.2. natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej. Zmiany te spowodowane są działaniem niektórych hormonów. Synteza. 6. i feomelaniny (kolor czerwony lub żółty). nieśność itd. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny). iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu.3. Należy pamiętać. syntetyzowane z metabolitów DOPA-chromu. a czarna lub brązowa w lecie). ale czynniki środowiskowe mogą modyfikować umaszczenie. rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci. kortykotropina i hormon melanotropowy — MSH (ang. że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. wydajność mleczna. iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę.4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5. Zjawisko to polega na tym. U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych.

Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. W determinację koloru jest włączonych wiele loci. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti). Hormon melanotropowy. Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. a podczas rozwoju embrionalnego wędrują do powstającej skóry. Melaniny są wytwarzane w melanocytach. Schemat biosyntezy melaniny Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów. które współdziałają ze sobą w sposób kompleksowy. REGULACJA NA POZIOMIE TKANKOWYM Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. zwany również intermedyną lub melanotropiną.Ryć. Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165 . Geny. Hormon ten stymuluje produkcję poszczególnych melanin na przemian. Wiele genów. jest wytwarzany przez część pośrednią części gruczołowej przysadki. 6-8. które zostały już sklonowane. komórkowym i subkomórkowym. warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). Melanocyty pochodzą z rdzenia nerwowego. Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym. a hamowanie produkcji feomelaniny wewnątrz melanocytów. Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina). Jest wiele genów. ma działanie plejotropowe na rozwój i różnicowanie organizmu. Receptor ten jest determinowany przez locus E (Extension). jeśli nie wszystkie związane z wytwarzaniem pigmentu.

Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. Locus D koduje strukturalne białko. REGULACJA NA POZIOMIE KOMÓRKOWYM Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów. Do loci działających na poziomie tkankowym. oba typy melanin nie są więc syntetyzowane jednocześnie. a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. Mutacje w tych loci wpływają wyraźnie na kolor oczu. U osobników typu dzikiego. REGULACJA NA POZIOMIE SUBKOMÓRKOWYM Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym). E (Extension .. pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. Należą do nich geny z loci D (Dilute — rozjaśniony). Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora. podczas gdy locus Extension działa w melanocytach. odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego). A (Agouti — dziki). przez działanie na mechanizmy włączone w funkcję melanocytu. Locus E (Extension) koduje przede wszystkim receptor MSH. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych. zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) .stalowy. które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów. które działają na pigmentację ssaków na poziomie subkomórkowym. wpływają bezpośrednio na ilość i typ wytwarzanej melaniny. 166 . Locus ten kontroluje ilość eumelaniny. Geny. lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np. w jednolity typowy sposób. brak syntezy melaniny w przypadku albinizmu). Większość z tych mutacji ma wpływ plejotropowy na rozwój. melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę. nazywanych agouti. co wpływa na koloryt (układ barw). W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np. gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów.plamisty.dominujący biały nakrapiany i Steel (Sl) .pełna barwa).. Dominant White Spotting (W) .niesieniu do myszy. Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu).

Badania poszczególnych mutacji w locus Albino u królików. Locus C kontroluje liczbę i intensywność ziaren pigmentu. natomiast inne geny regulują typ formowanego pigmentu. prowadząca do osłabienia funkcji enzymu. iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown. warunkujących umaszczenie himalajskie i szynszylowate. że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. cch. jeszcze inne — sposób. Geny z locus C u królików tworzą szereg alleli wielokrotnych. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka. ale są to mutacje typu nonsens. Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji.Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). Interesujące jest to. skórze i tęczówce oka. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. inhibitora) w melanocytach. Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino. Takie białka nie są kompetentne katalitycznie. której funkcja jest decydująca dla wytwarzania pigmentu. Historycznie był on uważany za locus strukturalny dla tyrozynazy. a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. B i E. Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny. która powoduje uwrażliwienie efektu fenotypowego na temperaturę. Tyrozynaza przejawia swą ekspresję w melanocytach. ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. czy pełnią one jakąś rolę (np. gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza. która prowadzi do wymiany cysteiny na tyrozynę. czyli wycinania intronów. ale mechanizm działania tego genu dotąd nie jest znany. ale dotychczas nie stwierdzono. w jaki pigment ma być formowany. Wiadomo jednak. ch. U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną. wykazały. Warunkiem ekspresji genów z tych loci jest 167 . zmiany sensu i mutacje zmiany fazy odczytu. w którym występuje dominacja w następującej kolejności: C. c (ryć. Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu). Specyficzna funkcja tego białka nie jest jeszcze poznana. Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A. a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny. 6-9 wkładka kolorowa). natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm. Mutacje w locus C powodują brak pigmentu we włosach.

u obu gatunków są dwa allele — E i Ed. Allel ten odpowiedzialny jest za eliminację eumelaniny.genotyp gg. W locus E. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny. efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -. w populacji lisa polarnego w Islandii). Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1. W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny. Lis polarny o genotypie aa jest czarny. warunkujących różne odmiany umaszczenia. R. W locus B również są dwa allele — dominujący B (czarny pigment) i b. u lisa polarnego jest rozcieńczona lub usunięta w ogóle. We wszystkich tych loci. warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny.oczywiście obecność odpowiednich genów z locus C. w układzie homozygotycznym -. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci. u lisa 168 .pigment czekoladowobrązowy. W. jak G. S. jakie są geny z innych loci. bez względu na to. P. z wyjątkiem locus W. U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie. Natomiast u lisa polarnego zamiast allelu A jest allel A". która z reguły zajmuje miejsce eumelaniny. Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. w tym przypadku kolor jest determinowany allelami z locus A. Feomelanina. ale genotyp ten występuje bardzo rzadko (np.

jedno oko niebieskie. takie jak W i W.srebrzystego: genotyp pp . oraz allel E+ umożliwiający ekspresję alleli z locus A. Letalny jest także genotyp WW. Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. Mutacje dominujące. Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. recesywny allel e. natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. W locus tym. opisanych w rozdziale: Mutacje. SJ i SH) i t (T). brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). natomiast allel a w układzie homozygotycznym — recesywne czarne. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy. Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. Allel dominujący Ed. natomiast gen marble daje inny efekt fenotypowy u tych odmian. W (białopyski). Genetyczne podłoże umaszczenia u bydła Wyniki wielu badań sugerują. kodujący czarny kolor. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a. której skutkiem może być różny kolor oczu u tego samego osobnika. Locus A koduje syntezę białka. natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. przy czym genotyp ww występuje u lisa rudego i srebrzystego. melanocyte stimulating hormon receptor). F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia). Locus E koduje syntezę białka MSH-R (ang. Mutacja w locus s (Shadow) charakteryzuje się heterochromią. W locus W są następujące allele: w.perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. 169 . umiejscowionym w chromosomie 18. DD — niebieski). gdy w locus E jest genotyp E+_. U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe. a drugie brązowe. Niestety dotychczas nie przeprowadzano badań molekularnych locus A. złożonego z około 350 aminokwasów. W (platynowy). W3 (biały Georgian) i W M (gen marble). W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna. w układzie homozygotycznym mają efekt letalny. będącego antagonistą białka MSH-R. że u bydła umaszczenie czarne. Allele te powstały w wyniku mutacji punktowych. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny. jest homologiczny do allelu ES0 u myszy. są 3 allele: Ed warunkujący umaszczenie czarne dominujące. s (trzy allele: S.. np. Allele z tego locus mogą wykazać ekspresję tylko wtedy. który w układzie homozygotycznym warunkuje umaszczenie czerwone.

W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej. U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic. blisko telomerowego regionu ramienia p. także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica. locus E (Extension). e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey. niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. mroziate). a mała allelu e (czerwone umaszczenie). U ras bydła (np. poland-china i pietrain. W locus I są dwa główne allele: 7 (inhibicja koloru). Większość ras świń udomowionych ma allel recesywny a — nieagouti. Kolejność dominowania tych alleli jest następująca: E-Ep-e. warunkujący fenotyp nazwany colorsided — łaciaty. cornwall i hampshire. Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego. iż locus ten jest umiejscowiony w chromosomie 6. i allel i — recesywny (kolorowy).. obserwowana jest zmienność w ekspresji cechy łaciatości. u których allel s jest utrwalony. że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension. Genetyczne podłoże umaszczenia u świń U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti). kora jest efektem plejotropowego oddziaływania allelu R na płodność.nieagouti. belgijskie błękitne). który dominuje nad s. cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie. W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a . w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. Podobnie jak u myszy i bydła. bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. powodując różne zaburzenia. ale jest recesywny w stosunku do allelu S. natomiast u shorthornów jest odwrotnie. Na przykład.Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. W tym samym locus u bydła tej rasy znajduje się allel Sc. odpowiedzialny za umaszczenie dominujące białe. Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire. U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe. Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8). w których do analizy sprzężeń użyto ponad 230 markerów genetycznych. wskazują. Wśród 170 . Badania. recesywny s — łaciatość. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę. ale recesywny w stosunku do białego (I). locus I (biały dominujący) i locus Be (Belted opasany).

W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. Genetyczne podłoże umaszczenia u koni Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały). wykazujący niepełną dominację. allel dominujący E determinuje syntezę eumelaniny. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus. Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina). wessex saddleback. G (Gray — siwy) i RN (Roan — deresz). Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"'. D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). charakterystyczny dla niektórych ras. Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. sabino (SB) czy tarantowate (LP). cremello). 6-10 wkładka kolorowa). Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. zatem wystarczy jeden allel W. trzeciego allelu w locus Extension — ED). Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita. We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele. Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony). hannover-braunschweig. oznaczonych symbolem Id (deresz). takie jak tobiano (TO). by było 171 . są determinowane przez geny z innych loci. Allele z tego locus wpływają na ekspresję genów z locus A.świń domowych dominujący biały jest przeważający. Locus E warunkuje wytwarzanie określonego rodzaju melaniny. Umaszczenie białe. Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). Biały pas. jak np. Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. overo (O). jest kodowany przez allel Be w z locus Be. Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. dominujący w stosunku do jednolitego umaszczenia. ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. W locus C u koni nie występuje allel recesywny c. hampshire (ryć. Locus I został zlokalizowany w chromosomie 8. I p (czarne łaty) oraz im (brudny szary). występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace. Wzory umaszczenia. natomiast inne rasy są homozygotami recesywnymi (ii). Genotyp tego knura jest następujący: aa U EE BewBew.

Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww). Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. wobec którego jest hipostatyczny. z wyjątkiem białego. Allel G (w homo. Genotypy w 7 loci.LWFS (ang. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" . Natomiast umaszczenie siwe kontroluje allel dominujący z locus G. w locus W mają genotyp homozygoty recesywnej (ww). znacznie rzadziej. który jest epistatyczny w stosunku do wszystkich alleli z innych loci. na skutek braku części jelita. lethal white foal syndrome). z wyjątkiem allelu W. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_). O i RN. polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub.i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. Allel D z locus Dun wykazuje zupełną dominację. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny. który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Należą do nich allele dominujące z loci W. Wszystkie rodzaje umaszczenia. zestawiono w tabeli 6-II. determinujące wybrane rodzaje umaszczenia koni. Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina. osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd). Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny.umaszczenie białe). 172 .

Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu. czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina. natomiast recesywny allel. Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab. Owce biało umaszczone są zwykle prawie pozbawione pigmentu. warunkuje białe umaszczenie owiec. Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny.15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała. Brw — czekoladowobrązowej eumelaniny. Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia. natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny. 6-III). Allel typu dzikiego. Allel A wh . 173 . ale mogą mieć pigment tan. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec. inne wpływają na typ włókien. bądź mieszaniny jasnych i ciemnych włókien wełny.Genetyczne podłoże umaszczenia u owiec U owiec stwierdzono trzy typy pigmentu: czarna eumelanina. Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała. allel Awh zmniejsza płodność owiec o około 0. Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów. który w fenotypie ujawnia się ze zmienną intensywnością. np. natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. będący pierwszym w kolejności dominowania z szeregu alleli z tego locus. Przykładem tego jest brązowoczerwony kolor wełny karakułów. bądź też oba efekty występują łącznie. w których genotypach jest allel Awh. Niektóre allele z tego locus mają efekt plejotropowy. od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. Bw. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. warunkuje wytwarzanie czarnej eumelaniny. podczas gdy feomelanina może być syntetyzowana. Badania specjalistyczne wykazały. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny. wzór koloru i obecność lub brak białych znaków.

Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej. Ew umożliwia normalną ekspresję alleli z locus Agouti. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy). U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS). Owce ras wełnistych. a także homozygotyczne białe. Allel typu dzikiego. recesywny. Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. ale epistatyczny do dominującej brązowej (tan). natomiast homozygoty SSSS są całkowicie białe. Allel ten jest epistatyczny 174 . Umaszczenie białe dominujące (białe perskie. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension. AwhAwh.Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. łaciate afgańskie) jest kontrolowane przez allel W a z locus White.

gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. Na przykład. w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą. natomiast drugie jako ekspresywność genu. mówimy o penetracji niezupełnej. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. wykazują charakterystyczny dla niego fenotyp. Natężenie drgań jest bardzo zróżnicowane. zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów. inaczej określana jako przenikliwość. jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników. współdziałania tych genów między sobą oraz współdziałania ze środowiskiem. Penetracja może być całkowita lub niezupełna. również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny. inne zaś jej nie mają. Z drugiej strony. kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy. O penetracji całkowitej mówimy wówczas. ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. Natomiast jeśli nie wszystkie osobniki. jest to częstość. która w formie homozygotycznej jest letalna. to mówimy. z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość. iż działanie genów może wywoływać różnorodne efekty. warunkuje dominującą szarość u karakułów.w stosunku do wszystkich innych genów umaszczenia. 175 . Stwierdzono to na podstawie wyników doświadczenia. Penetracja określonego genu może być różna zależnie od płci. Penetracja i stopień ekspresji (ekspresywność) genów Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika. Penetracja. a nawet. 6. Pierwsze z tych zjawisk określane jest jako penetracja genu. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym.4. Inny allel z tego locus. Wrn. Często zdarzają się przypadki. że jego penetracja wynosi 80%. ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. w przypadkach krańcowych. mające taki sam genotyp.

Dziedziczenie pozajądrowe Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym. możemy mieć wtedy. Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach. 6. Geny z różnych loci mogą dawać podobne fenotypy. Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. Już na początku naszego stulecia zauważono. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony.Pojęcie stopień ekspresji (ekspresywność. a także położenie zarodka w macicy i nawet obecność innych płodów. zależnie od kierunku krzyżowania. W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki. w którym pojawiają się pierwsze objawy. jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. Nie bez znaczenia jest stan zdrowotny matki. gdy jest ona obserwowana u osobników spokrewnionych ze sobą. Zarówno stopień penetracji. Należy jednak pamiętać o tym. że niektóre cechy nie podporządkowują się temu terminowi. które nie są dziedziczne. dziedziczą się różnie. że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu.5. czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne). Pewność. sole mineralne oraz inne związki krążące we krwi. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. a także chloroplas176 . Z kolei. geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji. Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). docierające przez łożysko do rozwijającego się płodu). ujawniające się w różnym stopniu. jak: wiek. a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. iż mamy do czynienia ze zmiennością przejawiania się tego samego genu. Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością.

Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. że warunkuje on od 2 do 10% zmienności tych cech. Jak dotąd. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały. Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg. której wartość zawiera się w granicach od 0. iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je. Mitochondrialny DNA. Przyczyną tego. w przeciwieństwie do DNA jądrowego. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację. +26 ±99 kg. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. średnią i niską wydajnością mleka.tach roślin wyjaśniło podłoże tego zjawiska. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką. natomiast komórka jajowa ma ich około 100 tysięcy. inaczej pozajądrowe lub cytoplazmatyczne. między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca. Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika). Powstał nowy termin dziedziczenie pozachromosomowe. Natomiast allele charakteryzujące się niską frekwencją (^ 0. W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA.3 do 0. co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała. jest przekazywany następnemu pokoleniu wyłącznie przez matki. Plemnik zawiera od 50 do 100 mitochondriów. może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. -879 ±114 kg mleka. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym. w świetle wyników najnowszych badań. analizowanego metodą RFLP.9. tli .4.1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce. u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca. ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA. O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje.

Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła. Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej. Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe.. Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA. U owiec badania mitochondrialnego DNA. Stwierdzono bowiem istotny wpływ zamiany (tranzycji .Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności. wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu.rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka. . prowadzone za pomocą technik molekularnych (RFLP).

interakcja genotyp-środowisko. tzw. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza. jeśli rozpatrujemy populację zwierząt. Rodzaje zmienności i czynniki ją wywołujące Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników. które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np. występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa). Istnieje także zmienność grupowa. czyli indywidualna. Na zmienność fenotypową. może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi. mamy do czynienia ze zmiennością wewnątrzosobniczą. lub S2 w przypadku próby losowej pochodzącej z tej populacji. zwaną także ogólną. Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa).1. Zmienność oznaczamy symbolem S2. W przypadku cech. wydajność mleczna w kolejnych laktacjach). 179 .Rozdział 7.

Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest 180 . Osobniki fenotypowo identyczne (bezrogie). ale także fenotypu (bezrogie i rogate).Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. Głównymi składnikami zmienności genetycznej są: zmienność addytywna. która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. są przyczyną powstawania różnych genotypów. w którego genotypie funkcjonuje jeden gen dominujący. Mutacje prowadzą do powstawania nowych genów. Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym. Poniższy schemat krzyżowania bydła obrazuje to odchylenie. Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych. będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie. innych układów w obrębie chromosomu lub między chromosomami. Natomiast rekombinacje. Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. ale różniące się pod względem założeń genetycznych (homo. i osobnikami homozygotycznymi — dominującym i recesywnym.i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu. Zmienność dominacyjna jest to część zmienności genetycznej. które kontrolują występowanie danej cechy. odchylenie dominacyjne i odchylenie epistatyczne. Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów. Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą.

należy także efekt matki pre-i postnatalny. sposób utrzymania itp. których wartość wyrażana jest za pomocą liczb naturalnych. dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami. genotypów i fenotypów w danej populacji (stadzie). liczba prosiąt w miocie. warunkowanych zwykle jedną parą alleli. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało. Zmienność skokowa występuje również w przypadku pewnych cech ilościowych.białe upierzenie kur rasy leghorn i whiterock. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów. w zmienności fenotypowej danej cechy ilościowej. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. Z krzyżowania osobników 0 białym upierzeniu. Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny. Do czynników środowiskowych. Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży.). Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. a zwłaszcza jej składnika — zmienności addytywnej. czynniki klimatyczne) lub okresowo (żywienie. do których należy odziedziczalność. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych. Zmienność skokowa odnosi się przede wszystkim do cech jakościowych. jak 1barwnie upierzone. W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej. Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. mających istotne znaczenie. Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. Do szacowania tego udziału stosowane są parametry genetyczne. np. należących do tych ras. uzyskuje się mieszańce biało upierzone. upierzenie biafe). Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału 181 .

w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. dane zestawia się w tzw. Miary zmienności Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników. Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej.1.charakterystycznego dla danej cechy. procentowa zawartość tłuszczu w mleku itp. według wartości rosnących lub malejących (szereg statystyczny uporządkowany). a niektóre wartości powtarzają się. 7. Średnia arytmetyczna nie odzwierciedla zmienności. zwanej próbą. które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji). W celu określenia zmienności cechy musimy ją oznaczyć (np. Miary skupienia Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna. zmierzyć) u wszystkich osobników stanowiących próbę. ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru: . Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt. Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np. wydajność mleka w kilogramach. ważona. wysokość w kłębie w centymetrach.2.2. 7. Jeśli liczba obserwacji jest duża. np. szereg rozdzielczy. którego elementami są poszczególne osobniki. harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta). Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy.

a w trzeciej l kg. Wzór na jej obliczanie jest następujący: Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu. 7-1): Średnią ważoną obliczamy wówczas. do obliczania średniej prędkości. Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący. w drugiej 2 kg. jaka była średnia szybkość oddawania mleka: 183 . gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. np. Wzór na obliczanie średniej harmonicznej jest następujący: Przykład: Ważono mleko oddawane przez krowę w kolejnych minutach doju.Średnia arytmetyczna charakteryzuje się następującymi właściwościami: Przykład (dane z tab. W pierwszej minucie uzyskano 4 kg mleka.

gdy rozkład zmienności cechy jest asymetryczny. tzn. Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu. odbiega od rozkładu normalnego.Średnią geometryczną stosuje się wtedy. W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną: . Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy.

Przykład: Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych. ale przez N—1. Miary rozproszenia Podstawowe miary rozproszenia to wariancja.0414.. w celu ułatwienia obliczeń stosuje się wzór roboczy. ale podniesione do kwadratu. Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej Biorąc pod uwagę. natomiast ich suma = 0. w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji.1239. 0. Wartość modalna (średnia modalna) jest to wartość cechy. Wariancja nie może mieć wartości ujemnej. standardowe odchylenie i współczynnik zmienności. 7.0294.0864. a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie). w którym licznik jest sumą kwadratów odchyleń: Jeśli próbę stanowi mała liczba obserwacji. 0. że najczęściej średnia arytmetyczna nie jest liczbą całkowitą.28. czyli 128%.3010.2. 0. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną: Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1. Wartości zlogarytmowane tego współczynnika wyniosły: 0. Ma ona miano takie jak analizowana cecha.6518. Wartość środkowa (mediana) jest to wartość cechy. 0. 0.0697. która dzieli szereg uporządkowany malejąco lub rosnąco na połowę.2. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji. 185 . która najczęściej powtarza się w szeregu liczbowym.

Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona. Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji. a także zmienności tej samej cechy w różnych populacjach (np. dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach. dotyczące masy ciała owiec w wieku 10 miesięcy.Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji. Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru: gdzie: Współczynnik zmienności wyraża zmienność w procentach. Dobór zwierząt do grup doświadczalnych powinien być losowy. Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. np. wykorzystując dane liczbowe zawarte w tabeli 7-1. Sposób obliczania miar rozproszenia przedstawiono niżej. Wariancja: .

3. że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy. U potomstwa w pokoleniu F2 nastąpiło rozszczepienie. mające założenia genetyczne warunkujące nieśność 240 jaj rocznie. uzyskujemy przedstawiony niżej obraz graficzny: 187 .3. Poligeny. zwiększające wartość cechy). warunkujące 7 poziomów nieśności (fenotypów tej cechy). Założono również. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie. w którym hipotetycznie przyjęto. Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę. Zmienność cech ilościowych 7. Przyjmuje się. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. natomiast zmniejsza się częstość występowania form skrajnych. specyficznie ze sobą współdziałają. Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej. skrzyżowano z kurami o genotypach aabbcc. czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych. Dziedziczenie cech ilościowych Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. Liczba poligenów kontrolujących cechy ilościowe jest nieznana. a drugi neutralne. addytywnymi lub kumulatywnymi. Kolejnym założeniem jest to. Zagadnienie to obrazuje przykład. pomiędzy którymi zachodzi dziedziczenie pośrednie. że efekty genów A. Najczęściej występują genotypy warunkujące wartości fenotypowe cechy. natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. przy czym jeden z nich ma działanie pozytywne (tzn. Zakłada się. które skupiają się wokół wartości średniej. Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny). niosącymi 120 jaj rocznie. Koguty o genotypach AABBCC.1. że każdy poligen ma dwa allele. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc). czyli obojętne dla wartości cechy. B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. że nieśność kur warunkowana jest trzema parami alleli z różnych loci.7. uzyskano 64 genotypy. nazywane inaczej genami polimerycznymi.

poniżej i powyżej średniej. • rozkład ten jest symetryczny. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. iż: • jest to rozkład. gdyż zacierają one różnice między fenotypami. 188 . Znaczenie tych czynników jest istotne. a oś symetrii przechodzi przez punkt. że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego. w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej. zwana krzywą Gaussa. Rozkład normalny charakteryzuje się tym. determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy: W podanym przykładzie celowo pominięto wpływ czynników środowiskowych.Po zestawieniu wartości fenotypowych cechy. w którym jest średnia wartość cechy. co w przypadku cech ilościowych o zmienności ciągłej powoduje. a najmniej skrajne wartości.

na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. są heterozygotyczne pod względem znacznej liczby loci. • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny).• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie. behawior matczyny). ilości substancji odżywczych dostarczanych płodowi (lub płodom). Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. • w przedziale x±S znajduje się ok.4% wszystkich obserwacji. procent tłuszczu w mleku oraz wartość energetyczną mleka. Zmienność transgresywna Zwierzęta gospodarskie. 95. Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka. Mogą one maskować oddziaływanie poligenów. dziedziczenie pozajądrowe. na przykład. 99. • w przedziale x ±2 S znajduje się ok. a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. wpływ matki na potomstwo jest większy od wpływu ojcowskiego. co wartość średniej arytmetycznej. • w przedziale x±3 S znajduje się ok. z innych ras). a także wielu czynników środowiskowych. stwierdzono. rasy. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189 .2% wszystkich obserwacji. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym.2. Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw.i postnatalnego zależy od gatunku. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy. 7. omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech). Jak już wspomniano. że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia. jak i mitochondrialnym DNA. maternal effect). Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów. Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw.3. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np. Wielkość efektu matki prę.6% wszystkich obserwacji cechy. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang. U trzody chlewnej. nawet ras o ustalonym genotypie. 68. wielkości matki oraz jej stanu fizjologicznego i zdrowotnego.

czyli wykazujące większą zmienność cechy. Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang. DDEEFF — 4800 kg. Gen o dużym efekcie jest identyfikowany wówczas.wartości cechy takie. Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. growth hormone). Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej.3. W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot). Genotyp ddeeff warunkuje wydajność 2400 kg mleka. Efekty genów D. zwany inaczej genem głównym. Cechy takie charakteryzują się rozkładem normalnym. U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25). której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty. warunkujące różną wydajność mleczną. E i F są identyczne (D = E = F). W przypadku niektórych cech zaobserwowano zmienność. w którym obok poligenów działa gen o dużym efekcie. Jest to wynikiem dziedziczenia. W badaniach prowadzonych na simentalerach stwierdzono. bądź wartości wyższe lub niższe niż u rodziców. spłaszczony albo nadmiernie uwypuklony. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna. wykorzystywanej w pracy hodowlanej. natomiast heterozygotyczny DdEeFf— 3600 kg mleka. że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D. Niektóre geny o dużym efekcie zostały wykryte przypadkowo. warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka). gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie. Zjawisko to nosi nazwę transgresji. Ilustruje je przykład: Załóżmy. Geny o dużym efekcie W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). iż zwierzęta homozygotyczne pod względem allelu B hormonu 190 . równą wartości cechy u rodziców. jakie obserwowano u rodziców.3. a każdy z nich zwiększa produkcję mleka o 400 kg. Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np. E i F. genotyp DDEEFF. quantitative trait locus). Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy. 7.

191 . W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. Badania cytogenetyczne wykazały.wzrostu charakteryzowały się o 382 + 18. powodowane transportem. Stwierdzono także. a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała. Świnie U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie.5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA. Dotychczas wykazano. Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu. Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt. z równoczesnym zmniejszeniem otłuszczenia. iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu. Dalsze badania zmierzają do ustalenia. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej. Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych. Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena.3.5. prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. Gen receptora rianodyny (KYR1). a IGF-1 wspomaga jego działanie. porcine stress syndrome). które allele mają związek z użytkowością mięsną. warunkami termicznymi i niektórymi czynnikami chemicznymi. jak zawartość mięsa w tuszy i powierzchnia oka polędwicy. będących nosicielami zmutowanego allelu. a najnowsze osiągnięcia są omówione w rozdziale 12. Hormon wzrostu reguluje rozwój mięśni. Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. bydła i szczura. iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe. Zwierzęta takie są więc dobrym materiałem do tuczu. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. jak karłowatość i akromegalia. iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe). Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni.

W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki. W innym. natomiast w zmutowanym 192 . Mutacja ta likwiduje miejsce trawienia niektórymi enzymami. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI).Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan. opatentowanym przez badaczy kanadyjskich. Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. Procedurę tego testu przedstawiono na rycinie 7-1. jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. początkowo oznaczono go symbolem Haln. Badania przeprowadzone przez naukowców kanadyjskich wykazały. z których najistotniejsza jest mutacja w 1843 nukleotydzie. że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1). powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. W obrębie genu RYR1 stwierdzono 18 mutacji punktowych. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T. fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. co umożliwiło opracowanie molekularnych testów diagnostycznych.

yorkshire. Pierwsze sugestie co do istnienia genu o dużym efekcie. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu.. estrogen receptor gene) może mieć istotny wpływ na wielkość miotu. Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością. Test molekularny wykrywający mutację genu PRKAG3 został opatentowany.allelu zmiana tej sekwencji powoduje. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3). wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19. pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie 193 . że jeden z alleli tego genu. 32 pz. Wyniki tych badań wskazują. a u koni w 10 chromosomie. Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1.5-2. ale tylko tranzycja G-»A w kodonie 200. Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. warunkuje cechę kwaśnego mięsa.4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz. 49 pz. powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym. iż zlokalizowany w chromosomie l (1p2. U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce). W pracy hodowlanej należy prowadzić kojarzenia tak. że enzym nie znajduje miejsca cięcia. Stwierdzono. u bydła w 18. prowadzone u świń innych ras (niemiecka landrace. występujący w chińskiej plennej rasie meishan. natomiast dla heterozygoty trzy prążki: 81 pz. duroc). W genie tym stwierdzono siedem mutacji. czego wynikiem jest uzyskanie nie strawionego fragmentu genu. by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy.jeden prążek długości 81 pz. Gen wpływający na wielkość miotu (ESR). Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych.4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). dla homozygotycznego (nn) . Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi.

Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. identyfikowanych w mleku córek. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. wykorzystywanych jako dodatkowe kryterium selekcji buhajów. Gen ten nie wykazuje plejotropowego negatywnego działania na inne. Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy. Jest to konsekwencja różnic w sekwencji nukleo- 194 . gdyż określony wariant tego białka. przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. zawiera 7 eksonów. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. 7-2). Gen κ-kazeiny. Opracowana została metoda identyfikacji genotypów κ-kazeiny. tłuszczu i kazein oraz lepszą przydatnością technologiczną. ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT). wyprowadzanych z udziałem rasy meishan. zlokalizowany w chromosomie 6. W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. podczas gdy w wariancie B — treonina (w DNA kodon ACC). Gen β-laktoglobuliny ma długość około 7800 par zasad. Bydło Geny białek mleka. ekonomicznie ważne cechy. Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka.1754). natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć. wariant A alaninę (GCT). wpływa na wydajność mleka i jego składników. jak wzrost i grubość słoniny na grzbiecie. Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII. W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC). Gen β-laktoglobuliny uważany jest za gen o dużym efekcie. Białko wariantu A różni się od B dwoma aminokwasami. podobnie jak κ-kazeiny. utrzymywanych w zakładach unasieniania. białka i tłuszczu).

dlatego mutacja ta jest oznaczona jako nt821(del11). Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne. muscular hypertrophy). 2 — trawienie enzymem restrykcyjnym Hindlll tydowej obu alleli. Gen miostatyny należy do rodziny TGFβ (ang. Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras. Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2. Rozwiązaniem 195 . a — marker. transforming growth factor β).AB AA BB Ryć. b — produkt nie strawiony. zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi. Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. 7-2. należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci. jak i ich mieszańców. Gen hipertrofii mięśniowej (MH — ang. Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem. mniejszy obwód i masa jąder. l — trawienie enzymem restrykcyjnym Hinfi. spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej. Duża masa płodu stwarza wyraźne trudności naturalnego porodu. natomiast u krów dłuższa ciąża. Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa.

Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. U owiec występuje mutacja powodująca hipertrofię mięśniową. cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. Prowadzone są badania w celu jego izolacji. Jest to pojedynczy autosomalny gen. która jest odpowiedzialna za substytucję cysteiny przez tyrozynę. Hipertrofia ujawnia się u potomka wówczas. mutacje te są charakterystyczne dla określonych ras bydła mięsnego. że istnieją dwa allele — CLPG i clpg. warunkujące zwiększony stopień owulacji. Przypuszcza się. Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. począwszy od pozycji 419 nukleotydu. w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego.pośladki) -. b) tranzycja C→T w 610 nukleotydzie. Pomimo ujemnych następstw związanych z hipertrofią mięśni. który pełni nieznaną jeszcze funkcję regulacyjną. Ostatnio ustalono. Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji. zlokalizowany w chromosomie płci X) 196 . czy od matki. gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). Owce Gen hipertrofii mięśniowej (CLPG). która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy. Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. 7-3 wkładka kolorowa). b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). czy gen CLPG pochodzi od ojca. pyge -. Przypuszcza się. Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938. noncoding RNA). a jego produkt to niekodujący RNA (ncRNA ang. Co ciekawe. takie jak gen Inverdale (FecXI. że locus ten podlega transkrypcji.ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. U owiec wykryto geny główne. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów. Gen CLPG pochodzący od matki jest nieaktywny. c) transwersja G → T w nukleotydzie 676. Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. Jak wykazały ostatnie badania. Mutacje a) i c) występują u bydła francuskiego maine-anjou. które uszkadzają funkcję kodowanego białka. przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia.symbol CLPG. nazwany callipyge (z greckiego calli — piękne.

owca fińska). w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to. odpowiedzialnej za dużą plenność owiec rasy merynos booroola. uwarunkowaną genami o addytywnym efekcie. . ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang. Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB. że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. zawierającego miejsce mutacyjne. polegającą na tranzycji adeniny na guaninę. W przeciwieństwie do owiec ras wysokopiennych (owca romanowska. gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II).u owiec rasy romney. wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80. u których zwiększona plenność jest cechą poligeniczną. produkt PCR nie strawiony) dla homozygoty typu dzikiego. Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych. Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB. będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego. Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie). W locus BMPR-IB wykryto mutację w 830 nukleotydzie. trzy prążki (110 pz. „Thoka" u owiec islandskich. 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz. Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. fecundity gene of booroola). której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego.

lecz zbiorowości określonej jako populacja. Podstawowym prawem genetyki populacji. Hardy'ego i niemieckego lekarza W. Hodowla jest działalnością genetyczno-populacyjną. jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G. 8. 198 . mimo iż dotyczyły nieraz grupy zwierząt. teoretycznie nieskończona liczba osobników.Rozdział Podstawy genetyki populacji Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia. Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników. Prawo równowagi genetycznej Struktura genetyczna populacji Populację tworzy określona.1. Rozpatrując daną cechę można powiedzieć. Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową. w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki. Populację stanowią zwierzęta należące do jednego gatunku. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. Weinberga.H. mogące się rozmnażać i występować na danym obszarze. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej. Ponieważ badacze ci działali niezależnie od siebie. prawo to nosi nazwę Hardy' ego-Weinberga. że każdy osobnik ma określony fenotyp. tak więc w populacji występuje określona liczba fenotypów. opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów.

natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). W genotypach 250 ptaków białych jest 500 alleli a. W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych. podobnie frekwencja allelu a = 1000/2000 = 0.z których każdy reprezentowany jest przez pewną liczbę osobników. Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów. Oba te elementy są od siebie zależne. to: 199 . które ten allel mógłby zająć w badanej populacji. każdy ma dwa allele). Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. Sposób postępowania obrazuje poniższy przykład. Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów. Częstość występowania (frekwencja) allelu A = 1000/2000 = 0. 250 ptaków czarnych ma w swych genotypach 500 genów A. oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. Jeśli frekwencję allelu dominującego oznaczymy symbolem p. Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca: Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków. a allelu recesywnego symbolem q. Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci. Suma frekwencji wszystkich fenotypów równa się l lub 100%. ptaki niebieskie mają 500 genów A i 500 genów a.5 (50%). Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu. Suma frekwencji obu alleli wynosi l (100%). inaczej frekwencja danego fenotypu. Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). Zatem w stadzie tym jest 1000 alleli A i 1000 a. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego. Częstość występowania. 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim).5 (50%).

które mówi o tym. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci. a' zdarzają się również migracje i mutacje. frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie. losowo kojarzącej się populacji. wówczas struktura genetyczna w pokoleniu potomnym będzie następująca: czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. zatem rozkład fenotypów i genotypów w tej populacji wynosi: Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). które wpływają na zmianę struktury genetycznej populacji.Rozpatrywana cecha dziedziczy się z niezupełną dominacją. jeśli nie działają czynniki naruszające równowagę. że: w dużej. a osobniki charakteryzują się równą płodnością i żywotnością. 200 . Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci. bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna. O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej. Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga. w której frekwencje genów u obu płci są jednakowe.

łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q. Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q.09.7. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący: 201 . Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej. Wiedząc.2. Frekwencja genów i genotypów w przypadku dominowania W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. że frekwencja homozygot recesywnych wynosi q2. która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0.3. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych.3 = 0. W stadzie tym prowadzone są kojarzenia losowe. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych. 8. jak i genów stwarza pewne trudności.(EdEd) lub heterozygotyczne (Ede). że w przypadku losowych kojarzeń rozkład genotypów jest następujący: łatwo jest obliczyć frekwencję pozostałych genotypów: W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot.8. że zawierają jedynie allele recesywne. gdyż w ich przypadku wiadomo na pewno. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0. Zatem obliczanie frekwencji zarówno tych genotypów. Pozostałe 910 krów ma genotypy homo. Wiedząc. a 90 czerwonych.

U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C. 13 himalajskich i 2 albinosy. W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa). 8-1): 202 . w której są kojarzenia losowe. W populacji tej. himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc). q dla genu dla genu c. fenotypy. Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli. Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. genotypy i ich frekwencja są następujące (tab.q. Frekwencja poszczególnych fenotypów wynosi zatem: Frekwencję genów oznaczono symbolem p dla genu C.przy czym p.

(q + r) równa się: Frekwencję genu c = r można obliczyć. że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi: Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego.114. stąd r = = 0.013. znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc). W danym przykładzie r2 = 0. Podstawiając dane liczbowe. Frekwencję genu można obliczyć następująco: W badanej populacji królików frekwencja genów umaszczenia jest więc następująca: 203 .Po dodaniu takich samych genotypów uzyska się rozkład: Z zestawienia tego wynika.

który ją warunkuje). lecz przyjmie postać: przy czym A jest genem dominującym. których liczba w genotypach jest jednakowa bez względu na płeć osobnika.ogółem = 1.08. Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu. U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi: U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu: 204 . Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym. U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm. jak i u mężczyzn.4.000 8. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet. geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej. natomiast a — jego recesywnym allelem. czyli zgodna z rozkładem dwumianowym. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0. U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych.

Ekspresja fenotypowa mutacji. może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus. 8. Analogicznie. Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie: 205 . W rozdziale dotyczącym mutacji podano. pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ). umaszczenie zwierząt futerkowych. jego frekwencja zmaleje o wartość równą up.= p = 0. z wyjątkiem doboru. ale będą nosicielkami genu daltonizmu (Dd). Jeśli zmutuje jeden z genów addytywnych. Jeśli zmutuje allel dominujący. Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. selekcja. zależy od genetycznego uwarunkowania danej cechy. mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji. dobór par do kojarzeń i dryf genetyczny. powodująca pojawienie się nowej barwy okrywy włosowej. Czynniki naruszające równowagę genetyczną Do czynników naruszających równowagę genetyczną populacji należą: mutacje.92 d. iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u. która może wpłynąć na zmianę struktury genetycznej populacji. mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq. Natomiast mutacja genu warunkującego cechę jakościową. w której mutacja wystąpiła. np.5.D. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej). migracje.08 Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64. Wszystkie te czynniki. natomiast częstość mutacji odwrotnej symbolem v. 1472 kobiety będą rozróżniały barwy.= q = 0. kontrolujących cechę ilościową. wpływają na zmianę frekwencji genów i genotypów. Mutacje Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. o tyle pozostałe czynniki są związane z jego świadomą działalnością. W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ). ale także mogą się pojawić nowe allele. O ile mutacje i dryf genetyczny nie zależą od hodowcy. pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD).

Ede = 2pq = 0. W wyniku mutacji genowej. ee = q = 0.49.66. ee = q2 = 0. Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji) 206 . Jeśli jest to zabieg jednorazowy.14 alleli Ed zmutowało w kierunku allelu e. doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw. w przypadku wielokrotnego krzyżowania. Ede = 2pq = 0. po mutacji: EdEd = p2 = 0. czyli ustali się nowy układ genetyczny.42. W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja. zatem migracja nie zawsze wiąże się z wprowadzaniem osobników. Migracje Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu.09. a 6 alleli e w kierunku allelu Ed. krzyżowanie wypierające). natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0. Natomiast krzyżowanie uszlachetniające. może ona dotyczyć wprowadzania nasienia.1.4356.7. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia. Może nawet. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0.4488.34. Przy krzyżowaniu różnych ras w zależności od tego. które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną. powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. Zmianie uległa także frekwencja genotypów. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów.3.1156. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji. i wyniosła 0.Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0. po pewnym czasie populacja wróci do równowagi. ile razy dokonywane jest to krzyżowanie. allelu czerwonego umaszczenia e = q = 0. wielkość zmian frekwencji genów i genotypów jest różna.

zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy.9.74 czyli wzrosła o 0. które hodowca zamierza pozostawić do hodowli. jakie geny czy genotypy są preferowane.2 • 0. a frekwencję genu u osobników wprowadzonych do stada literą p'.5476. Ede = 2pq = 0. 207 . wprowadzono 20 krów.74) = 0. to część osobników rodzimych będzie równa (1 —m). nazywany jest selekcją.4. ee = q = 0.9 + (l -0. stanu zdrowotnego.49. w którym frekwencja allelu Ed wynosiła 0. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej. Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0. Nowa frekwencja allelu e wynosi (1 — 0. E'e = 2pq = 0.oznaczymy literą m. z frekwencją allelu Ed wynoszącą 0. ee = q2 = 0. zmalała osobników heterozygotycznyh Ede i homozygotycznych ee.42.26.7 = 0. Zmiany w strukturze genetycznej populacji zależą od tego. Selekcja Wybór zwierząt.18. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy.0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd. ee = q= 0. Hodowca preferuje geny korzystne.09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0.01. E d e = 2pq = 0. Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0.81. obniżenia płodności i produkcyjności lub niepożądanego genotypu. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji.2) • 0. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0. że do omawianego wcześniej stada liczącego 100 krów. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku.7. a eliminuje z populacji zwierząt geny niepożądane.3848.

prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. Współczynnik ten może przybierać wartość od O do l. w którym frekwencja allelu bezrożności wynosi 0. zależy od rodzaju tej selekcji. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego: Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0. to oznacza. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym. Załóżmy. Efekt selekcji zostanie zachowany. Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji. że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. Dobór par do kojarzeń W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe. Jeśli współczynnik selekcji będzie wynosić 0. czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled). będącą jej konsekwencją. W pewnym stadzie.8. prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. gdy usuwane są wszystkie niepożądane genotypy. wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. zmianę częstości genu recesywnego. wartość l współczynnik osiąga. złożonym z 1000 ptaków. wówczas frekwencja genu tworzącego ten genotyp wyniesie: wzoru: Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną.4. będąca konsekwencją selekcji.187. gdy nie ma w ogóle selekcji. co oznacza. Cecha ta dziedziczy się z dominacją zupełną. można obliczyć ze Jeśli natomiast selekcja preferuje genotyp recesywny. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie. zastosowano kojarzenia w obrębie takich samych 208 . że wartość O jest wówczas. Zmiana frekwencji genu.013 i wyniesie 0.Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. że w omawianym już wcześniej stadzie kur andaluzyjskich.

na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji. koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi. pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt.5 (allel A) i q = 0.5 (allel a). można przeprowadzić obliczenia: Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji.5 Aa + 0. W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej 209 . gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami.25 AA + 0. stado powróci do stanu równowagi genetycznej. W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0. W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0. Niekiedy. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych. stosowane są kojarzenia osobników spokrewnionych.genotypów. Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych.25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie Frekwencja genów pozostała nie zmieniona. Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. iż kojarzono koguty czarne z kurami czarnymi. ojca z córką czy matki z synem. Odwrotna sytuacja zaistniałaby. Aby się o tym przekonać. np. Oznacza to. maleje natomiast częstość genotypów heterozygotycznych.

która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt. Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego. żywotności czy ujawnienie się wad dziedzicznych. to w następnym pokoleniu ustali się nowa równowaga genetyczna. szczepów wsobnych. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej. w której frekwencja genu dominującego wyraźnie wzrośnie. iż allele niekorzystne z reguły są recesywne. Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. szczególnie niebezpieczny może być wzrost homozygot recesywnych. Dryf genetyczny Dryf genetyczny. Biorąc pod uwagę. iż w potomstwie uzyskamy 5 osobników homozygot dominujących. Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać. Szczepy wsobne są wykorzystywane w badaniach biomedycznych. 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. polega na zmianie frekwencji genów i genotypów w małych populacjach. w których działa on najsilniej. że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych. zwłaszcza w małych populacjach. Jeśli było to jednorazowe zaburzenie. tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210 . Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać. 8. zjawisko tak nazwane przez Wrighta w 1931 roku.brat x siostra) prowadzą do wytworzenia tzw.6. jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. w których stopień homozygotyczności jest bliski 100%. to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach. Może jednak się zdarzyć tak. Im większa jest pula genów w jakiejś populacji. którego skutkiem będzie zmniejszenie płodności. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych.

esterazy. Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini. amylazy. Wartość tego parametru zawiera się w granicach od O do l. na przykład warunkujących antygeny erytrocytarne. można także przedstawiać ją w procentach. zalecane jest monitorowanie zmian w strukturze genetycznej populacji. czyli markery genetyczne klasy II). ceruloplazminy czy anhydrazy węglanowej. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru: 211 . czego wynikiem będzie utrata zdolności adaptacyjnych. może dojść do znacznego ograniczenia puli genów. Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności. Na skutek długotrwałej selekcji. należące do markerów genetycznych klasy I. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych. By temu niekorzystnemu zjawisku zapobiec. które zachodzą w wyniku pracy hodowlanej. zwłaszcza w małych populacjach. Mogą to być loci kontrolujące syntezę transferyny.wych. opisanych w rozdziale: Markery genetyczne. różne typy białek surowicy krwi czy enzymy erytrocytarne.i mikrosatelitarny. albuminy.

które cechuje duża zmienność genetyczna. jak i polimorfizmu białek i antygenów erytrocytarnych. należy znać frekwencję wszystkich alleli w danym locus: Dystans genetyczny Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw. tak na podstawie polimorfizmu sekwencji mikrosatelitarnych. By obliczyć wartość PIĆ. a także między populacjami w obrębie gatunku. najczęściej stosowany jest wzór: Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów. complete linkage method) lub skupienia parami — UPGM (ang. 212 .Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. polymorphic Information content). Do szacowania dystansu genetycznego (Dr). Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi. na przykład: najbliższego sąsiedztwa — SLM (ang. obliczonych różnymi metodami. najdalszego sąsiedztwa — CLM (ang. unweighted pair group method). służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. single linkage method). O markerach genetycznych jest mowa w innym rozdziale. Szacowanie dystansu genetycznego i wybór ras. Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci.

219 z linii Palasa. 213 . 1997).. Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM.39 oraz Palasa a Partnera 0. Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych. a także między linią Banata a Celebesa i Probata. Partnera a Banata 0.Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp. wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0. 8-1). Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa. Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III. Analizą objęto 141 koni z linii El Paso. najmniejszy między linią Celebesa a Probata. 150 z linii Banata. Na przykład.37 (ryć. 146 z linii Partnera i 202 z linii Bandosa.32. 146 z linii Celebesa. Prace i Materiały Zootechniczne. 50:111-120. Palasa a Partnera. 369 z linii Probata.

.

opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji). Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS . . wykorzystując wzór: gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1. Im mniejsza zmienność genetyczna w danej populacji. odcisk palca DNA. tym większa wartość tego współczynnika. band sharing).ang. opisaną w rozdziale: Metody analizy i modyfikacji genomu. W wyniku analizy polimorfizmu minisatelitarnego (tzw. że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA. określający prawdopodobieństwo. a także metodę RAPD.Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne). W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej.

w tym u wszystkich krokodyli. Płeć może zależeć od warunków środowiska zewnętrznego. behawioralna determinacji płci. Wśród ryb spotyka się również gatunki. Z kolei u niektórych gatunków ryb zachodzi tzw. Ten typ determinacji płci obserwuje się u wielu gatunków gadów. U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ). a w przypadku ptaków Z oraz W.1. Determinacja płci ssaków Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw. a samice heterogametyczne (układ Z W). Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie.Rozdział 9 Determinacja i różnicowanie płci oraz interseksualizm Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów. w jakich rozwijają się zarodki. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. U ssaków płcią heterogametyczną są samce (układ XY). 9. 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. czyli zmieniają one płeć w ciągu życia. głównie temperatury. mają gonady męskie i żeńskie. tzn. które są hermafrodytami sekwencyjnymi. U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci. a płcią homogametyczną są samice (układ XX). płeć chromosomowa. wielu gatunków żółwi i niektórych gatunków jaszczurek. W przypadku ssaków wyróżnia się chromosomy X oraz Y. płci gonadowej i 3) uformowanie się wewnętrznych 216 . Zwierzęta takie są zazwyczaj obojnakami.

Pojawiają się one w endodermie pęcherzyka żółtkowego. Pleć fenotypowa obejmuje również zmiany powstające w mózgu.i zewnętrznych cech płciowych — powstanie tzw. Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym. Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. 9-1). pici fenotypowej (ryć. a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe. 217 . które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego.

Badania cytogenetyczne prowadzone u ludzi dowiodły. Wiadomo o nich. oprócz kory nadnerczy. Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. które pełni rolę czynnika transkrypcyjnego. a część korowa w jajniku. SF1. sex determining region Y). W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi. Od końca lat 50. do grupy białek określanych skrótem HMG (ang. że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. także w niezróżnicowanej gonadzie. 9-2). SRY. Fgf9. Produkt tego genu miał odpowiadać za tzw. a w tym: WT1. Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9. w przeciwieństwie do jajnika. przełączenie rozwojowe. Produktem tego genu jest białko zawierające tzw. Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y. Badania molekularne pokazały. polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej.Dotychczasowe badania wykazały. czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. steroidogenic factor 1) koduje białko receptora jądrowego. którego locus występuje w chromosomie Y. testis determining factor) — czynnik determinujący jądro. ZFX i FOXL2. regulującego ekspresję hydroksylaz steroidowych. podobnie jak białko SRY. wiadomo było. Gen WT2 (ang. Gen ten podlega ekspresji. high mobility group). Gen SF1 (ang. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. którego produkt należy. SOX9. że jest tam zlokalizowany gen TDF (ang. W rosnącej gonadzie wyróżnia się część korową i rdzeniową. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. że funkcja tego genu jest tożsama z funkcją genu SRY (ang. W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). 218 . Białko kodowane przez ten gen składa się z trzech regionów (ryć. że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów. palce cynkowe. gdzie obserwuje się zanik jego ekspresji. że pełnią funkcję czynników transkrypcyjnych. Przyjęto.

a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9). Bardziej szczegółowe dane wskazują. które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne. że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9. Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika. że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. aniżeli w odniesieniu do jądra. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. pełni funkcję czynnika transkrypcyjnego. tak jak białka WT1 i SOX9. Z testosteronu powstaje dihydrotestosteron. wysepka CpG). w momencie kiedy rozpoczyna się proces formowania gonady męskiej. Ekspresja tego genu zachodzi w komórkach Sertolego. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza. który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego. Z przewodów Wolffa rozwinąć się mogą nasieniowody. określanego także jako hormon antymiillerowski (ang. a drugi rozwija się. a jego produktem jest jądrowy receptor dla hormonów. Bardzo ciekawe jest również to. Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. również położonemu w chromosomie X. że jego locus występuje w chromosomie X. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron. odpowiada za prawidłowe różnicowanie się gonady męskiej. w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1. gen palca cynkowego). Kaskadowe włączanie tych genów. czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. a z przewodów Miillera — jajowody i macica. który podtrzymuje rozwój przewodów Wolffa. Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej). że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. Wiadomo. niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik. Białko SRY. anti-Mullerian hormone — AMH). składający się z 79 aminokwasów. oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). Miillerian inhibitor substance). odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. Obecnie większą rolę przypisuje się genowi ZFX (tzw. po pojawieniu się produktu genu SRY. Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. Gdy gen SRY jest nieobecny. ma strukturę podobną do białek z grupy HMG. omówiony wcześniej.Region środkowy. W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu 219 . Początkowo przypuszczano.

Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). Jeśli w genotypie wystąpi delecja tego locus. to rozwój w kierunku męskim nie jest zakłócony. Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. macicę i górną część pochwy. lub do zahamowania podziału mejotycznego. Zakłada się. gen RBM (ang. to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X.kodującego testosteron. że w chromosomie Y poza genem SRY. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. występują także inne geny. gen Ube1Y (ang. Gen ten umiejscowiony jest w obu chromosomach płci. Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1). W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody. np. Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y. oznaczających czynnik odpowiedzialny za powstanie azoospermii. czyli brak plemników w ejakulacie. których ekspresja związana jest z przebiegiem spermatogenezy. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro). Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. W regionie tym występują geny. Jego nazwa pochodzi od słów angielskich azoospermia factor. jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. Znane są też geny położone w innych częściach chromosomu Y. który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej. 220 . RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. w których genotypie występuje duplikacja locus DSS (DAX1). Szczególnie istotną częścią chromosomu Y jest region AZF. czy też klonowania. Należy również zwrócić uwagę. samic biorczyń. U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. np. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci. takich jak całkowity brak spermatogoniów. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. splicing) mRNA. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa.

Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego. co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu. w którym powstały połączenia naczyniowe. że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. frymartynizm). Interseksualizm Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego. które określa się terminem interseksualizmu lub obojnactwa. Frymartynizm Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów.2. ze względu na bardzo duże zróżnicownie obserwowanych zmian. niż to wcześniej zakładano. głównie przeżuwaczy. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian. że informacja genetyczna zawarta w chromosomie Y jest bogatsza. który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach. Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy. często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy. Z przedstawionych wyżej informacji można wyciągnąć wniosek. w którym kształtują się jajniki. 9. co w konsekwencji prowadzi prawie zawsze do niepłodności. to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony. to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci 221 . Połączenie krwiobiegów bliźniąt różnopłciowych sprawia. kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych.ubiąuitin activating enzyme-1). Jeśli połączenie łożysk dotyczy płodów różnopłciowych. W rozwoju embrionalnym różnicowanie się jąder poprzedza okres. kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski.

Ze względu na wspólną cyrkulację krwi u płodów. dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. Z tego powodu we krwi frymartynów. Szacuje się. Powstawanie anastomoz jest bardzo często stwierdzane u bydła. stwierdza się obecność dwóch linii komórkowych — jednej własnej. szczególnie wówczas. Okazuje się. a w drugiej układ XY. wskaźnik niepowtarzalności rui itp. to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. gdy zewnętrzne narządy płciowe są prawidłowo uformowane. a często u owiec (od 40 do blisko 100% ciąż. sekwencje mikrosatelitarne). a także samców będących bliźniętami frymartynów. w mniejszym lub większym zakresie. Trzeba podkreślić. Bardzo pomocne okazało się badanie cytogenetyczne.) są często obniżone. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. których łożyska są połączone anastomozami. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy. obraz nasienia. Znacznie rzadziej zdarza się to u owiec (od l do 10%. może być wskazówką. a drugiej współbłiźniaka. zależnie od rasy). polegające na ustaleniu zestawu chromosomów płci w leukocytach. proces kształtowania się zewnętrznych narządów płciowych. ale także molekularnych (np. Wówczas dihydrotestosteron. a w ślad za tym drogi płciowe będą miały charakter męski. Chimeryzm dotyczy również erytrocytów. które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. chociaż parametry określające ich przydatność rozpłodową (np. powstający z wydzielanego przez komórki Leydiga testosteronu. Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany. Buhaje takie mogą być wykorzystywane w rozrodzie. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych. a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. Identyfikacja sekwencji typowych dla chromosomu Y (np. że badany osobnik jest frymartynem. że prawie we wszystkich przypadkach. zależnie od 222 . Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo.żeńskiej w takim stopniu. może zakłócić. że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż). Możliwe jest również powstanie połączeń. Ponieważ linie te pochodzą od dwóch różnych genotypów. przy jednoczesnym ich braku np. w komórkach błony śluzowej. Linie te różnią się układem chromosomów płci — w jednej występuje układ XX. że badania kliniczne samic są niewystarczające. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych. stwierdza się niepłodność samic frymartynów. że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy. że rozwinie się nawet gonada męska. w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę. Biorąc jednak pod uwagę. niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych. dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie.

Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. Zespół niewrażliwości na androgeny Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. Z jednej strony mogą to być aneuploidie. a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. w które są zaangażowane chromosomy płci. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad.5% (bydło) do kilku procent (niektóre rasy owiec. Charakteryzowały się one gorszym tempem wzrostu. XYY lub XXX). w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie. co oczywiście prowadziło do bezpłodności. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). Z drugiej strony ważną rolę odgrywają mutacje strukturalne. że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera. w zakresie od 0. Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. Mutacje chromosomów płci Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. Z badań przeprowadzonych na owcach wynika. a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników.rasy). Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY. wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY. Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie. Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. Konsekwencją występowania 223 . Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. miały niedorozwinięte jądra. merynos booroola). które są fenotypowo prawidłowo rozwinięte. np. Kilkanaście takich przypadków opisano u buhajów.

Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane. STS). zespół odwróconej płci (ang. sex reversal). U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX. Badania molekularne genów położonych w chromosomie Y. a stopień 224 . a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp.nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie. chociaż zdarzają się zwierzęta z powiększoną łechtaczką. Najczęściej zespół ten diagnozowany jest u fenotypowych samic. Osobniki takie powinny być samicami. że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze. Taki typ odwrócenia płci spotykany jest również u kóz. ZFY. przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem. co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim. Przyczyny takiego stanu mogą być różne. w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego. które mają układ chromosomów XY. a wśród nich należy wymienić: mutację w locus SRY (np. jak i wewnętrznych cech płciowych. Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. z wykorzystaniem techniki PCR. przy jednoczesnym braku kluczowego genu SRY. świń i psów. ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL. a w ich genotypie nie stwierdza się genu SRY. Zespół odwróconej płci u koni W hodowli koni częstym typem interseksualizmu jest tzw. ale z powiększoną łechtaczką. który uznawany jest za niezbędny do rozwoju gonady męskiej. tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych. który polega na niezgodności między płcią fenotypową i chromosomową. które mają układ chromosomów płci XX. a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. W genotypie tych zwierząt nie ma genu SRY. Interseksualizm bezrogich kóz Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder. od prawie typowo samczych do samiczych. Bezrożność kóz uwarunkowana jest przez dominujący allel P. częściowa lub całkowita delecja). Okazało się.

że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek. co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym). zlokalizowana w niekodującym fragmencie DNA. Choroba białych jałowic Innym przykładem genu o działaniu plejotropowym. że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. że kariotypy obu gatunków są prawie identyczne. allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). że jest on położony w chromosomie l — w części dystalnej. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. Można z tego wyciągnąć wniosek. Z badań porównawczych wiadomo. Gonady zazwyczaj mają strukturę jądra. Okazało się. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe.nasilenia tych zmian jest bardzo zróżnicowany. jest allel R genu Roan (umaszczenie dereszowate) u bydła. również w zakresie układu loci w chromosomach. ale w części proksymalnej (w pobliżu centromeru). a w ich genotypie występuje gen SRY. że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci. Allel R odpowiada za powstanie białego umaszczenia. czyli mających układ chromosomów płci XY. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. Co więcej należy podkreślić. Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym. natomiast jajniki są rozwinięte prawidłowo. ukończono wieloletnie badania. U obu ras bydła stwierdzono. tzn. że odpowiedzialna za to jest delecja 11 700 par zasad. a rzadko jajnikojądra. Wreszcie mogą występować również osobniki. Zaburzenia te polegają na braku lub niedorozwoju pochwy. szyjki macicy i macicy. polledness and intersexuality syndrome). gen PIS — ang. W 2001 r. że locus genu bezrożności bydła został umiejscowiony również w chromosomie l. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm. Allele te prezentują typ dziedziczenia pośredniego. których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej. Zespół tych zmian jest określany jako choroba białych jałowic 225 . Ciekawe jest. z tym jednak że genotyp Rr+ wykazuje niepełną penetrację. które mają zdecydowanie samczy fenotyp. który jest odpowiedzialny za rozwój interseksualny.

Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła.XX. U zwierząt tych stwierdzano obecność jąder. Można natomiast przypuszczać. że powstanie gonady męskiej może nastąpić pomimo braku genu SRY. W potomstwie jednego knura pojawiło się kilkanaście obojnaków. bowiem ponad 90% chorych jałówek ma umaszczenie białe. Tło genetyczne tych przypadków jest słabo poznane. W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej. w których kariotypie występowały dwa chromosomy X. a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny. Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38. a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny). Sytuacja taka wskazuje. z tym jednak że łechtaczka była bardzo powiększona. Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym.3%. Przypuszcza się. Interseksualizm u świń Przypadki interseksualizmu u świń obserwuje się z częstością około 0. .XX/38. że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm. Zakłada się. który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. a srom tworzył z odbytem wspólny otwór (ryć. w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe. Badania chromosomowe wykazują. a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. pomimo nieobecności genu SRY. Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. 9-3 wkładka kolorowa). że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego. Locus tego genu został wcześniej zmapowany w regionie. white heifer disease).(ang. macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich. że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. w którym ostatnio umiejscowiono locus genu Roan. pomimo braku genu SRY w ich genotypie. gdzie gonady mają strukturę jądra lub jajnikojądra. że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38. Dotychczasowe obserwacje dowodzą. że genem roan może być gen kodujący czynnik wzrostu komórek tucznych. że choroba białych jałowic ma złożone podłoże. Wśród nich niejednokrotnie zdarzają się przypadki.XY.

wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato. jakim jest główny układ zgodności tkankowej.. heavy — H). Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał. usunięcie tych obcych białek.gamma 227 . ε .epsilon. Genetyczne podłoże różnorodności przeciwciał Immunoglobuliny.delta. są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. light — L). ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego. ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np.. czyli przeciwciała. Są one elementem odporności swoistej (nabytej. której celem jest zwalczenie. bakterii czy wirusów). 10. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna.Rozdział 10 Genetyczne podstawy odporności i oporności Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. o masie po 25 kDa. Ma on. iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje.alfa. γ .. Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. adaptatywnej). zdolność uczenia się. zapamiętywania. Zastanawiające jest. α . Jest pięć typów łańcuchów ciężkich (gr. reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm. δ . podobnie jak układ nerwowy.. mimo że ma tylko pięć klas przeciwciał. po 50 kDa każdy. połączonych z dwoma łańcuchami lekkimi (ang.1.

Stosunek przeciwciał. Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin. IgE. constant — C). których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. complementarity determining regions CDR). znajduje się tzw. iż informacja genetyczna 228 . u myszy l: 20.. natomiast A. variable — V) oraz części stałe (ang. Zarówno łańcuchy ciężkie. G i M od symboli łańcuchów ciężkich. jak i lekkie mają części zmienne (ang. Ponieważ regiony te determinują swoistość przeciwciał. IgD. 10-1). E. u koni l: 25). utworzonej przez łańcuchy ciężkie.mi) i dwa typy lekkich (κ— kappa i λ. u ludzi wynosi on 70:30. W części zmiennej znajdują się trzy regiony hiperzmienne (ang. region zawiasowy (ang. nazywane są także regionami determinującymi dopasowanie (ang. w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie. które mają łańcuch lekki typu κ. D. IgG i IgM. Badacz ten odkrył. Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi. hinge region). W części stałej łańcucha ciężkiego. HV2 i HV3. oznaczone HV1. — lambda). Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku. między domeną CH1 i CH2. a wzdłuż jej ramion znajdują się łańcuchy lekkie. hypervariable). Przeciwciało ma kształt litery Y (ryć. Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA. do łańcucha λ zależy od gatunku (np.i μ .

Część stała obu rodzajów łańcuchów jest kodowana przez gen C. Przypuszczalnie jest wiele genów kodujących region V. ich swoistość wynikają z tego. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang.. kilkadziesiąt genów D i kilka genów J. zachodzące dzięki aktywności enzymu — rekombinazy. Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. natomiast geny łańcucha lekkiego typu κ w 2. dla lekkiego — kilka. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V. natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A. iż dziedziczone są nie całe geny immunogłobulinowe. natomiast łańcucha ciężkiego przez trzy geny: V. typu λ w 22 chromosomie. Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla. Rekombinacyjne łączenie się genów. ] i C. jest głównym źródłem różnorodności przeciwciał. przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V. których kolejność łączenia się jest następująca: gen D z genem J. Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów. a łańcuchów lekkich z rekombinacji regionów V. Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. D. 229 . Różnorodność przeciwciał. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. diversity) i J. D (ang. które nazwał segmentami. u myszy natomiast odpowiednio w chromosomach 2. czyli połączeniu się segmentów po jednym z każdej grupy minigenów. Proces syntezy przeciwciała następuje po skompletowaniu genów. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D. Geny determinujące region C różnią się od pozostałych tym. 10-2).immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów". powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt. joining). ale ich segmenty. a nie na jego powinowactwo do antygenu. 6 i 16. variable) i J (ang. może kilkaset). J i C. następnie z genem V. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. Różnorodność przeciwciał wynika z wielu przyczyn. że wpływają na funkcję przeciwciała. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie. 6 genów funkcjonalnych i 3 pseudogeny regionu J. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen.

oraz odpowiedzi typu humoralnego 230 . Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu. Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego. tym samym liczba wariantów genu D] może być zwiększona około 10 razy. Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu). które razem stanowią przeciwciało. V-D i D-J) mogą być wstawiane nukleotydy (od l do 15). insercje lub konwersje.Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J. Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). 10. powodujące zmianę pojedynczego aminokwasu. atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T). natomiast genu VDJ następne 10 razy. przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego. Ponieważ są to nowo powstałe odcinki DNA. bądź też usuwane (do około 20 nukleotydów). rzadziej natomiast delecje. Genetyczne podłoże różnorodności receptorów limfocytów J W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B. prowadzi to do zmienności na złączach i utworzenia nowego genu. Najczęściej są to mutacje punktowe. będące specyficznym receptorem tego limfocytu.2.

II i III. cytotoksyczne CD8. który kontroluje ich syntezę. odpowiedzialnych za przyjęcie przeszczepu. zachodzi podobnie jak rekombinacja genów przeciwciał. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2. Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej.5 x 106 α-β heterodimerów. Badania polegające na przeszczepach skórnych 231 . 2 regionów D i 12 genów dla łańcucha β-J. Podobnie. Prowadzone w latach 30. przez Petera Gorera poszukiwania innych antygenów grupowych krwi. Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ. które odpowiadają za syntezę przeciwciał. Główny układ zgodności tkankowej — MHC Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi.3. że wszystkie elementy genów są włączone w rearanżacje. 10. doprowadziły do wykrycia grup (klas) antygenów oznaczonych I.(Th — pomocnicze limfocyty T). który następuje podczas dojrzewania komórek T w grasicy. Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie. jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. D i J (łańcuchy p i §). Limfocyty pomocnicze mają receptory CD4. Proces rearanżacji elementów genów receptorowych. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ). liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. Poprzez proces rearanżacji genów. podobnie jak limfocyty B. około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V. Oczywiście jest mało prawdopodobne. Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V. Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I.

Tabela 10-1 Lokalizacja MHC i nazwa u poszczególnych gatunków 232 . Natomiast inny antygen. W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał. wykazały. zwłaszcza transplantacji szpiku kostnego. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i. Nawet wówczas.między tymi liniami. H-l. Zatem jest on przekazywany przez ojca męskim potomkom. major histocompatibility complex — MHC). Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. nazwany Mta (ang. H-5 i inne. iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska. U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców). gdy biorca i dawca są zgodni pod względem haplotypów MHC. minor histocompatibility loci). gdyż gen kodujący go jest zlokalizowany w chromosomie Y. słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. Antygeny te są istotną barierą podczas transplantacji tkanek. maternally transmitted antigen). Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. H-3. a tylko w niewielkim stopniu od innych loci. często ich efekt jest niedoceniany. jak i ilościowej. być może dlatego. natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC. że większość z nich znajduje się w chromosomie 2. pochodzi tylko od matki. ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech). wykonywanych dla kilkunastu kolejnych pokoleń. nazwanych słabymi antygenami zgodności tkankowej (ang. Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej. Antygen H-Y występuje tylko u samców.

Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną. są wysoce polimorficzne.Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. w populacji istnieje bardzo duża liczba różnych haplotypów. jak już wspomniano. a wraz z nim — haploidalny genotyp MHC (haplotyp). II i III. U drobiu nie stwierdzono regionu klasy III. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym. należące do klasy I i II (np. 10. MHC u drobiu nazwano kompleksem B. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów. regionu K. często są one nazywane antygenami MHC. iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu. nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku.1. w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów 233 . Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka. 10-1). Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych. Zwłaszcza niektóre geny MHC. crossing over czy rekombinacji wewnątrzgenowych. Ponieważ MHC zawiera wiele genów oraz. Z powodu powiązań tego układu z układem grupowym krwi B. kodujący białka zlokalizowane na krwinkach czerwonych. Struktura i funkcje głównego układu zgodności tkankowej U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I. C i A u ludzi). rzadziej mutacji punktowych. jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt.3. a drugim podstawową funkcję — LA (tab. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku. Wykryto natomiast specyficzny region klasy IV. układ ten cechuje ogromny polimorfizm. leukocyte antigens — LA). D i L u myszy i B. powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I). będących glikoproteinami. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin.

zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach. a także w odrzucaniu przeszczepu. N-końcowy fragment łańcucha ciężkiego. które kodują miejsce wiązania peptydów. Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. Mimo iż początkowo uważano. Łańcuch ciężki jest kodowany przez geny MHC. Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. oznaczone symbolami αl. których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC. natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. że MHC pełni funkcję tylko w odrzucaniu przeszczepu. α2 i α3. że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego. w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. obecnie wiadomo. 10-3).• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie. wpływa na możliwość immunologicznego rozpoznania obcych białek. Domeny αl i α2 odznaczają się polimorfizmem. każda złożona z około 90 aminokwasów. który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T. co zostało już udowodnione. Łańcuch ciężki składa się z trzech części: • Najdłuższy. 234 . Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny. stanowi około 80% jego długości i znajduje się na zewnątrz komórki. W domenach tych występują alloantygeniczne miejsca. biorąc tym samym udział w reakcji przeciwko infekcji wirusowej. a więc w tych. Jest on kodowany przez geny MHC i ma trzy koliste domeny.

stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi. 235 . Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3. Cząsteczki MHC klasy II. Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β.zawierające determinanty specyficzne dla osobników. śródbłonowej i wewnątrzkomórkowej. podobnie jak łańcuch ciężki cząsteczki klasy I. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie. składają się z trzech części: zewnątrzkomórkowej N-końcowej. które następnie są prezentowane limfocytom T. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I. Łańcuchy te. Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin. oznaczonych symbolami α i β. Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. 10-4). Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. które są między nim a błoną komórkową. regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. przechodzący przez błonę komórkową. kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. który leży w cytoplazmie komórki. • Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy. • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy). komórki den-drytyczne i limfocyty B). W rowku tym wiązane są antygeny.

Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. jak i klasy II prezentują obcy peptyd (antygen) limfocytom T. Główny układ zgodności tkankowej myszy Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy. C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III. I. złożony z kilku aminokwasów peptyd. gdyż ich miejsce wiążące pozostaje otwarte z obu stron. Badania sekwencji genu Qa-2. Jednak cząsteczki klasy I mogą wiązać jedynie krótki.3. od kilkunastu do ponad 20 aminokwasów. u myszy natomiast przez loci regionu S w obrębie H-2. Pierwotnie w MHC u myszy zidentyfikowano regiony K. Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu.1. 10-5). Białka te są oznaczane literą C (ang. Natomiast produkty genów kompleksu Tlą i Qa wyka- 236 . Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I. Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). klasyczne cząsteczki klasy I. kontrolujących syntezę klasycznych białek MHC klasy I. które określono symbolem H-2 (ryć. Dotychczas wykryto co najmniej 15 genów klasy la. complement) i liczbą. W jego skład wchodzą białka surowicy i płynów tkankowych. oznaczane symbolem la). Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości. Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. S i D. Białka C2. a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka. których jest łącznie z czynnikami regulującymi około 30.1.3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC. z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib). a potem również zwierząt gospodarskich. niektóre z nich też biorą udział w odpowiedzi immunologicznej. 10. ponieważ mają zamknięte miejsce wiążące. Późniejsze badania ujawniły.Zarówno białka MHC klasy I.

znajduje się poza MHC. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%. u myszy w 2.3 i Tla zmapowano dotychczas 31 genów. natomiast u myszy z trzech eksonów. Główny układ zgodności tkankowej człowieka • U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny. bardzo istotny dla ekspresji produktów genów klasy I. immune response). z wyjątkiem H2-P. W regionie Qa-2. który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. przy czym trzy pierwsze . u człowieka w 15 chromosomie.1% całego genomu. -P. Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E.żują wiele różnic w porównaniu z antygenami transplantacyjnymi. zajmuje łącznie około 4 mpz DNA (4 miliony par zasad).2. DP.3. DOB/DNA i DM. w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom). 10-6). Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. w grupie sprzężeniowej z locus dehydrogenazy sorbitolu.1. Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I. Białka klasy III są kontrolowane przez geny regionu S. Każda podklasa ma co najmniej jeden gen łańcucha α i β. DR. oznaczone symbolem Ir (ang. natomiast cząsteczki kontrolowane przez loci HLA-E. Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A. 10. Struktura HLA przedstawiona jest na liniowym diagramie (ryć. Gen ten u ludzi składa się z ośmiu eksonów. -B i -C. Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S). -O/N oraz -M. Geny klasy II HLA znajdują się w pięciu podklasach: DQ. czyli ponad 0. -F i -G należą do nieklasycznych cząsteczek klasy I.

Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów. 314 alleli klasy II i 40 alłeli klasy III. Biorą one udział w proteolizie białek. Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów.in. HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka. białek transkrypcyjnych oraz białek nieprawidłowych. Odkryty niedawno locus DM jest nieco inny niż pozostałe. Stwierdzono na przykład. DOB/DNA. m. iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). białek szoku 238 . region klasy II HLA zawiera także geny. iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. mają tylko 2 allele.kodują klasyczne cząsteczki klasy II. determinuje syntezę nieklasycznych cząsteczek klasy II. -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC. bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I. Podobnie jak u myszy. Jest pewnym paradoksem. Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. Są to geny TAP1 i TAP2 kodujące peptydowe transportery. które strukturalnie nie należą do genów klasy II. Dotychczas wykryto 267 allełi klasy I HLA. -B. Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC.in. Nieliczne z genów MHC. co potwierdza fakt. m. że geny HLA-A. Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych. nie podlegających transkrypcji (np. podczas gdy czwarta podklasa. 10-11). na przykład DRA. geny dla 21-hydroksylazy (CYP21). jak i do genów klasy II.

1. Geny klasy I należą do dwóch grup — A i B. Struktura BoLA przedstawiona jest na rycinie 10-7.3. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany. Wiadomo jednak. Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami. w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych.3. główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt. Jest to najlepiej poznany chromosom bydła. Produkty genów klasy I są to klasyczne cząsteczki MHC. Jak wspomniano na początku tego podrozdziału.cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB). Główny układ zgodności tkankowej bydła Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie. Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111. który koduje krótki fragment transbłonowy łańcucha cząsteczki 239 . Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa. różniących się delecją 6 par zasad w eksonie 5. Na przykład homologia genów klasy II u ludzi i myszy jest następująca: myszy: ludzie: Aa Aβ DQα DQβ Eα Eβ DKα DRβ P O/N DP DOB/DNA M DM 10. iż homologia między poszczególnymi gatunkami i człowiekiem jest duża.

Główny układ zgodności tkankowej świni Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. Nie jest znana dokładna liczba genów klasy I SLA. że jest ich około 7-10. W obrębie klasy II obserwowany jest duży polimorfizm genów. że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. Regiony klasy I i II znajdują się blisko siebie. Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB.MHC. Homologia między genami BoLA i HLA jest stosunkowo duża. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś. DQA.4 cM. Region klasy II zawiera wiele genów. DRĄ i DRB. PD7 i PD14. Tylko kilka genów regionu klasy I wykazuje ekspresję. i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1. mają dużą homologię. różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC. których homologia wynosi około 80-85%. par zasad mniejsza niż w MHC u ludzi. natomiast DQA bydła i człowieka — 75% homologii. szacuje się. odległość między nimi wynosi 0. spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. w SLA 240 . 26 DQB i 31 DQA. Wydaje się. W locus DRB wykryto pseudogen (DRB1). w granicach 75-87%. Są to PD1. z odpowiadającymi im genami HLA. Niektóre geny. DQB. Podobnie jak u innych gatunków.

Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont. C2 i C4. 10-8). iż nie jest on funkcjonalny.6%. powodujące. w którym znajduje się główny układ zgodności tkankowej. podobnie jak u bydła. W regionie tym są także inne geny typowe dla tego układu (ryć. obok genów MHC znajdują się pseudogeny. znajdują się po jednym genie CYP22. 241 . ma długość 5. Dotąd nie sporządzono mapy fizycznej tego układu. 1996.Ryć. W regionie klasy III. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B. w przeciwieństwie do innych gatunków. Geny klasy II wykazują duży polimorfizm. 10-8. w którym stwierdzono delecję nukleotydu w kodonie 53. ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. w eksonach 3 i 4 znajdują się kodony „stop". Jest nim na przykład gen DRB2. W regionie klasy II. ovine aries). W wyniku mutacji. Mapa sprzężeniowa owczego chromosomu 20. a częstość rekombinacji między nimi wynosi 0. Najlepiej poznany jest pseudogen DRB2. ale można również spotkać określenie Ovar (ang. które wykryto w tym pseudogenie. Główny układ zgodności tkankowej owcy Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA. zmodyfikowano) znajdują się także pseudogeny.6 cM. przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ.

Jak już wspomniano przy omawianiu budowy cząsteczki klasy I. gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem 242 . a klasy IV — B-G. Długość tego regionu u owiec wynosi około 150 tyś. że jest on zlokalizowany również w tym chromosomie (ryć. Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. 10-9). Z kolei. Główny układ zgodności tkankowej kury U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y.Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. O ile funkcje regionów B-F i B-L są znane. Kompleks B znajduje się w 16 mikrochromosomie.około 0. że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców. Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz. które są klasyfikowane niezależnie. natomiast w odniesieniu do Rfp-Y większość badaczy uważa.5%. Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. przypuszcza się natomiast. klasy II — B-L. chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA. par zasad. częstość rekombinacji między skrajnymi loci tego układu -. częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21). Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). U drobiu nie ma regionu klasy III. Za typowy MHC uważany jest kompleks B. Region klasy I oznaczony jest symbolem B-F. o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. Badania MHC u drobiu koncentrują się na kompleksie B.

1. Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. Do badań serologicznych wykorzystywane są surowice lub. Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej.2. Związek MHC z odpornością na choroby Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe. przeciwciała monoklonalne. 10. badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis. dzięki której możliwe jest wykrycie obecności danego allelu MHC.3. Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii. U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane.3. tuberkulozę. jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. białaczkę.zgodności tkankowej.3. allele specific oligonucleotides — ASO). pozwalających na identyfikację określonej cząsteczki (białka. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości). 10-IV). 243 . Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań. Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC). 2) poprzez analizę molekularną DNA. 10. od pewnego czasu. inwazję kleszczy i pasożytów oraz trypanosomatozę (tab.3. poprzedzona amplifikacją danego frag mentu DNA (PCR).3. w którym używane są homozygotyczne komórki stymulujące. antygenu) MHC. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej. Znaczenie głównego układu zgodności tkankowej 10. • metoda RFLP. Na przykład. Udoskonaleniem tej techniki jest test HTC. Identyfikacja cząsteczek głównego układu zgodności tkankowej Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych. ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby.

2.2*8 — podatność 10. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej. Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje. haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3. kokcydiozę. mięsaka Rousa i cholerę ptasią.3. Na przykład.U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej.2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3. oprócz szczególnej roli w reakcji immunologicznej. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne. ale stwierdzono już jego związek z odpornością na raka skóry.3. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany. oddziałuje także na inne cechy (produkcyjne i reprodukcyjne). U bydła mlecznego stwierdzono istotne oddziaływanie niektórych 244 .

bez względu na to. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. Tutaj też następuje związanie cząsteczki MHC z peptydem. reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech. nie do końca został poznany. zależnie od rodzaju patogenu i miejsca infekcji. Dotyczyły one wpływu MHC na stopień owulacji. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń. obniżać stopień przeżywalności i masę ciała cieląt. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i.cząsteczek MHC klasy I na cechy związane z użytkowością mleczną. zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. po czym powstały kompleks transportowany jest na powierzchnię komórki. U koni natomiast stwierdzono. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji. Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością. jak dotychczas. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. Zasadniczą rolę w ich rozpoznaniu. W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe. odgrywają cząsteczki głównego układu zgodności tkankowej. przeżywalność zarodków i płodów oraz liczebność miotu.4. bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób. 245 . Wykazano wyraźny wpływ haplotypu rodziców na te cechy. natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC. 10. gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne. Zarys przebiegu reakcji odpornościowej W odpowiedzi na wniknięcie patogenów (wirusy. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu). czyli są degradowane do peptydów. przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków.

(b) prezentacja antygenu przez cząsteczki MHC klasy II 246 . które zabijają zakażoną komórkę (ryć. są rozkładane na peptydy w wakuolach (endosomach). 10-10a). Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej. Powstały Ryc. Peptydy te wiążą się z cząsteczkami MHC klasy II. które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne. makrofagi lub limfocyty B. Podczas infekcji bakteryjnej. Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny.nazywane inaczej zabijającymi. jeśli bakterie zostaną pochłonięte przez makrofagi. 10-10. przedostającymi się z siateczki śródplazmatycznej. Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I. mające na powierzchni cząsteczkę CD8. prezentując przede wszystkim obce antygeny.

Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. IgE lub IgA). Następnie peptydy te są wiązane przez cząsteczki klasy II. Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD. nieśność itd. określane jako Th2. chromatyna ulega kondensacji na obrzeżach jądra. które służą jako receptory antygenów. a raczej ich pojemność jest różna. 10-10b). W określonych przypadkach. Zdolność cząsteczek MHC do wiązania peptydów. a jej fragmenty są trawione przez sąsiadujące komórki. Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247 . Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8). Apoptoza (gr. Makrofagi wchłaniają. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek.kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). apoptosis opadanie) jest to programowana śmierć komórki. Jeśli bakterie zostaną pochłonięte przez limfocyty B. wkrótce potem jądro. degradują i prezentują wszystkie antygeny (ryć. w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze. po przedostaniu się na powierzchnię komórki.5.). prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. które dotarły tu z siateczki śródplazmatycznej. Utworzony kompleks. Genetyczna oporność na choroby Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność. czyli jej fizjologiczna śmierć. ale także oporności/podatności na choroby zakaźne i inwazyjne. które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. a następnie cała komórka pęka. 10-10b). Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek. ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć. 10. Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów. 10-10b). Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG. gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów. natomiast cząsteczka klasy II może ich związać dwa razy więcej. makrofagi mogą pełnić rolę pośrednią. jest rozpoznawany przez limfocyt pomocniczy T. które uległy apoptozie.

Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć. celowe jest zmapowanie tego genu. Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. Gdy cecha — wskaźnik oporności jest już wybrana. czyli określenie jego położenia w chromosomie. 248 . W przypadku gdy oporność na chorobę jest cechą poligeniczna. chociaż w przypadku niektórych schorzeń stwierdzono. Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową.kowanej oporności na choroby. Umożliwi to poznanie sposobu jej dziedziczenia. iż cecha oporności jest warunkowana pojedynczym genem. iż oporność na nie zależy od pojedynczego genu o dużym efekcie. następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. Jeśli okaże się. Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów. należy oszacować jej zmienność genetyczną. Na ogół jest to cecha poligeniczna. następnie sklonowanie go i poznanie sekwencji nukleotydów. np. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania. których celem jest znalezienie takich genów. Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. 10-11).

jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). Na przykład. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne. Y2/ D' i P'. i barwne upierzenie drobiu. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus. Znajomość cech określanych metodami serologicznymi. warunkowaną wieloma lub jednym genem. która prowadzi do śpiączki afrykańskiej (trypanosomatoza). wskazujące na większą niż u osobników białych oporność na choroby wirusowe. • cechy. Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową). Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze. umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. • cechy ustalane za pomocą badań molekularnych DNA. Na przykład. Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB. które są określane za pomocą testów serologicznych lub elektroforezy. jak i rasowe. u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B. a markerami genetycznymi. jak i techniki inżynierii genetycznej. związana z opornością na raka oczu. Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka. W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych.Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością. Sprzężenia takie są szczególnie korzystne w selekcji. gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. jak: • cechy eksterierowe (widoczne gołym okiem). Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi. rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. Choroba ta dziesiątkuje populacje bydła 249 . Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei. takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech. które mogą być wskaźnikami oporności na choroby. co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu.

której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych. Należą do nich stany zapalne gruczołu mlecznego (mastitis). Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby. Kokcydioza powoduje obniżony stopień wzrostu. enteritidis) sugerują. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. W Norwegii od 1978 roku mastitis jest już włączone jako cecha 250 . śmiertelność. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). typhimurium. Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. Obserwowane są zarówno różnice rasowe. a także. Ponadto świadczą one. S.afrykańskiego. nie zabezpieczając ich przed infekcją. Na przykład. krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej. Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach). Kokcydioza jest równocześnie przykładem choroby. gallinarum. zwłaszcza u młodych kurcząt. simentalery czy szwyce. S. Wyniki badań wrażliwości kur na bakterie Salmonella (S. z zachowaniem ich wysokiej produkcyjności. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę. zmniejszone wykorzystanie paszy. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie. które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. pullorum. S. Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. w tym przypadku jest to temperatura otoczenia. jak i indywidualne. iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. Zmienność podatności zwierząt na choroby najlepiej poznano u kur.

Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników. których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy. zbyt duża wielkość i niskie zawieszenie. Wiadomo. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. Innym schorzeniem u bydła. opartej na wskaźnikach fenotypowych oporności. że mastitis najczęściej występuje u krów. iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. oprócz wydajności.selekcyjna w programach hodowlanych. takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek. Jej występowanie stwierdzono na wszystkich kontynentach. ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków. Stwierdzono na przykład. jak również niekorzystnym warunkom środowiska (np. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. która w znacznym stopniu jest uwarunkowana genetycznie. Na podstawie licznych badań można sądzić. Wydaje się. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. kształt i wielkość wymienia oraz strzyków. Można zatem przypuszczać. wapń. w celu ograniczania występowania mastitis poprzez selekcję. ale także zakażenia przez łożysko. którego leczenie jest bezskuteczne. iż byłoby celowe prowadzenie selekcji pośredniej. jak: magnez. kobalt i mangan). charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. że skłonność do białaczki jest przekazywana przez rodziców. Wydaje się. a zwłaszcza przez chore matki. siarę i mleko oraz. wysokość zawieszenia wymienia i szybkość oddawania mleka. jest białaczka limfatyczna. za duże lub za małe strzyki. że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby. przez uprzednio zarażoną wirusem białaczki komórkę jajową. Z drugiej 251 . Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia. Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów. Ta metoda selekcji jest zalecana na przykład w Szwecji. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. co zostało udowodnione. niedobór niektórych pierwiastków. Podstawowymi kryteriami tej selekcji są. ustawienie strzyków.

Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna. Stwierdzono. coli jest opisane w podrozdziale: Mutacje genowe. Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt. lub też jako zdolność do współżycia z pasożytem (ang. że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie. w odróżnieniu od genetycznej zmienności oporności.6. przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. coli i F18 E. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne. co może być dowodem na dziedziczenie podatności na białaczkę. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem. że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę. resistance).jednak strony wielu badaczy stwierdzało. cieszy się mniejszym zainteresowniem wśród badaczy. . W tym miejscu należy podkreślić. ale także innych schorzeń.5-0. Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie. której wartość waha się w granicach 0. przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. na przykład schorzeń kończyn.

antygenowe determinanty białek surowicy krwi (allotypy). która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej. Przydatność markera zależy od tego. Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA. co zachodzi wówczas. Metody serologiczne wymagają stosowania surowic testowych. Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych. umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). temperatura. czy jest on polimorficzny. antygeny głównego układu zgodności tkankowej.). uzyskanych metodą PCR. pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253 . W ten sposób badane są antygeny erytrocytarne (grupy krwi).Rozdział W klasycznym ujęciu marker genetyczny to cecha jakościowa. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością. które nie kodują informacji genetycznej. przydatna do celów analizy genetycznej. a z drugiej strony od parametrów fizycznych rozdziału (napięcie. stężenie nośnika — żelu itp. wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. gdy w populacji występują przynajmniej dwa allele w locus tego markera. uwarunkowana w sposób prosty — tzn. zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka. a dokładniej — rozpoznające konkretną determinantę antygenową. W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. przez jedną parę alleli.

W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. że markery zostały podzielone na dwie klasy. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. np. polskiego badacza Ludwika Hirszfelda. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50.geny. Jeśli białko ma tylko jedną determinantę antygenową.1. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP. Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus). Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. czyli sekwencje kodujące -. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne. i 60. który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I. single stranded conformation polymorphism). a ich obecność można wykryć metodami serologicznymi. Wspólną ich właściwością jest to. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. 11. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym. Do pionierów tych badań należy zaliczyć m. Ich efektem było wykrycie wielu układów grupowych. Klasa II markerów to sekwencje niekodujące. o właściwościach antygenowych. wówczas jest rozpoznawane 254 . dotyczącej kontroli pochodzenia. SSCP). który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych). cechujący się obecnością charakterystycznych białek.in. które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. czyli Ag-NOR). a w mniejszym stopniu sekwencje minisatelitarne. Z badań prowadzonych u człowieka wynika. receptorami. cząsteczkami adhezyjnymi czy białkami strukturalnymi. Klasa I obejmuje klasyczne markery. Przez grupę krwi należy rozumieć typ krwi. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi.mentu DNA genu (metoda SSCP — ang. że są związane z błoną plazmatyczną erytrocytów. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych. Antygeny erytrocytarne (grupy krwi) Grupy krwi były najwcześniej wykorzystane w analizie genetycznej. że mogą one być enzymami. Objęcie badaniami niekodujących sekwencji DNA spowodowało. na powierzchni erytrocytów.

a to z kolei może wpłynąć na zmianę struktury białka. Jeśli białko ma kilka determinant antygenowych. że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi. a w tym jego determinanty antygenowej. Wreszcie może być taka sytuacja. Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów. to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. Jeśli takie geny mają wiele alleli. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych. może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej. Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny. a przez to do utworzenia (lub zlikwidowania) 255 .za pomocą jednej surowicy testowej.

Gdyby dla uproszczenia przyjąć. Sytuacja staje się bardziej złożona. Mówi się wówczas o fenogrupach. prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć. Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. że białko ma tylko jedną determinantę antygenową. przykład dla białka mającego kilka determinant antygenowych. które dziedziczą się jak jednostka. które pojawiają się w trzech fenogrupach: abc. 11-2. że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256 . to wówczas każda mutacja genu. Mechanizm powstawania zróżnicowania antygenów erytrocytarnych. ab oraz a’bc). gdy białko ma więcej determinant antygenowych. 11-1). czyli zespole antygenów. W takiej sytuacji mutacja genu zmienia jedną Ryć. Schemat opiera się na założeniu. a więc są uwarunkowane przez jeden allel.nowej determinanty w antygenie erytrocytarnym.

Przyjmuje ona. ale nie narusza struktury pozostałych (ryć. Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. a w konsekwencji do nietypowego dziedzi- 257 . Badania prowadzone u zwierząt wykazały.z determinant. że występują obie sytuacje. że istnieje także druga teoria tłumacząca fenomen fenogrup. 11-2). Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów. że każdy antygen warunkowany jest przez jeden gen. Należy jednak zaznaczyć.

M. N. które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. B. M. Można przypuszczać. przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową. Z. w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). Przykłady takie opisano u bydła. K. Należy pamiętać. C. 11 w genomie bydła (układy: A. B. 11-1). a drugi allel (allel „ —") koduje białko. Wśród poznanych układów są takie. że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. H. J. Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. jak np. J. T'. że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. C. W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. Na drugim biegunie są układy o olbrzymim polimorfizmie.czenia antygenów krwinkowych. Zatem możliwe jest. H. P) oraz 15 w genomie świni (układy: A. że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. E. B. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A. w których wykryto dotąd tylko dwa allele (np. R. L. M. G. głównie w odniesieniu do układu grupowego B. D. D. F. Biologiczna funkcja powyższych białek nie została jeszcze poznana. K. J. P. D. Układ grupowy. C. R'). Ponadto determinanty mogą 258 . układ L bydła czy układ C świni). układ grupowy B bydła. K. X). Q. M. w którym występuje allel „ — " określany jest jako otwarty. D. O). G. L. S. I. C. B. U) oraz owcy (układy: A. F. 13 w genomie kury (układy: A. O. E. F. C.

przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss. że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt. Cel ten osiąga się poprzez cykliczne przeprowadzanie. elektroforeza w żelu poliakryloamidowym lub elektroforeza 259 . Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S. W układzie grupowym A występują dwa antygeny A oraz O. International Society for Animal Genetics — ISAG). konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie). Białka surowicy krwi. jakie antygeny występują na erytrocytach w poszczególnych próbkach. Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe. świnie. Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np. międzynarodowych testów porównawczych (ang. charakteryzowały się identyczną swoistością.2. Jego ekspresja zależna jest od dodatkowego locus S. erytrocytów i leukocytów są drugą. Procedura produkcji oparta jest na immunizacji zwierząt. Niezmiernie istotne jest.mieć wiele wariantów. które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). badanie grup krwi wymaga stosowania surowic testowych. pod względem liczebności grupą markerów genetycznych klasy I. który ma działanie epistatyczne w stosunku do locus układu A. aby surowice testowe. które powinny spełniać warunek swoistości. które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę). Na uwagę zasługuje układ grupowy A świni. Jak to już wcześniej wspomniano. Surowice takie są produkowane przez laboratoria. comparison test). W efekcie wśród alleli będą takie. a każdy z nich jest rozpoznawany przez odrębną surowicę testową. pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang. W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. oraz takie. czyli zawierającej wiele różnych przeciwciał). po grupach krwi. w których zidentyfikowano kilka czy kilkanaście alleli. erytrocytów i leukocytów Białka surowicy krwi. W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło. 11. to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. Za pomocą dostępnych surowic testowych należy ustalić. Gen S ma dwa allele: S oraz s. wyprodukowane w różnych laboratoriach. pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej. a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej). Polegają one na tym. które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt.

nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC). Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych. elektrofokusing). będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną.dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt). Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III. Spośród ponad 25 białek najbardziej polimorficzne 260 . Na przykład u koni testy takie wykonywane są dla 16 systemów białek. i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Polimorfizm białek leukocytów.

są albumina. U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach. występuje szczególnie często u zwierząt podatnych na stres. twarde i suche). Z drugiej strony. są one cennymi markerami genetycznymi. Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. jak np. inhibitor α-proteaz i transferyna. charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). Locus transferyny u świń znajduje się w chromosomie 13 (13q31). które mają skłonność do wytwarzania mięsa typu DFD (ciemne. u bydła w chromosomie l. U świń w locus ADA znanych jest sześć alleli. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D. U koni jest ono determinowane przez 13 alleli. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych. PO1AB i PO1BY dla wielkiej białej polskiej. przy czym jeden z alleli (ALBS) występuje u większości ras. niektóre allele są charakterystyczne dla danych ras. że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz). Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich. podczas gdy allel TfA występuje przede wszystkim u yorkshire. Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. Allel ten. mającą dwa aktywne centra wiązania żelaza. Najwięcej wariantów tego białka zidentyfikowano u bydła. koń i koza. Spośród białek i enzymów erytrocytarnych (tab. 261 . P/3. natomiast jest ona aktywna w leukocytach i innych tkankach. U świń są one determinowane przez ściśle sprzężone loci (Pi1. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. Transferyna jest β-globuliną. w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli. Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej. Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). PIZ. u owiec także w chromosomie l (Iq42q45). określany jako zerowy. przy czym u bydła jest to enzym leukocytarny. owiec (chromosom 15). Polimorficzne warianty są związane z różną aktywnością tego enzymu. kur i bydła. Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci. hampshire i duroc. przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. PO1A. Tak więc. PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). Ze względu na to. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków. PO1B. jak świnia.

Na przykład u bydła w trzech pozycjach tego łańcucha.Hemoglobina wykazuje największy polimorfizm u owiec. u rasy Jersey i niektórych ras mięsnych. Większość ras bydła. są różne aminokwasy. Warianty tego białka różnią się tylko budową łańcucha β. jak np. bydła i kóz. kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27. jest monomorficzna. wśród nich bydło czarno-białe i czerwono-białe. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła. U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15 262 .

jest układ Lpb. Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu. β i κ oraz białko serwatkowe — P-laktoglobulina. Określenie genotypu na podstawie 263 . określane terminem allotypy. 14 allotypów dla γ-globulin i 3 dla α-globulin. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin. U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad). Białka mleka Głównymi białkami mleka są kazeiny αs1. układ sprzężonych alleli nazywany jest haplotypem. 11.chromosom). β. 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. αs2. U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki. Większość tych allotypów jest determinowana przez kodominujące allele. iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA.4. jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). bva2 oraz bvb. wykazują właściwości antygenowe. Allotypy immunoglobulin i lipoprotein Antygenowe właściwości surowicy krwi. Największe zróżnicowanie allotypów lipoprotein. 11. U bydła zidentyfikowano 3 allotypy. stwierdzono dotychczas u świń. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku. kontrolowane przez allele bval. oznaczonych symbolem Lp. U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin.i γ-globulinach. od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). u owiec 1. W następnych układach (Lpr. bo liczący ponad 21 allotypów. Również lipoproteiny. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy). biorące udział w transporcie cholesterolu. U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-. dotychczas zidentyfikowano 3 allotypy. Lpt i Lpu) znane są po dwa allele. a wielkość tego wytwarzania zależy od nasilenia anemii. u których najbardziej polimorficzny.3. a w piątym układzie (Lps) tylko jeden allel. Ciekawe jest. Ze względu na ścisłe sprzężenie loci kazein. są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku. W przypadku antygenów immunoglobulin u bydła.

tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów. B. Białko β-laktoglobuliny składa się z 162 aminokwasów. powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. wynikające z polimorfizmu genu kodującego to białko. Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA. B. przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B. E. a u bydła indyjskiego — alleł C. β-laktoglobulina. które powodują zmianę aminokwasu. F i G. znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny. β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2. będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną). opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu. determinowanych allelami: A. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP. U bydła w locus kazeiny αsl wykryto pięć alleli: A. Podobnie jak w przypadku κkazeiny. natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy. β-Laktoglobulina odgrywa rolę w odporności organizmu. Różnica między 264 . Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. a wariant A — alaninę. bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB). występuje w dwóch wariantach A i B. B. D i E. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A.badania białka jest możliwe tylko u samic będących w okresie laktacji. składają się one bowiem odpowiednio z 207 i 199 aminokwasów. W pozycji 136 łańcucha polipeptydowego B jest treonina. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII. z których jedynie A i D są obecne w genotypie bydła ras europejskich. C. której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. Podobnie allel G powstał wskutek tranzycji C→T w allelu A. U bydła europejskiego najczęściej występuje wariant β-kazeiny A. C. a w wariancie A — izoleucyna. Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy. albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. Dotychczas u bydła wykryto 6 typów κ-kazeiny. Białko serwatkowe mleka bydła. C i D. polegającej na tranzycji G→A. Allel F powstał w wyniku mutacji punktowej w allelu A.

do kontroli pochodzenia i identyfikacji śladów biologicznych. oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265 .alanina (GCC). który także jest już rutynowo stosowany. W pozostałych loci wykryto po 2 allele. E. zaś w B -. Polimorfizm DNA W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące. W połowie lat 80. który może być wykorzystany m.wariantem A i B polega na tym. C.5 (motyw podstawowy: GGGAGGTGGGCAGGAGG). ale także sekwencje ją otaczające. Sekwencje te występują w wielu miejscach (loci) genomu. Zostało to wykorzystane w opracowanym teście PCR-RFLP. opisano po raz pierwszy sekwencje minisatelitarne. a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo. polegające na delecji odpowiednio 11 i 37 aminokwasów. że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. przedstawia wysoce charakterystyczny obraz osobniczego DNA.5. B. B. z wyjątkiem locus P-laktoglobuliny (chromosom 3p28). że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT). Fragmenty te pochodzą z wielu loci. są cztery frakcje białek. to na błonie radiograficznej pojawia się układ prążków. Uzyskany układ prążków. 33. DNA fingerprint). a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości. D. natomiast wariant B — glicynę (GGT). o tyle allele D i F wykazują znacznie większe różnice.6 (motyw podstawowy: AGGGCTGGAGG) i 33. nazywany niekiedy „odciskiem palca" DNA (ang. Do najbardziej znanych sekwencji minisatelitarnych należą: 33. Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B. to znaczy zawierających nie tylko sekwencję minisatelitarną. Podobnie u owiec. F. C i E różnią się między sobą kilkoma podstawieniami aminokwasów. Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną. 11. W mleku kóz i owiec. w którym są 3 allele. Badanie takie wymaga zastosowania sond o dużej specyficzności. jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. Ich cechą charakterystyczną jest to. Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus. który reprezentuje fragmenty DNA o różnej długości. Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A. w loci kontrolującym główne białka mleka występują po 2 allele. Z kolei w pozycji 118 w wariancie A jest walina (GTC). O ile allele A. O).15 (motyw podstawowy: AGAGGTGGGCAGGTGG). podobnie jak bydła.in.

Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów.durą (ang. polimorficznego fragmentu DNA. lub dwóch fragmentów — u heterozygoty (ryć. Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas. tzn. możliwe stało się analizowanie pojedynczych loci. random amplified polymorphic DNA — RAPD). Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu. 11-3 wkładka kolorowa). w przypadku homozygoty. Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych. Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. Szacuje się. Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego. Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili. dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. pochodzących z DNA wyizolowanego od danego osobnika. także powtarzających się tandemowo. po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną. high stringency). żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. CATA) motywy podstawowe. że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. gdy za pomocą techniki PCR. CA) lub czteronukleotydowe (np. a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. Do tej pory najczęściej opisywano dwu. za pomocą sekwencji starterowej o losowej 266 . (GT)nGAT(AG)m.(np. Warto zaznaczyć. Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA. Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych. bo zawierających motyw podstawowy długości kilku nukleotydów. Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony. (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. polegający na tym. że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). Zostały one określone terminem sekwencji mikrosatelitarnych. że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. że ich loci są położone głównie w częściach telomerowych chromosomów. Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji. gdy nie są znane ani sondy molekularne.

które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD. O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu.kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów). jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%.4 mln miejsc SNP. Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę. wykryty za pomocą techniki RAPD. co doprowadziło do identyfikacji markera specyficznego SCAR. Zamplifikowane fragmenty. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. czyli nie wpływa na budowę polipetydu. których celem jest sekwencjonowanie genomów różnych gatunków. Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP. reprezentujące zazwyczaj różne loci w genomie. seauence characterized amplified region). w tym sekwencjonowanie.AATCGGC oraz allel 2 — AATGGGC. który zlokalizowano w chromosomie 9 u psa. Wynika z tego. są poddawane elektroforezie. Badając grupę osobników można stwierdzić różnice w układzie prążków. progressive rod-cone degeneration). Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli. amplifikowanego przez starter 5'-AGAATAGGC-3'. charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. Polimorficzny fragment. Jeśli amplifikowany fragment jest wystarczająco duży. spośród których większość występuje poza strukturą genów. W ten sposób identyfikuje się markery określane skrótem SCAR (ang. Należy zaznaczyć. prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1. został następnie molekularnie opisany. np. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP). ale może od267 . Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I. że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna. w której dominują nukleotydy C i G. Dynamiczny rozwój badań. że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw. a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach. określanych symbolem SNP (ang. w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). zaowocował identyfikacją nowej klasy markerów genetycznych. to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne). Na przykład. Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. allel l . single nucleotide polymorphism). cichego podstawienia.

którego nie stwierdzono u jednego z rodziców. u bydła są to układy B (40 antygenów). Wykorzystanie markerów genetycznych w hodowli zwierząt Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia. Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. w których występuje wiele antygenów. on zatem może być ojcem źrebięcia. że potomek dziedziczy jeden allel z każdego locus od ojca. C (12 antygenów) oraz S (8 antygenów). D (17 antygenów). u świń układy M (12 antygenów). Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego. P-ad i Q-b oraz typy białek TF-O. można wykluczyć jego ojcostwo. Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to. ALB-A. drugi od matki. następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT). Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek. PHI-I. Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej. Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). w tym sekwencjonowania DNA. Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. D-cgm. Warunków tych nie spełnia ogier l. Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP. Do kontroli pochodzenia najlepsze są układy grupowe. 11. Spełnia je ogier 2. natomiast u koni układy A (7 antygenów). czyli markerów genetycznych klasy I. ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej. marker assisted selection). 268 .działywać na ekspresję genu. tzw.6. MAS (ang. P (4 antygeny) i Q (3 antygeny). Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np. ES-I. ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego. Podstawą tej kontroli jest to. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik. że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a. E (17 antygenów) i L (12 antygenów).

Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia. Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne.ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). Uzyskany obraz prążków jest charakterystyczny dla danego osobnika. Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. sekwencja minisatelitarna. którą jest np. prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269 . 11-4). jedna jest oparta na polimorfizmie minisatelitarnym. druga na polimorfizmie mikrosatelitarnym. W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory. ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć. Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą. W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru: Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka.

Jak już wspomniano. W takim przypadku określa się tzw. analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia. łączne prawdopodobieństwo wykluczenia dla wszystkich 270 .

szacowaniu zmienności genetycznej i dystansu genetycznego. drugi — 263 pz). Dwa z nich otrzymały od matki allel długości 243 pz. jak i obojgu rodzicach: Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. przedstawiono na rycinie 11-5 (wkładka kolorowa). dokładnie tak. w której stosuje się kilka markerów równocześnie. W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów. Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2). Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów.243 pz. że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych. ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia. Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje. Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. single nucleotide polymorphisms). 271 . jak to jest przy cechach monogenowych — jakościowych. Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki. sprawia. dodawany do każdej próby DNA analizowanej za pomocą sekwenatora.badanych loci. drugi od ojca. określanego symbolem SNPs (ang. matka natomiast heterozygotą (jeden allel . Również to. Ojciec jest homozygotą pod względem allelu długości 235 pz. iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia. natomiast trzeci — allel 263 pz. Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks. Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków. dostępności informacji zarówno o jednym. której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora. Wszystkie szczenięta są heterozygotami. 1300 par zasad). Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA. przy czym allel długości 235 pz odziedziczyły po ojcu. których częstość szacuje się na 10-2-10-5 na pokolenie.

głównie klasy II. Jest to cecha dziedzicząca 272 . 11-VI). warunkujących cechy użytkowości mlecznej (tab. Prowadzone są badania w celu znalezienia takich genów. które mają znaczący wpływ na kształtowanie się cech użytkowych. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła. zwiększoną plenność świń. W przypadku tych cech jest już możliwa selekcja bezpośrednia. Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. Okazało się. a postęp genetyczny jest uzyskiwany w krótszym czasie. cechy użytkowości mlecznej). wydajnością białka w mleku. jaka będzie wartość tej cechy w przyszłości. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt. Identyfikacji genotypu w loci tych markerów daje 99. U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych. W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową.99% prawdopodobieństwa wykluczenia. Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. Znając sprzężenie między określonym markerem genetycznym a np. której kryteriami są genotypy zwierząt w danych loci. Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach. można dla młodej jałówki określić. zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech). Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych". Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich. Geny takie nazwano głównymi lub genami o dużym efekcie. o istotnym wpływie na cechy użytkowe. marker assisted selection). brunatnego szwajcarskiego i simentali.Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego. Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych. są również pomocne w doskonaleniu niektórych cech jakościowych. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną. czyli istotnych z hodowlanego punktu widzenia. 11-VII). Markery genetyczne. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec.

Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich. jak również intensywnej hodowli (zasiniaczenia i ukryte 273 . której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego.się z dominacją całkowitą. w których coraz więcej uwagi poświęca się dobrostanowi zwierząt. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała).

Szacowanie dystansu genetycznego i wybór ras. Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób. w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources). coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji. przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego. Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne. Aby tego uniknąć. że locus polled. 274 . Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych. Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. ponadto jest zabiegiem kłopotliwym. występuje w l chromosomie.uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). zwłaszcza infekcyjnych. jak i klasy II. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania. sprzężone z locus polled. zanim wystąpią objawy chorobowe. ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. Znane są już dwie sekwencje mikrosatelitarne. kontrolujący bezrożność/rogatość u bydła. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii). Dotychczas wiadomo jedynie. Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to. jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia. które cechuje duża zmienność genetyczna. dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani. które mogą być wykorzystane do tego celu. a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji. w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi.

Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów. czyli geny. 12. Organizacja DNA jądrowego W obrębie genomu występują zarówno sekwencje kodujące. Tam też znacznie częściej zachodzi crossing over. Rozmieszczenie loci genów w genomie jest nierównomierne. mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. Zdecydowanie przeważają sekwencje niekodujące. Miejsca te można wybarwić metodą barwienia prążkowego typu T. dlatego pojęcie genomu odnoszone jest do DNA jądrowego. że w genomie ssaków występuje około 35 tysięcy genów. wyrażona w cM. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów. która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów.Rozdział 12 Mapy genomowe Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. Przyjmuje się. Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad. 12-1). jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM). Genom może być opisany za pomocą kilku parametrów. które stanowią około 97% całego DNA (ryć. Sekwencje powtarzalne 275 . U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM. Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów.1. jak i sekwencje niekodujące. Po pierwsze. Całkowita długość genomu u ssaków.

Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. Szacuje się. W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej. Niezależnie od tego. którą uwidocznia się metodą barwienia prążkami C. jest to. z punktu widzenia przydatności tych sekwencji do analizy genetycznej. że liczba powtórzeń danego układu podstawowego wykazuje w obrębie 276 . że genom jest bardzo silnie nimi nasycony. ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim).dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to. że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad. Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów). Szczególnie cenne. sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych. Oznacza to. że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu.

których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się. Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. podobnie jak elementy nukleotydowe. że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. Elementy nukleotydowe to takie sekwencje.2. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego. sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element). 12. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów. ale w danym miejscu występuje tylko jedna kopia sekwencji.populacji silne zróżnicowanie. jest sekwencja telomerowa (TTAGGG/AATCCC). Podobnie jak poprzednio. Organizacja DNA mitochondrialnego Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin). że sekwencje te. Wiadomo. jest do tej pory słabo rozpoznana. Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną. której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. w których asocjuje heterochromatyna z kilku chromosomów. 277 . które również są rozproszone w wielu miejscach genomu. z wyjątkiem sekwencji telomerowych. dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych. leżą w pobliżu białkowych struktur kompleksów. przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. Funkcja sekwencji powtarzalnych. w pobliżu końców ramion chromosomów. Inaczej mówiąc. których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element). Skróceniu ulegają właśnie sekwencje telomerowe. Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny. która stanowi zakończenia ramion chromosomowych.

Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy. mtDNA jest bowiem kolisty. Struktura mtDNA jest inna niż DNA jądrowego. w których być może replikacja mtDNA nie zachodzi. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA. że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. ubichinon/koenzym Q. oxidative phosphorylation — OXPHOS). a tylko część przez mtDNA. cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka. W nich odbywa się większość reakcji oddychania komórkowego. Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. Całkowita liczba genów w ludzkim mtDNA wynosi 37. poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. zatem muszą być syntetyzowane wewnątrz mitochondriów. Wiadomo już. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie. 278 . Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli.Mitochondria należą do organelli komórkowych przekształcających energię. Białka będące podjednostkami enzymów łańcucha oddechowego (np. Jego długość wynosi około 16 tysięcy par zasad. przy czym kompleks V jest to syntaza ATP. Większość komórek zawiera od tysiąca do 10 tyś. kopii mtDNA.

Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych. Łańcuchy komplementarne. tzn. uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. która wskazuje położenia loci w chromosomach.T niż łańcuch lekki (L). Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA. nazywa się cytogenetyczną lub fizyczną mapą genomu. 12. różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H). Z kolei mapa opisująca sprzężenia. wyrażonych w cM. czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach. która przebiega równocześnie. genów (markery klasy I). transkrypcji podlegają obie nici kolistego DNA. pomiędzy sprzężo nymi loci oraz ich uszeregowaniu.DNA występujący w mitochondriach nie jest powiązany z białkami. a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. który ma większy udział nukleotydów guanylowych — G i tymidylowych . co więcej. c) odległościach genetycznych. że geny mitochondrialne nie zawierają intronów. a niektóre geny nawet nakładają się na siebie. dlatego niejednokrotnie mówi się o markerowej mapie genomu. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących. Mapa. w której obrębie występuje potrójna struktura DNA. ale w przeciwnych kierunkach. na obu łańcuchach. Markerowa mapa genomu Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D. b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli). który stanowi dominującą część genomu. pozostający w asocjacji z cząsteczką macierzystą. 279 . wchodzące w skład cząsteczki mtDNA. uformowana przez krótki fragment nowego łańcucha H. W mtDNA występuje jedno miejsce inicjujące transkrypcję. i niekodujących. w odróżnieniu od DNA jądrowego. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego.3. a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA. Prawie cały mtDNA zawiera sekwencje kodujące. Kolejną cechą charakterystyczną mtDNA jest to.

3. Różnica między DNA genu a jego cDNA polega na tym. ale nie jedyną. Fizyczna mapa genomu Podstawową. która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. na bazie którego syntetyzowano cDNA.12. sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa. metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany. Często sondę stanowi tzw. że w cDNA nie występują introny. reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję. 280 . na przykład mikrosatelitę — marker klasy II. Jest to taka sekwencja nukleotydowa.1. ponieważ w mRNA. cDNA (komplementarny DNA) genu.

chromosome painting) i mapowaniu na chromatynie jąder interfazowych. Analizę taką określa się terminem porównawczego malowania chromosomów (ang. związanego z barwnikiem fluorescencyjnym (ryć. w którym sonda połączy się z DNA chromosomu. 12-4 wkładka kolorowa). Q lub R). Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. gdzie sonda hybrydyzowała z DNA chromosomu splicing). (a) chromosomy barwione metodą prążków Q. W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu. 12-3). że do identyfikacji chromosomu. które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt. jasne punkty wskazują miejsce. Hybrydyzacją in situ ma wiele odmian. Malowanie chromosomów polega na zastosowaniu sondy. albo po hybrydyzacji. Trzeba podkreślić. Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. comparative chromosome 281 . które stosuje się albo przed hybrydyzacją. jest rozpoznawane przez obserwację mikroskopową. Ponadto. technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków. świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów. (b) ta sama metafaza po hybrydyzacji. Warto wspomnieć o dwóch: tzw. Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu. która zawiera unikatowe sekwencje DNA wybranego chromosomu. Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych. Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. Miejsce. FISH) na chromosomie 3 psa. wykorzystuje się techniki prążkowego barwienia (G.Ryć. Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. zgodnie z przyjętym wzorcem kariotypu. malowaniu chromosomów (ang. 12-3.

12-1). Należy jednak 282 . że sondę chromosomowo specyficzną. człowieka). które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. Dowodzi to.painting) i polega ona na tym. bydła). konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych. są bardzo złożone. utworzoną dla jednego gatunku (np. W ten sposób można wskazać. że w genomach bydła. jakie zaszły podczas ewolucji. stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. Przeprowadzone eksperymenty ujawniły. że zmiany na poziomie chromosomowym.

Nie można natomiast wskazać. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci. której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku. Loci takie nazywa się syntenicznymi. czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów. Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA. mysich komórek nowotworowych. przed hybrydyzowaniem z komórkami nośnikowymi (np. Polega ona na poddawaniu komórek gatunku mapowanego. a w każdej 283 . Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku.zaznaczyć. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji. którego genom jest badany — w tym przykładzie są to komórki bydlęce. ale czasami może się zdarzyć tak. podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. że jeżeli takie komórki są hodowane w warunkach in vitro. Na przykład. że metoda malowania chromosomów ma ograniczoną dokładność. których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego.6 milionów par zasad. Okazuje się jednak. nieznana pozostaje również wzajemna odległość między nimi. przyjmuje się bowiem. że grupa tych loci jest położona w tym samym chromosomie. Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. komórki nowotworowe myszy). naświetlaniu promieniami jonizującymi. które zawsze pojawiają się razem. z fibroblastami pochodzącymi z mięśni czy skóry bydła. które będą się między sobą różniły liczbą zachowanych chromosomów bydła. że są położone w jednym chromosomie. Tak wyprowadzone klony poddawane są analizie elektroforetycznej. utrzymywanych w hodowli. że sonda chromosomowo specyficzna da widoczny sygnał. naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. to stopniowo „gubione" są chromosomy. W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki). jeżeli obejmuje segment długości co najmniej kilku milionów par zasad. 0 ich umiejscowieniu wiadomo jedynie tyle. np. a zatem fragmentacja chromosomów. Sytuacja taka świadczy o tym. że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. które nie pochodzą z komórek nowotworowych. W tym przypadku są to chromosomy bydła. że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków. Polega ona na tym. który jest to chromosom 1 w jakim regionie mieszczą się badane loci. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych.

Kolejność postępowania jest następująca.5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci. przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia. Najpierw poszukuje się sprzężeń pomiędzy loci. na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci.. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu. że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej. przyjmującej niezależne dziedziczenie (r = 0. obliczana jako prawdopodobieństwo wystąpienia określonych genotypów. u potomstwa osobników o znanych genotypach. względem hipotezy alternatywnej. Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania. Jednostką odległości genetycznej jest l cM. Dalej. L . Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego.. 7 tyś.funkcja wiarogodności. Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania.współczynnik rekombinacji. krzyżówka trójpunktowa). tym mniejsze fragmenty. 12. służy tworzeniu genetycznej mapy genomu.3. Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie. że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych.. wynoszą zazwyczaj 5 tyś. radów. Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang. lub 12 tyś. 0. Dawki promieniowania jonizującego. wykorzystywane w mapowaniu radiacyjnym. w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. Genetyczna mapa genomu Analiza segregacji alleli w loci markerowych. na tyle blisko. loci). Odległość taka oznacza.5) r . zawierający się w przedziale (0.2. przy założonym współczynniku rekombinacji (r). W tym celu korzysta się z wiedzy o genotypach osobników 284 . które odzwierciedlają częstość. w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. ze względu na zbyt małe prawdopodobieństwo zajścia crossing over.z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa.

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe. dla którego ustalono sekwencję nukleotydów. bawoła. analizy hybrydowych komórek somatycznych. Opublikowano ją we wrześniu 2003 r. Przewiduje się. Szczegółowe dane dotyczące map poszczególnych genomów. świni i kury. zostanie ustalona sekwencja genomu bydła. Coraz więcej informacji pojawia się o mapach: kota. są zamieszczone w internetowych bazach danych (tab. takie jak: lis pospolity. W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r. obok wymienionych w tabeli 12-11. królika. lis polarny oraz jenot. a w tym i konkretnych chromosomów. że do 2005 r. Warto zwrócić uwagę. 12-111). Wśród tych ostatnich pierwszym genomem. są coraz lepiej poznane. a w tym także mapowania radiacyjnego) i sprzężeniowego. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt. a także łososia i pstrąga tęczowego.situ. jest genom psa. Tak opracowane mapy określane są terminem map zintegrowanych (ang.) i domowych. że również mapy genomów innych gatunków zwierząt gospodarskich. comprehensive map). 291 .

że cecha ta warunkowana jest monogenowo. choroby genetyczne itp. polegająca na klasyfikacji fenotypów dla interesującej cechy. pale. które polega na opisie struktury genu. odpowiedzialnych za występowanie różnych alleli.3. mięso blade. marmurkowatość mięsa. tzn. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. że allele któregoś z markerów kosegregują z określonymi fenotypami cechy. jak i genotypów w jak największej liczbie loci markerowych. exudative — PSE). Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw. Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych). Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. zlokalizowanych w różnych miejscach genomu. Mogą to być zatem zarówno cechy ilościowe. homozygot recesywnych 292 . Stwierdzenie. wydajność białka w mleku. którego celem jest identyfikacja nieznanego genu. jak i jakościowe. że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. Hodowca wskazuje cechę. Punktem wyjścia jest precyzyjne opisanie zmienności cechy. dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. soft. np. tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali. który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA. wskazuje. odporność na infekcje specyficznymi patogenami.5. ang.12. a konkretnie przez allel recesywny. Następnie podejmowana jest żmudna analiza. gen główny w przypadku cech ilościowych). Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres. Wykorzystanie markerowych map genomowych w hodowli Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów. Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. która ma istotne znaczenie gospodarcze. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP). Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu. które z hodowlanego punktu widzenia mają istotne znaczenie. jest pokazany na rycinie 12-6. Najpierw ustalono. miękkie i wodniste. bezrożność. wydajność rzeźna. a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych. Ogólny schemat postępowania.

PGD i A1BG). np. 12-6. Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu. 12-7a). która polega na zamianie argininy na cysteinę w pozycji 615. Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI. Loci tych markerów umiejscowiono. Kilka lat później zidentyfikowano pierwsze markery genetyczne (m. Badania molekularne tego genu u osobników wrażliwych na stres wykazały. Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. za pomocą hybrydyzacji in situ. którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych (nn).in. candidate gene). locus układu grupowego krwi H oraz loci polimorficznych białek krwi . że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym. które okazały się ściśle sprzężone z locus HAL.GP7. Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym. który nie rozpoznaje 293 . Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang. w chromosomie 6 świni (ryć.Ryć. Był nim gen receptora rianodyny (RYR1).

jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. Od połowy lat 80. w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy sekwencji zawierającej mutację. (c) BMPR-IB. który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot. 12-7b). że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła.Ryć. że hipertrofia mięśniowa (tzw. wiadomo było. Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić. muscular hyperthrophy). wywodzących się z rasy belgijskiej 294 . 12-7. Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową. W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech). Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1. Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN). (b) MSTN. (d) PRKAG3 oraz regionów chromosomowych.

dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. różnych mutacji uszkadzających funkcję białka miostatyny. które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. Okazało się. Co więcej. 295 . kwaśnego mięsa. 12-7d). czyli genu głównego. są prowadzone w licznych ośrodkach naukowych. że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania. że mutacja polegała na braku (delecji) 11 nukleotydów. W początkowym stadium badań zakłada się. który jest biologicznie nieaktywny. wpływający na plenność owiec rasy merynos booroola. zakończyły się wieloletnie poszukiwania genu RN. Badania zmierzające do identyfikacji genów głównych. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. ustalono. a allel recesywny rn+ mniejszą zawartość glikogenu. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop"). Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. W 1994 roku ukazała się praca dowodząca. wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). W 2001 r. Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. Okazało się. Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi. co fenotypowo objawia się hipertrofią mięśniową. 12-7c). a konkretnie kontrolujący liczbę owulujących oocytów podczas rui. które ma mniejszą wartość technologiczną. nie udało się jeszcze wskazać genów kandydujących. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). Analiza segregacji licznych markerów genetycznych. który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. Przykładem może być gen FecB.błękitnej i asturiana. który odpowiada za zawartość glikogenu w mięśniach. że gen FecB to zmutowana postać genu BMPR-IB. Dominujący gen RN~ powoduje większą. pokrywających w miarę równomiernie większość genomu. Innym przykładem jest gen RN. oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego. Locus genu RN umiejscowiono w chromosomie 15. które w znaczący sposób wpływają na cechy użytkowe. które umiejscowione są w chromosomie 6 (ryć. że w chromosomie 4 świni. w którym prawdopodobnie występuje locus genu głównego. Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101. W 2000 r. że jest nim zmutowany allel genu PRKAG3. Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech.

ze względu na wywoływane zmiany m. W 2001 r. że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę. wykazano. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują. występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego. Sugestia ta została potwierdzona także w innych badaniach. między markerami mikrosatelitarnymi S0083 i S0090.między markerami S0001 i S0067. 12-7f). Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. określana symbolem bd (ang. czyli duży efekt fenotypowy pojawia się tylko wtedy. w budowie czaszki. który odpowiadałby za kształtowanie tych cech ilościowych. że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. czego efektem jest 3-krotny wzrost ekspresji genu IGF2.in. że również wiele krów było nosicielkami zmutowanego genu bd. Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela. Z badań prowadzonych w rodzinach referencyjnych wynikało. krowa nosicielka. którzy również byli nosicielami tego niepożądanego genu. a to upośledza funkcję kodowanego enzymu. charakteryzującego się wybitną wartością hodowlaną. że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka. Można się spodziewać. Jednym z przykładów może być letalna wada rozwojowa — achondroplazja. doniesiono. W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca. że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej. chore cielę — homozygota recesywna). występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie. w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. Trzeba zaznaczyć. że gen ten podlega piętnowaniu gametycznemu. W początkowym okresie jego użytkowania stwierdzono. że w chromosomie 12. 12-7e). że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. Z kolei w październiku 2003 r. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku. Odnotowano też znaczące osiągnięcie dotyczące bydła. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja. Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu. 296 . gdy zmutowany allel jest odziedziczony od ojca. Oznaczało to. Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym. bulldog disease).

Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne. polegającą na zniekształceniu kręgów (ang. Niestety badań tych nie opublikowano. Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują. narkolepsja u dobermanów i labradorów. Wśród nich są geny wywołujące takie schorzenia. W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów). Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej. Wiele z tych mutacji występuje w ściśle określonych rasach. . ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli. a ostatnio scharakteryzowano gen oraz mutację w nim występującą. że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt. dziedziczny zanik siatkówki u owczarków francuskich). Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów. CVM — central vertebral malformation). a opracowany test molekularny skomercjalizowano. U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów.W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową.

King. B. P. Wydawnictwo Medyczne Słotwiński Yerlag. Kłyszejko-Stefanowicz. Wydawnictwo Polskiego Towarzystwa Zootechnicznego.C. Warszawa. A. pod red. Jaszczaka i J. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994). Poznawanie zasad dziedziczenia (1997).A. Węgleńskiego). W. Ośrodek Wydawnictw Naukowych PAN. R. II— lata 1972^-1997 (1997). K. Rozwiązywanie problemów medycznych (2003). W. Krzyżosiaka. J. z j. J. Michejdy). Genetyka człowieka. CRC Press Inc. Rosłanowskiego. 298 . The Major Histocompatibility Complex Region of Domestic Animal Species (1996). P. pod red. pod red.. P. Lamont. Waśniewska-Brzeska i J. Węgleńskiego. pod red. Wydawnictwo Naukowe PWN. Żeromskiego). Cytobiochemia (1995). ang. Genomy (2001).B. Krzanowskiej. Wydawnictwo Naukowe PWN. Juszczaka i S. Stansfield (przekład zbiorowy pod red. Zwierzchowskiego. ang. Brown (przekład pod red.D. Stryer (tłum. M. Jury i H. Brostoff. pod red. Wydawnictwo Naukowe PWN. Filistowicza. Nowicki i wsp. Genom człowieka. K. Wężyka. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. Singer (tłum. Biologia molekularna w medycynie. J. L. J. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997). Wydawnictwo Naukowe PWN. T. J. D. B. pod red. pod red. Schook i S. Wydawnictwo Naukowe PWN. Brzeski). Wydawnictwo Akademii Rolniczej w Poznaniu.Literatura uzupełniająca Podręczniki Biochemia (1997). L. Wydawnictwo Naukowe PWN. Leksykon biologiczny (1992). Wydawnictwo Naukowe PWN. pod red. Berg i M. Wydawnictwo Naukowe PWN. Małe (tłum. Brema. Jeżyk genów. L. z j.R. W. Prus-Głowackiego). L. Warszawa. Elementy genetyki klinicznej (2001). Modlińskiego. z j. Korf (przekład pod red. Genetyka molekularna (1995). Warszawa. Augustyniaka i J. Bala. Cz. Prószyński i S-ka. USA. Biotechnologia zwierząt (1997). Słownik terminów genetycznych (2002). A. Poznań. I. Roitt. Immunologia (1996). pod red. ang. Wiedza Powszechna. Cz. Leksykon rozrodu zwierząt (1996). Pawlaka). pod red. Karty z Dziejów Zootechniki Polskiej..J.

. 299 . Pierzchała M. (1998). Long S. Lechniak D. (1996). A second-generation linkage map of the sheep genome. Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding.M. (1996)..A. (1999). i wsp. Smith T. Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych. (1997).. Beattie C. Metody oraz znaczenie sterowania proporcją płci u bydła. Journal of Applied Genetics 37 (3): 299-312. (1996). The genetics of pigmentation: from fancy genes to complex traits. Magiczne mikromacierze. (1997). Krzanowska H. Kurył J. (1996).W. (2002). Stone R. Prace i Materialy Zootechniczne. Medycyna Weterynaryjna 54 (2): 92-96. Trends in Genetics 12 (8): 299-305. McGraw R.A.. Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt. Journal of Applied Genetics 38: 65-76. Stoughton R.T. European Journal of Immunogenetics 21: 209-215. (1998). DNA microarrays — a methodological breakthrough in genetics. Parham P. Journal of Applied Genetics 37: 179-196. Current Opinion in Genetics & Development 6: 316-321.. Naturę 409: 860-921.M. Kirkness E. Science 272: 67-74. Pareek Ch. Biotechnologia 3 (38): 38-50.W.. Ludzki genom mitochondrialny — mutacje.G. Charon K. Cuthbertson R. Kappes S. Beattie C. Postępy Biologii Komórki 24 (8): 69-75. (1994)..S. Prace i Materiały Zootechniczne 50: 69-78. Zeszyt specjalny 8: 9-18..A. (1997). Ramikssoon Y. Medycyna Weterynaryjna 52 (2): 89-93.P. Freking B. Chromosome abnormalities in domestic sheep (Ovis aries)..P.. Dymnicki E.M.S..Artykuły przeglądowe Barsh G. Crawford A. Geny oddziałujące na jakość tuszy i mięsa świń. i wsp. (1996). Charon K. Stone R. Initial seąuencing and analysis of the human genome. (1998). Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Genome Research 7: 235-249... Grzybowski G. Lopez-Corrales N. Science 301: 1898-1903.. Molecular genetics of sex determination.W. (1996). Early steps in mammalian sex determination. Ohta T. Świat Nauki 4 (128): 36-43. Kappes S. Ellis S.F. International Human Genome Seąuencing Consortium (2001). Dodds K. Postępy Nauk Rolniczych 7 (nr 5): 87-97. Keele J.A. The dog genome: survey seąuencing and comparative analysis. Friend S.L. De Gortari M. (1998). (1997).B. Postępy Biologii Komórki 26 (supl. A second-generation linkage map of bovine genome.W.. Kamiński S. Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej.E. Seminars in Reproductwe Medicine 20: 157-167. Mapa genomu świni (Sus scrofa domestica). Prace i Materialy Zootechniczne 49: 7-28. polimorfizmy i choroby. Mammalian Genome 9: 204-209.. Cotinot C.J. Leymaster K.L. Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich.M. (1997).T. Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence. Goodfellow P. Kamiński S... (2002). Minireview — MHC studies in domestic animals.. Kamiński S. Population biology of antigen presentation by MHC class I molecules. (2003). Keele J.. Bartnik E. Grzybowski G. (2002).M. (1996). Sonstegard T.H. 12): 53-58.. Journal of Applied Genetics 43: 123-130.

(1994). Journal of Animal and Feed Sciences 2/3: 91-103.H.L. Barciszewska M. (1998). Rohrer G. (2003). Kulig H. Medycyna Weterynaryjna 53 (10): 581-584. Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt. A comprehensive map of the porcine genome.S. (1998). Synaptonemal complexes in domestic mammals — a review. 10): 113-122. (2002).. Ruvinsky A.. Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej. Beattie C. . Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej. i wsp. Basics of gametic imprinting. Postępy Biologii Komórki 25 (supl..... Stranzinger G.. Szydłowski M. Determinacja płci u ssaków. Rosochacki S. Sysa P. Napierała D. (1998). (1998). Alexander L. (1999). Prace i Materiały Zootechniczne 52: 37-42... Science 291: 1304-1351. Żywiecki M. The seąuence of the human genome. Wierzbicki H. 2):288-237. Danielak B. Kozubska-Sobocińska A..J. (1993). Kwiatkowska J. (1998). Medycyna Weterynaryjna 50 (8): 379-382. Journal of Heredity 89 (6): 473-480.P. Węgrzyn J. — Celera Genomics (2001). Świtoński M. Noncoding RNA transcripts. Journal of Dairy Science 82 (suppl. Smith T. (1997). Zwierzchowski L. (1997).. 10): 195-217. Journal of Applied Genetics 38:195-204. (2003). Szymański M. Zych S. Aberracje chromosomowe u bydła o użytkowości mięsnej. Journal of Applied Genetics 40 (2): 117-128. Prace i Materiały Zootechniczne 50: 11-39..W. Identyfication of animal major genes in field collected data by use of statystical methods.. Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka. Postępy Biologii Komórki 25 (supl. (1997). Biotechnologia 2 (41): 33-56. Medycyna Weterynaryjna 59: 847-852.. (1994). Skiba E. Szatkowska L. Naturę 420: 520-562. Zwierzchowski L. Genome Research 6: 371-391.Z. i wsp. Inheritance of colours in horses. (1996). Walawski K.. Szwaczkowski T. Hu Z. Keele J. (1998). Journal of Applied Genetics 38 (3): 319-328.. Słomski R. Poszukiwanie genów kontrolujących cechy tuczne. Genetic aspects of mastitis resistance in cattle. Krajowy system kontroli cytogenetycznej buhajów. Journal of Applied Genetics 44: 1-20..A. Barciszewski J. Antigenic markers of protein genes and their nomenclature in cattle. Yenter C. Świtoński M. Słota E. Świtoński M.J. Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt. opasowe i rzeźne — najnowsze osiągnięcia. Waterston R..W.. (1998).Rejduch B. Stachurska A. Prace i Materiały Zootechniczne 53: 35-48. Świtoński M. Initial seąuencing and comparative analysis of the mouse genome. Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus). Kurył J. Prace i Materiały Zootechniczne 46: 29-40. (1999).

Charon. na których hasła znajdują się na rysunku lub w jego podpisie. na których znajduje się główny opis.Skorowidz Opracowali: Krystyna M. Gwiazdką oznaczono numery stron. są pogrubione. Marek Świtoński Numery stron. .

Master your semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master your semester with Scribd & The New York Times

Cancel anytime.