P. 1
Genetyka Zwierzt - Charon 2004 Pl

Genetyka Zwierzt - Charon 2004 Pl

|Views: 5,036|Likes:
Wydawca: Anna Krawczyk

More info:

Published by: Anna Krawczyk on Mar 19, 2012
Prawo autorskie:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

08/22/2014

pdf

text

original

Sections

  • Chromosomy i podziały jądra komórkowego
  • 2.1. Budowa chromosomu
  • 2.2. Barwienie prążkowe chromosomów
  • 2.5. Mejoza
  • 2.6. Gametogeneza
  • Gen i jego ekspresja
  • 3.1. Budowa kwasów nukleinowych
  • 3.1.1. DNA
  • 3.1.2. RNA
  • 3.2. Replikacja DNA
  • 3.3. Kod genetyczny
  • 3.4. Transkrypcja
  • 3.5. Translacja
  • 3.6. Budowa genu
  • 3.7. Regulacja ekspresji genu
  • 3.7.1. Czynniki transkrypcyjne
  • 3.7.2. Geny homeotyczne
  • 3.7.3. Metylacja DNA
  • 3.7.4. Piętno gametyczne
  • 3.7.5. Inaktywacja chromosomu X w zarodkach żeńskich
  • 4.1. Endonukleazy restrykcyjne
  • 4.2. Wektory
  • 4.3. Rekombinacja molekularna i klonowanie
  • 4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
  • 4.5. Techniki hybrydyzacji i sondy molekularne
  • 4.6. Polimorfizm fragmentów restrykcyjnych DNA (RFLP)
  • 4.7. Biblioteki genomowe i genowe
  • 4.8. Sekwencjonowanie DNA
  • 4.9. Badanie ekspresji genów
  • 4.10. Transgeneza
  • Mutacje
  • 5.1. Mutacje genomowe
  • 5.2. Mutacje chromosomowe
  • Przyczyny i rodzaje mutacji genowych
  • 5.4.2. Skutki mutacji genowych
  • 5.4.3. Mutacje genowe wpływające na cechy produkcyjne zwierząt
  • 5.4.4. Mutacje genowe wywołujące choroby genetyczne
  • 5.4.4.1. Geny letalne, semiletalne i subwitalne
  • 5.4.4.2. Choroby monogenowe wywołujące wrodzone wady rozwojowe
  • 5.4.4.4. Ograniczanie występowania chorób genetycznych
  • 5.5. Mutacje w mitochondrialnym DNA
  • 6.1. Dziedziczenie cech warunkowanych jedną parą alleli
  • 6.1.1. Współdziałanie alleli
  • 6.1.2. Niezależne dziedziczenie cech (II prawo Mendla)
  • 6.1.3. Dziedziczenie cech sprzężonych
  • 6.1.4. Cechy sprzężone z płcią
  • 6.1.5. Plejotropia
  • 6.2. Współdziałanie genów z różnych loci w kształtowaniu fenotypu
  • 6.2.1. Komplementarność
  • 6.2.2. Epistaza
  • 6.2.3. Geny modyfikujące
  • 6.2.4. Sumujące działanie genów
  • 6.3. Dziedziczenie umaszczenia
  • 6.4. Penetracja i stopień ekspresji (ekspresywność) genów
  • 6.5. Dziedziczenie pozajądrowe
  • 7.1. Rodzaje zmienności i czynniki ją wywołujące
  • 7.2. Miary zmienności
  • 7.2.1. Miary skupienia
  • 7.2.2. Miary rozproszenia
  • 7.3. Zmienność cech ilościowych
  • 7.3.1. Dziedziczenie cech ilościowych
  • 7.3.2. Zmienność transgresywna
  • 7.3.3. Geny o dużym efekcie
  • Podstawy genetyki populacji
  • 8.1. Prawo równowagi genetycznej
  • 8.2. Frekwencja genów i genotypów w przypadku dominowania
  • 8.4. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią
  • 8.5. Czynniki naruszające równowagę genetyczną
  • 9.1. Determinacja płci ssaków
  • 9.2. Interseksualizm
  • Genetyczne podstawy odporności i oporności
  • 10.1. Genetyczne podłoże różnorodności przeciwciał
  • 10.2. Genetyczne podłoże różnorodności receptorów limfocytów J
  • 10.3. Główny układ zgodności tkankowej — MHC
  • 10.3.1. Struktura i funkcje głównego układu zgodności tkankowej
  • 10.3.1.1. Główny układ zgodności tkankowej myszy
  • 10.3.1.2. Główny układ zgodności tkankowej człowieka
  • 10.3.1.3. Główny układ zgodności tkankowej zwierząt gospodarskich
  • 10.3.2. Identyfikacja cząsteczek głównego układu zgodności tkankowej
  • 10.3.3. Znaczenie głównego układu zgodności tkankowej
  • 10.3.3.1. Związek MHC z odpornością na choroby
  • 10.3.3.2. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi
  • 10.4. Zarys przebiegu reakcji odpornościowej
  • 10.5. Genetyczna oporność na choroby
  • 11.1. Antygeny erytrocytarne (grupy krwi)
  • 11.2. Białka surowicy krwi, erytrocytów i leukocytów
  • 11.3. Allotypy immunoglobulin i lipoprotein
  • 11.4. Białka mleka
  • 11.5. Polimorfizm DNA
  • 11.6. Wykorzystanie markerów genetycznych w hodowli zwierząt
  • 12.1. Organizacja DNA jądrowego
  • 12.2. Organizacja DNA mitochondrialnego
  • 12.3. Markerowa mapa genomu
  • 12.3.1. Fizyczna mapa genomu
  • 12.3.2. Genetyczna mapa genomu
  • 12.3.3. Strategia mapowania genomu
  • Podręczniki
  • Skorowidz

Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

..........................................7................. 3....... Geny homeotyczne ...................................... 3............ 3..............1.......... Translacja ....7...........................................3.................... 3.. 3.................... ............... Budowa genu .......4................................................ 3..............4...... Piętno gametyczne .......................................................... 3..... 3................ Barwienie prążkowe chromosomów ..............2.... Czynniki transkrypcyjne ..........................2.......................................................1................................................................... 2....................7.............................................Spis treści 1 2 Wstęp — zarys historii genetyki ........................ 48 48 49 50 52 53 54 56 57 60 61 62 63 64 66 4 Metody analizy i modyfikacji genomu ......1...... ........... Metylacja DNA ....... Wektory... 3......5.....2...........................................6........................................................ RNA ..........1............ 3............. n 1 5 16 23 31 33 37 43 3 Gen i jego ekspresja .... 3...... 2................................3..........3.................................................................................................................................................... Inaktywacja chromosomu X w zarodkach żeńskich ........... Regulacja ekspresji genu ................................ 2....6............................................ Gametogeneza ............................................. Transkrypcja ...................4........ 2..................7.........................................................7......... 3.....1.................................................... 3...................................................... 3..............5..........................................2............................. Kariotyp ...................... Mejoza ................. 4............................. Budowa kwasów nukleinowych ................ 2.................................... Chromosomy i podziały jądra komórkowego ....2..................................... Mitoza............................................................................................ 2......1.................. Budowa chromosomu ... Kod genetyczny ............................ DNA ........................... Replikacja DNA ........ 4.......................5................. 69 69 72 ...................... Endonukleazy restrykcyjne ...........7......1.....

......... Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny .... 5..................... 6.........4....... Mutacje chromosomowe .................4....4......2.............. Geny modyfikujące ........................................1.. 6.... Biblioteki genomowe i genowe ......................................................................................2.......1..... Dziedziczenie umaszczenia.................................. 5....2... 5..............10....... Choroby monogenowe wywołujące wrodzone wady rozwojowe 5..............9..... 6..................................................................................................................................................................... Sumujące działanie genów .................................. 4.................................................. 95 96 100 111 112 112 118 123 124 124 127 132 135 143 144 6 Podstawowe mechanizmy dziedziczenia cech .............................. Mutacje genowe wpływające na cechy produkcyjne zwierząt ........ 7.............................. 5.....................5................................4...3. Przyczyny i rodzaje mutacji genowych ............ 6...4.................4...........................1................2......... 6.................. Cechy sprzężone z płcią .. Współdziałanie genów z różnych lód w kształtowaniu fenotypu ......... Mutacje genowe wywołujące choroby genetyczne ..4......8..................... Niezależne dziedziczenie cech (II prawo Mendla) ............................1...........5..... Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) ............... 4.......1.....1.................... 6......... Sekwencjonowanie DNA . 76 78 82 86 87 88 91 91 5 Mutacje .......3..2.................. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) ..4.... 5..............................4... 6....................4........................ Rekombinacja molekularna i klonowanie ..........4..........2........ 4........ 4.3..... Techniki hybrydyzacji i sondy molekularne .....2...2..............................................7.. 4............. Penetracja i stopień ekspresji (ekspresywność) genów ....1............................................................................................. Rodzaje zmienności i czynniki ją wywołujące .............. 7........1......1. .................2....... Mutacje genomowe .................... 5....... Transgeneza ..................................................... semiletalne i subwitalne ............ 179 179 182 182 8 ...4.....2. 7.......... Miary zmienności .... ............4.......................... 6....... Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce .....................................4.................... Epistaza ...1....4................................................................................ 6...........4.......3....6........... 6........... 6....... 4... ..... Mutacje w mitochondrialnym DNA ................................................................................................................................ 6....... 146 147 147 150 152 157 160 160 161 162 163 164 164 175 176 7 Zmienność cech..... 6..3..................4.............. Plejotropia ..............3...................2....5.... 5................................. Miary skupienia ....................1....... Mutacje genowe .........4............4......5...............3........ Skutki mutacji genowych ................. ................ Komplementarność ...........2. Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych .............. 5......................... 5................. Dziedziczenie cech sprzężonych .4. 4..................... 5... Geny letalne....................... 5............... 5......... Dziedziczenie pozajądrowe ..................... Badanie ekspresji genów ......5...... 6.. .............1................... 5........ Współdziałanie alleli .......... Dziedziczenie cech warunkowanych jedną parą alleli .......................1..... Ograniczanie występowania chorób genetycznych......4...........................................................

....... 10. ............................. Główny układ zgodności tkankowej człowieka ..................................... Główny układ zgodności tkankowej zwierząt gospodarskich 10.4... Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych . Znaczenie głównego układu zgodności tkankowej . Allotypy immunoglobulin i lipoprotein ............ Genetyczne podłoże różnorodności receptorów limfocytów T ...... 11.......7..6.........2...... 8........... Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami ..... 9.......1...................3........3...1................ 9..3.......5.....................5......4... 11... Geny o dużym efekcie .3. 8............3..........1.... Zmienność transgresywna ..3....................... 210 216 221 10 Genetyczne podstawy odporności i oporności ...... Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8............... 227 227 230 231 233 236 237 239 243 243 243 244 245 247 11 Markery genetyczne ................ Główny układ zgodności tkankowej myszy ................... 185 187 187 189 190 8 Podstawy genetyki populacji ........................ 10...... 198 198 201 201 204 205 210 9 Determinacja i różnicowanie płci oraz interseksualizm ..... .............3..2.................... 11.. 7.........3....... 11.....................................................................2...........2...............1...... 8.....2.....................2.............. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10........ Genetyczna oporność na choroby ............3...6.................. 10.......1.......................... Białka mleka ...4......................... 7.. 10. erytrocytów i leukocytów ........3..... 7....3......... 10.................................... Zarys przebiegu reakcji odpornościowej ...................................... Identyfikacja cząsteczek głównego układu zgodności tkankowej 10............................ Determinacja płci ssaków .......... .................. 8..... Wykorzystanie markerów genetycznych w hodowli zwierząt................. 11...... Genetyczne podłoże różnorodności przeciwciał ...................................................... Białka surowicy krwi.................... Antygeny erytrocytarne (grupy krwi) ......................................................3.....3... 10...........1........1..................5........2.........2..... Prawo równowagi genetycznej . ...... Związek MHC z odpornością na choroby ............3....... Zmienność cech ilościowych .............3............ ..................... Główny układ zgodności tkankowej — MHC ....................1............3. Dziedziczenie cech ilościowych ............. 7..........................................2........2.............. Czynniki naruszające równowagę genetyczną .......1......1....... 10..... 11.................................................. 10.... Interseksualizm ...... Miary rozproszenia ..3.. ........... 8......1.... Struktura i funkcje głównego układu zgodności tkankowej .3................. Frekwencja genów i genotypów w przypadku dominowania .. 10.............. 253 254 259 263 263 265 268 9 ............ Polimorfizm DNA ............3...............3................ 10........................................................

......................................................1.. .............................. Fizyczna mapa genomu .........................3... Wykorzystanie markerowych map genomowych w hodowli ... Podręczniki ......... 12.............................................. 275 275 277 279 280 284 287 289 292 Literatura uzupełniająca .. 12.............................. 12...... Organizacja DNA jądrowego ...... ................. 12....................................................... Genetyczna mapa genomu ..3....................... 293 298 298 Skorowidz ................... ....... .....4........... 12........................................1............................... 12... Strategia mapowania genomu................. 12......3............................ 12... Aktualny stan map genomowych zwierząt gospodarskich ............... Organizacja DNA mitochondrialnego ...............................................1 2 Mapy genomowe ........2.................................... Artykuły przeglądowe ...................3....... ...................5... 301 ........................... Markerowa mapa genomu ......3.........2.3...............3...........................

ale także przekazanie tych korzystnych właściwości potomstwu. Autorami pierwszej z nich — teorii komórkowej budowy organizmów. O powstawaniu gatunków drogą doboru naturalnego. Zgodnie z teorią Darwina. umożliwiając im nie tylko przeżycie. podstawą ewolucji organizmów żywych jest dobór naturalny. chemików. że wszystkie rośliny i zwierzęta są zbudowane z komórek. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum). korę mogą powstawać jedynie przez podział innych komórek. Okazało się to niezwykle stymulujące dla rozwoju cytologii. komórek i ich organelli. tkanek. której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków. byli Schwann i Schleiden. rośliny samopylnej. a ostatnio również informatyków. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych. a z drugiej formułowaniem przełomowych hipotez i teorii. ogłoszonej w 1838 roku. Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. Główną tezą tej teorii było twierdzenie. W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania. czyli nauki o budowie i funkcji komórek.Rozdział 1 Wstęp . Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. konstruktorów. Badania nad mieszańcami roślin. które stało się początkiem nauki o ewolucji. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty 11 . stanowiącą zaczątek genetyki.zarys historii genetyki Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii.

Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. Ten dział genetyki określa się często jako genetykę cech ilościowych. zostały podane przez polskiego botanika Strasburgera w 1880 roku. które okazały się bardzo istotnymi narzędziami badawczymi. za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. przy czym jedna gameta zawiera tylko jeden taki element. kiedy to trzej badacze: Avery. do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. de Yriesa i Tschermacka. Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków. nazwanych w 1888 roku przez Waldeyera chromosomami. Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. W latach 20. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. o których różnorodności wiedziano już wówczas dość dużo. Niektórzy autorzy uważają. które kilkadziesiąt lat wcześniej podał Mendel. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki. Pierwsze doniesienia o „pałeczkowatych" strukturach. Wright i Haldane wprowadzili do genetyki metody statystyczne. Dopiero wówczas zrozumiano genialność odkryć Mendla. MacLeod i McCarty wykazali. w tym struktur związanych z dziedziczeniem. Rok później Morgan ogłosił chromosomową teorię dziedziczenia. że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie. nasiona gładkie lub pomarszczone. a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. Opis mitozy przedstawił w 1882 roku Flemming. Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. Przez wiele lat przypuszczano. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. że można je określać tylko jednym terminem — genetyka populacji. że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet. cech ilościowych. które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2). Mendel uzyskał pierwsze pokolenie mieszańców (F1). że nośnikiem informacji genetycznej są białka. Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne. że 12 . którą można uważać za początek cytogenetyki. Na początku XX wieku podjęto wiele badań. Przełom nastąpił w 1944 roku. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi. którzy niezależnie od siebie doszli do wniosków. Stało się to za sprawą trzech badaczy: Corrensa. nasiona żółte lub zielone itd. Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. których celem było poznanie praw rządzących dziedziczeniem cech.czerwone lub białe. Fischer.

w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. ale również jego sekwencjonowanie. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów. a wiodącą rolę w tych badaniach odegrali między innymi Khorana. owca.). ochroną środowiska itp. których celem było poznanie struktury chemicznej DNA. Human Genome Organisation Project) 13 .) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. bydło.). W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości. koń. W przypadku człowieka celem jest nie tylko mapowanie genomu. zwierząt. kura czy pies. że molekularne poznanie genomów człowieka. wykrywaniem 1 zwalczaniem patogenów. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków. opracowanie techniki rekombinacji i klonowania DNA (1972 r.) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r. Warto zaznaczyć.nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA). teorii operonu. to czas usilnych badań. Do wniosku tego doszli na podstawie wyników eksperymentu. Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie. która wyjaśniała mechanizm ekspresji genów u bakterii. hodowlą zwierząt i roślin. Zostały one zakończone w pierwszej połowie lat 60. Odkrycie enzymów restrykcyjnych (1962 r. Początek lat 50. a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań. że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang. W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów. tzn. sekwencjonowania DNA (1975 r. W doświadczeniu tym można upatrywać początku genetyki molekularnej. liczącym ponad trzy miliardy par nukleotydów.) oraz enzymu odwrotnej transkryptazy (1970 r. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw. przetwórstwem żywności.. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna. Program ten został urucho miony w 1987 roku. roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych. jak świnia. Warto podkreślić. Nirenberg i Ochoa. ustalenie kolejności par nukleotydów w całym DNA ludzkim.

Istotnym elementem pracy hodowlanej jest kontrola pochodzenia. świni i kury. a w przypadku mutacji genowych — metod genetyki molekularnej. . Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji. Głównymi metodami hodowlanymi są selekcja i krzyżowanie. zwierząt. Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój. że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych. że do 2005 roku zostaną zsekwencjonowane genomy bydła. W grudniu 2002 roku ustalono sekwencję genomu myszy. Wydaje się. bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji. a także człowieka powinna wywołać głębokie zastanowienie się nad tym. której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów. wysoką plenność owiec rasy boorola i inverdale. a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa. Przewiduje się. wysoką mięsność świń czy wydajność tłuszczu w mleku krów. którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek. Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. a ostatnio także polimorfizmu DNA. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt.oraz 2) prywatną firmę CELERA. czego jednym z licznych przykładów jest hodowla zwierząt. Ustalono. dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła. gdzie jest granica. roślin. Pierwsze osiągnięcia zostały już opublikowane.

Rozdział 2 Chromosomy i podziały jądra komórkowego W podziale systematycznym organizmów żywych wyróżnia się. Należy jednak podkreślić. Do prokariontów zalicza się bakterie i sinice. 2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie. biorąc pod uwagę organizację informacji genetycznej i budowę komórki. że nie 15 . Tym samym organizmy te zawierają pojedynczy zestaw genów. czyli są haploidalne. który w 1910 roku ogłosił chromosomową teorię dziedziczenia. które podlegają podziałom (mitoza. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię. W jądrze komórkowym występują chromosomy. Głównymi tezami tej teorii było twierdzenie. że: 1) geny zlokalizowane są w chromosomach. Odpowiednikiem jądra komórkowego jest nukleoid. mejoza). Do eukariontów zalicza się wszystkie organizmy komórkowe. zdolnego do podziałów (kariokinezy). Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana. zbudowany z „nagiej" kolistej cząsteczki DNA. a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota). które są zbudowane z kwasów nukleinowych i białek. Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu. Prokarionty nie mają wyodrębnionego jądra komórkowego. Eukarionty zbudowane są z komórek mających jądra komórkowe. oprócz bakterii i sinic.

A — anafaza i T — telofaza 16 .1. Oznaczenia: P — profaza.wiedziano wówczas. 2. S. Budowa chromosomu Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA). Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego. kwasów rybonukleinowych (RNA). która następuje za pomocą białek histonowych i niehistonowych. Gl. Fazy (GO. 2-1. Dzięki kondensacji cząsteczki DNA. M — metafaza. G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu. białek histonowych i niehistonowych. chromosom Ryć. z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu.

2-1). submeta-.00).osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej. określane inaczej jako obszar jąderkotwórczy — NOR (ang. że są siostrzane. Czwarta chromarydy siostrzane Ryć. ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. (3.71-3. także przewężenie wtórne. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17 . 2-2). Wówczas to chromosom ma długość rzędu kilku mikrometrów. 2-2. oprócz przewężenia pierwotnego. nucleolar organizer region). Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-. subtelo-i akro-(telocentryczny) (ryć.70). Część końcowa ramienia chromosomowego nazywana jest telomerem. który jest odpowiedzialny za uformowanie jąderek podczas interfazy. Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną.01-7. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). O chromatydach mówi się. Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym.00) i (7. 18S i 28S. ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć. (1.8S.01-oo). Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC. określanym jako centromer. Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej. W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5. Niektóre chromosomy mają. a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną. która obejmuje nie tylko ustalenie liczby chromosomów.00-1. W jąderkach budowane są podjednostki rybosomów. Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu.

że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację. W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej. W każdej parze jeden chromosom pochodzi od matki. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału.frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. Heterochromosomy. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y). Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. który występuje za przewężeniem wtórnym. Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y. występują w układzie XX u samic oraz XY u samców. Podczas fazy S następuje replikacja — 18 . Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). morfologii. która z kolei zawiera jedną cząsteczkę DNA. 2-3). układu prążków poprzecznych oraz. nazywa się satelitą. jak i żeńskiej. a drugi od ojca danego osobnika. podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X. Fragment ramienia chromosomu. Oznacza to. Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego. co najważniejsze — zestawu loci genów. W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy. które są w nich położone. Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć. oznaczane u ssaków symbolami X oraz Y. która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny.

Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom. 19 . Przyjmuje się. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo. ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki. zawierający po dwie cząsteczki histonów: H2A. Jest on zbudowany z rdzenia białkowego (oktamer histonowy. charakteryzują się niezwykłą precyzją (ryć. że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. H3 i H4). Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz. Fragment DNA owinięty na oktamerze histonowym (1.8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt. w zakresie od 0 do 80 pz. w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. H2B.Ryć. a procesy te. 2-4. inaczej par zasad (pz). 1997. na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów. 2-4). PWN) samoodtworzenie DNA. która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu.

które są zakotwiczone w rdzeniu białkowym chromatydy. która może ulec trwałej kondensacji. zbudowanym z białek niehistonowych. Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów. czyli geny. Pojawia się ona podczas zapłodnienia. czyli regionami wiążącymi się ze szkieletem chromosomu. Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości. rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego. Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. domeny. Chromosomy interfazowe zachowują strukturę nukleosomowa. a jej ostatecznym etapem jest utworzenie domen pętlo wych. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów. Wiadomo jednak. Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny. że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. przykładem jest jeden z chromosomów X u osobników żeńskich. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. Heterochromatyna fakultatywna jest częścią chromatyny. Jej replikacja występuje w późnym okresie fazy S. głównie powtarzalnych sekwencji DNA. Zbudowana jest z niekodującycK. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną.Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid. ciałka Barra. które odpowiadają za zbliżenie się sąsiednich nukleosomów. z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. Dlatego te sekwencje DNA określane są terminem S AR (ang. Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw. Podlega ona replikacji w początkowym okresie fazy S. która zawsze występuje w stanie skondensowanym. Heterochromatyna konstytutywna jest frakcją chromatyny. wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20 . W niej zlokalizowane są kodujące sekwencje DNA. high mobility group). Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu. Solenoid podlega dalszej spiralizacji. W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl. sekwencji nukleotydowych. przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. należącymi do rodziny białek HMG (ang. scaffold attachment region). które tworzą większe chromocentra.

Chromosomy homologiczne mają loci tych samych genów. ale mogą zawierać w nich różne allele 21 . a drugi matczynego. w których jeden chromosom jest pochodzenia ojcowskiego. W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych.w oocycie drugiego rzędu (komórce jajowej).

że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. Należy podkreślić. od 30 u norki do 78 u psa (tab. Chromosomy B. czyli nadliczbowe względem podstawowego ze- 22 . 2-1. ryć.Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota. 2-5 i 2-6).

Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. Barwienie prążkowe chromosomów Zróżnicowanie wewnętrzne chromosomu. ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii. wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T. Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej.2. Efektem tego jest zmienność ich liczby zarówno między osobnikami.49 lub 48 chromosomów. które mogą mieć 50. że często są zbudowane z heterochromatyny konstytutywnej. fuzji centrycznej u lisów polarnych. Konsekwencją tego jest występowanie u lisów osobników. charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych. Okazało się. Do tej pory nie poznano funkcji tych chromosomów. np. 2. może być uwidocznione za pomocą technik barwienia różnicującego. chociaż wiadomo.stawu A. Prążki mają identycz23 . jak i pomiędzy komórkami w obrębie jednego osobnika. czyli można przypuszczać. iż są nieaktywne genetycznie.

Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym.ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole. że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów. Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące 24 . Wynika z tego. ale także układ prążków na chromosomach. po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny.

W efekcie na chromosomach 25 . a następnie barwienia roztworem Giemsy. 2-7a). Silne wiązanie barwnika kwinakryny następuje w miejscach. Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny).(ryć. gdzie dominują pary zasad A-T.

Ponadto. Prążki R. pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. które zaszły w kariotypach zwierząt. Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach. a pozostają trudne do usunięcia. a miejscami szczególnie bogatymi w loci genów są prążki T. Heterochromatyna konstytutywna 26 . Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T. Prążki ciemne występują w tych samych miejscach. 2-8). które się wybarwiają roztworem Giemsy. są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl. Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. wykorzystywanych do identyfikacji chromosomów homologicznych.pojawiają się prążki ciemne i jasne (ryć. takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze. w których jest też najwięcej wysepek CpG. które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. silnie skondensowane obszary heterochromatynowe. Wskazuje to zatem. które pozwalają na uwidocznienie charakterystycznych regionów chromosomu. że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. a przy barwieniu GTG prążek jasny. Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. znane są metody. że prążki R są głównymi regionami. 2-7b). Oznacza to na przykład. H2 i H3. Zależność ta jest szczególnie interesująca. Oprócz opisanych wyżej metod prążkowych. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG). W takich warunkach znaczna część euchromatyny zostaje usunięta. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. w których zlokalizowane są geny. po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. a prążki jasne odpowiadają nie świecącym prążkom Q. Największe zagęszczenie genów występuje w obrębie izochor H3. gdzie przy barwieniu QFQ obserwowane są prążki świecące. wysepki CpG). są one niezbędne przy mapowaniu fizycznym genów. gdzie przy barwieniu QFQ występuje prążek nie świecący.

które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). czy też w częściach środkowych ramion. 2-10). Prążki Ag-I. ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć. W miejscach tych następuje wytrącenie metalicznego srebra. inaczej Ag-NOR. np. to barwienie azotanem srebra. u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona. które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć. a rzadziej na końcach. 2-9b).jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. 2-9a). Znane są również takie gatunki zwierząt. 27 .

28 .Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków. Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych.

w ramionach krótkich. w którym nie jest jeszcze zakończona kondensacja chromosomów. Chromosom X jest dużym akrocentrykiem. 2n = 64 (ryć. 2-6b). 2n . Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych. Wszystkie autosomy są akrocentryczne.i submetacentrycznych) oraz 6 par akrocentrycznych. Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków. 2n = 54 (ryć. a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. 2-5b). 2-5a). Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X. w chromosomie X widoczne są krótkie ramiona. 2-6a). Chromosom X jest średniej wielkości metacentrykiem. natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim. Świnia. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach. Chromosom X jest dużym chromosomem metacentrycznym. a chromosom Y jest małym metacentrykiem. 2-10a). Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. Owca. 2-9a). w pobliżu centromeru (ryć.60 (ryć. 2n = 38 (ryć. Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X. ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem. Koza. w części telomerowej ramion długich pięciu par autosomów. a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. a chromosom Y jest akrocentrykiem.Bydło. trudnym do odróżnienia na podstawie morfologii od autosomów. który ma dodatkowy prążek 29 . Podobnie jak w przypadku bydła. Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta. Obszary jąderkotwórcze występują. Również akrocentryczny jest chromosom X. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów. 2n = 60. Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków. co odróżnia go od autosomów akrocentrycznych o podobnej wielkości. a chromosom Y jest małym metacentrykiem. Układ prążków C. natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. podobnie jak u bydła. Chromosomy płci są łatwe do identyfikacji. W chromosomie X brak jest centromerowego prążka C. Koń. Chromosom Y jest najmniejszym chromosomem metacentrycznym. także koza ma wszystkie autosomy akrocentryczne. a chromosom Y jest małym metacentrykiem. W stadium prometafazy.

Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. 30 . W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. Liczba chromosomów B waha się od O do 7. którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B. Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych. Chromosom X jest dużym metacentrykiem. 2n = 34 +B (ryć. 2n = 78. U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. występuje liczna grupa bardzo małych chromosomów. a chromosom Y bardzo małym akrocentrykiem. Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. Chromosom Y jest w znacznej części heterochromatynowy. Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów. Wszystkie chromosomy. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. 49 lub 48. łącznie z chromosomami płci. przy czym najczęściej obserwowano l. Lis polarny. 2-10b). Lis pospolity. Obszar jąderkotwórczy występuje tylko w jednej parze autosomów. 2-9b). Wszystkie autosomy z grupy A są chromosomami dwuramiennymi. a chromosom Y bardzo małym akrocentrykiem. Kura. mają bloki heterochromatynowe w okolicy centromeru. a chromosom W jest małym metacentrykiem. dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe. z grupy mikrochromosomów. 2n = 50. nazywanych mikrochromosomami. Chromosom Z jest dużym metacentrykiem. W kariotypie kury. w okolicach centromeru. Chromosom X jest dużym metacentrykiem. podobnie jak u innych ptaków. Ponadto.interstycjalny w ramieniu długim. a chromosomy z grupy B są akroćentryczne lub subtelocentryczne. wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne. Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną. oraz w chromosomie Y. 2-7a). W grupie dużych autosomów analizuje się najczęściej 8 par. 2 lub 3 chromosomy B.

Pies. 2n = 78 (ryć. Fazy Gl. ale także identyczną sekwencję nukleotydów w DNA.3. a faza S jest związana z procesem samoodtworzenia się DNA (replikacja). 2. Jeżeli ilość DNA wyrazimy za 31 . że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. Chromosom X jest dużym metacentrykiem. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. a także z pierwszymi etapami gametogenezy. Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y. 2-8b). a czwartą fazą jest podział. chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. mających genotyp identyczny z tym. Mitoza Mitoza to proces podziału jądra komórkowego. jaki miała komórka rodzicielska. W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu. komórki krwi. a chromosom Y jest małym metacentrykiem. Wszystkie autosomy są akrocentryczne. Rozpoczęcie fazy S oznacza. odnawianiem niektórych komórek u dorosłych organizmów (np. w części terminalnej ramion długich. W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki. Komórki potomne mają nie tylko taką samą liczbę chromosomów. proliferacją limfocytów przy reakcji odpornościowej organizmu. nabłonka). S i G2 tworzą okres międzypodziałowy — interfazę. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki. który prowadzi do powstania dwóch komórek potomnych.

a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. W telofazie zachodzą procesy odwrotne do tych. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. W końcu. W profazie rozpoczyna się proces kondensacji chromosomów. Po zakończeniu podziału jądra komórkowego następuje cytokineza. metafazy. wychodzące z centrosomu (obszar wokół centrioli). Mitoza składa się z czterech faz: profazy. czyli podział cytoplazmy i rozdział organelli komórkowych. Istotnym zmianom podlegają również inne organelle komórkowe. że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. Następuje formowanie się wrzeciona podziałowego. organelle komórkowe odpowiedzialne za wytwarzanie rybosomów.4. Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi. W trakcie omawiania podziału mej etycznego pokazane zostanie. odbudowuje się błona jądrowa oraz jąderka.pomocą umownych wartości C. że najmniejszą zawartość DNA (1C) mają gamety (ryć. łączą się z centromerami chromosomów w taki sposób. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. dezintegracji ulega błona jądrowa. którego włókienka. Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32 . odpowiedzialne za powstanie wrzeciona podziałowego. a centriole dzielą się na dwie parzyste struktury. 2. w których każdy z chromosomów jest zbudowany z jednej chromatydy. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. 2-12). Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska. Kariotyp Uszeregowanie chromosomów. w pary homologiczne określane jest terminem kariotyp. anafazy i telofazy (ryć. W obrębie jądra komórkowego zanikają jąderka. Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. W wyniku kariokinezy w komórce powstają dwa jądra potomne. 2-11). to w jądrze komórkowym po replikacji jest 4C. jakie występują w profazie. występujących w jądrze komórki somatycznej. rozchodzą się do przeciwległych biegunów komórki. Centriołe. Chromosomy ulegają dekondensacji. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. W tej fazie chromosomy są rozprzestrzenione w całej komórce. Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych.

C — cytokineza. Wydawnictwo AR. b— zanikające jaderko. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. T — telofaza. d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt. Oznaczenia: P — profaza. Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów.spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce. PM — prometafaza. 2-12. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. M — metafaza. Być. A — anafaza. Poznań 1988) 33 . Schemat przebiegu podziału mitotycznego. a — centriole. c — dezintegrująca błona jądrowa.

lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć. 2-8a 34 . 2-13.Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych. kozy i psa. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds. ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. do których zalicza się: długość chromosomu. w których wszystkie Ryć. że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny. położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-. submeta-. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła. Standaryzacji Kariotypu Świni. Jest to spowodowane tym. subtelo. Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu. G lub R.

Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds. Standaryzacji Kariotypu Świni (Hereditas 109:151-157.chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości. 2-14.1988) 35 . przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne. Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy Ryć.

R G. Natomiast w drugiej połowie lat 90. konia. dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem. R G. nazywa się idiogramem (ryć. 1999 . precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe. Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła. opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11 Wykaz gatunków. R Źródło Cytogenetics and Celi Genetks 92:283-299. 2-14). 1985 Cytogenetics and Celi Genetks 31:240-248. Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony. dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang.zróżnicowane pod względem morfologicznym. 1988 Chromosome Research 5:433-443. przyjętym dla danego gatunku. owcy. W latach 80. 1999 J w- Hereditas 109:151-157. 2001 jw. Ponadto. Każda para homologiczna ma opisaną morfologię. w zakresie wyznaczonym przez liczbę par dla danego gatunku. Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej. landmarks). Graficzne przedstawienie kariotypu. w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. które są numerowane (ryć. C. Ag-I G. 1985 Hereditas 103:171-176. Q. kozy i kota. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni. Opracowanie kariotypu. kozy i konia. R R G. R G. Przykładem może być kariotyp świni (2n = 38). owcy. czasami określanego kariogramem. Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. i 85:317-324. bydła. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery. 1996 Cytogenetics and Celi Genetks 86:271-276. W obrębie regionów numerowane są także kolejne prążki. dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G. 1981 Chromosome Research 4:306-309. wielkość oraz wzór prążkowy (najczęściej prążki G lub R). świni. 2-13). obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków. które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. Q. która odbyła się w 1976 roku w Reading (W. 1997 Hereditas 103:33-38. Brytania). Ag-I G G G. C. 2-14).

a element centralny powstaje w miejscu. synaptonemal complex — SC). Wejście komórki w podział mejotyczny poprzedzone jest. Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne. tzn. Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału. pojawiającej się w zygotenie i pachytenie profazy I. pachyten.szych par spośród 39) oraz poprawiono wzorzec kariotypu konia. diploten i diakinezę. Należą do nich: kondensacja chromosomów. w których występują takie same fazy jak w mitozie. 2-16 i 2-17). Elementy lateralne 37 . który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. 2. Każdy element lateralny zakończony jest tarczką przylegającą. która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. metafaza. replikacją DNA w fazie S. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten. Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. dla których opracowano wzorce. W tabeli 2-II zestawione są gatunki. gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. Mejoza Podział mejotyczny prowadzi do powstania komórek. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych.5. polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych. która mocuje chromosom do wewnętrznej strony błony jądrowej. anafaza i telofaza (ryć. Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu. Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną. zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. Ponadto. dezintegracja błony jądrowej. Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej. Strukturą tą jest kompleks synaptonemalny (ang.: profaza. w których liczba chromosomów jest zredukowana o połowę. Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym. komórki te mają zmniejszoną do poziomu 1C zawartość DNA. które występują również w mitozie. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. 2-15). tzn. Mejoza składa się z dwóch podziałów. z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów. czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. zygoten. podobnie jak w przypadku podziałów mitotycznych.

Z — zygoten. c — początek budowania kompleksu synaptonemalnego. DL — diploten.Tli Ryć. d — guzek rekombinacyjny. Wydawnictwo AR. TI — telofaza I. Oznaczenia: PI — profaza I. a — tarczka przylegająca. AI — anafaza I. Tli — telofaza II. 2-15. Schemat przebiegu podziału mejotycznego. Pil — profaza II. b — centromer. e — chiazma (wg: Genetyka zwierząt. DK — diakineza. MI — metafaza I. Ali — anafaza II. L — leptoten. MII — metafaza II. Poznań 1988) . P — pachyten.

Wiele wskazuje na to. SCP2 i SCP3. Ponieważ koniugacja ma charakter homologiczny. Wynika z tego. U ssaków dobrze poznano strukturę trzech białek SCP (ang. których długość. że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. zależnie od gatunku. Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. która z kolei miała umożliwiać zajście crossing over na początku pachytenu. domen pętlowych. mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz). Koniugacja chromosomów 39 . zanim dojdzie do koniugacji za pośrednictwem SC. Ostatnio przeprowadzone badania pokazały jednak. sekwencjami DNA. Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej. Badania białek SC pokazały. chociaż jeszcze nie poznanymi.łączą się tylko z niewielką częścią DNA chromosomów (około 1%). które są zakotwiczone w rdzeniu białkowym chromatydy. że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE). synaptonemal complex protein): SCP1. Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi. występującymi w tej części domen pętlo wy ch. że crossing over może zajść. że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego.

Biwalent jest także formowany przez heterochromosomy X i Y (ryć. 2-17b). Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów.zostaje zakończona na początku pachytenu (ryć. na okładce). dzięki 40 .

Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. w przeciwieństwie do sytuacji. Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I. składające się z maksymalnie skondensowanych chromosomów homologicznych.niewielkim regionom pseudoautosomalnym (ang. że crossing over jest zjawiskiem obligatoryjnym. Zjawisko to określane jest terminem interferencji. Wiadomo. Przyjmuje się. Na początku pachytenu występuje zjawisko crossing over. że SC jest w to istotnie zaangażowany. które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. pseudoautosomal region — PAR). gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T. dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over. które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. Zasadniczo crossing over jest zdarzeniem losowym. stanowiące cytologiczny dowód zajścia crossing over. a tym samym i jego chromatydy. jaka była przed crossing over. Zasada ta dotyczy także biwalentu X-Y. Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału). że na jednych chromosomach liczba ta byłaby znaczna. Wówczas to chromosom. które uruchamiają homologiczną koniugację. Należy podkreślić. przy czym liczba tych zdarzeń waha się od l do 5. że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. a w świetle ostatnich badań można przypuszczać. uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego. poza miejscami. a drugi od matki. miał zestaw alleli tylko jednego z rodziców. gdzie wystąpiło crossing over. następuje rozkład kompleksów synaptonemalnych. której efektem jest zmienność w świecie ożywionym. tzn. Chromatyda. Losowość crossing over naruszona jest również przez to. tzn. a na innych brak byłoby takich wymian. Po zakończeniu pachytenu — w diplotenie. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm. Potencjalnie mogłoby istnieć niebezpieczeństwo. czyli musi zajść w obrębie każdego biwalentu. ponieważ brak crossing over pociąga za sobą brak chiazm. że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca. co wynika z zasady. w których powstają chiazmy. że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji. zmierzają do płaszczyzny równikowej 41 . która uczestniczyła w wymianie. że pierwotnym źródłem zmienności są mutacje. że zachodzi ono rzadziej w pobliżu centromeru. ich zanikania. W metafazie I biwalenty. Należy jednak pamiętać. które są podklasą prążków R. Ponieważ tak się nie dzieje. Losowość zachodzenia crossing over jest jednak ograniczona. zachodzi w przypadkowym miejscu biwalentu.

Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA. Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział. Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I. że do centromeru przyłączają się włókna tylko z jednego bieguna. który nie jest poprzedzony replikacją DNA. 2-18a). natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego. 42 . 2-18c). W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. 2-18b). że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej. w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć. Oznacza to. czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym.komórki (ryć. Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób.

które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy. 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43 . a niektóre mają zrekombinowany układ alleli.Drugi podział ma przebieg zgodny z mitozą. Trzystopniowa rekombinacja sprawia. że wśród gamet nie występują dwie o tym samym zestawie alleli. a ich chromatydy mają zrekombinowane układy alleli. Przebieg mejozy. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. Po ustawieniu się chromosomów podczas metafazy II (ryć. 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. inne matczynego. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego. W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. Ten typ określany jest jako rekombinacja chromatydowa. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C.6. Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd. można podzielić na: chromosomowe. rozpoczyna się telofaza. wśród których jedne są pochodzenia ojcowskiego. 2. przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny. Gametogeneza Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają. że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice. z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów. chromatydowe i wewnątrzchromatydowe. Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki. jakie występują w profazie mitotycznej. jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów. rozumiane w szerokim sensie. w której zachodzą procesy odwrotne do tych. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza). Rekombinacje genetyczne zachodzące podczas mejozy. obok mutacji. Ten fenomen.

która jest określana jako syncytium. stronie jądra komórkowego. które niezwłocznie rozpoczynają podział mejotyczny. w której jest umiejscowione jądro komórkowe i akrosom. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. Podziały te są zsynchronizowane. a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. Główne zmiany. powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi. nie kończą się cytokinezą. Spermatydy. w których komórki linii płciowej lokują się w części korowej gonad. która stanowi przedłużenie wstawki. w stosunku do akrosomu. stem cells). które rozpoczynają podział mejotyczny. 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach. Następne podziały mitotyczne spermatogoniów. 3) wykształceniu na bazie centrioli włókna osiowego witki. które są umiejscowione po przeciwnej. oraz witki. 2-20). Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego.geneza. a druga podlega dalszym podziałom. który okrywa górną część jądra komórkowego znajdującego się w główce plemnika. jakie zachodzą podczas spermiogenezy. Pierwszy podział prowadzi do powstania dwóch spermatogoniów. czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika. wstawki znajdującej się u podstawy główki. czyli komórek nie w pełni zróżnicowanych. Oocyty przechodzą w stan spoczynkowy. polegają na: 1) przekształceniu aparatu Golgiego w akrosom. będące w stadium diktiotenu. które wykazują zdolność do samoodnawiania. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych. podlegają głębokim przeobrażeniom podczas procesu spermiogenezy. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu. która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. Ostatecznie. 44 . Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. 2) zgrupowaniu mitochondriów w pobliżu centrioli. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. a jest ich najczęściej sześć. w której zgrupowane są mitochondria. po zakończeniu mejozy. zostają przekształcone w oocyty I rzędu. Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. które występowały w jajniku. Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu. który jest nazywany diktiotenem. Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki. W ten sposób wszystkie oogonia. Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. z których jedna komórka zajmuje miejsce pierwotnego spermatogonium. 2-19). Dojrzały plemnik zbudowany jest z główki. jako komórki niezróżnicowane. w wyniku którego powstają plemniki.

W kolejnych cyklach płciowych. w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. to może nastąpić dokończenie oogenezy. pewna część pęcherzyków rozpoczyna wzrost. który jest wspomagany przez otaczające komórki pęcherzykowe. których wzrost był wystarczająco intensywny. Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki. Dzieje się to na drodze wyrzucenia przez oocyt zawartości 45 .Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji. przed owulacją następuje ponowne uruchomienie podziału mejotycznego. Oocyt znajduje się w stadium metafazy II. regulowanych hormonalnie. Oocyt I rzędu kończy pierwszy podział mejotyczny. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej. W pęcherzykach. a w nich rozrasta się również oocyt.

które pozostały w oocycie 46 . Powoduje to „utwardzenie" osłonki przejrzystej. podlega dekondensacji i powstaje przedjądrze męskie. Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny. po czym następuje telofaza II. a drugie reprezentujące zestaw chromosomów żeńskich. który zapłodnił oocyt. znajdujących się pod powierzchnią oocytu. Zapłodniony oocyt II rzędu przekształca się w zygotę. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie. do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. a chromatyna plemnika. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego. która staje się barierą nie do pokonania dla plemników. w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika.ziaren korowych.

że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne). można wprowadzić techniką elektrofuzji komórkę somatyczną. przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu. Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów. . Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. Warto zauważyć. samic biorczyń. Zawartość DNA wzrasta do poziomu 4C. profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów). W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja). inseminacja. pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). że zygota jest gotowa do rozpoczęcia podziału mitotycznego. które umożliwiają uzyskiwanie potomstwa pożądanej płci. Do takich oocytów. do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy. co powoduje. Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. samic dawczyń do rogów macicy tzw. który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. zygotach. z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II). zarodkach. które są określane jako enukleowane. Na przykład.po zakończeniu drugiego podziału mejotycznego. Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki. U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich. W taki właśnie sposób sklonowano słynną owcę Doiły. a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii). z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro).

a także o strukturze cząsteczek rybosomowego (rRNA). informacja o pierwszorzędowej strukturze białek. transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. McCarty. Po drugie. MacLeod i M. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA. które z kolei podlegają rekombinacjom podczas mejozy. Z kolei proces ekspresji 48 . Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości. DNA charakteryzuje się trzema właściwościami. C. Watson i F. Badania te przeprowadzili badacze amerykańscy O. W ślad za tym odkryciem nastąpiły następne. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA). w sekwencji nukleotydów zapisana jest. DNA może podlegać mutacjom. Crick przedstawili model budowy DNA. które są niezbędne do pełnienia funkcji nośnika informacji genetycznej. 3. DNA ma zdolność do samoodtwarzania się. czyli procesowi generującemu pierwotną zmienność genetyczną. Avery. a przez następne lata rozszyfrowywano kod genetyczny. Budowa kwasów nukleinowych Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych.1.Rozdział 3 Gen i jego ekspresja Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi. czyli replikacji. Po pierwsze. Po trzecie. W 1953 roku J. który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy.T.M.D. za pomocą kodu genetycznego.

Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi 49 .1. 3. DNA Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. 3-1). które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C). i tRNA (transportujący RNA). W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy. cukier deoksyryboza i reszta kwasu fosforowego (ryć. rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów.genu jest nierozerwalnie związany z RNA.1. który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów. w którego skład wchodzą: zasada azotowa. W DNA występują cztery zasady azotowe. a rzadziej podwójny heliks. helix). występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu. Struktura ta określana jest w języku polskim terminem podwójna helisa (ang. Podstawową jednostką struktury DNA jest deoksyrybonukleotyd. które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji.

Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla. nucleolar organizer region — NOR). Pomiędzy zasadami powstają słabe wiązania wodorowe. natomiast liczba aktyw50 . Taka organizacja podwójnej helisy DNA sprawia. powstaje pre-rRNA o stałej sedymentacji 45S.8S. 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang. W jąderku zlokalizowane są cztery rodzaje rRNA. że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. RNA Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych.z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą. tzn.1. inaczej nazywanych przewężeniami wtórnymi. Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji. z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA. Przyjmuje się. tak więc w parze AT są dwa wiązania wodorowe. a w przypadku mRNA także dla procesu translacji. lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. określaną wielkością S — stała sedymentacji. który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. Trzy rodzaje rRNA: 5. 3. Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku. Przeciwna polaryzacja polega na tym. a w parze GC trzy takie wiązania. naprzeciw adeniny zawsze występuje tymina. że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha. Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności. W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA).2. polskim lub bp od słów angielskich base pairs). czyli każdy łańcuch ma koniec 3' i 5'. w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). Długość cząsteczki DNA wyraża się liczbą par nukleotydów. bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA. Podczas transkrypcji. prowadzonej przez polimerazę I RNA. które są wyróżniane ze względu na wielkość cząsteczki. a naprzeciw guaniny znajduje się cytozyna. którego długość wynosi około 14 000 pz.

3) pętla III — dodatkowa. która katalizuje związanie tRNA z. zawiera układ trzech nukleotydów. a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć. które są komplementarne do kodonu aminokwasu transportowanego przez tRNA. Na końcu 3' cząsteczki tRNA występuje sekwencja CCA. Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA). że przekracza liczbę znanych aminokwasów. Geny 5S rRNA są transkrybowane przez polimerazę III RNA. a trzy pozostałe rodzaje. 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem. zlokalizowane są w podjednostce dużej (60S). o mało poznanej funkcji. co oznacza.8S i 28S. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. 5. Wymienione rodzaje rRNA uczestniczą w budowie rybosomu. który jest zaangażowany w dostarczanie aminokwasów do rybosomów. zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu.nych obszarów. tzn. 51 . Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów. jest zmienna. w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas. 5S. W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową. czyli takich. które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60. Czwarty rodzaj — 5S rRNA jest kodowany przez gen. W nici takiej mogą jednak występować fragmenty komplementarne. 2) pętla II — antykodonowa. 3-2).właściwym aminokwasem. występujący w wielu powtórzeniach w innej części genomu. które podlegają transkrypcji.

modyfikacji nukleotydów. Na uwagę zasługuje jeszcze jedna klasa RNA. Replikacja DNA Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego. która bierze udział w procesie wycinania intronów z pre-mRNA. że jest to bardzo ważna grupa RNA. z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji. noncoding RNA). bądź mejozy.2. liczba replikonów w genomie ssaków szacowana jest na około 25 000. Na przykład. 3. określana terminem niekodujący RNA (ncRNA — ang. czyli mitozy. które określane są jako replikony. Ostatnie badania wykazują. a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów. a także regulacji ekspresji genów. Każdy podział mitotyczny musi być poprzedzony replikacją.Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych. Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. 52 . Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach. Podobnie jest w przypadku mejozy.

Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). kod ma charakter trójkowy. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów. widełki replikacyjne (ryć. np. w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. tryplet) w DNA zawierają informację o aminokwasie. 3. 3-3). Po drugie. to ogółem możliwe jest utworzenie 64 trójek (tab. tzn. Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA. który ma być wbudowany w procesie biosyntezy białka. Od tej zasady są tylko nieliczne wyjątki. W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. o czym była już mowa wyżej. mającego charakter trójkowy. trzy kolejne nukleotydy (kodon. Rozplecione łańcuchy polinukleotydowe stanowią matryce. Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne. jest on uniwersalny. Kod genetyczny Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego. że sekwencje nukleotydów w tych łańcuchach. Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. W ten sposób powstają tzw. który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą.3. Wynika z tego. który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. Drugi. kodon UGA w kodzie uniwersalnym jest 53 . które następnie są łączone przez enzym ligazę w ciągłą nić. które nie kodują żadnego aminokwasu. Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. w obrębie danego odcinka DNA. 3-1). że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. Po pierwsze. są różne. a nić powstająca w sposób nieciągły opóźnioną. tzn. tzn. rozpoczyna część kodującą genu. Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia. które dotyczą niektórych kodonów w mitochondrialnym DNA.Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. takie. Oznacza to. fragmenty Okazaki). Tryplet AUG. na których w sposób komplementarny syntetyzowane są drugie łańcuchy. że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego.

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

elektroforeza białek. Mechanizm ten nazywa się alternatywnym składaniem mRNA. potranskrypcyjnej modyfikacji mRNA. oprócz zmian opisanych w podrozdziale poświęconym transkrypcji. że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA. że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele. funkcje gospodarza komórki (ang. budowa struktur komórkowych itp. hybrydyzacja ze znakowanym przeciwciałem itp.lub heterozygotycznym. które mogą występować w układzie homo.). Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. housekeeping genes). Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu. Wśród nich znaczną grupę stanowią geny pełniące tzw. obejmuje także inne procesy. Zakończenie transkrypcji związane jest z sekwencją AAUAAA. że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu. Należy jednak pamiętać. którego całościowe poznanie wymaga jeszcze wielu lat badań. poligeny. W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw. podatność na stres itp.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek. Ekspresja genu obejmuje procesy: transkrypcji. zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. replikacja DNA. Warto pamiętać. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji. co ma oczywiście związek z ekspresją genów. Jest to bardzo złożony proces. w skład którego będą wchodziły różne kombinacje eksonów. czyli dobudowa60 . zależnie od tego. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. w jakim kierunku różnicuje się dana komórka. jest włączana i wyłączana ekspresja różnych genów. Modyfikacja mRNA. wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych.7. umaszczenie. Z drugiej strony.3. obok genów ulegających powszechnej ekspresji. Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki. w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. translacji i potranslacyjnej modyfikacji białka. które są zaangażowane w kontrolę ekspresji genów. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. która wskazuje. czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. badania serologiczne — grupy krwi. Regulacja ekspresji genu W genomie ssaków występuje około 35 tysięcy genów. Podczas rozwoju ontogenetycznego. obecność rogów. Niemniej znanych jest już wiele mechanizmów. takie jak: przemiany energetyczne.

Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. Efektem tego może być na przykład pojawianie się w transkryptach. Funkcjonują wówczas dwa rodzaje mRNA. powstających w niektórych tkankach. Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie. w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA). takich jak hormony. czyli od jego stabilności. Forma rozpuszczalna tego białka powstaje na matrycy mRNA. który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. Czynniki transkrypcyjne. które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang.nie sekwencji poliA (tzw. 3-7). przed przejściem do cytoplazmy. Taką formę modyfikowania mRNA opisano m. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. Wreszcie mRNA powstały podczas transkrypcji może ulegać.1. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych.7. dodatkowego kodonu stop. że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty.in. Czynniki transkrypcyjne Czynnikami transkrypcyjnymi nazywane są białka. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik 61 . zależnie od ich struktury trzeciorzędowej. modyfikacjom polegającym na zmianie sekwencji nukleotydów. są zaliczane do następujących grup: białka zawierające tzw. leucine zipper). Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć. zinc finger). Wymienione struktury wchodzą w kontakt z nicią DNA. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza. 3. a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. palce cynkowe (ang. powstałe na bazie tego samego matrycowego DNA. W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. ogonek poliA) na końcu 3' mRNA. białka o strukturze typu heliks-skręt-heliks (ang. Białka te w swojej strukturze zawierają dwa istotne obszary. Okazuje się. odpowiedzialne za syntezę polipeptydów o różnej długości. Proces ten nazywa się redagowaniem mRNA.

hormon wzrostu. insulina itp. a z drugiej strony od różnicowania się komórek. R — receptor hormonu peptydowego.7. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników. T1 T2 — przekaźniki wewnątrzkomórkowe. Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. Geny homeotyczne Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych. a jedynie wiążą się z receptorami błonowymi. Hormony peptydowe (np. Schemat regulacji ekspresji genów za pomocą hormonów. Domena wiążąca DNA jest aktywna tylko wówczas. Gj. Wiązanie takie wywołuje wiele reakcji.) nie wnikają do wnętrza komórki. co można uznać za regulację ekspresji genów na etapie potranslacyjnym. lub też z udziałem przekaźników modyfikujących białka w cytoplazmie.2. 3-7. których mechanizm działania jest jeszcze słabo rozpoznany. Poznanie genów od62 .Ryć. 3. RS — receptor hormonu steroidowego. gdy do receptora jest przyłączony hormon steroidowy. HS — hormon steroidowy. G2 — części strukturalne genów transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu. Pl P2 — promotory genów. Oznaczenia: HP — hormon peptydowy.

homeoboks). U ssaków geny te. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji. HOX2. Prawie cały DNA zawiera zmetylowaną cytozynę. Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. które odpowiadają za poszczególne etapy morfogenezy. Geny te funkcjonują w układzie hierarchicznym. czego skutkiem jest przejście DNA w stan nieaktywny. Struktura tych genów wykazuje zaskakujące podobieństwo. że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu. Obok wielu genów. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. które w genomie muszki owocowej występują w dwóch kompleksach. a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. zgrupowane są w czterech kompleksach: HOX1. w liczbie około 30. która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących 63 . Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia. Wynika z tego. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną. 3. a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie. HOX3 i HOX4. Okazało się. że mają one sekwencję o długości około 180 pz (tzw. która koduje fragment białka (tzw. Oznacza to.7. ich ekspresja następuje w ściśle określonej kolejności. że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów. Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks. Trzeba jednak podkreślić. położonych w jednym chromosomie. Rozwój muszki owocowej przebiega pod kontrolą genów. ANT-C i BX-C.powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. Metylacja DNA Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA. że około 56% genów zawiera te sekwencje. tzn.3. domena białkowa) o długości 60 aminokwasów.

a także w komórkach somatycznych organizmu dorosłego. gdy pochodzą np. znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. w które zaangażowane są fragmenty podlegające piętnowaniu. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną. 3. niedorozwinięty zaś był sam zarodek. jeśli pochodzą od ojca. Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego. dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. zawierające dwa genomy żeńskie. były zdecydowanie niedorozwinięte.7. zależną od tego. Powstałe na drodze manipulacji zarodki ginogenetyczne. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. które mogą być nieaktywne. Piętno gametyczne W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze. rozwijały się dość dobrze. typowy dla danej płci (ryć. w której cytozyny nie są metylowane. czy od matki. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji. a nie tylko diploidalna liczba chromosomów. czyli nieistotne jest. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję.w części poprzedzającej gen. czyli ze strony końca 5'. czy allel pochodzi od ojca. od którego z rodziców pochodzi allel A. 3-8). genotyp Aa jest równoważny genotypowi aA. mające dwa genomy męskie. tzn. Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. tzn. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca. a drugi — MspI przecina tę sekwencję niezależnie od tego. czy cytozyna jest metylowana. czyli nie wpływa na prawidłowość replikacji wysepek CpG. gametic imprinting). Dowód na to. znane są liczne geny.4. Natomiast zarodki androgenetyczne. wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. lub aktywne. czyli uczestniczące w formowaniu łożyska. od matki. Zjawisko to niekiedy dotyczy całych regionów chromosomowych. Jeden z nich -— HpaII przecina sekwencję CCGG. Jedynie zarodki zawierające zarówno genom żeński. Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych. jak i genom matki. a od którego allel a. z tym jednak że struktury wywodzące się z trofoblastu. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych. czy niemetylowana. dobrze rozwijały struktury trofoblastu. W obu przypadkach dochodziło do obumarcia zarodka. że do rozwoju osobniczego niezbędny jest zarówno genom ojca. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna. tzn. jak i męski rozwijały się prawidłowo. to 64 .

gen SNRPN — ang. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca.in. Wynika z tego.in. natomiast kilka genów (m. a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska). ubiquitin protein ligase E3) pochodzenia matczynego. głębokie upośledzenie umysłowe. podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. brak mowy. a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym. 3-8.in. gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). Wiadomo. Tak więc. Przyjmuje się. W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego. tylko jeden gen — UBE3A nie podlega ekspresji. M — chromosom pochodzący od matki wówczas rozwija się zespół zmian fenotypowych (m. a inny w gametogenezie żeńskiej. Piętnowanie gametyczne. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m. który nosi nazwę zespołu Pradera-Willego. Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony. że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego. że fragment chromosomu 15 podlega piętnowaniu gametycznemu. jeśli pochodzi od ojca. a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. drgawki) określanych jako zespół Angelmana. P — chromosom pochodzący od ojca. smali nuclear ribonucleoprotein polypep65 . Podobna sytuacja powstaje.M r ZYGOTA 2ENSKA M P ZYGOT-A MĘSKA Ryć. że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej. W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. otyłość i niedorozwój umysłowy).

Obecnie znane są 34 geny. insulin growth factor type 2) u myszy. że inaktywacją chromosomu X jest formą piętnowania. Okazało się. Przykładem może być gen Igf2 (ang. W komórkach męskich występuje tylko jeden chromosom X.7. duże fragmenty chromosomu 7. wywołujące zahamowanie transkrypcji. 3. Na przykład. które podlegają metylacji. W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX). W komórkach żeńskich występują dwa chromosomy X. do którego nie może się przyłączyć białko (represor). Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego. W efekcie oba allele są transkrybowane. obok chromosomu Y.5. które zachodzi podczas wczesnego rozwoju zarodkowego. jeśli są położone w chromosomie pochodzącym od matki. Stan taki określany jest terminem hemizygotyczności. że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca. W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych. W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. które są objęte zjawiskiem piętnowania gametycznego. a także 11 i 12 podlegają piętnowaniu. a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego. nie ulega ekspresji. Może się jednak zdarzyć. które podlegają piętnowaniu gametycznemu u myszy. albo matczynego.tide N). niezbędnych do podjęcia transkrypcji. ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. który podlega piętnowaniu podczas gametogenezy żeńskiej. 66 . że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego. W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji. co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych. Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. W genie tym występują dwa regiony. Inaktywacja chromosomu X w zarodkach żeńskich Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. Sytuacja ta jest spowodowana tym.

.

Inaktywacja jest związana z metylacją DNA danego chromosomu. w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X. W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu. Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X. .Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. Później. 3-9). a jego obecność ujawnia się w postaci tzw. Warto zaznaczyć. że nieaktywny chromosom X jest replikowany w późnym okresie fazy S. że produktem locus Xist jest niekodujący RNA (ncRNA). że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3. w której część komórek ma aktywny chromosom pochodzenia ojcowskiego. Spełnia on funkcję regulacyjną. W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R. który pełni główną rolę w uruchomieniu inaktywacji. a część pochodzenia matczynego (ryć. które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. ciałka Barra. Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym. albo matczynym. W centrum inaktywacji zidentyfikowano locus Xist (ang. W konsekwencji organizm żeński jest swoistą mozaiką. Wiadomo. Barwienie to pokazuje. ekspresja genu Xist pojawia się losowo. X inactive specific transcript). albo w chromosomie ojcowskim. który to stan jest utrzymywany w komórkach potomnych. Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X.

nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. w zależności od ich mechanizmu działania.Rozdział 4 4. Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów. że pierwsza litera stanowi skrót nazwy rodzaju bakterii. rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów. Większość metod wymaga fragmentacji (pocięcia. DNA nie jest odpowiednio oznaczony (zmetylowany). System ten polega na tym. enzym HindIII pochodzi z bakterii Haemophilus influenzae. drugi to metylotransferazy (zwane też metylazami).1. ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii. serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. Endonukleazy restrykcyjne Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne. Endonukleazy dzieli się na trzy klasy. wirusowy. Do klasy I enzymów 69 . niszczony jest przez endonukleazy bakterii. substratów i produktów. druga i trzecia — gatunku. metody in situ) bądź w wyizolowanym DNA lub RNA. bakterie wykształciły system restrykcji-modyfikacji. co umożliwia np. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak. niszcząc niepożądane. Na przykład. by nie zostały przecięte przez endonukleazy. następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii. Nazewnictwo endonukleaz tworzone jest w ten sposób. Jeden to endonukleazy. W celu ochrony własnego DNA przed działaniem restryktaz. strawienia) DNA. Ponieważ obcy. np. obce cząsteczki DNA. Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz. a także kofaktorów. że bakterie wytwarzają dwa rodzaje enzymów.

Tabela 4-1 Przykłady enzymów restrykcyjnych 70 . czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna. które wykazują aktywność nukleazy. ale wzmacnia ich aktywność). utrudniającą ich wykorzystywanie w analizie DNA. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I. że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów. a ich działanie zależy od obecności takich kofaktorów. Cechą tych enzymów. jony magnezu (Mg2+) i S-adenozylometionina. Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1. jest to. Różnica między tymi dwiema klasami polega na tym.zaliczane są te restryktazy. ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. jak ATP.

Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję: Niektóre enzymy. w których enzymy przecinają te sekwencje. tępe końce. sekwencje palindromowe). 4-1). czego konsekwencją jest powstawanie fragmentów DNA o tzw. Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum) przecinają rozpoznaną sekwencję w różnych miejscach: . Jednak miejsca. Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie. lepkich końcach. rozpoznają te same sekwencje DNA. Są to izoschizomery. Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6. rzadziej 8 nukleotydów. mogą być różne. mimo że pochodzą z różnych szczepów bakterii. charakteryzujące się dwustronną symetrią (tzw.Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej. dając fragmenty mające tzw. Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach.

Niektóre enzymy potrzebują takich samych buforów.. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne. • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki.. mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza. Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'. wykorzystywanym m. izolacji i identyfikacji genów.. Wektory Wektory są podstawowym narzędziem klonowania DNA.. opisane pod względem fizycznym i genetycznym.3' 3'.. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych. diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP). sekwencjonowania DNA.. do którego fragment ten został uprzednio włączony (rekombinacja molekularna). oraz składem buforu. do sporządzania map genomowych.. • powinny mieć jeden lub kilka silnych promotorów tak. Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą.5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA.. W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii).GGATG(N)9'.. aby wstawiając 72 . w której mieszanina DNA z enzymem jest inkubowana. Wektor (np.. 4.od rozpoznawanej sekwencji. • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców). Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA.GAAGA(N)8'. Są one podstawowym narzędziem. którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji. HinPI) tną jednoniciowy DNA. plazmidowy.. drożdżowy) jest zdolny do autonomicznej replikacji. klonowania molekularnego i rekombinacji genów czy fragmentów genomu.2..CCTAC(N)13.5' podobnie enzym FokI (Flavobacterium okeanokoites): 5'.3' 3'.. Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora.in... a tylko nieliczne enzymy (np. fagowy.CTTCT(N)7..

i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. • nie są zdolne do przeżycia poza komórką gospodarza. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. np. który ma długość 2686 par zasad. „polilinker" (miejsce wielokrotnego klonowania).w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów. gen β-galaktozydazy oznaczony symbolem lacZ. gen oporności na antybiotyk. Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie. korę mogą stanowić zagrożenie ekologiczne. • zawierają znaczniki (markery). Najczęściej jest to gen kodujący enzym. np. przedstawiony jest na rycinie 4-1. Kosmidy Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. Kosmidy służą do klonowania większych cząsteczek DNA. plazmidy i kosmidy. za pomocą których można je ziden tyfikować. Za pomocą modyfikacji molekularnych (np. Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. Podobnie jak 73 . Wektory plazmidowe Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. Przykładowy wektor plazmidowy pUC19. długości 10-40 kpz. Wektory fagowe Spośród wektorów fagowych największe znaczenie ma fag λ. • ze względów etycznych wektor nie powinien mieć genów. RODZAJE WEKTORÓW Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi). geny oporności na antybiotyki. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori. rozkładający barwny substrat. którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych.

Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz w przypadku wektorów plazmidowych. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. Do klonowania fragmentów DNA w organizmach eukariotycznych (np. adenowirusów i retrowirusów. drożdżach. 4-1. W przypadku komórek zwierzęcych są to pochodne wirusów SV40. Wektory drożdżowe Wektory te wykazują zdolność replikacji tak w komórkach drożdży. ale efektywność tego działania jest większa. jak 74 . wadą natomiast organiczona długość wbudowanego obcego DNA. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych. do wektorów fagowych wprowadzono polilinkery. Schemat wektora plazmidowego pUC19. Są one również stosowane w somatycznej terapii różnych schorzeń. krowianki. geny markerowe i silne promotory. Najwcześniej był stosowany wirus SV40. którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu. komórkach ssaków) stosowane są: Wektory — pochodne wirusów Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych. bakulowirusów. coli. Sztuczny chromosom bakteryjny (BAC) Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang.Ryć. Papilloma.

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

reverse transcription-polymerase chain reaction). O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego. co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych). Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje. Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami). Enzymem używanym do tej reakcji jest termostabilna ligaza. Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego. wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji. a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach. amplifikując badany gen (odcinek DNA). Te dwa etapy są powtarzane. RT-PCR (ang. gdy są one zhybrydyzowane z komplementarną matrycą. która łączy specyficznie dwa przyległe oligonukleotydy. wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. Odwrotna transkrypcja-PCR. Nie może być natomiast 81 . W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C). Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. z zastosowaniem biotyny.przerwa. że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. mutacja punktowa). Reakcja ta stosowana jest do wykrywania mutacji punktowych. np.

jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to. które ułatwiają ten 82 . w których określana jest ilość mRNA. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod. które przyjmują określoną konformację przestrzenną. Jak wiadomo. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej. Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. np. że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA. bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. Techniki hybrydyzacji i sondy molekularne Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe. W tych przypadkach może być stosowana metoda RT-PCR. 4. RNA: RNA i RNA: DNA istnieją wiązania wodorowe. Konformacja ta zależy od sekwencji nukleotydów.5. jak również do wykrywania wirusów.wykorzystana w badaniach ekspresji genów. to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany. single stranded conformation polymorphism). między nićmi DNA:DNA. które jest oczywiście najbardziej precyzyjne. Jeśli badany DNA pochodzi od nosiciela zmutowanego genu. a następnie jego denaturacji i elektroforezie. Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ. iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją. których materiałem genetycznym jest RNA. polegająca na tym. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA. Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. SSCP (ang. RFLP lub sekwencjonowania. Polimorfizm konformacji jednoniciowych łańcuchów DNA. Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA. podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA).

Fragmenty te są następnie zatrzymywane na filtrze. dCTP i UTP a 32P. czas półtrwania 14. do 500 par zasad). Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy. który przenikając przez żel zabiera ze sobą fragmenty DNA. Sposób znakowania sond można podzielić na dwie główne grupy: 1. Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P). northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). który jest nicią pojedynczą. klonowane sekwencje lub syntetyczne oligomery stosowane w PCR. iż muszą być stosowane wkrótce po ich wyznakowaniu. Ogromną zaletą hybrydyzacji jest to. że można ją stosować nawet wówczas.71 MeV — megawoltów). Wadą sond znakowanych izotopem jest również to. Znakowanie sond. czyli cięższe fragmenty) lub poliakryloamidowym (krótsze. Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe. Zjawisko to stało się podstawą metod analizy kwasów nukleinowych. Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. By była możliwa hybrydyzacja sondy z badanym DNA. a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. jednak niewielką rozdzielczością. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. Izotop ten jest stosowany do znakowania DNA i RNA. kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego). wirusów lub organizmów wyższych).proces. Sonda musi być odpowiednio wyznakowana. Znakowanie izotopowe charakteryzuje się dużą czułością. 83 . Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej. gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA. który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1. stosowana w hybrydyzacji kwasu rybonukleinowego.3 dnia. Technika northern blotting. takich jak hybrydyzacja Southern blotting (DNA). nie wymaga etapu denaturacji. lżejsze. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy. by było możliwe wykrycie powstałej hybrydy.

stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+. Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego). Podstawowym źródłem trytu jest trytowana tymidyna. używany jest do znakowania kwasów nukleinowych. której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. 4-6). Zaletą tej metody jest to. głównie DNA. który emituje promieniowanie β (energia promieniowania E = 0. w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą. gdy jest on unieruchomiony na filtrze. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura. • tryt (3H). Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. głównie DNA. ale daje mniejszą czułość detekcji. Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C).26 roku. digoksygeniny). że różnica ta powinna wynosić 20-25°C. Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S. jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg). Znakowanie nieizotopowe zapewnia dobrą rozdzielczość. emitujący promieniowanie β.• izotop siarki (35S). 84 . Hybrydyzację przeprowadza się z reguły w temperaturze 68°C. biotyny. Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np.018 MeV). Na wydajność hybrydyzacji wpływają także inne czynniki. Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych.1 dnia. 2. okres półtrwania 87.167 MeV). Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). Znakowanie sond można przeprowadzać za pomocą kilku różnych metod. a detekcja sygnału jest poprzez autoradiografię (ryć. Hybrydyzacja na filtrach. które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0. iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. Hybrydyzację z wyizolowanym DNA można przeprowadzać. okres półtrwania 12. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji. w zależności od zastosowanego znacznika. tak powstają pochodne nukleotydów. Przyjmuje się. w której przebiega hybrydyzacja. Hybrydyzacja jest poprzedzona prehybrydyzacją. z wyjątkiem obecności sondy. Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach. Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny.

również hybrydyzacja może być przeprowadzana na preparatach chromosomowych. fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). Jej różne warianty są opisane w rozdziale: Mapy genomowe. Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana. W metodzie zwanej „odcisk palca" DNA (ang. Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. Metoda ta nosi nazwę hybrydyzacji in situ (ISH). w diagnostyce chorób). Podobnie jak metoda PCR. do wykrywania ściśle określonych fragmentów DNA (np.in. Hybrydyzacja w zminiaturyzowanej postaci. określana jako technika mikromacierzy DNA. 85 .Wykorzystanie metody hybrydyzacji. pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. Na niewielkiej płytce (ok. Metoda hybrydyzacji służy m. l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja).

5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości. Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll): GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA: GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA. czyli lżejsze.4. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu.6..AGGCTAT 86 . Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu. Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych. Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu. Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym. tym szybciej. Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP).. natomiast dalej będą prążki o zmniejszającej się masie.. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus.A-. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) Polimorfizm fragmentów restrykcyjnych DNA (ang.ATCCAGTCCTCGCCTGATTTCGAA.3' 3'.ATAGCTT . Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'.TTCGA... Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału.. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego..

Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania. Jest on amplifikowany 87 . Biblioteki genomowe i genowe Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. których budowa molekularna jest znana. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe. omówiona wcześniej.Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz. W zależności od wielkości fragmentów DNA używane są różne wektory. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest. sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii. jak kosmidy. Proces ten jest opisany w części dotyczącej klonowania DNA. Interseksualizm. Materiałem wyjściowym w tym przypadku jest RNA. Tworzenie biblioteki genomowej Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym.7. Tak otrzymany cDNA zawiera tylko sekwencje kodujące. 11 pz i 7 pz. Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów. Tworzenie biblioteki genowej (cDNA) Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. 4. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka. czyli eksony. wśród nich są geny determinujące cechy jakościowe. Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe). wprowadzonych za pomocą wektorów do bakterii. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. metoda rekombinacji molekularnej. Geny o dużym efekcie. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA. a także ilościowe (ang. quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory. Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA.

4. 4-7). o którym niewiele wiadomo. Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań.metodą PCR. Sangera. czyli reakcji antygen-przeciwciało. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą). Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej. Biblioteka genomowa jest również przydatna w poszukiwaniu genu. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. nieznany jeszcze fragment. Metoda enzymatyczna została opracowana w 1977 roku przez F. Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem. ddGTP lub ddTTP (ryć. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej). przeprowadzane są cztery oddzielne reakcje syntezy DNA. przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy.8. Rolą tych dideoksynukleotydów (tzw. Postępujemy tak do momentu. a następnie rekombinowany z wektorem i wprowadzany do bakterii. polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda. Każda z czterech probówek zawiera matrycowy DNA. której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. terminatorów) jest zakończenie syntezy nici 88 . Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. ddCTP. bufor reakcyjny. chromosome walking). W ten sposób każdy klon bakterii ma cały określony gen. wykorzystuje się bibliotekę genomową. polegające na określeniu sekwencji nukleotydów. gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen. mieszaninę deoksynukleotydów. Sekwencjonowanie DNA Sekwencjonowanie DNA. starter. W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen. jest stosowane dość często w genetyce molekularnej. która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący.

by tylko część syntetyzowanych fragmentów DNA uległa terminacji. W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości. kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp.autoradiogram żelu sekwencyjnego Ryć. 4-7. zależnie od użytego w reakcji dideoksynukleotydu. W celu detekcji prążków DNA.2-0. kończące się odpowiednim nukleozydem. w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89 ..6 mm). Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm. metodą autoradiografii. 10 :219-237. Postępy Biologii Komórki. 25 supl. 1998) komplementarnej w miejscu włączenia określonego dideoksynukleotydu. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki. ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera. grubości 0.

kleotydy lub wyznakowany starter. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. Postępy Biologii Komórki. kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp. 10 :219-237.. która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. 25 supl. polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów. w czterech oddzielnych probówkach. Enzymatyczna metoda sekwencjonowania ma tę zaletę. siarczan dimetylu (DMS) i kwas mrówkowy. Do rozszczepiania wykorzystywane są hydrazyna. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. 1998) 90 . że jest szybka. podobnie jak przy metodzie enzymatycznej. 4-8): autoradiogramżelusekwencyjnego Ryć. Metoda chemiczna. 4-8. Do mieszaniny reakcyjnej dodawana jest także piperydyna. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta. Sekwencjonowanie metodą chemiczną przeprowadza się. ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów. opracowana w 1977 roku przez Maxama i Gilberta. które mają zdolność modyfikacji zasad w cząsteczce DNA.

Następnym etapem. pozwala także na wyróżnienie grup komórek. ale są inne pod względem biochemicznym. Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. pyroseąuencing. które morfologicznie nie różnią się od sąsiednich.10. 4. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji. kilka firm oferuje specjalistyczną aparaturę. Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA. zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba). Najnowsza metoda sekwencjonowania. Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80. które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika. Samce transgeniczne przekazywały swojemu potomstwu obcy gen. Podobne 91 .W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca. przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny. jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym. natomiast samice były niepłodne. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego. Zwierzęta transgeniczne to takie. Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane. Jedna z wymienionych metod. tzw. do zygoty myszy szczurzego genu hormonu wzrostu. Różnią się one od innych komórek ekspresją pewnych genów. nieaktywnych w komórkach zdrowych. których długość zależy od miejsca rozszczepienia łańcucha DNA. autoradiografia i odczytanie sekwencji nukleotydów. 4. podobnie jak w metodzie enzymatycznej. Transgeneza Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. hybrydyzacja in situ na skrawkach tkanek. northern blotting. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów.9. znacznie różni się od powyższych metod. RT-PCR) i translacji (western blotting). Badanie ekspresji genów Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek.

że w procesie transgenezy wprowadzane są konstrukty genowe. Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC. W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro. umożliwiającej ukierunkowaną ekspresję transgenu (np. • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. nawet niekorzystne. Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. ogranicza jej stosowanie. zapłodnionej komórki jajowej. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza. najczęściej męskiego. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne. Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich. Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). Jak dotychczas opisana technika jest stosowana z sukcesem u myszy.rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu. Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa. które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. w gruczole mlecznym). 92 . growth hormone — GH). Wielkość fragmentu DNA. Na razie nie mamy żadnego wpływu na to. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego. które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu. Wykorzystanie techniki transgenezy 1. Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. w którym miejscu genomu włączy się transgen. około 8 kpz. gen struktury hormonu wzrostu (ang. który może być wprowadzony tą metodą. blastocyst pozbawionych węzła zarodkowe go). np. Należy jednak zauważyć. embryonic steam cells).

• modyfikacji składu mleka. na przykład poprawy jakości i tempa wzrostu wełny. duże nadzieje wiąże się z poprawą jakości białek mleka. • modyfikacji cech biochemicznych u zwierząt. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie. W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy. Odporność na choroby można uzyskać przez wprowadzenie do komórek 93 . poprzez wprowadzenie do genomu owiec genów białek keratynowych.

Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem. których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu. kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii. Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu. 2. które wykazują nadekspresję określonych genów. metabolizm węglowodanów i lipidów. Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny. których celem jest ocena jego wpływu na wzrost. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym. . 3. prowadzącej do odrzucenia przeszczepionego narządu. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. Zaletą tej metody jest to. blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek. świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię). Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. iż samice transgeniczne wytwarzają mleko zawierające obce białko. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw. Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych.zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych. ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych. ksenotransplantów) dla ludzi. wykazujące karłowatość. najlepiej dominujące. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych. krowy wytwarzające mleko z ludzką laktoferyną. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc). laktację. świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. z powodu nadostrej reakcji układu immunologicznego biorcy.

czyli takich. powstałych de novo. dlatego większość z nich jest niekorzystna dla organizmów. a poznanie ich podłoża wymaga zastosowania metod molekularnych. Wreszcie mutacje genowe dotyczą zmian w budowie genu. przez następne pokolenia. niektóre związki chemiczne). które uszkadzają DNA lub strukturę chromosomu (np. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi. a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych. a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. chromosomowe i genowe. Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji. W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu. Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. takich jak replikacja DNA czy podział jądra komórkowego. Należałoby zatem rozróżnić proces przenoszenia mutacji.Rozdział Mutacje Mutacje to nagłe i trwałe zmiany w informacji genetycznej. Mutacje mogą powstawać samoistnie. Dzieli się je na: genomowe. gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. promieniowanie jonizujące. nazywane też aberracjami chromosomowymi. Mutacje chromosomowe. cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych 95 . związane są z naruszeniem budowy chromosomu. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji. obserwowanymi wśród organizmów żywych. jako wynik błędów w przebiegu niektórych procesów komórkowych. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas. przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji. które były korzystne lub obojętne dla organizmu. za pośrednictwem komórek płciowych. a ponadto.

Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. Zdarzenia takie określa się mianem połispermii. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista. 5-1): 1. Znane są i inne mutacje. Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości. W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji. Mutacje genomowe Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie.1. ponieważ obok mutacji szkodliwych (np. a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. a oocyt II rzędu ma diploidalną liczbę chromosomów. wśród których do najważniejszych zalicza się (ryć. pojawiające się od czasu do czasu na fermach zwierząt futerkowych. że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych. to stan ten określa się jako poliploidalność. Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej. które wpływają korzystnie na cechy produkcyjne zwierząt. 2. Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II. 5. Jeżeli powstają układy o większej liczbie genomów niż dwa. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. która odbywa się już po wniknięciu plemnika do oocytu. Na przykład. prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. Zaburzenie przebiegu mejozy. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna. zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia. mutacja w genie BMPR-IB) itp. głównie żeńskiej. Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego. wysoka plenność u niektórych ras owiec (np. 96 . monoploidia). choroby genetyczne) znanych jest wiele przykładów pokazujących. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik. takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny).pokoleń. z jakimi spotykamy się w hodowli zwierząt gospodarskich. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów. co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). Dlatego można bez większych zastrzeżeń przyjąć.

Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza). Ponieważ komórki te wywodzą się z jednej zygoty. np. Euploidie są mutacjami letalnymi. Mutacje te są jedną z przyczyn niepowodzeń 97 . układ taki klasyfikowany jest jako mozaicyzm. W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego. gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności. czego skutkiem jest rozwój haploidalnego zarodka. 4. 2n i 4n czy 2n i 3n itd. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo). Niektóre mechanizmy powstawania mutacji genomowych typu euploidii 3. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. że prowadzą one do śmierci osobnika. Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności. 5-1. co oznacza. zazwyczaj we wczesnym okresie rozwoju zarodkowego. tetraploidalne oogonium. np. takich na przykład jak brak cytokinezy po podziale jądra komórkowego. to znaczy takiego. które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego. Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym.Ryć. Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka.

Jeśli natomiast występuje brak obu chromosomów w parze. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. zarodka) prowadzi do mozaicyzmu. która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki. Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. Aneuploidia to druga kategoria mutacji genomowych. Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika. jaka jest skala tego problemu. Wskazuje to. to stan taki określany jest jako nullisomia (2n —2). Zdecydowana większość aneuploidii jest letalna. 5-2a). prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1. gdy oba chromosomy zmierzają do jednego bieguna komórki. Równocześnie wynika z tego. Jeżeli gamety takie będą uczestniczyły w zapłodnieniu. to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. jednak powodują powstanie licznych wad rozwojowych. Wyjątek stanowią aneuploidie chromosomów płci. a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). Klacz obarczona tą mutacją ma kariotyp 98 . Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela.w rozrodzie zwierząt. a nadmiar chromosomów to trisomia (2n +1). Trudno jednak określić. Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci. Nieprawidłowa segregacja w jednym biwalencie. że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych. że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). Zazwyczaj mutacje te stwierdzano w układzie mozaikowym. Tak więc brak chromosomu nazywa się monosomią (2n — 1).

XO/64. Zwierzęta takie mają zasadniczo normalny eksterier. 99 . dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego. Osobniki takie mają diploidalną liczbę chromosomów 61.XY/61. W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy. Znane są również przypadki trisomii XXY u buhajów.XXY.X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63. zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników.XXY lub występuje u nich układ mozaikowy 60.XX.2n = 63.

poza nielicznymi wyjątkami. niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. ze względu na dość częste występowanie u klaczy monosomii chromosomu X. Mogą powstać także inne nietypowe struktury. albo głębokie zaburzenia rozwojowe lub bezpłodność. podczas podziału komórkowego. W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza. Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd 100 . Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna. Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. jest niemożliwe. translokacja wzajemna). że osobniki mające w swoim kariotypie trzy chromosomy X są płodne. 5-2b). Jest to skutek segregacji chromosomów w anafazie I. w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. Niemniej jednak. to zazwyczaj mają pochodzenie de novo. Mutacje chromosomowe Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią.Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością. co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. Dzięki temu. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika. wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych. Jeżeli pęknięcie nie zostanie naprawione.2. tandem fuzja. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni. a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu. której zdiagnozowanie. to nastąpi utrata fragmentu chromosomu (delecja). Przedstawione wyżej prawidłowości wskazują. nie ma ryzyka przeniesienia tej mutacji na następne pokolenia. Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć. przez odpowiedzialne za to systemy naprawy komórkowej. Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu. Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu. że aneuploidie ilekroć się pojawiają. z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder. gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela. takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. a zatem i szerokiego rozprzestrzenienia w populacji. 5. bez zastosowania metod cytogenetycznych.

Mutacja chromosomowa może wystąpić w układzie zrównoważonym. Z kolei mutacje zrównoważone. duplikacje. czego skutkiem jest uruchomienie procesu nowotworowego. gdy ilość informacji genetycznej w komórce została zmieniona. Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje. że zdecydowana większość tych przypadków nie jest identyfikowana. bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas. a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów. tandem fuzje. gdy występuje ona w komórkach linii płciowej. prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. Znane są liczne przykłady u ludzi. prowadzą do zmiany sąsiedztwa genów. Szczególna 101 . ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. Wynika to przede wszystkim z tego. mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych. że mutacje chromosomowe niezrównoważone. lub też w układzie niezrównoważonym. translokacje wzajemne. fuzje tandemowe. inaczej centromerowe (translokacje robertsonowskie). nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych. wzmacniacz. mają najczęściej negatywny wpływ na płodność nosiciela mutacji. U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. translokacje wzajemne i inwersje. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. Przypadki takie. zauważalnych zmian fenotypowych. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych. jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej. padnięcie po urodzeniu lub ubój z konieczności. Zdarzyć się może. których skutkiem jest przegrupowanie informacji genetycznej w kariotypie. a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. występując pierwotnie w układzie zrównoważonym. Jeżeli dotknie to osobnika o dużej wartości genetycznej. inwersje. bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć. fuzje centryczne. Mutacje chromosomowe. które w momencie powstania mają charakter zrównoważony. Inne — tzn. Zaliczane są do nich: fuzje centryczne.i paracentryczne. podobnie jak aneuploidie. odnotowywane jako martwe urodzenie. wśród których wyróżniane są inwersje peri. że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. jak i ze strukturą samego genu. to szansa na wykrycie nosicielstwa mutacji jest znacznie większa. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor. wyciszacz). są letalne lub prowadzą do poważnych. izochromosomy).niesiostrzanych podczas crossing over. buhaje).

a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć. Fuzja centryczna (translokacja robertsonowska) powstaje wówczas. 102 . 5-3a. gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru.uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji.

reprezentujące prawie cale ramiona długie chromosomów. który zawiera przede wszystkim niekodujące sekwencje powtarzalne. kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym. natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy).7).29). Utrata małych fragmentów z okolicy centromeru. Translokacje robertsonowskie: (a) rob(l. triwalent oraz biwalent X-Y są wskazane 103 . (b) rob(5. buhaj. nie odbija się negatywnie na nosicielu. barwienie roztworem Giemsy. Ryć.5-4a). Duże fragmenty. kozioł. 5-4. chromosom translokacyjny oraz chromosomy pici są wskazane. zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom.

W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety. w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. W efekcie powstają gamety o zrównoważonej informacji genetycznej. mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. podczas gdy na drugim biegunie zabraknie jednego chromosomu. Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych. 104 . Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. blonde d'Aquitaine itp. szczególnie ras mięsnych. z tym jednak że wśród nich będzie chromosom dwuramienny. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła. Jeżeli komórka taka rozpocznie podział mejotyczny. a w tym również w Polsce. że jej nosiciele mają zmniejszoną płodność o około 5%. jak poprzez badanie cytogenetyczne. Jeżeli fuzji uległy chromosomy homologiczne. natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom. w których uczestniczyły chromosomy z różnych par. W przypadku zapłodnienia powstają zygoty aneuploidalne. W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji. 5-4b). które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego. to w pachytenie profazy I uformuje się triwalent. z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych.Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden. Fuzje centryczne są często identyfikowane u bydła. podczas której chromosom dwuramienny przechodzi do jednego bieguna. 5-4a). Zupełnie inaczej przedstawia się sytuacja. że połowa gamet będzie typu n —l (układ powstający na biegunie. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób. W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent. Prowadzi to oczywiście do tego. Opisano wiele różnych fuzji. Pięć lat później ten sam badacz wykazał. Należy zaznaczyć. a oba chromosomy akrocentryczne do drugiego bieguna komórki. czyli ukształtuje się układ aneuploidalny. 5-3b. a druga będzie miała n chromosomów. a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. na wszystkich kontynentach. co w rzeczywistości odpowiada układowi n + 1.). do którego nie przeszedł chromosom dwuramienny). gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard.

Szwecja była pierwszym krajem. dwóch par akrocentryków. bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona. którą opisano w Polsce. u którego fuzja centryczna występuje bardzo często. Oprócz fuzji 1. włoskie bydło rasy podolian czy bydło korsykańskie).a niekiedy także w małych izolowanych rasach lokalnych (np. białe bydło rrytyjskie. natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48. Chromosomy biorące udział w fuzji przedstawiono schematycznie 105 . w których zaangażowane były chromosomy z innych par. Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. który wprowadził taką regulację. Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. jest lis polarny. 5-5. Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. W Polsce. przed ich wprowadzeniem do stacji produkcji nasienia. Ciekawe. a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. obowiązkowymi badaniami objęte są wszystkie młode buhaje. Przykładem może być fuzja między chromosomami z pary 5 i 22. Gatunkiem. jedynych w kariotypie lisa.29 zdiagnozowano wiele innych przypadków. począwszy od 1989 roku. że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49. nr 23 i 24). Ryć. W tym przypadku można wręcz mówić o polimorfizmie kariotypowym.

5-6b. jeśli oczywiście wystąpi w linii komórek płciowych. a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia. 5-8). Skutek takiej translokacji będzie zazwyczaj letalny. Przedstawione obserwacje wskazują. 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję. Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par. 0 2n = 58 (ryć. które podlegały translokacji. pochodzących z dwóch różnych chromosomów. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over. że powstaną gamety o zrównoważonej informacji genetycznej. bądź duplikacją. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów. Pokazuje to jedno cześnie. który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2. szczególnie wówczas. 5-6a. że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela. to podczas mejozy dojdzie do powstania gamet. Dwa pozostałe rodzaje segregacji. jest taka sama jak w dwóch nie zmienionych chromosomach. Jest to segregacja naprzeciwległa. które uczestniczyły w trans lokacji. tzn. określane jako sąsiednie. Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej. Przyjmuje się. jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych. lisy polarne. jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji. 5-5). W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. Należy zaznaczyć. które będą obarczone bądź delecją. prowadzą do uformowania niezrównoważonej (delecje. Podobnie jak w przypadku fuzji centrycznej. także translokacją wzajemna jest mutacją dziedziczną.Należy podkreślić. to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60. a nie częstego powstawania de novo. że suma informacji genetycznej zawarta w dwóch chromosomach. Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. że około 50% gamet wytwarzanych przez 106 . Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć. duplikacje) ilości informacji genetycznej w gametach. to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. Segregacja symetryczna (2:2) nie gwarantuje jeszcze. Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. 5-7). że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło. a do drugiego przechodzą chromosomy. gdy rozród jest oparty na sztucznej inseminacji.

5-6.*Schemat nie uwzględnia segregacji tetrawalentu. Translokacja wzajemna: (a) schemat powstawania. (b) segregacja tetrawalentu podczas mejozy nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu. to doprowadzą do powstania zygot. w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany Ryć. Hodowca odnotuje 107 . które będą ginęły zazwyczaj w życiu płodowym.

.

w którą zaangażowany jest chromosom X (translokacja typu X-autosom). że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy. Przypuszcza się. Podobnie normalny fenotyp mają lochy nosicielki. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. a obraz nasienia (koncentracja. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów. a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione. Knury nosiciele mają prawidłowe libido. w którym wystąpią dwa translokowane chromosomy. Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu. a połowa będzie nosicielami translokacji. 5-7). Oczywiście stan taki może być spowodowany różnymi czynnikami. morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie. Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia. a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego.lub dwuramiennym. które były rozprzestrzenione w populacjach w różnym stopniu. w rozmaitych rasach. Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). ponad 90 różnych translokacji wzajemnych. Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109 . która prowadzi do bezpłodności samców nosicieli. po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie). że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. Stan taki towarzyszy nosicielstwu translokacji wzajemnej. w którym polowa będzie miała prawidłowy kariotyp. U samic nosicielek stwierdza się jedynie zmniejszenie płodności. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo. Trzeba podkreślić. Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej. Jedno z nich występuje w części końcowej ramienia w chromosomie jedno. podobnie jak w przypadku translokacji typu autosom-autosom. Fuzja tandemowa jest mutacją podobną do fuzji centrycznej. Do tej pory zidentyfikowano na świecie. ale wśród nich połowa będzie miała układ.wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika. podobnie jak w przypadku fuzji centrycznej.

która częściowo jest niehomologiczna. gdzie na jednym z chromosomów występuje odwrócony fragment. to wówczas powstaną gamety obarczone delecją lub duplikacją. Jeżeli w obrębie pętli zajdzie crossing over. Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji. Uwaga ta dotyczy 110 . z punktu widzenia skutków gametogenezy. Inwersje dość rzadko opisywano u zwierząt gospodarskich. Przebieg koniugacji podczas pachytenu profazy I. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna. że fragment pomiędzy punktami pęknięć został odwrócony o 180°. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. to wówczas inwersja jest określana jako pericentryczna. jest pierwszy sposób koniugowania. 2) chromosomy częściowo pozostają nieskoniugowane — w części. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu.chromosomami akrocentrycznymi. a następnie zostały one niewłaściwie naprawione w taki sposób. tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym. w którym wystąpiły dwa pęknięcia. w obrębie fragmentu objętego inwersją na jednym z chromosomów. chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). Jeżeli w obrębie odwróconego fragmentu występuje centromer. gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. analogicznie do schematu przedstawionego dla translokacji robertsonowskich. może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków. spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie. które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej. która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu. może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną. Znane są nieliczne przypadki tej mutacji u bydła. podobnie jak przy fuzji centrycznej. z wyjątkiem sytuacji. to nieprawidłowość jest określana jako inwersja paracentryczna. podczas którego dochodzi do uformowania pętli inwersyjnej. to podczas mejozy. oraz 3) pełna koniugacja. Oceniano wówczas. było dość duże. Jeżeli odwrócony fragment nie obejmuje centromeru. dojdzie do powstania aneuploidalnych gamet. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii. Najmniej korzystny. to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. Mutacja ta jest dziedziczona przez połowę potomków nosiciela. że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%. Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu. tzn.

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form. prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). dystrofię miotoniczną. tym wcześniej rejestrowany jest początek objawów chorobowych. Mutacje te związane są z tzw. zaś ketonowej na enolową (=C—OH). Z kolei. niestabilnymi sekwencjami DNA. w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony). Mutacje genowe mogą być także następstwem zakłóceń w splicingu. zespół kruchego chromosomu X. Błąd replikacji zachodzi wówczas. guanina w normalnej formie (ketonowej) łączy się z cytozyną. zlokalizowanego w chromosomie 4. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. Dotychczas wykryto je u ludzi w 12 loci. czyli tzw. Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej. Z kolei. Inną 117 .i protonów w cząsteczce zasady. natomiast w formie enolowej łączy się trzema mostkami z cytozyną. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę. Im większy stopień zwielokrotnienia danej sekwencji. z których 10 powoduje choroby genetyczne. Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA). a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne. należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). Skutkiem tego będzie pojawienie się pary G-C w miejscu. że enołowa forma tyminy łączy się z guanina. Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka. iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. między innymi chorobę Huntingtona. U ludzi zdrowych liczba powtórzeń wynosi 10-36. Błąd włączania polega na tym. Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH). nazwanej dojrzewaniem. W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. a w formie tautomerycznej z tyminą. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi. obróbce mRNA. przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina.

jak i intronu. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np. iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA. Taka sytuacja jest możliwa. Jeśli allel zmutowany pochodzi od matki. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym. Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym. Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4. Natomiast jeśli ojciec przekazuje zmutowany allel. Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji: 118 .cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw. Należy podkreślić. Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony. dlatego nazywane są cichymi podstawieniami (ang. 5. jest polimorfizm fragmentów restrykcyjnych — RFLP (ang. restriction fragment length polymorphism). substitution at silent site). polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie. Jednym ze skutków mutacji genowych. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi. trypletów). Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu. ani kodowanego przez ten gen białka. identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. mającym szczególne znaczenie dla molekularnej analizy DNA. Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. piętno gametyczne. iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. Przypuszcza się. różnica w długości sekwencji może dochodzić do 50%. gdyż kodon AAC również koduje asparaginę. Skutki mutacji genowych Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów. Są one wykorzystywane w analizie polimorfizmu DNA.4.2. Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu.

Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. Na przykład.1. która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi. 2. Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G. jest locus β-laktoglobuliny (białko mleka). mutacje genowe nie zawsze mają niekorzystny skutek. roku życia osobników homozygotycznych pod względem zmutowanego genu. skutki tego mogą być dla organizmu letalne. przejawiająca się zmniejszeniem odporności cieląt. w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy. warunkujący czarne umaszczenie. mleka. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła. odnoszącym się do polimorficznych białek.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) - Ryć. nasienia i jaj zawiera rozdział: Markery genetyczne. Mutacja ta jest przedstawiona na rycinie 5-10. oraz T→C (zapis dla DNA. Jak już wcześniej wspomniano. bovine leukocyte adhesion deficiency). Mutacje typu zmiany sensu . Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+.. Innym przykładem mutacji typu zmiany sensu. Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła 119 . której następstwem jest śmierć przed ukończeniem 1. Mutacje typu nonsens (mutacja stop) . Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę. 5-10.

Schemat tej mutacji przedstawiono na rycinie 5-10. Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia. Jest to schorzenie nazwane DUMPS (ang. lecz stanowią sygnał zakończenia translacji. powstaje nieaktywny peptyd złożony z 85 aminokwasów. w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu. czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka. również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu.cytrulinemia. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem. ochrę (UAA) lub opal (UGA). przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. Jest ono przyczyną zamierania zarodków. We wspomnianym już locus E u bydła allel recesywny e. które nie kodują aminokwasów. Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. a w konsekwencji zmniejszenia płodności krów. zamiast aktywnego enzymu składającego się z 412 aminokwasów. wykorzystujący to. Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen. W jej konsekwencji. Cytrulinemia występuje również u ludzi.amber (UAG). natomiast allel dominujący ma takie miejsce. Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. Począwszy od kodonu 104 (GGT) dla glicyny. a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy. ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. Podobnie jak mutacje typu zmiany sensu. iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl. występuje u bydła. deficiency uridine monophosphate synthase). występująca u bydła rasy holsztyńsko-fryzyjskiej. powstaje krótszy N-końcowy fragment tego polipeptydu. Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu. Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna . powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady. następnie roz120 . w procesie translacji przyłączane są inne aminokwasy. 3. kodujący u zwierząt homozygotycznych ee umaszczenie czerwone. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej. Bydło holsztyńskie ma umaszczenie z reguły czarno-białe.

dzielany elektrofor etycznie. dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. Mutacje te mogą prowadzić do poważnych zaburzeń. pełniącego funkcję kanału chlorkowego. Insercja trójki może spowodować: dodanie aminokwasu – w białku. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. możliwe jest także pojawienie się kodonu „stop". jeśli trójka nukleotydów zostanie wstawiona między kodony. Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego. przy czym najczęściej jest stwierdzana mutacja w eksonie 10. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. 4. zamianę fazy odczytu. zwanego CFTR (ang. 5-11). jeśli trójka „rozerwie" istniejący dotychczas kodon. Częstość występowania tej wady. utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". W obrębie tego genu wykryto wiele mutacji. a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów). Mutacja ta prowadzi 121 . wynosi l: 2500 osób. cystic fibrosis transmembrane conductance regulator). oznaczona symbolem ΔF508 (ryć. prowadzącej do przedwczesnej śmierci. Dotyczy to przede wszystkim trzustki. polegająca na zakłóceniu transportu jonów chlorkowych. Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego. a nawet śmiertelnych chorób genetycznych. Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi. płuc i oskrzeli. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym.

a także umaszczenie zwierząt i inne. natomiast w allelu F . Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej. ale może być również rozpoznawalny w okresie późniejszym. Mutacje zachodzące podczas obróbki potranskrypcyjnej. złożonej z takiej liczby glutamin. Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. powoduje powstanie domeny glutaminowej. przekształcającego fenyloalaninę w tyrozynę. blok metaboliczny). Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA. Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. a następnie sekwencja GGT dla glicyny. 5. zwanej składaniem (ang. w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. 122 . Częstość tych mutacji wynosi 10-40%. W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów. łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny). oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. na przykład białko determinowane przez locus Albino (C). powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny. kodującej aminokwas glutaminę. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka. Gen C warunkuje wytwarzanie enzymu tyrozynazy. skrócenie kręgosłupa u bydła i psów. na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). Zwielokrotnienie powtarzającej się sekwencji CAG. 5-12 wkładka kolorowa). Często są to zaburzenia przebiegu szlaku metabolicznego (tzw. na przykład wielopalczastość. i glicyna — 509 póz. Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe. 5-13). Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA. czego konsekwencją jest synteza zmienionego białka. o czym pisano już wcześniej.do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego.3 eksony kodujące 37 aminokwasów. jaka jest zakodowana w sekwencji (CAG)n.

powodując jego ciemnienie na powietrzu.niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego. Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę). Tyrozynoza -.3. Jednym z genów. którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich. 123 . tęczówka oka nie jest zabarwiona. białe włosy.brak oksydazy kwasu homogentyzynowego.. kwas homogen tyzynowy jest odkładany w stawach. np. Mutacje genowe wpływające na cechy produkcyjne zwierząt Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. osobniki albinotyczne mają bardzo jasną skórę. nie powodujący wyraźnie złych skutków dla organizmu. a jego nadmiar jest wydalany z moczem. growth hormone — GH). chrząstkach i skórze wywołując stany zapalne.B. C. Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków.brak enzymu tyrozynazy. cukrów czy lipidów.4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę. 5. biorącego udział w przemianie tego kwasu w kwas homogentyzynowy. a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie. Albinizm. prze kształcającego ten kwas w kwas maleiloacetooctowy. D. przekształ cającego 3. brwi i rzęsy. Alkaptonuria -. czyli bielactwo .4. E. Albinizm występuje także u zwierząt. jest gen hormonu wzrostu — somatotropiny (ang. powodujący różny stopień nasilenia niedorozwoju umysłowego.

U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw. Zależnie od stopnia penetracji tych genów można je podzielić na: 124 . Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią. estrogen receptor gene — ESR) a wielkością miotu. 5. metabolicznych.6 jagnięcia. U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową. gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji. O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych. sprawia dużo trudności.4. semiletalne i subwitalne Wpływ szkodliwego działania zmutowanych genów jest różny. np. wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie. Stąd poznanie podłoża wielu chorób genetycznych. Geny letalne. Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie). wykryty u owiec rasy romney.4. kwaśne mięso (RN). a szczególnie wrodzonych wad rozwojowych. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. Należy jednak pamiętać. 5. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2).Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. psychicznych itp.15 prosięcia u świń bardzo plennej rasy meishan i 0. które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu. że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych. Mutacje genowe wywołujące choroby genetyczne Mutacje genowe często prowadzą do powstania chorób genetycznych.4.4. Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1. Inne mutacje to: gen FecJ u owiec jawajskich. odpornościowych. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych.1.42 prosięcia u wielkiej białej. największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. endokrynologicznych. Spośród wykrytych dotychczas mutacji. U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA.

również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. Innym genem.• geny letalne. Przykładem jest gen platynowego ubarwienia u lisów. Oba zmutowane geny w układzie homozygotycznym (WpWp. w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). w stosunku l platynowy: l srebrzysty (ryć. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. w których genotypach wystąpią w dawce aktywnej (np. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego. homozygota recesywna). 5-14 wkładka kolorowa). powodujące śmierć ponad 90% osobników. warunkującego srebrzystą barwę włosa. Geny te działają letalnie w układzie homozygotycznym. który jest letalny w podwójnej dawce. powodując śmierć nie tylko homo-. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych. Również okres w życiu osobnika. z nie wyjaśnionych dotąd przyczyn. Niektóre z nich. • geny semiletalne. w okresie pourodzeniowym lub u dorosłych osobników. uzyskamy wówczas lisy zdolne do życia. powodujących poważne zakłócenia procesu trawienia. powodujące w aktywnej dawce śmierć od 50 do 90% osobników. może być różny. które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. w którym dany gen przejawia działanie letalne. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w. ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia. WW) działają letalnie. warunkujący umaszczenie tzw. gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego. powodują śmierć osobnika. U kur gen achondroplazji (Cp) w układzie hetero- 125 . Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry. jest gen W. natomiast u osobników heterozygotycznych nie są letalne. inne zaś później. ale dają zauważalny efekt fenotypowy. białopyskie. nie ograniczając na ogół przeżywalności czy sprawności życiowej. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce. w którego genotypie wystąpią. • geny subwitalne. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym. będącym również wynikiem mutacji genu ω.

zygotycznym (Cpcp) warunkuje krótkonożność. Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się W przypadku gdy matka jest heterozygotą. od niewielkich zmian (np. nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. jak też od interakcji ze środowiskiem. jak achondroplazja recesywna. Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec. Geny semiletalne często jest trudno odróżnić od genów letalnych. Cecha ta występuje tylko u samic. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31. warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. U samców gen ten jest letalny. 126 . U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. Zakres działania tych genów jest różny. Niektóre geny letalne mogą także powodować śmierć matki. Zmienność tej cechy u krów jest duża. w potomstwie występuje stosunek samców do samic l: 2. co obrazuje schemat: jedynie samice. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują. bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń. Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt. gdyż ich działanie zależy między innymi od czynników środowiskowych. natomiast u homozygotycznych — bardzo wyraźne. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji. iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców. natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną.

mimo że są pochodzenia pozagenetycznego. Teratologia. Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi. Można to uczynić biorąc pod uwagę: 127 . a powstałe pod wpływem czynników środowiskowych. wady te nie dziedziczą się. sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. noszą nazwę fenokopii. 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia.4. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego. 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód. przypominające mutanty. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych. bloki metaboliczne. Przykład takiego bloku podano już wcześniej. epilepsja u bydła). powodując niepłodność czy utrudniając akt kopulacji. następny podrozdział dotyczy wad wrodzonych. 2) wady — są to pewne zaburzenia w prawidłowej budowie. nauka zajmująca się zaburzeniami rozwojowymi. wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała. Niektóre z tych genów są przyczyną zaburzeń metabolicznych. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika. ich rodzajów. Wady takie. do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi. 5. powstające w okresie płodowym. obarczone nimi zwierzęta nazywane są potworkami. a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe. Choroby monogenowe wywołujące wrodzone wady rozwojowe Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne.Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. inne ujawniają się w późniejszym okresie życia (np.2.4. chromosomowych lub genomowych. Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne. że niektóre anomalie. powodując tzw. Zdarza się jednak.

skrócenie lub brak żuchwy. Jest to prosta cecha recesywna. Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. U bydła wada ta występuje u ras mięsnych (np. 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich. Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii. którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany). charakteryzującego się wybitną wartością hodowlaną. bulldog disease). U japońskiego bydła mięsnego. Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. Mutacja ta powoduje powstanie kodonu terminacyjnego. Do mutacji wpływających na cały kościec należy karłowatość. oznaczonego symbolem bd (ang. Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. czyli zahamowanie rozwoju układu kostnego. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. polegającą na insercji 4 nukleotydów w genie. japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN). Nosicielstwo allelu achondroplazji. 5-15 wkładka kolorowa). jak i dalszych. 128 . że płody dotknięte tą wadą. stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej. creeper — pełzacz).1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie. Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy. 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka. chondrodysplastic dwarfism). Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika. cechująca się skróceniem kończyn. Badania genetyczne wykazały. ulegają poronieniu zwykle przed ósmym miesiącem (ryć. W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację. powodując tylko nieznaczne skrócenie kończyn. skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy. wpływa pośrednio na zwięzłość budowy. dała początek nowej rasie bydła — dexter). kodowany przez ten gen. przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. u którego występuje recesywna karłowatość chondrodysplastyczna (ang. u herefordów). homozygotyczne pod względem genu niezupełnie dominującego. OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH Wady układu kostnego Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja. Gen karłowatości u osobnika heterozygotycznego.

Anomalia ta uwarunkowana jest genem recesywnym. 5-16 wkładka kolorowa). a także u owiec. amputacji kończyn. Wadzie tej często towarzyszą: skrócenie żuchwy. żeber i mostka oraz części pyskowej (garbaty nos). która zależnie od gatunku.Zaburzeniem. U psów skrócenie kręgosłupa nie jest letalne dla suk. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego. któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. świń. Natomiast samce prawdopodobnie nie osiągają dojrzałości. Szczenięta obarczone tą wadą cechuje mniejsza żywotność. brakowi gałek ocznych 129 . pęcinowego lub kolanowego. a u tych. Anomalią układu kostnego. bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie. Wada ta. jest autosomalna recesywna cecha skrócenie kręgosłupa. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw. rozdwojenie podniebienia i brak większości zębów. cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. które przeżyły. deformację grzbietu. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość. U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. przepuklinie mózgowej. Jest ona wynikiem mutacji (transwersja adeniny na tyminę. Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. świń i owiec. Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego. central vertebral malformation). Może ona natomiast towarzyszyć: wodogłowiu. Możliwe więc. a nawet niepłodność. polega na niezrośnięciu się kości czaszki. hampshire) w Stanach Zjednoczonych w latach 80. której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. obserwowana głównie u bydła. które występuje u większości ras bydła. spider syndrome). U jagniąt. fibroblast growth factor receptor 3 -. U owiec niektórych ras mięsnych (suffolk. Jest ona letalna u bydła i indyków. rozmnażają się one prawidłowo. a nawet płci wykazuje różny stopień letalności. W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. amputacja kończyn (akroteriaza) (ryć. Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi".FGFR3). że jest to cecha letalna dla jednej płci. Genetycznym podłożem tej wady jest autosomalny gen recesywny. a nawet ludzi jest tzw. Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka. Ogólne zesztywnienie stawów notowane jest u bydła. stwierdza się osłabione zdolności rozrodcze.

Na podstawie szczegółowych badań można sądzić. Inną wadą dziedziczną układu powłokowego jest brak owłosienia. u bydła rasy Jersey. Schorzenie to przybiera najostrzejszą formę. Anomalia ta polega na skróceniu dolnej części dzioba. Cielęta dotknięte tą wadą w warunkach naturalnych giną. perskie lub meksykańskie) są heterozygotami. jak włosy i pióra. skrócenie szczęki. duck). chińskie. W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. 130 . że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. Ptaki. Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. psy tureckie. u bydła ayrshire. jak wodogłowie. królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. Wyniki badań wskazują. prowadzącą do śmierci płodów lub noworodków. uwarunkowana recesywnym genem sprzężonym z płcią. Nienormalność ta jest prostą cechą recesywna. U owiec obserwowana jest również cecha recesywna — brak żuchwy. Płytki te są porozdzielane rowkami. Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. natomiast najłagodniejszą. U drobiu wadą układu powłokowego jest nagość. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi. Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. U psów brak owłosienia uwarunkowany jest genem dominującym. Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. że osobniki homozygotyczne rodzą się martwe. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu. która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka. oznaczonym symbolem n (ang. Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości. które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu.lub zesztywnieniu stawów. naked). Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła. niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). U bydła. ale i takich jej wytworów. że wszystkie bezwłose psy (tzw. Wady układu powłokowego Wady układu powłokowego odnoszą się nie tylko do skóry. a to z kolei może spowodować śmierć w pierwszych tygodniach życia. w których rosną włosy.

świń i drobiu jest wodogłowie wewnętrzne. u koni natomiast okrężnicy. nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. U drobiu występuje również recesywne. U bydła nienormalność ta dotyczy jelita biodrowego. U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. przy czym u kur gen ten nie jest letalny (np. Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). Obie nienormalności warunkowane są genem recesywnym. natomiast u królików — recesywnym. Niedorozwój móżdżku najlepiej został poznany u bydła i owiec. determinowana u bydła genem dominującym. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy.Wady układu pokarmowego Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. U indyków i kur notowane jest wrodzone zaburzenie równowagi. Niedrożność jelit zaś. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem. podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną. jak i u koni. powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. natomiast heterozygoty mają piękny czub. Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych. wykazują powiększenie czaszki. to prosta autosomalna cecha recesywną występująca zarówno u bydła. sprzężone z płcią zaburzenie zwane paroksyzmem. warun131 . Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe. Wady układu nerwowego Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. u których jest prostą cechą recesywną. pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. Prostą autosomalna cechą występującą u bydła. rasy houdan i polskie czubatki). Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. powodując jego rozjaśnienie. Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja. Atak taki trwa około 10 sekund. ale nie mogą stać. Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. U świń gen warunkujący tę wadę wykazuje działanie plejotropowe. następnie upadkiem. usztywnieniem nóg oraz drżeniem ciała. crest). Większość z tych kurcząt ginie przed 15 tygodniem życia. Brak odbytu jest recesywną cechą letalną. Zwierzęta dotknięte tą wadą rodzą się żywe. Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. wpływa bowiem na umaszczenie.

jak na przykład brak lub niedobór pewnych enzymów czy hormonów. Anomalią o dużej częstości występowania. niedrożność jajowodów czy wnętrostwo. związanym z niedorozwojem przodomózgowia. Trudność tę powiększa to. świń i owiec. występujący u bydła. Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem. takie jak: niedorozwój (hipoplazja) jąder. 5. loco). autosomalna cecha recesywna. pić i giną w ciągu kilku dni. dlatego nazwano je „gałkowatymi". Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang. Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Wady układu rozrodczego Dość często występujące. Obustronne wnętry są niepłodne również po takim zabiegu.kowane recesywnym genem letalnym lo (ang. powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych. szczególnie u buhajów. Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów. Zaburzeniem układu nerwowego. jest paraliż i przykurcz mięśni kończyn i szyi. macicy. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych. czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny. Jest to prosta. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu.3. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu. Podłoże genetyczne zaburzeń natury biochemicznej. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Niepłodność obserwowana jest także u buhajów. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne. jajników. 132 . iż objawy pojawiają się u zwierząt w różnym wieku. a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego.4. jest trudne do identyfikacji.4. knurl). czyli szczytowej części główki. Nienormalność tę można usunąć zabiegiem chirurgicznym. ogierów i samców innych ssaków jest wnętrostwo. nasieniowodów. Pisklęta obarczone tą wadą kłują się dobrze. ale także u knurów. ale nie mogą jeść. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy.

gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. Oprócz ogromnej liczby wrodzonych wad dziedzicznych. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła. która jest produktem rozkładu chlorofilu. 133 . Genetycznym podłożem tej wady u bydła jest gen recesywny. Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny.Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne. Uczulenie na promienie słoneczne występuje również u owiec. składnika hemoglobiny. niezbędnego do wytwarzania tromboplastyny osocza. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa). lecz jest ono jednak innej natury niż porfiria u bydła. istnieje wiele anomalii. U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna. charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. który przyspiesza przemianę protrombiny w trombinę. reagują powstawaniem pęcherzy na skórze. które są niewątpliwie dziedziczne. a także owiec. zębach i innych częściach ciała. i hemofilia B. wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej. Schorzeniem notowanym u ludzi i psów. wywoływana działaniem genu recesywnego sprzężonego z płcią. których podłoże genetyczne jest dobrze poznane. powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. Należą do nich przypadki wielokończynowości. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu. kościach. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II. mająca łagodniejszy przebieg. U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. Fenotypowym obrazem tej wady jest egzema na pysku i uszach. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. a w skrajnych przypadkach — wrzodów. a dotycząca czynnika IX (czynnik Christmas). zroślaki (zrośnięte dwa płody). a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. wytwarzany w nadmiernych ilościach i odkładany we krwi.

134 .

są zauważalne i łatwe do eliminacji. Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń.4. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania. Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli). Terminem nosiciel określamy osobnika. który jest fenotypowo normalny. W Polsce. niestety. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli. kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana. częstość jest niewielka.4. Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych.5.4. które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji). ale w swoim genotypie 135 . Ograniczanie występowania chorób genetycznych Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach. ale jedynie te.

Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. Natomiast wśród jego córek połowa będzie normalnych. Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice. będą pochodzić wszyscy synowie fenotypowo normalni. 136 . a u połowy ujawni się wada dziedziczna. Schemat takiego kojarzenia jest następujący: Jeżeli testowany osobnik jest nosicielem allelu recesywnego.ma gen letalny (czy semiletalny) w układzie heterozygotycznym. u ptaków samce). Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza. że aż 18% osobników jest nosicielami niepożądanego allelu. Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. to około 50% jego potomków będzie homozygotami recesywnymi. fenotypowo ujawniają swą obecność wówczas. Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. Jeśli będzie to gen letalny powodujący zamieranie zarodków. 2. to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności. Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników. gdy homozygoty recesywne wykazujące wadę żyją i są płodne. buhaje). głównie wykorzystywanych w sztucznej inseminacji (np. gdy występują w stanie homozygotycznym. a połowa nosicielami niepożądanego genu. Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią. wśród których można się spodziewać obecności nosicielek recesywnego allelu. jak już wspomniano. skojarzonego z normalnymi kurami. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Geny te. Testowanie takie jest możliwe jedynie wtedy. Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic. jednakże połowa z nich będzie homozygotami dominującymi.

że samice matki tych córek są homozygotyczne (AA). a samiec jest heterozygotyczny. jest kojarzenie samca z jego własnymi córkami. Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych. Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw. W hodowli bydła młode buhaje. zakupione przez Stacje Hodowli i Unasieniania Zwierząt. z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich). Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. Wówczas schemat kojarzenia testowego jest następujący: Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. Rejestracja ta z jednej strony daje obraz częstości występowania tych wad. kojarzone są z losowo wybranymi samicami. 137 . 3.Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. Dokładną metodą identyfikacji nosicielstwa recesywnego genu. lecz trudną do zaakceptowania ze względów hodowlanych. Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus. Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. test automatyczny). Jeśli przyjmiemy. w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). a połowa Aa. to wśród córek połowa będzie miała genotyp AA.

Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych. powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138 . Ponieważ jest to gen recesywny. która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy). po raz pierwszy opisano go w 1983 roku. Jest to choroba autosomalna recesywna. DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi. Na początku lat 90. głównie PCR-RFLP. które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. U bydła zespół BLAD był znany od kilkunastu lat. fenotypowo zdrowe). tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. Zagadnienie to opisano niżej. W latach 70. a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu). Stwierdzona w pozycji 383 nukleotydu mutacja. który koduje strukturalną podjednostkę CD18 p2-integryny. leukocyte adhesion deficiency). Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2. w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne. Białko to odgrywa istotną rolę w odporności organizmu. Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. W diagnostyce tych chorób stosowane są techniki biologii molekularnej. rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego. występująca również u ludzi pod nazwą LAD (ang. iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych.Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt. Analiza rodowodowa wykazała. Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to. w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej.

wego na glicynę. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA. które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. podejmowane są środki prewencyjne. opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. który bierze udział w cyklu mocznikowym. ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. Z kolei. tzw. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych. natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to. Obraz elektroforetycznego rozdziału wygląda następująco: W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację. Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach. iż zmutowany allel nie ma miejsca restrykcyj139 . a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). Za pomocą analizy fragmentów restrykcyjnych określa się. jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa. Mutacja ta została już przedstawiona wcześniej. Jej podłożem genetycznym jest zmutowany. ciche podstawienie 775 nukleotydu. Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni. recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. jaki allel występuje w badanym DNA.

W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę. Z drugiej jednak strony. natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. Pierwsza z nich to okresowy paraliż. niemożliwa jest analiza DNA osobników homozygotycznych. Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony. jest recesywna mutacja genu syntazy urydynomonofosforanowej.nego dla enzymu Avall w kodonie 86. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni. Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu. których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych). za140 . polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku. okresie głodzenia. występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego. Zmutowany allel genu UMPS. Osobniki heterozygotyczne są fenotypowo normalne. 118 pz i 72 pz. hyperkalemic periodic paralysis). natomiast allel zmutowany (DUMPS) — nie będzie. Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. Objawami tej choroby są ataki drżenia mięśni i paraliżu. Kolejną. Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz. ale wykazują obniżony poziom aktywności enzymu. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. pojawiający się u koni „ąuarter" w USA. do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. nie dającą żadnych skutków fenotypowych. Podobnie jak w przypadku poprzednich mutacji. dla heterozygotycznego trzy prążki: 194 pz. 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym. deficiency uridine monophosphate synthase). określony symbolem DUMPS (ang. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży. nazwany HYPP (ang. Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz. powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT). również wcześniej przedstawioną mutacją letalną. występujące po zmianie diety. dlatego nazwano go „genem zamieralności zarodków". a dla normalnej homozygoty dwa prążki 118 pz i 72 pz.

severe combined immunodeficiency disease — SCID). Podobna choroba od 50 lat znana jest u ludzi. iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen. poznanych chorób prionowych u zwierząt jest trzęsawka (ang. którym jest białko. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20. u owiec — 13ql7-ql8. nazwane prionami. Z tego powodu określane są gąbczastymi encefalopatiami (ang. u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny. przy czym u bydła w pozycji 13ql7. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową. Choroba ta charakteryzuje się brakiem limfocytów T oraz B. natomiast badania przeprowadzone w Polsce wykazały. namnażają się w ten sposób. Przypuszcza się. Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA. z zastosowaniem enzymu restrykcyjnego Tagi. co powoduje załamanie się układu immunologicznego. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP.działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. Białkowe cząsteczki infekcyjne. Gen kodujący białko komórkowe oznaczono symbolem PrPc. indukując zmiany ich konformacji. chorób prionowych. spongiform encephalopathies). W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach. Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej. Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji. Omawiając choroby genetyczne nie sposób pominąć tzw. iż przekształcają prawidłowe cząsteczki białka w szkodliwe. Mutacja HYPP dziedziczy się z niezupełną dominacją. Jedną z najdawniej. na granicy prążka 12 i 13 (20pl2-pl3). natomiast u bydła i owiec w długim ramieniu chromosomu 13. dobrze umięśnionych. jak P 141 . że nie występuje ona w polskiej populacji koni arabskich. a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). trwającym miesiące lub lata bez żadnych objawów. bo około 250 lat temu. scrapie — drapać) u owiec. warunkujący białko prionowe — symbolem PrPSc. jego zmutowany allel. Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang.

które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. oznaczenia literowe V/A). Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. Wykryto już kilka mutacji w tym genie u owiec. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. a jej rezultaty nie były zadowalające. że w pobliżu genu białka prionowego znajduje się gen Prnd (ang. rok później została opisana jej patologia. związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. Wydaje się. że częściej występuje 6 powtórzeń. Ponadto tylko ten genotyp nie występował u krów z BSE. Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc. Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej. R/H) oraz 171 (arginina/glutamina. Białko to ma około 250 aminokwasów. kóz i bydła. downstream prion-like protein) lub doppel. 5-III).śledziona czy węzły chłonne. Spośród trzech możliwych genotypów (6:6. Metoda ta okazała się jednak zbyt droga i długotrwała. 154 (arginina/histydyna. U bydła chorobą prionową jest rozmiękczenie mózgu (ang. R/Q) (tab. Czynnikiem zakaźnym BSE jest to samo białko prionowe. 5-17). bovine spongiform encephalopathy — BSE). Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm. 142 . Dotychczas stwierdzono. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny. Gen ten koduje białko określane jako Dpl (ang. Ostatnie badania wykazały. a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). że najbardziej odporne są owce o genotypie AA136RR154RR171. prion-doppel). które wywołuje scrapie u owiec. Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii. które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym. Jest to choroba ośrodkowego układu nerwowego.

Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt. Należą do nich biegunki okresu noworodkowego u prosiąt. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie. w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli.5. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny Gen odporności na kleszcze W niektórych krajach.4. głównie w północnej Australii i innych regionach tropikalnych. jak również w Europie. występowanie tych 143 . powodujące rocznie padnięcie około 10 min prosiąt na świecie. Gen K88 i F18 U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen. determinujący odporność na kleszcze. ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. umożliwiających adhezję bakterii i ich rozwój. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi. Z kolei.5. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła. bydło indyjskie jest bardzo odporne na kleszcze. bydło jest szczególnie podatne na inwazje kleszczy. Z kolei.

coli (bakterie te mają fimbrie). 5. z których jedna. stwierdzono bowiem.5.2-fukozylotransferazy. a ich charakterystyczną cechą jest to. 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych. znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l. W jednym z nich (FUT1) wykryto dwie mutacje. coli K88 zlokalizowano w chromosomie 13. blisko locus Tf (transferyny). Mutacje te mogą być dziedziczone po matce. mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym. której objawami są m. U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa. schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E. polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę). iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg. z ałlelem zmutowanym M307A. konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa). Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika. coli F18). Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne. ataksja. Loci receptorów dla E. Mutacje w mitochondrialnym DNA Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. trzech prążków (93. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E. Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA. a odporność recesywną (allel b). Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany). iż mogą 144 . oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. Podatność jest cechą dominującą (allel B). oznaczona symbolem M307.receptorów warunkowane jest genem głównym (o dużym efekcie). warunkującego odporność na infekcje E. Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra. W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1'. wykazuje ścisłe sprzężenie z genem ECF18R. coli F18.in.

polegają na substytucjach nukleotydów (głównie tranzycja). inne natomiast u odpornych. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. Z kolei. Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np. ale dalszym pokoleniom cechę tę przekazują tylko córki. kwasica mleczanowa i napady udaropodobne). Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. Miejsce i zasięg występowania danej mutacji powodują. jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP). pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. . Podstawienia nukleotydów w genach kodujących tRNA powodują m.dotyczyć całych tkanek. polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki. iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach. drugi natomiast mutacją homoplazmatyczną. podobnie jak w DNA jądrowym.in. że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka. wywoływaną przez wirus. Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. mitochondrialną miopatię. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego. Skutkiem tranzycji są takie choroby u człowieka. Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to. insercji bądź delecji nukleotydów. Wiadomo na przykład. padaczkę miokloniczną i tzw. Mutacje w mitochondrialnym DNA. Przykładem pierwszej sytuacji jest wspomniana już choroba LHON. której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. poszarpane czerwone włókna (MERRF). dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną. chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona. iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom. jak i synom. mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi.

posiadanie/brak rogów). Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym. układy grupowe krwi itd. a ich ujawnienie się zależy przede wszystkim od założeń genetycznych. Do cech jakościowych zalicza się takie. Mechanizm dziedziczenia cech jakościowych jest zróżnicowany. barwa umaszczenia. Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy. że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. Ponadto. Zjawisko to nazywa się plejotropią. Wspólną właściwością tych cech jest to. Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków. 146 . Znane są również przykłady. że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. Ogólnie cechy można podzielić na jakościowe i ilościowe. jak: umaszczenie zwierząt. rogatość lub bezrożność bydła.Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu. umaszczenia. kolor upierzenia u drobiu. np. Oznacza to. W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen. bowiem na ich ekspresję wpływa kilkanaście. rzadziej kilkoma współdziałającymi ze sobą parami genów. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości. Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. a nawet kilkadziesiąt par genów. w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. kiedy jeden gen wpływa na kształtowanie się kilku cech. Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone. która jest łatwa do odróżnienia w zespole innych właściwości (np. Cechy jakościowe są warunkowane jedną. owiec i kóz.

natomiast mająca dwa różne geny — heterozygotą (Aa). 6. Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla. Zygota. drugi natomiast — nieallelicznego (kilka par genów). W procesie gametogenezy allele z danej pary rozchodzą się do gamet. Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów). a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. 147 . I prawo Mendla.Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem. Potomek dziedziczy zatem jeden allel z danej pary od ojca. Geny te nazywane są parą alleli lub allelomorfów. Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary. Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. Dziedziczenie cech warunkowanych jedną parą alleli 6.1. A-a). że gameta zawiera tylko jeden gen z danej pary alleli. zwane prawem czystości gamet. Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. nazywa się homozygotą (AA lub aa). drugi natomiast od matki. W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech. Jak już wspomniano. Współdziałanie alleli Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu.1. Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. która zawiera dwa jednakowe geny z danej pary alleli. dając wszystkie możliwe formy danej cechy.1. Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek). Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA. cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą. mówi o tym. Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus.

Przykładem całkowitej dominacji może być bezrożność u bydła. Ilustracją tego typu dziedziczenia. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2). dominujące nad czerwonym i inne. Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi. że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. część mroziate. będących homozygotami alternatywnymi (PP i pp) pod względem locus polled. Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz. gdyż gen dominujący P maskuje jego ekspresję. kontrolowany przez allel dominujący Bew z locus Be. jednolitego umaszczenia. otrzymuje się potomstwo (pokolenie Fl) mroziate. Są one zatem w stosunku do siebie równorzędne. nazywanego również dziedziczeniem typu Zea. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane). wykazujące dominującą formę cechy. że fenotyp zwierzęcia odzwierciedla jego genotyp. to stosunek liczbowy osobników czerwonych. z którego część ma umaszczenie czerwone. upierzenie kur andaluzyjskich (czarne. U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. Charakterystyczną cechą tego typu dziedziczenia jest to. Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt. również czarno umaszczonych. Para rodziców. jest poniższy przykład. w locus tym występuje allel be. długość uszu u owiec rasy karakuł i inne. Dominowanie niezupełne genów z jednej pary alleli polega na tym. który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. Stwierdzono. Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie). W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie. Z kolei u świń rasy cornwall. mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. białe i stalowoniebieskie). Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. jednolite umaszczenie (dominuje) i łaciatość u bydła. czarne umaszczenie u bydła. zawsze da potomstwo heterozygotyczne. część zaś białe. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire. Przykładem tego typu współdziałania allelicznego jest grupa 148 .

krwi AB w układzie ABO u ludzi. który warunkuje tę samą cechę co allele pierwotne. w którym w jakiejś populacji 149 . W przypadku niektórych loci. Zdarzają się również takie loci. Układ taki. obok dotychczasowej pary alleli pojawia się allel trzeci. w wyniku mutacji genowych (patrz rozdział: Mutacje). w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu. że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa). dając jedynie inną jej formę lub natężenie. Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. w których u różnych osobników znajdują się więcej niż trzy allele. Naddominowanie polega na tym.

rogate) — allele recesywne e i p. czerwone). nazywamy szeregiem (serią) alleli wielokrotnych.występują więcej niż dwa allele. ep. to ich segregacja jest praktycznie niezależna. Niezależne dziedziczenie cech (II prawo Mendla) Niezależne dziedziczenie cech stwierdził Grzegorz Mendel. eP. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie. Dzieje się tak 150 . Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne. to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone).2. Jeśli szereg składa się z n liczby alleli. 6. Edp. mówiące o niezależnym dziedziczeniu się cech. Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP. Oznacza to. badając m. iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu.in. bezrogie. bezrogie) zawierają dominujące geny Ed i P. Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. Zwierzęta z pokolenia Fj będą mieć genotyp EdePp. czyli będą czarne. warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1). że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. to liczba genotypów będzie się równała: Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku. jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. Allele wielokrotne charakteryzują się tym.1. natomiast gamety osobnika rasy shorthorn (czerwone. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla). Wszystkie gamety osobnika aberdeen-angus (bydło czarne.

151 .

istnieje możliwość ujawnienia się 6 różnych fenotypów. Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie. a druga według typu Zea. zwiększy się liczba możliwych fenotypów. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może 152 . cechy kontrolowane przez te geny będą się dziedziczyć razem. a tylko kilka do kilkudziesięciu chromosomów. rogate): 3 (czerwone.1. w którym występuje przynajmniej jeden gen dominujący z każdej pary. Jednak organizmy żywe mają tysiące. że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p. Zatem każdy chromosom zawiera wiele genów. 6-2). Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne. Natomiast gdy jedna cecha dziedziczy się według typu Pisum. bezrogie): l (czerwone. Jeśli będzie rozpatrywana większa liczba cech równocześnie. W tym przypadku można mówić o niezależnej segregacji chromosomów. to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. rogaty). liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n 6. a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony.dlatego. Dziedziczenie cech sprzężonych Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to. iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy. gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych. Najliczniejszą grupę potomstwa stanowią osobniki o genotypie. Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy. dziesiątki tysięcy różnych genów. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli. sporządzając szachownicę genetyczną Punneta. gdy obie cechy dziedziczą się z dominowaniem całkowitym. Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2. Cechy takie nazywamy sprzężonymi.3. lecz 9 różnych fenotypów. rogate) (ryć. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4. bezrogie): 3 (czarne. Ponieważ każdy osobnik wytwarza 4 rodzaje gamet. inaczej mówiąc.

złożone z homologicznych chromosomów. U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł. Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna. bądź w różnych chromosomach i jest to faza odpychania (trans). Częstość tej wymiany jest tym większa. Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). że są one w fazie przyciągania (cis). w którym licznik oznacza jeden chromosom. jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom. 153 . tzw. W odróżnieniu od cech segregujących niezależnie. pojawią się kombinacje cech w innym układzie niż u rodziców. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami. normalne skrzydła są dłuższe od odwłoka. genotyp dla cech sprzężonych jest zapisywany w postaci ułamka. została przyjęta nazwa faza sprzężenia. dzikiej) każdej cechy u muszki. skrzydła szczątkowe (gen recesywny v — vestigal). Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący: Natomiast genotyp podwójnej homozygoty recesywnej: W celu określenia. zwanej crossing over. mianownik drugi chromosom z tej pary. Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy. W wyniku crossing over u części osobników potomnych. W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym. rekombinantów. Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty. im dalej od siebie znajdują się geny.być stosowany do tych cech.

W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over. W naszym przykładzie odległość między loci B i V wynosi 18. jest stała. z jaką crossing over zachodzi między sprzężonymi loci. W danym przykładzie rekombinanty stanowią około 18. iż częstość. jeśli pojedynczy 154 . od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana).Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe. Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu). Wynika to z tego. czyli l cM = 1% rekombinacji. Procent rekombinacji przyjęto za jednostkę odległości między genami. Na przykład.5% całego potomstwa z tej krzyżówki. Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy.5 cM. Można jednak przewidzieć częstość występowania podwójnego crossing over. jest ona iloczynem częstości przypadków pojedynczych crossing over. której symbolem jest cM (centymorgan. natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami). Doświadczalnie zostało udowodnione. że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów.

a gen recesywny c (cinnabar).001. natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV. Trzecią cechą rozpatrywaną będzie kolor oczu. w celu lepszego uwidocznienia efektu crossing over. W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny: Natomiast drugi rodzic ma genotyp: W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv. Przyczynę stanowi to. gdyż w naturze jest ona niższa. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie. Również w tej krzyżówce. 155 . Jeśli przyjmiemy. a nie za pomocą przyjętego dla nich symbolu „ + ". Z kolei. jak przed tą wymianą i nie będzie można odróżnić rekombinantów. czyli 0. U muszki owocowej dominuje czerwony kolor oczu (dziki). to częstość występowania podwójnego crossing over wynosi 0. Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych. Zjawisko to nosi nazwę interferencji.1%. krzyżówki trzypunktowe. umożliwiające dokładne ustalenie położenia loci względem siebie. Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych. stosuje się tzw. allele dominujące będą oznaczone literami alfabetu. że kolejność ułożenia loci w chromosomie jest następująca: A-B-C.05 (5%). Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej.02x0. Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi.crossing over w obszarze I zachodzi z częstością 0.02 (2%). podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci. a w obszarze II — 0. Jeśli jednak zajdzie podwójny crossing over. By tego uniknąć. Jest to jednak wartość przybliżona. warunkuje kolor cynobrowy. iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka.05 = 0. układ genów będzie taki. to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C.

W ten sposób tworzone są mapy genetyczne. Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane. W celu okreś156 .W potomstwie uzyskano następujące genotypy i liczebności: Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów. wyrażonym w procentach: Analogicznie do tego odległość między loci C i V wynosi: Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco: Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie.

Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład.in. W rozdziale tym pokazano m. Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. występująca u ludzi. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu. że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki). a osobnika — hemizygotą. Dzieje się tak dlatego. Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób: Fenotyp Samice Samce Samice Samce Jak wynika z tego zestawienia. Powstaje wówczas mapa fizyczna. a synowie po matce). Sposób ich dziedziczenia jest inny niż cech autosomalnych. ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. Cecha zmniejszonej krzepliwości krwi (hemofilia). należy zastosować inne metody badania (cytogenetyczne). iż u osobnika diploidalnego występuje tylko jeden gen z danej pary. że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego. Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi. uwarunkowana jest recesywnym genem h. 6. nazywamy hemizygotycznym. samce nie mogą być heterozygotami (nosicielami genu hemofilii). samce zaś heterogametyczne (XV). których geny są umieszczone w chromosomach płci. nazywamy cechami sprzężonymi z płcią. Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ). Układ genetyczny polegający na tym.. O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. 157 . U ssaków samice są homogametyczne (XX). Cechy sprzężone z płcią Cechy. a nie — jak u płci homogametycznej — od pary genów. a heterogametyczną samice (ZW). w którym chromosomie znajduje się dana grupa genów sprzężonych. obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu.lenia.4. Gdy płeć heterogametyczną ma cechę dominującą.1. Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego). psów i niektórych zwierząt gospodarskich. a pleć homogametyczną cechę recesywną.

w pokoleniu F. Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych. 6-4 wkładka kolorowa). Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce. u których zaraz po 158 . „dziedziczenie na krzyż" Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B. tj. Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. warunkujący cechę jastrzębiatości upierzenia. dominuje nad jego allelem b (gen czarnej barwy upierzenia). takich.Ryć. Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra. 6-3. Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią.

część z nich przedstawiono w rozdziale: Mutacje. U zwierząt domowych jest wiele cech sprzężonych z płcią. których założenia genetyczne znajdują się u osobników obu płci. Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści. ang. Rasą autoseksingową są polbary. inne — rude (genotyp Oo) (ryć. rasa sussex) i złocistości upierzenia (rhode island red). Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci. co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego. wytworzone przez polską badaczkę Laurę Kaufman. 6-5 wkładka kolorowa). Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia. orange). Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym. zlokalizowany w chromosomie X. geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw. Cechy te nazywane są cechami 159 . B (niebieskie dzikie) i b (czekoladowe). warunkowana przez locus O (ang. Niektóre z nich to tzw. Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. mając taki sam genotyp.wykluciu można rozróżnić płeć.będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach. natomiast osobniki homozygotyczne recesywne będą rogate. Osobniki męskie i żeńskie. Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X. Jest ono następstwem tego. U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych. Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach). Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech. samice zaś bezrogie. Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate. cechy związane z płcią. ale ujawniają się tylko u jednej płci. mogą się różnić fenotypowo. dwarf — karłowaty). Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone). Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. Samce mogą być tylko czarne (o-) lub rude (O-). Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw. mające gen jastrzębiatego upierzenia. iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie. Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. Przykładem takiej cechy jest rogatość owiec rasy dorset horn. ale ich ekspresja jest uzależniona od płci.

W przypadku wielu cech geny z różnych par alleli. pracę serca i aktywność procesów trawiennych. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. Zmiany te są jednak następstwem nieprawidłowego opierzenia. Na przykład gen warunkuje syntezę enzymu. wpływa zatem na inne właściwości organizmu. na tempo przemiany materii. nieśność samic ptaków. opisany w podrozdziale: Dziedziczenie umaszczenia.in.5. W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt. powodują pojawienie się nowej formy cechy jakościowej. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. Przykładem jest gen warunkujący platynową barwę u lisów. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe.2. 6. 6. która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech. hormonu). Plejotropia może być właściwa lub rzekoma. wnętrostwo czy przepuklina mosznowa u samców. Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy.ograniczonymi płcią lub ograniczonymi do płci. Plejotropia O plejotropii mówimy wówczas. kiedy jeden gen oddziałuje na powstanie kilku cech. Należą do nich: zdolność wydzielania mleka u samic ssaków. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt". 160 . które nie chroni ptaka przed nadmierną utratą ciepła. Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. w wyniku łącznego działania. Współdziałanie genów z różnych loci w kształtowaniu fenotypu W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m. Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne.1. Z kolei ten związek ma różnorodne funkcje fizjologiczne. gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. który bierze udział w syntezie jakiegoś związku (np. Plejotropia właściwa występuje wtedy.

W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p. 6-6a. 6-6a). Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161 .2. Komplementarność Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć. Jest kilka rodzajów tego współdziałania.Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. 6.1. Ryć.

Gen. Dwa dominujące geny z różnych par alleli. gdyż brak w ich genotypach genu C.Gen R warunkuje kształt różyczkowy grzebienia. 6. nazywany jest genem epistatycznym. a jego allel r — pojedynczy. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia. Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym. który hamuje ujawnienie się genu z innej pary. wyandotte. której genotyp może mieć kilka różnych wariantów. która powstaje w wyniku działania każdego z nich osobno. nazywamy genami komplementarnymi lub dopełniającymi się. Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc). charakteryzująca się tym. w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy. jak i różyczkowego. warunkującego wytwarzanie pigmentu (melaniny) w piórach. która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. natomiast gen P powoduje powstanie grzebienia groszkowego. ale mają 162 . całkowicie różny od obojga rodziców. W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy. podobna do wspomnianej wyżej u świń. w którym wystąpią 4 fenotypy w stosunku 9:3:3:1.2. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy. plymouth rock) mają upierzenie białe. warunkujący go genotyp to podwójna homozygota recesywna — rrpp. Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego. Ptaki te są również białe. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP). Zjawisko epistazy może wyjaśnić poniższy przykład. jego allel p — grzebienia pojedynczego (ryć. Z krzyżowania osobników o ustalonej cesze kształtu grzebienia. którego nie było w dwóch pokoleniach przodków. pojawia się również nowy typ — grzebień pojedynczy. natomiast gen hamowany to gen hipostatyczny. 6-6b wkładka kolorowa). że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. Epistaza Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza.2. gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_). współdziałające razem i wytwarzające odmienną formę cechy niż ta. tj. U białych leghornów jest inna sytuacja. natomiast w pokoleniu F 2 . Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. że w pokoleniu Fl pojawia się nowy fenotyp. Kury niektórych ras (np.

Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. natomiast czarno umaszczonych (np. dotyczącej dziedziczenia umaszczenia. Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów. psów i kotów. Różny stopień białej plamistości spowodowany działaniem genów modyfikujących w swych genotypach gen C. 6. 6-7). Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć. rasy cornwall): aa ii EE. W potomstwie F2. Geny te. oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. Geny modyfikujące Istnieje pewna grupa genów. które modyfikują przejawianie się jakiejś prostej cechy. Allele z locus E i A są opisane w dalszej części tego rozdziału. Geny epistatyczne mogą tłumić działanie wielu innych par. rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP. W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne.2. warunkowanej zwykle jedną parą genów. 6-7. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I. Gen epistatyczny nie zawsze jest dominujący w swojej parze. powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę. który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. 163 .Ryć. którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc). Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC.3. Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary. zwane modyfikatorami. mimo iż cecha łaciatości warunkowana jest inną parą alleli.

4. że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację.6. Synteza.6-dihydroksyindolu (DHI) do indolochinonu. syntetyzowane z metabolitów DOPA-chromu. że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. Geny te nazywane są genami polimerycznymi. wpływając na przykład na zmianę ilości wytwarzanego pigmentu. Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. Do niedawna uważano. addytywnymi lub poligenami.3. natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej.). 6-8): 1) hydroksylację tyrozyny do 3. rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci. Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. zależne od sumującego się ich działania. iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych. takich jak gonadotropiny. a czarna lub brązowa w lecie). U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych. Sumujące działanie genów Inną formą współdziałania nieallelicznego genów jest polimeria. 6.2.4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5. kortykotropina i hormon melanotropowy — MSH (ang. ale czynniki środowiskowe mogą modyfikować umaszczenie. Ostatnie badania wykazały. U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np. wydajność mleczna. iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę. i feomelaniny (kolor czerwony lub żółty). biała w zimie. Zmiany te spowodowane są działaniem niektórych hormonów. Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. 164 . Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny. Należy pamiętać. Zjawisko to polega na tym. powodując różne jej nasilenie. melanocyte stimulating hormone). wytwarzane z metabolitów cysteinylo-DOPA-chinonu. nieśność itd. Dziedziczenie umaszczenia Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny).

6-8. ma działanie plejotropowe na rozwój i różnicowanie organizmu. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti).Ryć. Melanocyty pochodzą z rdzenia nerwowego. Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina). Hormon melanotropowy. Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. Hormon ten stymuluje produkcję poszczególnych melanin na przemian. jest wytwarzany przez część pośrednią części gruczołowej przysadki. Schemat biosyntezy melaniny Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. Geny. komórkowym i subkomórkowym. W determinację koloru jest włączonych wiele loci. Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165 . zwany również intermedyną lub melanotropiną. Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym. Receptor ten jest determinowany przez locus E (Extension). warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów. które zostały już sklonowane. które współdziałają ze sobą w sposób kompleksowy. Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. Wiele genów. Melaniny są wytwarzane w melanocytach. a hamowanie produkcji feomelaniny wewnątrz melanocytów. REGULACJA NA POZIOMIE TKANKOWYM Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. jeśli nie wszystkie związane z wytwarzaniem pigmentu. a podczas rozwoju embrionalnego wędrują do powstającej skóry. Jest wiele genów.

Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) . pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych. w jednolity typowy sposób. nazywanych agouti. REGULACJA NA POZIOMIE KOMÓRKOWYM Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów.dominujący biały nakrapiany i Steel (Sl) . podczas gdy locus Extension działa w melanocytach. W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np.. lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np.niesieniu do myszy. Locus ten kontroluje ilość eumelaniny. Należą do nich geny z loci D (Dilute — rozjaśniony). U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego). Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora..stalowy. Mutacje w tych loci wpływają wyraźnie na kolor oczu. które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów.pełna barwa). E (Extension . Locus D koduje strukturalne białko. 166 . U osobników typu dzikiego. Dominant White Spotting (W) . REGULACJA NA POZIOMIE SUBKOMÓRKOWYM Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym). Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu). przez działanie na mechanizmy włączone w funkcję melanocytu. a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów. wpływają bezpośrednio na ilość i typ wytwarzanej melaniny. co wpływa na koloryt (układ barw). które działają na pigmentację ssaków na poziomie subkomórkowym. A (Agouti — dziki). melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę.plamisty. Do loci działających na poziomie tkankowym. brak syntezy melaniny w przypadku albinizmu). oba typy melanin nie są więc syntetyzowane jednocześnie. Geny. Locus E (Extension) koduje przede wszystkim receptor MSH. Większość z tych mutacji ma wpływ plejotropowy na rozwój.

która prowadzi do wymiany cysteiny na tyrozynę. natomiast inne geny regulują typ formowanego pigmentu. ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. Geny z locus C u królików tworzą szereg alleli wielokrotnych. czyli wycinania intronów. Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu). Interesujące jest to. ale mechanizm działania tego genu dotąd nie jest znany. Mutacje w locus C powodują brak pigmentu we włosach. inhibitora) w melanocytach. warunkujących umaszczenie himalajskie i szynszylowate. skórze i tęczówce oka. Tyrozynaza przejawia swą ekspresję w melanocytach. c (ryć. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka. iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown. Wiadomo jednak. B i E. Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino. ale dotychczas nie stwierdzono. gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza. a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). czy pełnią one jakąś rolę (np. Locus C kontroluje liczbę i intensywność ziaren pigmentu. w którym występuje dominacja w następującej kolejności: C. prowadząca do osłabienia funkcji enzymu. Warunkiem ekspresji genów z tych loci jest 167 . w jaki pigment ma być formowany. której funkcja jest decydująca dla wytwarzania pigmentu. zmiany sensu i mutacje zmiany fazy odczytu. która powoduje uwrażliwienie efektu fenotypowego na temperaturę. jeszcze inne — sposób. Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A. cch. ch. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. 6-9 wkładka kolorowa). ale są to mutacje typu nonsens. Takie białka nie są kompetentne katalitycznie. Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny. że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm.Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną. Historycznie był on uważany za locus strukturalny dla tyrozynazy. Badania poszczególnych mutacji w locus Albino u królików. iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową. Specyficzna funkcja tego białka nie jest jeszcze poznana. wykazały. Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny.

u obu gatunków są dwa allele — E i Ed.oczywiście obecność odpowiednich genów z locus C. We wszystkich tych loci. warunkujących różne odmiany umaszczenia. warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny. W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny. u lisa 168 . Natomiast u lisa polarnego zamiast allelu A jest allel A". W.genotyp gg. która z reguły zajmuje miejsce eumelaniny. Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci. Lis polarny o genotypie aa jest czarny. U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. w układzie homozygotycznym -. ale genotyp ten występuje bardzo rzadko (np. W locus E. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny. P. jakie są geny z innych loci. Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1. u lisa polarnego jest rozcieńczona lub usunięta w ogóle. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny. z wyjątkiem locus W. Feomelanina.pigment czekoladowobrązowy. bez względu na to. Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. jak G. w tym przypadku kolor jest determinowany allelami z locus A. R. Allel ten odpowiedzialny jest za eliminację eumelaniny. S. w populacji lisa polarnego w Islandii). W locus B również są dwa allele — dominujący B (czarny pigment) i b. efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -.

złożonego z około 350 aminokwasów. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a. gdy w locus E jest genotyp E+_. W3 (biały Georgian) i W M (gen marble). W locus tym. SJ i SH) i t (T). Locus A koduje syntezę białka.srebrzystego: genotyp pp . natomiast gen marble daje inny efekt fenotypowy u tych odmian. melanocyte stimulating hormon receptor). recesywny allel e.. natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. a drugie brązowe. Letalny jest także genotyp WW. Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy. Mutacje dominujące. Allel dominujący Ed. s (trzy allele: S. W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna. 169 . Genetyczne podłoże umaszczenia u bydła Wyniki wielu badań sugerują. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny. jest homologiczny do allelu ES0 u myszy. której skutkiem może być różny kolor oczu u tego samego osobnika.perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. takie jak W i W. który w układzie homozygotycznym warunkuje umaszczenie czerwone. będącego antagonistą białka MSH-R. W (platynowy). DD — niebieski). Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. umiejscowionym w chromosomie 18. Locus E koduje syntezę białka MSH-R (ang. Niestety dotychczas nie przeprowadzano badań molekularnych locus A. U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe. F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia). Allele z tego locus mogą wykazać ekspresję tylko wtedy. kodujący czarny kolor. w układzie homozygotycznym mają efekt letalny. W locus W są następujące allele: w. przy czym genotyp ww występuje u lisa rudego i srebrzystego. że u bydła umaszczenie czarne. oraz allel E+ umożliwiający ekspresję alleli z locus A. np. opisanych w rozdziale: Mutacje. natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. natomiast allel a w układzie homozygotycznym — recesywne czarne. jedno oko niebieskie. Mutacja w locus s (Shadow) charakteryzuje się heterochromią. Allele te powstały w wyniku mutacji punktowych. brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). W (białopyski). są 3 allele: Ed warunkujący umaszczenie czarne dominujące.

że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension. U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic. W locus I są dwa główne allele: 7 (inhibicja koloru). U ras bydła (np. Na przykład. mroziate). W tym samym locus u bydła tej rasy znajduje się allel Sc. Genetyczne podłoże umaszczenia u świń U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti). iż locus ten jest umiejscowiony w chromosomie 6. Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego. u których allel s jest utrwalony. bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. Kolejność dominowania tych alleli jest następująca: E-Ep-e. Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica. belgijskie błękitne). e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey.Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. ale jest recesywny w stosunku do allelu S. cornwall i hampshire. locus I (biały dominujący) i locus Be (Belted opasany). blisko telomerowego regionu ramienia p. w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. i allel i — recesywny (kolorowy). Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. Wśród 170 . wskazują. w których do analizy sprzężeń użyto ponad 230 markerów genetycznych. W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej. W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a . Badania. natomiast u shorthornów jest odwrotnie. odpowiedzialny za umaszczenie dominujące białe.nieagouti. powodując różne zaburzenia. a mała allelu e (czerwone umaszczenie). ale recesywny w stosunku do białego (I). który dominuje nad s. Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8). locus E (Extension). recesywny s — łaciatość. poland-china i pietrain.. obserwowana jest zmienność w ekspresji cechy łaciatości. także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe. Podobnie jak u myszy i bydła. Większość ras świń udomowionych ma allel recesywny a — nieagouti. niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. warunkujący fenotyp nazwany colorsided — łaciaty. kora jest efektem plejotropowego oddziaływania allelu R na płodność. cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę.

W locus C u koni nie występuje allel recesywny c. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus. trzeciego allelu w locus Extension — ED). wykazujący niepełną dominację. który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. Wzory umaszczenia. jest kodowany przez allel Be w z locus Be. We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele. hannover-braunschweig. ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. allel dominujący E determinuje syntezę eumelaniny. takie jak tobiano (TO). D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). I p (czarne łaty) oraz im (brudny szary). Umaszczenie białe. Genetyczne podłoże umaszczenia u koni Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). Locus E warunkuje wytwarzanie określonego rodzaju melaniny. Genotyp tego knura jest następujący: aa U EE BewBew. 6-10 wkładka kolorowa). wessex saddleback. jak np. Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony). Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita. Locus I został zlokalizowany w chromosomie 8. Biały pas. by było 171 . sabino (SB) czy tarantowate (LP). Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"'. G (Gray — siwy) i RN (Roan — deresz). W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina). Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. cremello). charakterystyczny dla niektórych ras.świń domowych dominujący biały jest przeważający. dominujący w stosunku do jednolitego umaszczenia. są determinowane przez geny z innych loci. zatem wystarczy jeden allel W. oznaczonych symbolem Id (deresz). w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. overo (O). występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace. Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. natomiast inne rasy są homozygotami recesywnymi (ii). siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały). Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). Allele z tego locus wpływają na ekspresję genów z locus A. hampshire (ryć.

LWFS (ang. lethal white foal syndrome). Genotypy w 7 loci. Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina. wobec którego jest hipostatyczny. Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny. znacznie rzadziej. determinujące wybrane rodzaje umaszczenia koni. Należą do nich allele dominujące z loci W. z wyjątkiem allelu W. w locus W mają genotyp homozygoty recesywnej (ww). Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww). O i RN. na skutek braku części jelita. zestawiono w tabeli 6-II.i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. który jest epistatyczny w stosunku do wszystkich alleli z innych loci. Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" . Wszystkie rodzaje umaszczenia. Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Natomiast umaszczenie siwe kontroluje allel dominujący z locus G. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. Allel G (w homo.umaszczenie białe). polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub. Allel D z locus Dun wykazuje zupełną dominację. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_). 172 . z wyjątkiem białego. osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd).

Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała. natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. ale mogą mieć pigment tan. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny. natomiast recesywny allel. podczas gdy feomelanina może być syntetyzowana. np. allel Awh zmniejsza płodność owiec o około 0. natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny. Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia. czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina.15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. Niektóre allele z tego locus mają efekt plejotropowy. Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu. bądź też oba efekty występują łącznie. Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. 6-III). warunkuje wytwarzanie czarnej eumelaniny. warunkuje białe umaszczenie owiec. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec. będący pierwszym w kolejności dominowania z szeregu alleli z tego locus. Przykładem tego jest brązowoczerwony kolor wełny karakułów. Allel typu dzikiego. Allel A wh . bądź mieszaniny jasnych i ciemnych włókien wełny. wzór koloru i obecność lub brak białych znaków. Owce biało umaszczone są zwykle prawie pozbawione pigmentu. który w fenotypie ujawnia się ze zmienną intensywnością. Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów. Brw — czekoladowobrązowej eumelaniny. Bw. Badania specjalistyczne wykazały.Genetyczne podłoże umaszczenia u owiec U owiec stwierdzono trzy typy pigmentu: czarna eumelanina. 173 . w których genotypach jest allel Awh. Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny. inne wpływają na typ włókien.

Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. Umaszczenie białe dominujące (białe perskie. Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. AwhAwh.Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS). Allel typu dzikiego. a także homozygotyczne białe. Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej. recesywny. łaciate afgańskie) jest kontrolowane przez allel W a z locus White. Allel ten jest epistatyczny 174 . Owce ras wełnistych. U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. ale epistatyczny do dominującej brązowej (tan). natomiast homozygoty SSSS są całkowicie białe. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy). Ew umożliwia normalną ekspresję alleli z locus Agouti.

Natomiast jeśli nie wszystkie osobniki. ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów. że jego penetracja wynosi 80%. to mówimy. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym. Pierwsze z tych zjawisk określane jest jako penetracja genu. jest to częstość. 6. 175 . Stwierdzono to na podstawie wyników doświadczenia. Wrn. w przypadkach krańcowych. Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. Natężenie drgań jest bardzo zróżnicowane. rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość. O penetracji całkowitej mówimy wówczas. iż działanie genów może wywoływać różnorodne efekty.w stosunku do wszystkich innych genów umaszczenia. inaczej określana jako przenikliwość. wykazują charakterystyczny dla niego fenotyp. inne zaś jej nie mają. jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników. Penetracja określonego genu może być różna zależnie od płci. z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. która w formie homozygotycznej jest letalna. ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). Penetracja może być całkowita lub niezupełna. Na przykład. Penetracja. natomiast drugie jako ekspresywność genu. Inny allel z tego locus. warunkuje dominującą szarość u karakułów. również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. mówimy o penetracji niezupełnej. Często zdarzają się przypadki. Z drugiej strony.4. w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą. Penetracja i stopień ekspresji (ekspresywność) genów Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika. a nawet. gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy. mające taki sam genotyp. współdziałania tych genów między sobą oraz współdziałania ze środowiskiem.

Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością. możemy mieć wtedy. a także chloroplas176 .5. a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. Nie bez znaczenia jest stan zdrowotny matki. 6. Należy jednak pamiętać o tym. ujawniające się w różnym stopniu. Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach. jak: wiek. które nie są dziedziczne. Z kolei. Już na początku naszego stulecia zauważono. Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony. Geny z różnych loci mogą dawać podobne fenotypy. w którym pojawiają się pierwsze objawy. jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. zależnie od kierunku krzyżowania. gdy jest ona obserwowana u osobników spokrewnionych ze sobą. Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych. Zarówno stopień penetracji. że niektóre cechy nie podporządkowują się temu terminowi. Dziedziczenie pozajądrowe Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki. a także położenie zarodka w macicy i nawet obecność innych płodów. dziedziczą się różnie. sole mineralne oraz inne związki krążące we krwi. stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji. docierające przez łożysko do rozwijającego się płodu). Pewność. iż mamy do czynienia ze zmiennością przejawiania się tego samego genu. że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu.Pojęcie stopień ekspresji (ekspresywność. czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne).

u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca.1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce. Jak dotąd. tli . Natomiast allele charakteryzujące się niską frekwencją (^ 0. W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA. natomiast komórka jajowa ma ich około 100 tysięcy.3 do 0. średnią i niską wydajnością mleka. może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. Powstał nowy termin dziedziczenie pozachromosomowe. analizowanego metodą RFLP. -879 ±114 kg mleka. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację. między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały. +26 ±99 kg. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym. której wartość zawiera się w granicach od 0. O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje. Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. że warunkuje on od 2 do 10% zmienności tych cech. Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika). ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA. Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg. Plemnik zawiera od 50 do 100 mitochondriów. iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. jest przekazywany następnemu pokoleniu wyłącznie przez matki. Przyczyną tego. inaczej pozajądrowe lub cytoplazmatyczne. co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka.9. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała. w przeciwieństwie do DNA jądrowego.4. Mitochondrialny DNA.tach roślin wyjaśniło podłoże tego zjawiska. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. w świetle wyników najnowszych badań. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je.

prowadzone za pomocą technik molekularnych (RFLP). wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu.. Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła. Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej. Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA.rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka.Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności. Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe. U owiec badania mitochondrialnego DNA. . Stwierdzono bowiem istotny wpływ zamiany (tranzycji .

które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np. czyli indywidualna. mamy do czynienia ze zmiennością wewnątrzosobniczą. lub S2 w przypadku próby losowej pochodzącej z tej populacji. W przypadku cech. Zmienność oznaczamy symbolem S2. tzw. Rodzaje zmienności i czynniki ją wywołujące Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników. zwaną także ogólną. występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa). Na zmienność fenotypową. wydajność mleczna w kolejnych laktacjach). 179 . Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej.Rozdział 7. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza. interakcja genotyp-środowisko. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa). jeśli rozpatrujemy populację zwierząt. może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi. Istnieje także zmienność grupowa.1.

i osobnikami homozygotycznymi — dominującym i recesywnym. Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych. Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest 180 . Mutacje prowadzą do powstawania nowych genów.Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. Natomiast rekombinacje. innych układów w obrębie chromosomu lub między chromosomami. ale różniące się pod względem założeń genetycznych (homo. ale także fenotypu (bezrogie i rogate). Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów.i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu. odchylenie dominacyjne i odchylenie epistatyczne. które kontrolują występowanie danej cechy. będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie. Osobniki fenotypowo identyczne (bezrogie). która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. Poniższy schemat krzyżowania bydła obrazuje to odchylenie. Głównymi składnikami zmienności genetycznej są: zmienność addytywna. Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą. Zmienność dominacyjna jest to część zmienności genetycznej. Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym. w którego genotypie funkcjonuje jeden gen dominujący. są przyczyną powstawania różnych genotypów.

). W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej. Do szacowania tego udziału stosowane są parametry genetyczne.białe upierzenie kur rasy leghorn i whiterock. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. czynniki klimatyczne) lub okresowo (żywienie. upierzenie biafe). do których należy odziedziczalność. sposób utrzymania itp. dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało. np. Zmienność skokowa odnosi się przede wszystkim do cech jakościowych. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych. należy także efekt matki pre-i postnatalny. warunkowanych zwykle jedną parą alleli. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów. Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. których wartość wyrażana jest za pomocą liczb naturalnych. Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. a zwłaszcza jej składnika — zmienności addytywnej. Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. genotypów i fenotypów w danej populacji (stadzie). Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. należących do tych ras. Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży. Do czynników środowiskowych. Z krzyżowania osobników 0 białym upierzeniu. mających istotne znaczenie. w zmienności fenotypowej danej cechy ilościowej. Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny. Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału 181 . uzyskuje się mieszańce biało upierzone. Zmienność skokowa występuje również w przypadku pewnych cech ilościowych. jak 1barwnie upierzone. liczba prosiąt w miocie.

szereg rozdzielczy.2. W celu określenia zmienności cechy musimy ją oznaczyć (np. procentowa zawartość tłuszczu w mleku itp. Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np. Jeśli liczba obserwacji jest duża. np. harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta). zwanej próbą. którego elementami są poszczególne osobniki. w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. 7. wydajność mleka w kilogramach. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy.2. ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru: . Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej. dane zestawia się w tzw. ważona. które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji). Miary zmienności Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników.1. Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych. 7. Miary skupienia Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna. zmierzyć) u wszystkich osobników stanowiących próbę. wysokość w kłębie w centymetrach. a niektóre wartości powtarzają się.charakterystycznego dla danej cechy. Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt. Średnia arytmetyczna nie odzwierciedla zmienności. według wartości rosnących lub malejących (szereg statystyczny uporządkowany).

w drugiej 2 kg. 7-1): Średnią ważoną obliczamy wówczas. Wzór na jej obliczanie jest następujący: Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu. Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący.Średnia arytmetyczna charakteryzuje się następującymi właściwościami: Przykład (dane z tab. gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. Wzór na obliczanie średniej harmonicznej jest następujący: Przykład: Ważono mleko oddawane przez krowę w kolejnych minutach doju. np. W pierwszej minucie uzyskano 4 kg mleka. a w trzeciej l kg. do obliczania średniej prędkości. jaka była średnia szybkość oddawania mleka: 183 .

Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy. W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną: . Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu.Średnią geometryczną stosuje się wtedy. gdy rozkład zmienności cechy jest asymetryczny. tzn. odbiega od rozkładu normalnego.

3010. 0. Wartość modalna (średnia modalna) jest to wartość cechy. która dzieli szereg uporządkowany malejąco lub rosnąco na połowę. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji. 7.28.. 0. ale podniesione do kwadratu. w celu ułatwienia obliczeń stosuje się wzór roboczy. w którym licznik jest sumą kwadratów odchyleń: Jeśli próbę stanowi mała liczba obserwacji.Przykład: Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych. Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej Biorąc pod uwagę.0697. która najczęściej powtarza się w szeregu liczbowym. czyli 128%.0864.2. natomiast ich suma = 0. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną: Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1. Ma ona miano takie jak analizowana cecha.0414. 0. że najczęściej średnia arytmetyczna nie jest liczbą całkowitą. w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji. Wariancja nie może mieć wartości ujemnej. Miary rozproszenia Podstawowe miary rozproszenia to wariancja.1239.0294. 0. a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie). 0. 185 . Wartość środkowa (mediana) jest to wartość cechy.6518.2. Wartości zlogarytmowane tego współczynnika wyniosły: 0. ale przez N—1. standardowe odchylenie i współczynnik zmienności.

wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji. Wariancja: . Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). Sposób obliczania miar rozproszenia przedstawiono niżej. wykorzystując dane liczbowe zawarte w tabeli 7-1. Dobór zwierząt do grup doświadczalnych powinien być losowy. Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach. a także zmienności tej samej cechy w różnych populacjach (np. np. tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona. Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru: gdzie: Współczynnik zmienności wyraża zmienność w procentach.Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji. dotyczące masy ciała owiec w wieku 10 miesięcy.

Poligeny. warunkujące 7 poziomów nieśności (fenotypów tej cechy). Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej. natomiast zmniejsza się częstość występowania form skrajnych. które skupiają się wokół wartości średniej. uzyskujemy przedstawiony niżej obraz graficzny: 187 . Liczba poligenów kontrolujących cechy ilościowe jest nieznana. Dziedziczenie cech ilościowych Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. Zmienność cech ilościowych 7. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. Założono również. Zagadnienie to obrazuje przykład. nazywane inaczej genami polimerycznymi. że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. że efekty genów A. że nieśność kur warunkowana jest trzema parami alleli z różnych loci. że każdy poligen ma dwa allele.3. mające założenia genetyczne warunkujące nieśność 240 jaj rocznie. natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. Zakłada się. czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. Kolejnym założeniem jest to. specyficznie ze sobą współdziałają.7. czyli obojętne dla wartości cechy. w którym hipotetycznie przyjęto.3. a drugi neutralne. zwiększające wartość cechy). Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny). Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę. przy czym jeden z nich ma działanie pozytywne (tzn. B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. uzyskano 64 genotypy. niosącymi 120 jaj rocznie. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie. Najczęściej występują genotypy warunkujące wartości fenotypowe cechy. pomiędzy którymi zachodzi dziedziczenie pośrednie. Przyjmuje się. że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy. skrzyżowano z kurami o genotypach aabbcc. Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych.1. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc). U potomstwa w pokoleniu F2 nastąpiło rozszczepienie. addytywnymi lub kumulatywnymi. Koguty o genotypach AABBCC.

determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy: W podanym przykładzie celowo pominięto wpływ czynników środowiskowych. • rozkład ten jest symetryczny. że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego. poniżej i powyżej średniej. co w przypadku cech ilościowych o zmienności ciągłej powoduje. a najmniej skrajne wartości. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. gdyż zacierają one różnice między fenotypami. w którym jest średnia wartość cechy. w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej. a oś symetrii przechodzi przez punkt. Rozkład normalny charakteryzuje się tym. iż: • jest to rozkład. Znaczenie tych czynników jest istotne. zwana krzywą Gaussa.Po zestawieniu wartości fenotypowych cechy. 188 .

4% wszystkich obserwacji. Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw. 68. 95. ilości substancji odżywczych dostarczanych płodowi (lub płodom). behawior matczyny). że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia. omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech). 7. Jak już wspomniano. wpływ matki na potomstwo jest większy od wpływu ojcowskiego. na przykład. • w przedziale x ±2 S znajduje się ok. procent tłuszczu w mleku oraz wartość energetyczną mleka. jak i mitochondrialnym DNA. U trzody chlewnej. nawet ras o ustalonym genotypie. maternal effect). Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw. Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów. Mogą one maskować oddziaływanie poligenów.2% wszystkich obserwacji. 99.i postnatalnego zależy od gatunku. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang. rasy. z innych ras). dziedziczenie pozajądrowe. • w przedziale x±S znajduje się ok.• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie. Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np.6% wszystkich obserwacji cechy. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189 .3. są heterozygotyczne pod względem znacznej liczby loci. Zmienność transgresywna Zwierzęta gospodarskie. a także wielu czynników środowiskowych. na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny). • w przedziale x±3 S znajduje się ok. Wielkość efektu matki prę. stwierdzono. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy. Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. wielkości matki oraz jej stanu fizjologicznego i zdrowotnego.2. co wartość średniej arytmetycznej.

quantitative trait locus). E i F są identyczne (D = E = F). której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty. DDEEFF — 4800 kg. genotyp DDEEFF. że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D. bądź wartości wyższe lub niższe niż u rodziców. czyli wykazujące większą zmienność cechy. Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np. warunkujące różną wydajność mleczną. U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25).wartości cechy takie. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna. jakie obserwowano u rodziców. Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. a każdy z nich zwiększa produkcję mleka o 400 kg. Jest to wynikiem dziedziczenia. spłaszczony albo nadmiernie uwypuklony. Gen o dużym efekcie jest identyfikowany wówczas. zwany inaczej genem głównym. Niektóre geny o dużym efekcie zostały wykryte przypadkowo. W przypadku niektórych cech zaobserwowano zmienność. równą wartości cechy u rodziców. E i F. Zjawisko to nosi nazwę transgresji.3. Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej. natomiast heterozygotyczny DdEeFf— 3600 kg mleka. Efekty genów D. gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie. w którym obok poligenów działa gen o dużym efekcie. wykorzystywanej w pracy hodowlanej. Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy. iż zwierzęta homozygotyczne pod względem allelu B hormonu 190 .3. Genotyp ddeeff warunkuje wydajność 2400 kg mleka. 7. Ilustruje je przykład: Załóżmy. W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot). Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. Cechy takie charakteryzują się rozkładem normalnym. Geny o dużym efekcie W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). W badaniach prowadzonych na simentalerach stwierdzono. warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka). growth hormone). Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang.

prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. jak zawartość mięsa w tuszy i powierzchnia oka polędwicy. Badania cytogenetyczne wykazały. jak karłowatość i akromegalia.3. Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną. iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu. 191 . z równoczesnym zmniejszeniem otłuszczenia. Zwierzęta takie są więc dobrym materiałem do tuczu. warunkami termicznymi i niektórymi czynnikami chemicznymi. Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena. W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe. porcine stress syndrome). a IGF-1 wspomaga jego działanie. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni. Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt. a najnowsze osiągnięcia są omówione w rozdziale 12. Świnie U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie. Hormon wzrostu reguluje rozwój mięśni. powodowane transportem. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała. Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka. bydła i szczura. Dalsze badania zmierzają do ustalenia. które allele mają związek z użytkowością mięsną.5. Gen receptora rianodyny (KYR1). Dotychczas wykazano. będących nosicielami zmutowanego allelu. Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych. Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. Stwierdzono także.wzrostu charakteryzowały się o 382 + 18.5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA. Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe).

Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T. powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI). z których najistotniejsza jest mutacja w 1843 nukleotydzie. początkowo oznaczono go symbolem Haln.Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan. natomiast w zmutowanym 192 . W obrębie genu RYR1 stwierdzono 18 mutacji punktowych. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki. jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. co umożliwiło opracowanie molekularnych testów diagnostycznych. fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1). Badania przeprowadzone przez naukowców kanadyjskich wykazały. Procedurę tego testu przedstawiono na rycinie 7-1. W innym. Mutacja ta likwiduje miejsce trawienia niektórymi enzymami. opatentowanym przez badaczy kanadyjskich.

warunkuje cechę kwaśnego mięsa. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19. W genie tym stwierdzono siedem mutacji. W pracy hodowlanej należy prowadzić kojarzenia tak. 49 pz. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3). Gen wpływający na wielkość miotu (ESR). natomiast dla heterozygoty trzy prążki: 81 pz. 32 pz. dla homozygotycznego (nn) . Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1.4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. że enzym nie znajduje miejsca cięcia. powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym.. Wyniki tych badań wskazują. Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy. Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością. prowadzone u świń innych ras (niemiecka landrace. a u koni w 10 chromosomie. występujący w chińskiej plennej rasie meishan. Pierwsze sugestie co do istnienia genu o dużym efekcie.jeden prążek długości 81 pz. że jeden z alleli tego genu. ale tylko tranzycja G-»A w kodonie 200. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz. U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce).5-2. Stwierdzono. czego wynikiem jest uzyskanie nie strawionego fragmentu genu. by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. estrogen receptor gene) może mieć istotny wpływ na wielkość miotu. iż zlokalizowany w chromosomie l (1p2. Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi. pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie 193 .4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang. yorkshire. Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu. Test molekularny wykrywający mutację genu PRKAG3 został opatentowany.allelu zmiana tej sekwencji powoduje. u bydła w 18. wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. duroc). wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę.

Gen κ-kazeiny. Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. wpływa na wydajność mleka i jego składników. Bydło Geny białek mleka. podczas gdy w wariancie B — treonina (w DNA kodon ACC). W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC). Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT). jak wzrost i grubość słoniny na grzbiecie. Gen β-laktoglobuliny uważany jest za gen o dużym efekcie. Białko wariantu A różni się od B dwoma aminokwasami. utrzymywanych w zakładach unasieniania. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. zawiera 7 eksonów. Gen ten nie wykazuje plejotropowego negatywnego działania na inne. tłuszczu i kazein oraz lepszą przydatnością technologiczną. wykorzystywanych jako dodatkowe kryterium selekcji buhajów. Opracowana została metoda identyfikacji genotypów κ-kazeiny. 7-2). wariant A alaninę (GCT). identyfikowanych w mleku córek. Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń. Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII. gdyż określony wariant tego białka. Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny. wyprowadzanych z udziałem rasy meishan. przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. zlokalizowany w chromosomie 6. ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. białka i tłuszczu). Gen β-laktoglobuliny ma długość około 7800 par zasad.1754). Jest to konsekwencja różnic w sekwencji nukleo- 194 . Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy. ekonomicznie ważne cechy. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. podobnie jak κ-kazeiny. natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć.

b — produkt nie strawiony. l — trawienie enzymem restrykcyjnym Hinfi. Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem. Gen hipertrofii mięśniowej (MH — ang. transforming growth factor β). Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa. Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne. Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2. jak i ich mieszańców. Duża masa płodu stwarza wyraźne trudności naturalnego porodu. jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). dlatego mutacja ta jest oznaczona jako nt821(del11). 7-2. Gen miostatyny należy do rodziny TGFβ (ang. natomiast u krów dłuższa ciąża. muscular hypertrophy). spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej. mniejszy obwód i masa jąder. a — marker. Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras. zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi. Rozwiązaniem 195 .AB AA BB Ryć. 2 — trawienie enzymem restrykcyjnym Hindlll tydowej obu alleli. Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci.

cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. nazwany callipyge (z greckiego calli — piękne. Przypuszcza się. która jest odpowiedzialna za substytucję cysteiny przez tyrozynę.symbol CLPG. c) transwersja G → T w nukleotydzie 676. Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). Pomimo ujemnych następstw związanych z hipertrofią mięśni. noncoding RNA). b) tranzycja C→T w 610 nukleotydzie. w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego. pyge -. mutacje te są charakterystyczne dla określonych ras bydła mięsnego. że locus ten podlega transkrypcji. takie jak gen Inverdale (FecXI. Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. U owiec występuje mutacja powodująca hipertrofię mięśniową. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. Jak wykazały ostatnie badania. które uszkadzają funkcję kodowanego białka.pośladki) -. że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. Jest to pojedynczy autosomalny gen. Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. Ostatnio ustalono. Owce Gen hipertrofii mięśniowej (CLPG). Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. czy od matki. Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji. 7-3 wkładka kolorowa). który pełni nieznaną jeszcze funkcję regulacyjną. czy gen CLPG pochodzi od ojca. natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. U owiec wykryto geny główne. która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy. Gen CLPG pochodzący od matki jest nieaktywny. przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia. Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938. Co ciekawe.ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. Przypuszcza się. począwszy od pozycji 419 nukleotydu. gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). Mutacje a) i c) występują u bydła francuskiego maine-anjou. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów. a jego produkt to niekodujący RNA (ncRNA ang. że istnieją dwa allele — CLPG i clpg. zlokalizowany w chromosomie płci X) 196 . Hipertrofia ujawnia się u potomka wówczas. Prowadzone są badania w celu jego izolacji. warunkujące zwiększony stopień owulacji.

Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB. Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie). u których zwiększona plenność jest cechą poligeniczną. W locus BMPR-IB wykryto mutację w 830 nukleotydzie. Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. odpowiedzialnej za dużą plenność owiec rasy merynos booroola. będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego. wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II). owca fińska). Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to. zawierającego miejsce mutacyjne. trzy prążki (110 pz. której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego. polegającą na tranzycji adeniny na guaninę. że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. „Thoka" u owiec islandskich. 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz.u owiec rasy romney. ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang. uwarunkowaną genami o addytywnym efekcie. Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80. . W przeciwieństwie do owiec ras wysokopiennych (owca romanowska. fecundity gene of booroola). produkt PCR nie strawiony) dla homozygoty typu dzikiego. Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB. gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych.

Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową. Hodowla jest działalnością genetyczno-populacyjną. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów. teoretycznie nieskończona liczba osobników. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej. mimo iż dotyczyły nieraz grupy zwierząt. lecz zbiorowości określonej jako populacja.H. Weinberga. jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G. Rozpatrując daną cechę można powiedzieć.Rozdział Podstawy genetyki populacji Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia. Hardy'ego i niemieckego lekarza W. tak więc w populacji występuje określona liczba fenotypów. Ponieważ badacze ci działali niezależnie od siebie. w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki.1. Populację stanowią zwierzęta należące do jednego gatunku. że każdy osobnik ma określony fenotyp. prawo to nosi nazwę Hardy' ego-Weinberga. Podstawowym prawem genetyki populacji. Prawo równowagi genetycznej Struktura genetyczna populacji Populację tworzy określona. 8. mogące się rozmnażać i występować na danym obszarze. 198 . Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników.

Sposób postępowania obrazuje poniższy przykład. Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów. Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci.z których każdy reprezentowany jest przez pewną liczbę osobników. które ten allel mógłby zająć w badanej populacji. Zatem w stadzie tym jest 1000 alleli A i 1000 a. natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. inaczej frekwencja danego fenotypu. Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca: Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków. Suma frekwencji obu alleli wynosi l (100%). Częstość występowania (frekwencja) allelu A = 1000/2000 = 0. Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. Częstość występowania. Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów.5 (50%). Suma frekwencji wszystkich fenotypów równa się l lub 100%. W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych. to: 199 . 250 ptaków czarnych ma w swych genotypach 500 genów A.5 (50%). ptaki niebieskie mają 500 genów A i 500 genów a. Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego. Oba te elementy są od siebie zależne. podobnie frekwencja allelu a = 1000/2000 = 0. W genotypach 250 ptaków białych jest 500 alleli a. a allelu recesywnego symbolem q. każdy ma dwa allele). Jeśli frekwencję allelu dominującego oznaczymy symbolem p. 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim).

jeśli nie działają czynniki naruszające równowagę. wówczas struktura genetyczna w pokoleniu potomnym będzie następująca: czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie. które mówi o tym. Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga. bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna. w której frekwencje genów u obu płci są jednakowe. O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej. że: w dużej. Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci. losowo kojarzącej się populacji. które wpływają na zmianę struktury genetycznej populacji.Rozpatrywana cecha dziedziczy się z niezupełną dominacją. zatem rozkład fenotypów i genotypów w tej populacji wynosi: Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). a' zdarzają się również migracje i mutacje. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci. 200 . a osobniki charakteryzują się równą płodnością i żywotnością.

że zawierają jedynie allele recesywne.3 = 0. że frekwencja homozygot recesywnych wynosi q2. Zatem obliczanie frekwencji zarówno tych genotypów. łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q. Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q. a 90 czerwonych. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych.3. jak i genów stwarza pewne trudności. Frekwencja genów i genotypów w przypadku dominowania W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. 8.2.(EdEd) lub heterozygotyczne (Ede). Wiedząc. Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej. Pozostałe 910 krów ma genotypy homo.8.09. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych. gdyż w ich przypadku wiadomo na pewno. że w przypadku losowych kojarzeń rozkład genotypów jest następujący: łatwo jest obliczyć frekwencję pozostałych genotypów: W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot. W stadzie tym prowadzone są kojarzenia losowe. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0. która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0. Wiedząc.7. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący: 201 .

himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc). 13 himalajskich i 2 albinosy.przy czym p. Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli. genotypy i ich frekwencja są następujące (tab. U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C. 8-1): 202 . Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). w której są kojarzenia losowe. r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa). q dla genu dla genu c. W populacji tej. Frekwencja poszczególnych fenotypów wynosi zatem: Frekwencję genów oznaczono symbolem p dla genu C.q. fenotypy.

znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc).Po dodaniu takich samych genotypów uzyska się rozkład: Z zestawienia tego wynika.013. Frekwencję genu można obliczyć następująco: W badanej populacji królików frekwencja genów umaszczenia jest więc następująca: 203 . Podstawiając dane liczbowe. że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi: Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego. (q + r) równa się: Frekwencję genu c = r można obliczyć.114. stąd r = = 0. W danym przykładzie r2 = 0.

Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym. czyli zgodna z rozkładem dwumianowym.ogółem = 1. U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm. Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych. Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu. natomiast a — jego recesywnym allelem. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet. który ją warunkuje). U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). których liczba w genotypach jest jednakowa bez względu na płeć osobnika. geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej.4. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0. jak i u mężczyzn. lecz przyjmie postać: przy czym A jest genem dominującym.08.000 8. U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi: U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu: 204 .

ale będą nosicielkami genu daltonizmu (Dd). Ekspresja fenotypowa mutacji.= p = 0. jego frekwencja zmaleje o wartość równą up. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus. Wszystkie te czynniki. pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD).D. 8. w której mutacja wystąpiła. z wyjątkiem doboru. Analogicznie. mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji. 1472 kobiety będą rozróżniały barwy. selekcja. W rozdziale dotyczącym mutacji podano. umaszczenie zwierząt futerkowych.5. wpływają na zmianę frekwencji genów i genotypów. Jeśli zmutuje jeden z genów addytywnych. może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji. o tyle pozostałe czynniki są związane z jego świadomą działalnością. Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie: 205 . Czynniki naruszające równowagę genetyczną Do czynników naruszających równowagę genetyczną populacji należą: mutacje. Jeśli zmutuje allel dominujący. Natomiast mutacja genu warunkującego cechę jakościową. ale także mogą się pojawić nowe allele. W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ). dobór par do kojarzeń i dryf genetyczny. np. Mutacje Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. która może wpłynąć na zmianę struktury genetycznej populacji. powodująca pojawienie się nowej barwy okrywy włosowej. pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ).92 d. O ile mutacje i dryf genetyczny nie zależą od hodowcy. zależy od genetycznego uwarunkowania danej cechy.= q = 0.08 Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej). Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. natomiast częstość mutacji odwrotnej symbolem v. kontrolujących cechę ilościową. migracje. iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u. mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq.

W wyniku mutacji genowej. Migracje Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu. Natomiast krzyżowanie uszlachetniające. natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0. w przypadku wielokrotnego krzyżowania. krzyżowanie wypierające). Przy krzyżowaniu różnych ras w zależności od tego. ile razy dokonywane jest to krzyżowanie. czyli ustali się nowy układ genetyczny. Zmianie uległa także frekwencja genotypów. ee = q2 = 0.4356. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0.Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0. W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja.4488. allelu czerwonego umaszczenia e = q = 0. doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw.7. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia. Jeśli jest to zabieg jednorazowy. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji. ee = q = 0. i wyniosła 0. po pewnym czasie populacja wróci do równowagi.66.34.42. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0. może ona dotyczyć wprowadzania nasienia. Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji) 206 .49.1156.14 alleli Ed zmutowało w kierunku allelu e. wielkość zmian frekwencji genów i genotypów jest różna. po mutacji: EdEd = p2 = 0. które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną. Może nawet. powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. Ede = 2pq = 0. a 6 alleli e w kierunku allelu Ed.1.09.3. Ede = 2pq = 0. zatem migracja nie zawsze wiąże się z wprowadzaniem osobników.

7.5476. obniżenia płodności i produkcyjności lub niepożądanego genotypu. zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy. nazywany jest selekcją. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej.7 = 0.49. że do omawianego wcześniej stada liczącego 100 krów. Zmiany w strukturze genetycznej populacji zależą od tego.74 czyli wzrosła o 0.oznaczymy literą m.9 + (l -0.3848. wprowadzono 20 krów.81.18. ee = q = 0. Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku. ee = q= 0. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji. E'e = 2pq = 0. 207 .9.4. Hodowca preferuje geny korzystne. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0.42. z frekwencją allelu Ed wynoszącą 0. w którym frekwencja allelu Ed wynosiła 0.09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0.0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd. Ede = 2pq = 0. Selekcja Wybór zwierząt. a frekwencję genu u osobników wprowadzonych do stada literą p'.2 • 0. zmalała osobników heterozygotycznyh Ede i homozygotycznych ee.26. E d e = 2pq = 0. które hodowca zamierza pozostawić do hodowli. Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0. ee = q2 = 0. Nowa frekwencja allelu e wynosi (1 — 0. to część osobników rodzimych będzie równa (1 —m). jakie geny czy genotypy są preferowane.01. a eliminuje z populacji zwierząt geny niepożądane.2) • 0. stanu zdrowotnego.74) = 0.

W pewnym stadzie. wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. Dobór par do kojarzeń W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe. że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. będąca konsekwencją selekcji. Cecha ta dziedziczy się z dominacją zupełną. Zmiana frekwencji genu. gdy usuwane są wszystkie niepożądane genotypy.187. Jeśli współczynnik selekcji będzie wynosić 0. czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled). Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji.4. można obliczyć ze Jeśli natomiast selekcja preferuje genotyp recesywny. że w omawianym już wcześniej stadzie kur andaluzyjskich. Współczynnik ten może przybierać wartość od O do l. Załóżmy. będącą jej konsekwencją. zastosowano kojarzenia w obrębie takich samych 208 . złożonym z 1000 ptaków. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie.013 i wyniesie 0. że wartość O jest wówczas. to oznacza. zależy od rodzaju tej selekcji.8. zmianę częstości genu recesywnego. wówczas frekwencja genu tworzącego ten genotyp wyniesie: wzoru: Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną.Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. co oznacza. w którym frekwencja allelu bezrożności wynosi 0. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego: Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0. gdy nie ma w ogóle selekcji. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym. prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. wartość l współczynnik osiąga. Efekt selekcji zostanie zachowany.

na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji.25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie Frekwencja genów pozostała nie zmieniona. Odwrotna sytuacja zaistniałaby. Niekiedy. W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej 209 . gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami. stosowane są kojarzenia osobników spokrewnionych. Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt.5 Aa + 0. ojca z córką czy matki z synem. Oznacza to. maleje natomiast częstość genotypów heterozygotycznych. Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych. koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi.25 AA + 0. iż kojarzono koguty czarne z kurami czarnymi.5 (allel A) i q = 0. np. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych. Aby się o tym przekonać. W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0.genotypów. można przeprowadzić obliczenia: Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji.5 (allel a). stado powróci do stanu równowagi genetycznej. W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0.

Biorąc pod uwagę. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać. którego skutkiem będzie zmniejszenie płodności.6. Jeśli było to jednorazowe zaburzenie. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. zjawisko tak nazwane przez Wrighta w 1931 roku. to w następnym pokoleniu ustali się nowa równowaga genetyczna. w których stopień homozygotyczności jest bliski 100%. Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać.brat x siostra) prowadzą do wytworzenia tzw. Może jednak się zdarzyć tak. żywotności czy ujawnienie się wad dziedzicznych. Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. zwłaszcza w małych populacjach. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych. Szczepy wsobne są wykorzystywane w badaniach biomedycznych. Dryf genetyczny Dryf genetyczny. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego. tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210 . 8. jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt. w której frekwencja genu dominującego wyraźnie wzrośnie. szczepów wsobnych. szczególnie niebezpieczny może być wzrost homozygot recesywnych. iż w potomstwie uzyskamy 5 osobników homozygot dominujących. Im większa jest pula genów w jakiejś populacji. polega na zmianie frekwencji genów i genotypów w małych populacjach. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach. w których działa on najsilniej. 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus. iż allele niekorzystne z reguły są recesywne. że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych.

albuminy. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych. może dojść do znacznego ograniczenia puli genów. zalecane jest monitorowanie zmian w strukturze genetycznej populacji. By temu niekorzystnemu zjawisku zapobiec. które zachodzą w wyniku pracy hodowlanej. amylazy. należące do markerów genetycznych klasy I. opisanych w rozdziale: Markery genetyczne. czego wynikiem będzie utrata zdolności adaptacyjnych. zwłaszcza w małych populacjach. Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru: 211 . różne typy białek surowicy krwi czy enzymy erytrocytarne. czyli markery genetyczne klasy II). Mogą to być loci kontrolujące syntezę transferyny. esterazy. Na skutek długotrwałej selekcji.wych. Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini.i mikrosatelitarny. można także przedstawiać ją w procentach. ceruloplazminy czy anhydrazy węglanowej. na przykład warunkujących antygeny erytrocytarne. Wartość tego parametru zawiera się w granicach od O do l.

które cechuje duża zmienność genetyczna. polymorphic Information content). należy znać frekwencję wszystkich alleli w danym locus: Dystans genetyczny Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Szacowanie dystansu genetycznego i wybór ras. By obliczyć wartość PIĆ. Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci. najczęściej stosowany jest wzór: Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów. najdalszego sąsiedztwa — CLM (ang. obliczonych różnymi metodami.Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. complete linkage method) lub skupienia parami — UPGM (ang. tak na podstawie polimorfizmu sekwencji mikrosatelitarnych. Do szacowania dystansu genetycznego (Dr). single linkage method). unweighted pair group method). a także między populacjami w obrębie gatunku. Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi. 212 . na przykład: najbliższego sąsiedztwa — SLM (ang. jak i polimorfizmu białek i antygenów erytrocytarnych. dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. O markerach genetycznych jest mowa w innym rozdziale.

37 (ryć. Prace i Materiały Zootechniczne. 369 z linii Probata. 50:111-120. 146 z linii Partnera i 202 z linii Bandosa. Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM. 150 z linii Banata. 8-1).39 oraz Palasa a Partnera 0. 213 . 1997). Analizą objęto 141 koni z linii El Paso. najmniejszy między linią Celebesa a Probata.Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp. Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa. Palasa a Partnera.. Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III. wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0. 146 z linii Celebesa. 219 z linii Palasa.32. a także między linią Banata a Celebesa i Probata. Partnera a Banata 0. Na przykład. Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych.

.

ang. odcisk palca DNA.Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne). że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA. W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej. a także metodę RAPD. band sharing). Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS . określający prawdopodobieństwo. W wyniku analizy polimorfizmu minisatelitarnego (tzw. . wykorzystując wzór: gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1. Im mniejsza zmienność genetyczna w danej populacji. tym większa wartość tego współczynnika. opisaną w rozdziale: Metody analizy i modyfikacji genomu. opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji).

Ten typ determinacji płci obserwuje się u wielu gatunków gadów. behawioralna determinacji płci. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. a płcią homogametyczną są samice (układ XX). mają gonady męskie i żeńskie. w tym u wszystkich krokodyli. płeć chromosomowa. U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ). które są hermafrodytami sekwencyjnymi.1. wielu gatunków żółwi i niektórych gatunków jaszczurek. Zwierzęta takie są zazwyczaj obojnakami. a w przypadku ptaków Z oraz W. Wśród ryb spotyka się również gatunki. Determinacja płci ssaków Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw.Rozdział 9 Determinacja i różnicowanie płci oraz interseksualizm Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów. 9. a samice heterogametyczne (układ Z W). Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie. w jakich rozwijają się zarodki. U ssaków płcią heterogametyczną są samce (układ XY). W przypadku ssaków wyróżnia się chromosomy X oraz Y. a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. Z kolei u niektórych gatunków ryb zachodzi tzw. głównie temperatury. Płeć może zależeć od warunków środowiska zewnętrznego. 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. płci gonadowej i 3) uformowanie się wewnętrznych 216 . czyli zmieniają one płeć w ciągu życia. U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci. tzn.

i zewnętrznych cech płciowych — powstanie tzw. a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. Pojawiają się one w endodermie pęcherzyka żółtkowego. 217 . Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym. które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego. Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. Pleć fenotypowa obejmuje również zmiany powstające w mózgu. 9-1). pici fenotypowej (ryć. W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe.

palce cynkowe. Od końca lat 50. czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. a w tym: WT1. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. Produkt tego genu miał odpowiadać za tzw. Gen ten podlega ekspresji. że jest tam zlokalizowany gen TDF (ang. Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. że funkcja tego genu jest tożsama z funkcją genu SRY (ang. podobnie jak białko SRY. polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej. Wiadomo o nich. Fgf9. high mobility group). oprócz kory nadnerczy. także w niezróżnicowanej gonadzie. regulującego ekspresję hydroksylaz steroidowych. Gen SF1 (ang. sex determining region Y). W rosnącej gonadzie wyróżnia się część korową i rdzeniową. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. Białko kodowane przez ten gen składa się z trzech regionów (ryć. że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów. testis determining factor) — czynnik determinujący jądro. SOX9. gdzie obserwuje się zanik jego ekspresji. Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. 9-2). W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9. Badania molekularne pokazały. Gen WT2 (ang. które pełni rolę czynnika transkrypcyjnego. do grupy białek określanych skrótem HMG (ang.Dotychczasowe badania wykazały. ZFX i FOXL2. W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi. Produktem tego genu jest białko zawierające tzw. którego locus występuje w chromosomie Y. 218 . że pełnią funkcję czynników transkrypcyjnych. którego produkt należy. a część korowa w jajniku. SF1. w przeciwieństwie do jajnika. steroidogenic factor 1) koduje białko receptora jądrowego. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra. SRY. przełączenie rozwojowe. wiadomo było. Badania cytogenetyczne prowadzone u ludzi dowiodły. Przyjęto. że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y.

Początkowo przypuszczano. wysepka CpG). które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne. Kaskadowe włączanie tych genów. Gdy gen SRY jest nieobecny. gen palca cynkowego). Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. a z przewodów Miillera — jajowody i macica. że jego locus występuje w chromosomie X. tak jak białka WT1 i SOX9. W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu 219 . Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. Bardziej szczegółowe dane wskazują. że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. anti-Mullerian hormone — AMH). Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. również położonemu w chromosomie X. oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). a jego produktem jest jądrowy receptor dla hormonów. że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego.Region środkowy. czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. Z przewodów Wolffa rozwinąć się mogą nasieniowody. omówiony wcześniej. składający się z 79 aminokwasów. Bardzo ciekawe jest również to. który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. Białko SRY. odpowiada za prawidłowe różnicowanie się gonady męskiej. Obecnie większą rolę przypisuje się genowi ZFX (tzw. a drugi rozwija się. który podtrzymuje rozwój przewodów Wolffa. ma strukturę podobną do białek z grupy HMG. Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej). Miillerian inhibitor substance). w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. Ekspresja tego genu zachodzi w komórkach Sertolego. pełni funkcję czynnika transkrypcyjnego. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza. w momencie kiedy rozpoczyna się proces formowania gonady męskiej. po pojawieniu się produktu genu SRY. Wiadomo. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron. niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik. a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9). że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9. Z testosteronu powstaje dihydrotestosteron. określanego także jako hormon antymiillerowski (ang. aniżeli w odniesieniu do jądra.

to rozwój w kierunku męskim nie jest zakłócony. 220 . Jego nazwa pochodzi od słów angielskich azoospermia factor. W regionie tym występują geny. czy też klonowania. to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y. Szczególnie istotną częścią chromosomu Y jest region AZF. że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. np. RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. występują także inne geny. U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. Należy również zwrócić uwagę. Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY. splicing) mRNA. gen RBM (ang. w których genotypie występuje duplikacja locus DSS (DAX1). Jeśli w genotypie wystąpi delecja tego locus. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1).kodującego testosteron. który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro). W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody. oznaczających czynnik odpowiedzialny za powstanie azoospermii. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. czyli brak plemników w ejakulacie. samic biorczyń. jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. macicę i górną część pochwy. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). Gen ten umiejscowiony jest w obu chromosomach płci. gen Ube1Y (ang. takich jak całkowity brak spermatogoniów. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci. lub do zahamowania podziału mejotycznego. np. Znane są też geny położone w innych częściach chromosomu Y. że w chromosomie Y poza genem SRY. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X. Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy. Zakłada się. których ekspresja związana jest z przebiegiem spermatogenezy. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa.

W rozwoju embrionalnym różnicowanie się jąder poprzedza okres. to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci 221 . w którym kształtują się jajniki.ubiąuitin activating enzyme-1). który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach. to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony. Jeśli połączenie łożysk dotyczy płodów różnopłciowych. Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy. często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy. 9. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski. frymartynizm). Interseksualizm Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego. co w konsekwencji prowadzi prawie zawsze do niepłodności. Połączenie krwiobiegów bliźniąt różnopłciowych sprawia. co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników. Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów. niż to wcześniej zakładano. które określa się terminem interseksualizmu lub obojnactwa. że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu.2. Z przedstawionych wyżej informacji można wyciągnąć wniosek. że informacja genetyczna zawarta w chromosomie Y jest bogatsza. kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian. Frymartynizm Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych. ze względu na bardzo duże zróżnicownie obserwowanych zmian. w którym powstały połączenia naczyniowe. Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego. głównie przeżuwaczy.

Okazuje się. zależnie od 222 . Znacznie rzadziej zdarza się to u owiec (od l do 10%. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. sekwencje mikrosatelitarne). Identyfikacja sekwencji typowych dla chromosomu Y (np. ale także molekularnych (np. polegające na ustaleniu zestawu chromosomów płci w leukocytach. w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę. Bardzo pomocne okazało się badanie cytogenetyczne. a często u owiec (od 40 do blisko 100% ciąż. proces kształtowania się zewnętrznych narządów płciowych. wskaźnik niepowtarzalności rui itp. że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy. których łożyska są połączone anastomozami. że rozwinie się nawet gonada męska. to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. Szacuje się. szczególnie wówczas. Chimeryzm dotyczy również erytrocytów. może być wskazówką. Ze względu na wspólną cyrkulację krwi u płodów. Powstawanie anastomoz jest bardzo często stwierdzane u bydła. a drugiej współbłiźniaka. chociaż parametry określające ich przydatność rozpłodową (np. że badany osobnik jest frymartynem. stwierdza się niepłodność samic frymartynów. stwierdza się obecność dwóch linii komórkowych — jednej własnej.) są często obniżone. Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo. dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż). Ponieważ linie te pochodzą od dwóch różnych genotypów. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych. Z tego powodu we krwi frymartynów. a także samców będących bliźniętami frymartynów. przy jednoczesnym ich braku np. może zakłócić. Buhaje takie mogą być wykorzystywane w rozrodzie. a w drugiej układ XY. a w ślad za tym drogi płciowe będą miały charakter męski. Wówczas dihydrotestosteron.żeńskiej w takim stopniu. w komórkach błony śluzowej. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy. w mniejszym lub większym zakresie. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych. gdy zewnętrzne narządy płciowe są prawidłowo uformowane. że prawie we wszystkich przypadkach. że badania kliniczne samic są niewystarczające. dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie. niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych. Trzeba podkreślić. powstający z wydzielanego przez komórki Leydiga testosteronu. obraz nasienia. Linie te różnią się układem chromosomów płci — w jednej występuje układ XX. zależnie od rasy). Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany. Możliwe jest również powstanie połączeń. a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. Biorąc jednak pod uwagę.

U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera. w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie. a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych. Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie. Kilkanaście takich przypadków opisano u buhajów. niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. Konsekwencją występowania 223 . Mutacje chromosomów płci Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. co oczywiście prowadziło do bezpłodności. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych. w które są zaangażowane chromosomy płci. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad. Z drugiej strony ważną rolę odgrywają mutacje strukturalne. miały niedorozwinięte jądra.rasy). w zakresie od 0. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. Charakteryzowały się one gorszym tempem wzrostu.5% (bydło) do kilku procent (niektóre rasy owiec. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. XYY lub XXX). wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY. Z badań przeprowadzonych na owcach wynika. Zespół niewrażliwości na androgeny Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). Z jednej strony mogą to być aneuploidie. merynos booroola). np. Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy. które są fenotypowo prawidłowo rozwinięte. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY.

W genotypie tych zwierząt nie ma genu SRY. Najczęściej zespół ten diagnozowany jest u fenotypowych samic. które mają układ chromosomów płci XX. a stopień 224 . STS). Taki typ odwrócenia płci spotykany jest również u kóz. Przyczyny takiego stanu mogą być różne. Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane. z wykorzystaniem techniki PCR. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte. Bezrożność kóz uwarunkowana jest przez dominujący allel P. a w ich genotypie nie stwierdza się genu SRY. przy jednoczesnym braku kluczowego genu SRY. sex reversal). w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego. a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. Interseksualizm bezrogich kóz Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz. a wśród nich należy wymienić: mutację w locus SRY (np. przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem. ZFY. który uznawany jest za niezbędny do rozwoju gonady męskiej. co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim. a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp. częściowa lub całkowita delecja). U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX. Badania molekularne genów położonych w chromosomie Y. że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze. Okazało się. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder. Zespół odwróconej płci u koni W hodowli koni częstym typem interseksualizmu jest tzw. tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych. Osobniki takie powinny być samicami. od prawie typowo samczych do samiczych. jak i wewnętrznych cech płciowych.nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu. które mają układ chromosomów XY. zespół odwróconej płci (ang. Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. który polega na niezgodności między płcią fenotypową i chromosomową. chociaż zdarzają się zwierzęta z powiększoną łechtaczką. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie. ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL. świń i psów. ale z powiększoną łechtaczką.

Choroba białych jałowic Innym przykładem genu o działaniu plejotropowym. natomiast jajniki są rozwinięte prawidłowo. Zespół tych zmian jest określany jako choroba białych jałowic 225 . Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. że jest on położony w chromosomie l — w części dystalnej. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe. a rzadko jajnikojądra. co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym). szyjki macicy i macicy. jest allel R genu Roan (umaszczenie dereszowate) u bydła. ukończono wieloletnie badania.nasilenia tych zmian jest bardzo zróżnicowany. które mają zdecydowanie samczy fenotyp. Z badań porównawczych wiadomo. Allele te prezentują typ dziedziczenia pośredniego. Wreszcie mogą występować również osobniki. również w zakresie układu loci w chromosomach. Allel R odpowiada za powstanie białego umaszczenia. tzn. że odpowiedzialna za to jest delecja 11 700 par zasad. Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym. Zaburzenia te polegają na braku lub niedorozwoju pochwy. allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). W 2001 r. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm. zlokalizowana w niekodującym fragmencie DNA. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. a w ich genotypie występuje gen SRY. że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. gen PIS — ang. który jest odpowiedzialny za rozwój interseksualny. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej. polledness and intersexuality syndrome). Co więcej należy podkreślić. z tym jednak że genotyp Rr+ wykazuje niepełną penetrację. że kariotypy obu gatunków są prawie identyczne. Okazało się. że locus genu bezrożności bydła został umiejscowiony również w chromosomie l. ale w części proksymalnej (w pobliżu centromeru). W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono. czyli mających układ chromosomów płci XY. Można z tego wyciągnąć wniosek. których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek. Gonady zazwyczaj mają strukturę jądra. że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. U obu ras bydła stwierdzono. Ciekawe jest.

XX. bowiem ponad 90% chorych jałówek ma umaszczenie białe.(ang. Dotychczasowe obserwacje dowodzą. Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38. Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym. . a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny. z tym jednak że łechtaczka była bardzo powiększona. a srom tworzył z odbytem wspólny otwór (ryć. że choroba białych jałowic ma złożone podłoże. że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38. Zakłada się. pomimo nieobecności genu SRY. Sytuacja taka wskazuje. gdzie gonady mają strukturę jądra lub jajnikojądra. a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. pomimo braku genu SRY w ich genotypie. Można natomiast przypuszczać. U zwierząt tych stwierdzano obecność jąder. macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich. Wśród nich niejednokrotnie zdarzają się przypadki. w których kariotypie występowały dwa chromosomy X. Locus tego genu został wcześniej zmapowany w regionie. w którym ostatnio umiejscowiono locus genu Roan. 9-3 wkładka kolorowa). który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm. white heifer disease). W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej.XY. że powstanie gonady męskiej może nastąpić pomimo braku genu SRY.XX/38. Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła. Badania chromosomowe wykazują. Przypuszcza się. że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. Tło genetyczne tych przypadków jest słabo poznane. w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe.3%. Interseksualizm u świń Przypadki interseksualizmu u świń obserwuje się z częstością około 0. że genem roan może być gen kodujący czynnik wzrostu komórek tucznych. a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny). W potomstwie jednego knura pojawiło się kilkanaście obojnaków. że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego.

Są one elementem odporności swoistej (nabytej. po 50 kDa każdy. Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał. heavy — H).1.delta. mimo że ma tylko pięć klas przeciwciał. iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje..Rozdział 10 Genetyczne podstawy odporności i oporności Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego. czyli przeciwciała. α . 10. o masie po 25 kDa.epsilon. usunięcie tych obcych białek. Jest pięć typów łańcuchów ciężkich (gr. zapamiętywania..gamma 227 . Ma on. light — L). γ .. reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm. wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato. ε . podobnie jak układ nerwowy. adaptatywnej). Genetyczne podłoże różnorodności przeciwciał Immunoglobuliny. Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. Zastanawiające jest.alfa. jakim jest główny układ zgodności tkankowej.. są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. której celem jest zwalczenie. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). bakterii czy wirusów). połączonych z dwoma łańcuchami lekkimi (ang. zdolność uczenia się. Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna. δ . ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np.

Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA.i μ . IgG i IgM. Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin. region zawiasowy (ang. między domeną CH1 i CH2. których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. HV2 i HV3. jak i lekkie mają części zmienne (ang. D. do łańcucha λ zależy od gatunku (np. w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie. W części stałej łańcucha ciężkiego. u myszy l: 20. iż informacja genetyczna 228 . nazywane są także regionami determinującymi dopasowanie (ang. Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku. IgE. constant — C). u koni l: 25). variable — V) oraz części stałe (ang. Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi. oznaczone HV1. znajduje się tzw. natomiast A. complementarity determining regions CDR). u ludzi wynosi on 70:30. które mają łańcuch lekki typu κ. a wzdłuż jej ramion znajdują się łańcuchy lekkie. 10-1). hinge region). W części zmiennej znajdują się trzy regiony hiperzmienne (ang. — lambda).mi) i dwa typy lekkich (κ— kappa i λ. G i M od symboli łańcuchów ciężkich. Badacz ten odkrył. Przeciwciało ma kształt litery Y (ryć. utworzonej przez łańcuchy ciężkie. IgD. E. Zarówno łańcuchy ciężkie. Ponieważ regiony te determinują swoistość przeciwciał. hypervariable). Stosunek przeciwciał..

a nie na jego powinowactwo do antygenu. Proces syntezy przeciwciała następuje po skompletowaniu genów. Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt. natomiast geny łańcucha lekkiego typu κ w 2. natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A. jest głównym źródłem różnorodności przeciwciał. J i C. 10-2). Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów. variable) i J (ang. Geny determinujące region C różnią się od pozostałych tym. 229 . natomiast łańcucha ciężkiego przez trzy geny: V. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. może kilkaset). Różnorodność przeciwciał wynika z wielu przyczyn. diversity) i J. które nazwał segmentami. D (ang. ich swoistość wynikają z tego. przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V. że wpływają na funkcję przeciwciała. u myszy natomiast odpowiednio w chromosomach 2. kilkadziesiąt genów D i kilka genów J.. Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie. iż dziedziczone są nie całe geny immunogłobulinowe. czyli połączeniu się segmentów po jednym z każdej grupy minigenów. 6 genów funkcjonalnych i 3 pseudogeny regionu J. ] i C. następnie z genem V. dla lekkiego — kilka. Rekombinacyjne łączenie się genów. D. ale ich segmenty. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen.immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów". powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V. zachodzące dzięki aktywności enzymu — rekombinazy. Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla. joining). typu λ w 22 chromosomie. a łańcuchów lekkich z rekombinacji regionów V. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang. których kolejność łączenia się jest następująca: gen D z genem J. Różnorodność przeciwciał. 6 i 16. Część stała obu rodzajów łańcuchów jest kodowana przez gen C. Przypuszczalnie jest wiele genów kodujących region V.

przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego. bądź też usuwane (do około 20 nukleotydów). insercje lub konwersje. tym samym liczba wariantów genu D] może być zwiększona około 10 razy. Najczęściej są to mutacje punktowe. Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). prowadzi to do zmienności na złączach i utworzenia nowego genu. Ponieważ są to nowo powstałe odcinki DNA.2. 10. atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T). Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu). rzadziej natomiast delecje. powodujące zmianę pojedynczego aminokwasu.Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J. które razem stanowią przeciwciało. Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu. Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego. natomiast genu VDJ następne 10 razy. oraz odpowiedzi typu humoralnego 230 . V-D i D-J) mogą być wstawiane nukleotydy (od l do 15). Genetyczne podłoże różnorodności receptorów limfocytów J W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B. będące specyficznym receptorem tego limfocytu.

3. D i J (łańcuchy p i §). zachodzi podobnie jak rekombinacja genów przeciwciał. przez Petera Gorera poszukiwania innych antygenów grupowych krwi. że wszystkie elementy genów są włączone w rearanżacje. Badania polegające na przeszczepach skórnych 231 . liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. Podobnie. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ). doprowadziły do wykrycia grup (klas) antygenów oznaczonych I. Oczywiście jest mało prawdopodobne. jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. II i III. 10.(Th — pomocnicze limfocyty T). odpowiedzialnych za przyjęcie przeszczepu.5 x 106 α-β heterodimerów. Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie. które odpowiadają za syntezę przeciwciał. cytotoksyczne CD8. Główny układ zgodności tkankowej — MHC Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. Poprzez proces rearanżacji genów. który kontroluje ich syntezę. Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V. Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I. podobnie jak limfocyty B. Proces rearanżacji elementów genów receptorowych. Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej. który następuje podczas dojrzewania komórek T w grasicy. ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2. Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi. Prowadzone w latach 30. około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V. 2 regionów D i 12 genów dla łańcucha β-J. Limfocyty pomocnicze mają receptory CD4.

wykonywanych dla kilkunastu kolejnych pokoleń. a tylko w niewielkim stopniu od innych loci. H-3. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i. iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC. ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech). Tabela 10-1 Lokalizacja MHC i nazwa u poszczególnych gatunków 232 . Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców). Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. nazwanych słabymi antygenami zgodności tkankowej (ang. być może dlatego. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska. gdy biorca i dawca są zgodni pod względem haplotypów MHC. Nawet wówczas. podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. major histocompatibility complex — MHC).między tymi liniami. maternally transmitted antigen). U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo. gdyż gen kodujący go jest zlokalizowany w chromosomie Y. minor histocompatibility loci). jak i ilościowej. zwłaszcza transplantacji szpiku kostnego. pochodzi tylko od matki. nazwany Mta (ang. wykazały. W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał. Antygen H-Y występuje tylko u samców. Antygeny te są istotną barierą podczas transplantacji tkanek. często ich efekt jest niedoceniany. słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. Natomiast inny antygen. H-5 i inne. Zatem jest on przekazywany przez ojca męskim potomkom. H-l. że większość z nich znajduje się w chromosomie 2.

1. często są one nazywane antygenami MHC.Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. a wraz z nim — haploidalny genotyp MHC (haplotyp). jak już wspomniano. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów 233 . regionu K. MHC u drobiu nazwano kompleksem B. rzadziej mutacji punktowych. crossing over czy rekombinacji wewnątrzgenowych.3. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym. układ ten cechuje ogromny polimorfizm. będących glikoproteinami. iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu. Zwłaszcza niektóre geny MHC. Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA. D i L u myszy i B. Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną. jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt. Z powodu powiązań tego układu z układem grupowym krwi B. 10. W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów. powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I). kodujący białka zlokalizowane na krwinkach czerwonych. nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku. leukocyte antigens — LA). w populacji istnieje bardzo duża liczba różnych haplotypów. Ponieważ MHC zawiera wiele genów oraz. U drobiu nie stwierdzono regionu klasy III. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych. są wysoce polimorficzne. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku. Wykryto natomiast specyficzny region klasy IV. jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin. Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka. Struktura i funkcje głównego układu zgodności tkankowej U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. C i A u ludzi). a drugim podstawową funkcję — LA (tab. II i III. 10-1). należące do klasy I i II (np.

Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. biorąc tym samym udział w reakcji przeciwko infekcji wirusowej. α2 i α3. Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny.• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie. w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. 234 . Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. Jest on kodowany przez geny MHC i ma trzy koliste domeny. Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T. Łańcuch ciężki składa się z trzech części: • Najdłuższy. oznaczone symbolami αl. które kodują miejsce wiązania peptydów. Mimo iż początkowo uważano. N-końcowy fragment łańcucha ciężkiego. zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach. a także w odrzucaniu przeszczepu. że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego. każda złożona z około 90 aminokwasów. a więc w tych. których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC. obecnie wiadomo. że MHC pełni funkcję tylko w odrzucaniu przeszczepu. który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. Domeny αl i α2 odznaczają się polimorfizmem. 10-3). Łańcuch ciężki jest kodowany przez geny MHC. stanowi około 80% jego długości i znajduje się na zewnątrz komórki. wpływa na możliwość immunologicznego rozpoznania obcych białek. W domenach tych występują alloantygeniczne miejsca. co zostało już udowodnione.

• Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy. które następnie są prezentowane limfocytom T. Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. przechodzący przez błonę komórkową. W rowku tym wiązane są antygeny. 10-4). Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. składają się z trzech części: zewnątrzkomórkowej N-końcowej. • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy). który leży w cytoplazmie komórki. 235 . komórki den-drytyczne i limfocyty B). Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. oznaczonych symbolami α i β. Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin. Cząsteczki MHC klasy II. Łańcuchy te. które są między nim a błoną komórkową. Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3. śródbłonowej i wewnątrzkomórkowej. podobnie jak łańcuch ciężki cząsteczki klasy I. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie. regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi.zawierające determinanty specyficzne dla osobników. kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I.

ponieważ mają zamknięte miejsce wiążące. Późniejsze badania ujawniły. że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC.1. klasyczne cząsteczki klasy I. Natomiast produkty genów kompleksu Tlą i Qa wyka- 236 .1. kontrolujących syntezę klasycznych białek MHC klasy I. Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. I. Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu. Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I. 10. a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka.Zarówno białka MHC klasy I.3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. Dotychczas wykryto co najmniej 15 genów klasy la. oznaczane symbolem la). niektóre z nich też biorą udział w odpowiedzi immunologicznej. C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III. W jego skład wchodzą białka surowicy i płynów tkankowych. od kilkunastu do ponad 20 aminokwasów. 10-5). których jest łącznie z czynnikami regulującymi około 30. Główny układ zgodności tkankowej myszy Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy. z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib). Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości. complement) i liczbą. jak i klasy II prezentują obcy peptyd (antygen) limfocytom T. Badania sekwencji genu Qa-2. złożony z kilku aminokwasów peptyd. u myszy natomiast przez loci regionu S w obrębie H-2. Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. Białka te są oznaczane literą C (ang. Białka C2. a potem również zwierząt gospodarskich. które określono symbolem H-2 (ryć. Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). Jednak cząsteczki klasy I mogą wiązać jedynie krótki. gdyż ich miejsce wiążące pozostaje otwarte z obu stron. S i D.3. Pierwotnie w MHC u myszy zidentyfikowano regiony K.

u człowieka w 15 chromosomie. znajduje się poza MHC. -F i -G należą do nieklasycznych cząsteczek klasy I. Każda podklasa ma co najmniej jeden gen łańcucha α i β. z wyjątkiem H2-P. Geny klasy II HLA znajdują się w pięciu podklasach: DQ. Główny układ zgodności tkankowej człowieka • U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6. Struktura HLA przedstawiona jest na liniowym diagramie (ryć. natomiast u myszy z trzech eksonów. u myszy w 2. Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I. Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E. w grupie sprzężeniowej z locus dehydrogenazy sorbitolu. immune response). DP. czyli ponad 0. bardzo istotny dla ekspresji produktów genów klasy I. W regionie Qa-2. 10. Gen ten u ludzi składa się z ośmiu eksonów. natomiast cząsteczki kontrolowane przez loci HLA-E. który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. DOB/DNA i DM.1% całego genomu. DR. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny. oznaczone symbolem Ir (ang. -B i -C. zajmuje łącznie około 4 mpz DNA (4 miliony par zasad). Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. 10-6).3. -O/N oraz -M. Białka klasy III są kontrolowane przez geny regionu S.3 i Tla zmapowano dotychczas 31 genów. Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A. w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom).1. przy czym trzy pierwsze . Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S).żują wiele różnic w porównaniu z antygenami transplantacyjnymi. -P.2. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%.

in. jak i do genów klasy II. Nieliczne z genów MHC. Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". DOB/DNA. -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC. Jest pewnym paradoksem. mają tylko 2 allele. Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów. białek szoku 238 . Są to geny TAP1 i TAP2 kodujące peptydowe transportery.in. co potwierdza fakt. Podobnie jak u myszy. 314 alleli klasy II i 40 alłeli klasy III.kodują klasyczne cząsteczki klasy II. geny dla 21-hydroksylazy (CYP21). podczas gdy czwarta podklasa. Odkryty niedawno locus DM jest nieco inny niż pozostałe. Stwierdzono na przykład. HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka. Biorą one udział w proteolizie białek. m. białek transkrypcyjnych oraz białek nieprawidłowych. Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych. Dotychczas wykryto 267 allełi klasy I HLA. 10-11). na przykład DRA. nie podlegających transkrypcji (np. bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I. iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC. które strukturalnie nie należą do genów klasy II. że geny HLA-A. determinuje syntezę nieklasycznych cząsteczek klasy II. iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. region klasy II HLA zawiera także geny. -B. m.

Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami. Wiadomo jednak. w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych. Geny klasy I należą do dwóch grup — A i B. Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111. Jest to najlepiej poznany chromosom bydła.cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB).1. Jak wspomniano na początku tego podrozdziału. iż homologia między poszczególnymi gatunkami i człowiekiem jest duża. Główny układ zgodności tkankowej bydła Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie. Struktura BoLA przedstawiona jest na rycinie 10-7. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany. różniących się delecją 6 par zasad w eksonie 5. Produkty genów klasy I są to klasyczne cząsteczki MHC. który koduje krótki fragment transbłonowy łańcucha cząsteczki 239 . Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa.3. główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt. Na przykład homologia genów klasy II u ludzi i myszy jest następująca: myszy: ludzie: Aa Aβ DQα DQβ Eα Eβ DKα DRβ P O/N DP DOB/DNA M DM 10.3.

Region klasy II zawiera wiele genów. odległość między nimi wynosi 0. w granicach 75-87%. par zasad mniejsza niż w MHC u ludzi. z odpowiadającymi im genami HLA. Wydaje się. i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. Są to PD1. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś.4 cM.MHC. mają dużą homologię. W obrębie klasy II obserwowany jest duży polimorfizm genów. różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC. spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. Nie jest znana dokładna liczba genów klasy I SLA. W locus DRB wykryto pseudogen (DRB1). PD7 i PD14. DQA. Regiony klasy I i II znajdują się blisko siebie. że jest ich około 7-10. Główny układ zgodności tkankowej świni Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. szacuje się. 26 DQB i 31 DQA. Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB. Niektóre geny. których homologia wynosi około 80-85%. Podobnie jak u innych gatunków. DRĄ i DRB. Homologia między genami BoLA i HLA jest stosunkowo duża. Tylko kilka genów regionu klasy I wykazuje ekspresję. że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. w SLA 240 . natomiast DQA bydła i człowieka — 75% homologii. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1. DQB.

Główny układ zgodności tkankowej owcy Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA. 10-8. ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. powodujące. w którym znajduje się główny układ zgodności tkankowej. 1996. ovine aries). W wyniku mutacji. Jest nim na przykład gen DRB2. w którym stwierdzono delecję nukleotydu w kodonie 53. W regionie tym są także inne geny typowe dla tego układu (ryć. obok genów MHC znajdują się pseudogeny. znajdują się po jednym genie CYP22.6 cM. W regionie klasy III. W regionie klasy II. ma długość 5.6%. w eksonach 3 i 4 znajdują się kodony „stop". Najlepiej poznany jest pseudogen DRB2. w przeciwieństwie do innych gatunków. C2 i C4. 10-8). które wykryto w tym pseudogenie. podobnie jak u bydła. 241 . a częstość rekombinacji między nimi wynosi 0. ale można również spotkać określenie Ovar (ang. Mapa sprzężeniowa owczego chromosomu 20. przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ.Ryć. Geny klasy II wykazują duży polimorfizm. iż nie jest on funkcjonalny. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B. Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont. zmodyfikowano) znajdują się także pseudogeny. Dotąd nie sporządzono mapy fizycznej tego układu.

par zasad. Region klasy I oznaczony jest symbolem B-F. Główny układ zgodności tkankowej kury U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y. częstość rekombinacji między skrajnymi loci tego układu -. Długość tego regionu u owiec wynosi około 150 tyś. Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. Z kolei. o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21). a klasy IV — B-G. przypuszcza się natomiast. że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców. Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz. chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA.około 0.5%. Kompleks B znajduje się w 16 mikrochromosomie.Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. które są klasyfikowane niezależnie. częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. O ile funkcje regionów B-F i B-L są znane. gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem 242 . Badania MHC u drobiu koncentrują się na kompleksie B. klasy II — B-L. Za typowy MHC uważany jest kompleks B. natomiast w odniesieniu do Rfp-Y większość badaczy uważa. Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. Jak już wspomniano przy omawianiu budowy cząsteczki klasy I. U drobiu nie ma regionu klasy III. 10-9). że jest on zlokalizowany również w tym chromosomie (ryć.

Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC). badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis. 10-IV).3.zgodności tkankowej. Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej.2. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości). U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane. Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii. Znaczenie głównego układu zgodności tkankowej 10. białaczkę. w którym używane są homozygotyczne komórki stymulujące. 243 . tuberkulozę. Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. inwazję kleszczy i pasożytów oraz trypanosomatozę (tab. allele specific oligonucleotides — ASO). jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. Związek MHC z odpornością na choroby Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe. 10. dzięki której możliwe jest wykrycie obecności danego allelu MHC. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej. Udoskonaleniem tej techniki jest test HTC.3. Do badań serologicznych wykorzystywane są surowice lub. • metoda RFLP. Na przykład. Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań.3. antygenu) MHC.3. pozwalających na identyfikację określonej cząsteczki (białka.1. przeciwciała monoklonalne. ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby. od pewnego czasu. poprzedzona amplifikacją danego frag mentu DNA (PCR). 2) poprzez analizę molekularną DNA. Identyfikacja cząsteczek głównego układu zgodności tkankowej Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych. 10.3.

U bydła mlecznego stwierdzono istotne oddziaływanie niektórych 244 . Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje.2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3. Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka. Na przykład. mięsaka Rousa i cholerę ptasią.3. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany. oprócz szczególnej roli w reakcji immunologicznej.U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej. kokcydiozę.2.3. ale stwierdzono już jego związek z odpornością na raka skóry. haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3. oddziałuje także na inne cechy (produkcyjne i reprodukcyjne).2*8 — podatność 10. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis.

bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób. Tutaj też następuje związanie cząsteczki MHC z peptydem.4. po czym powstały kompleks transportowany jest na powierzchnię komórki. W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC. U koni natomiast stwierdzono. czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. Zasadniczą rolę w ich rozpoznaniu. Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością. przeżywalność zarodków i płodów oraz liczebność miotu. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. Zarys przebiegu reakcji odpornościowej W odpowiedzi na wniknięcie patogenów (wirusy. reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech. zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. Wykazano wyraźny wpływ haplotypu rodziców na te cechy. zależnie od rodzaju patogenu i miejsca infekcji. czyli są degradowane do peptydów. 245 .cząsteczek MHC klasy I na cechy związane z użytkowością mleczną. obniżać stopień przeżywalności i masę ciała cieląt. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków. 10. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu). Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń. odgrywają cząsteczki głównego układu zgodności tkankowej. nie do końca został poznany. Dotyczyły one wpływu MHC na stopień owulacji. bez względu na to. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. jak dotychczas. przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji. gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne.

nazywane inaczej zabijającymi. Powstały Ryc. przedostającymi się z siateczki śródplazmatycznej. makrofagi lub limfocyty B. jeśli bakterie zostaną pochłonięte przez makrofagi. Podczas infekcji bakteryjnej. są rozkładane na peptydy w wakuolach (endosomach). 10-10a). Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny. Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I. 10-10. prezentując przede wszystkim obce antygeny. Peptydy te wiążą się z cząsteczkami MHC klasy II. które zabijają zakażoną komórkę (ryć. Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej. które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne. (b) prezentacja antygenu przez cząsteczki MHC klasy II 246 . mające na powierzchni cząsteczkę CD8.

ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć. makrofagi mogą pełnić rolę pośrednią. które służą jako receptory antygenów. Genetyczna oporność na choroby Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność. jest rozpoznawany przez limfocyt pomocniczy T. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek. Makrofagi wchłaniają. a raczej ich pojemność jest różna. w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze. po przedostaniu się na powierzchnię komórki. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG. Apoptoza (gr. prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. 10. W określonych przypadkach. natomiast cząsteczka klasy II może ich związać dwa razy więcej.kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). określane jako Th2. nieśność itd. Zdolność cząsteczek MHC do wiązania peptydów. a jej fragmenty są trawione przez sąsiadujące komórki. które dotarły tu z siateczki śródplazmatycznej. Utworzony kompleks. 10-10b). Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247 . wkrótce potem jądro. które uległy apoptozie.5. Następnie peptydy te są wiązane przez cząsteczki klasy II. które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów. IgE lub IgA).). ale także oporności/podatności na choroby zakaźne i inwazyjne. Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć. Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8). Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek. chromatyna ulega kondensacji na obrzeżach jądra. apoptosis opadanie) jest to programowana śmierć komórki. degradują i prezentują wszystkie antygeny (ryć. czyli jej fizjologiczna śmierć. a następnie cała komórka pęka. 10-10b). Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD. Jeśli bakterie zostaną pochłonięte przez limfocyty B. Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów. 10-10b).

Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. celowe jest zmapowanie tego genu. Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów. Gdy cecha — wskaźnik oporności jest już wybrana. iż cecha oporności jest warunkowana pojedynczym genem. Umożliwi to poznanie sposobu jej dziedziczenia.kowanej oporności na choroby. Jeśli okaże się. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową. następnie sklonowanie go i poznanie sekwencji nukleotydów. czyli określenie jego położenia w chromosomie. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania. których celem jest znalezienie takich genów. Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć. należy oszacować jej zmienność genetyczną. 248 . Na ogół jest to cecha poligeniczna. iż oporność na nie zależy od pojedynczego genu o dużym efekcie. Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną. np. W przypadku gdy oporność na chorobę jest cechą poligeniczna. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. 10-11). następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. chociaż w przypadku niektórych schorzeń stwierdzono. może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów.

takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). związana z opornością na raka oczu.Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością. Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka. Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei. umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych. u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B. Y2/ D' i P'. które mogą być wskaźnikami oporności na choroby. Choroba ta dziesiątkuje populacje bydła 249 . Sprzężenia takie są szczególnie korzystne w selekcji. a markerami genetycznymi. • cechy. które są określane za pomocą testów serologicznych lub elektroforezy. jak: • cechy eksterierowe (widoczne gołym okiem). Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze. jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech. • cechy ustalane za pomocą badań molekularnych DNA. Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową). gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. która prowadzi do śpiączki afrykańskiej (trypanosomatoza). jak i rasowe. co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne. Znajomość cech określanych metodami serologicznymi. rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. jak i techniki inżynierii genetycznej. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus. Na przykład. i barwne upierzenie drobiu. Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów. warunkowaną wieloma lub jednym genem. Na przykład. wskazujące na większą niż u osobników białych oporność na choroby wirusowe. Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi.

Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach). zwłaszcza u młodych kurcząt. S. Na przykład. Należą do nich stany zapalne gruczołu mlecznego (mastitis). iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. pullorum. śmiertelność. które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. Ponadto świadczą one. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę. S. krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. Kokcydioza powoduje obniżony stopień wzrostu. gallinarum. zmniejszone wykorzystanie paszy. Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków. Zmienność podatności zwierząt na choroby najlepiej poznano u kur. Kokcydioza jest równocześnie przykładem choroby.afrykańskiego. nie zabezpieczając ich przed infekcją. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). typhimurium. której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie. W Norwegii od 1978 roku mastitis jest już włączone jako cecha 250 . simentalery czy szwyce. z zachowaniem ich wysokiej produkcyjności. a także. Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. Wyniki badań wrażliwości kur na bakterie Salmonella (S. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. enteritidis) sugerują. Obserwowane są zarówno różnice rasowe. że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. w tym przypadku jest to temperatura otoczenia. jak i indywidualne. S.

takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek. Można zatem przypuszczać. ustawienie strzyków. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby. co zostało udowodnione. Jej występowanie stwierdzono na wszystkich kontynentach. jak również niekorzystnym warunkom środowiska (np. iż byłoby celowe prowadzenie selekcji pośredniej. opartej na wskaźnikach fenotypowych oporności. Podstawowymi kryteriami tej selekcji są. niedobór niektórych pierwiastków. Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów. jest białaczka limfatyczna. Stwierdzono na przykład. Wydaje się. ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. a zwłaszcza przez chore matki. kształt i wielkość wymienia oraz strzyków. za duże lub za małe strzyki. jak: magnez. Wydaje się. Na podstawie licznych badań można sądzić. kobalt i mangan). Wiadomo. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. że skłonność do białaczki jest przekazywana przez rodziców. iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. że mastitis najczęściej występuje u krów. Innym schorzeniem u bydła. wapń. ale także zakażenia przez łożysko. Ta metoda selekcji jest zalecana na przykład w Szwecji. przez uprzednio zarażoną wirusem białaczki komórkę jajową. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. siarę i mleko oraz. Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników. która w znacznym stopniu jest uwarunkowana genetycznie. charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. zbyt duża wielkość i niskie zawieszenie. Z drugiej 251 . coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia. którego leczenie jest bezskuteczne. w celu ograniczania występowania mastitis poprzez selekcję. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia.selekcyjna w programach hodowlanych. wysokość zawieszenia wymienia i szybkość oddawania mleka. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków. których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy. oprócz wydajności.

coli jest opisane w podrozdziale: Mutacje genowe. resistance). W tym miejscu należy podkreślić. że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie. co może być dowodem na dziedziczenie podatności na białaczkę. cieszy się mniejszym zainteresowniem wśród badaczy. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta. Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna. której wartość waha się w granicach 0. na przykład schorzeń kończyn. coli i F18 E. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem.jednak strony wielu badaczy stwierdzało. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę.6. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne.5-0. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt. . Stwierdzono. przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. lub też jako zdolność do współżycia z pasożytem (ang. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt. iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np. ale także innych schorzeń. w odróżnieniu od genetycznej zmienności oporności. Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie.

które nie kodują informacji genetycznej.Rozdział W klasycznym ujęciu marker genetyczny to cecha jakościowa. antygenowe determinanty białek surowicy krwi (allotypy). uzyskanych metodą PCR. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych. pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253 . uwarunkowana w sposób prosty — tzn. która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej. wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. gdy w populacji występują przynajmniej dwa allele w locus tego markera. W ten sposób badane są antygeny erytrocytarne (grupy krwi). Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych. czy jest on polimorficzny. Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością. Metody serologiczne wymagają stosowania surowic testowych. antygeny głównego układu zgodności tkankowej. Przydatność markera zależy od tego. a z drugiej strony od parametrów fizycznych rozdziału (napięcie. stężenie nośnika — żelu itp. Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. a dokładniej — rozpoznające konkretną determinantę antygenową.). przydatna do celów analizy genetycznej. zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka. temperatura. umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). przez jedną parę alleli. W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. co zachodzi wówczas.

SSCP). cechujący się obecnością charakterystycznych białek. że markery zostały podzielone na dwie klasy. Jeśli białko ma tylko jedną determinantę antygenową. Klasa II markerów to sekwencje niekodujące. wówczas jest rozpoznawane 254 . czyli sekwencje kodujące -.1. single stranded conformation polymorphism). receptorami. polskiego badacza Ludwika Hirszfelda.geny. i 60. Przez grupę krwi należy rozumieć typ krwi. dotyczącej kontroli pochodzenia. Wspólną ich właściwością jest to. Ich efektem było wykrycie wielu układów grupowych. Do pionierów tych badań należy zaliczyć m. na powierzchni erytrocytów. który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. że są związane z błoną plazmatyczną erytrocytów. który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych).mentu DNA genu (metoda SSCP — ang. a w mniejszym stopniu sekwencje minisatelitarne. Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP. czyli Ag-NOR). np. wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne. a ich obecność można wykryć metodami serologicznymi. które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. 11. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. Klasa I obejmuje klasyczne markery. cząsteczkami adhezyjnymi czy białkami strukturalnymi.in. Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus). że mogą one być enzymami. W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. Antygeny erytrocytarne (grupy krwi) Grupy krwi były najwcześniej wykorzystane w analizie genetycznej. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. Objęcie badaniami niekodujących sekwencji DNA spowodowało. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym. o właściwościach antygenowych. Z badań prowadzonych u człowieka wynika.

Wreszcie może być taka sytuacja. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych. Jeśli białko ma kilka determinant antygenowych. to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi.za pomocą jednej surowicy testowej. może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej. Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów. Jeśli takie geny mają wiele alleli. a w tym jego determinanty antygenowej. Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny. a to z kolei może wpłynąć na zmianę struktury białka. a przez to do utworzenia (lub zlikwidowania) 255 .

Schemat opiera się na założeniu.nowej determinanty w antygenie erytrocytarnym. to wówczas każda mutacja genu. że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256 . Mechanizm powstawania zróżnicowania antygenów erytrocytarnych. że białko ma tylko jedną determinantę antygenową. czyli zespole antygenów. Sytuacja staje się bardziej złożona. 11-1). które pojawiają się w trzech fenogrupach: abc. a więc są uwarunkowane przez jeden allel. Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. Gdyby dla uproszczenia przyjąć. które dziedziczą się jak jednostka. Mówi się wówczas o fenogrupach. ab oraz a’bc). gdy białko ma więcej determinant antygenowych. przykład dla białka mającego kilka determinant antygenowych. 11-2. prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć. W takiej sytuacji mutacja genu zmienia jedną Ryć.

Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. że istnieje także druga teoria tłumacząca fenomen fenogrup. że występują obie sytuacje. a w konsekwencji do nietypowego dziedzi- 257 . Badania prowadzone u zwierząt wykazały. 11-2). Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów. że każdy antygen warunkowany jest przez jeden gen. ale nie narusza struktury pozostałych (ryć. Przyjmuje ona.z determinant. Należy jednak zaznaczyć.

C. 13 w genomie kury (układy: A. głównie w odniesieniu do układu grupowego B. J. Układ grupowy. w których wykryto dotąd tylko dwa allele (np. P. K. N. H. S. Zatem możliwe jest. T'. C. B. że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. C. Wśród poznanych układów są takie. Należy pamiętać. B. F. 11 w genomie bydła (układy: A. E. Ponadto determinanty mogą 258 . K. O). F. X). Q. C. Biologiczna funkcja powyższych białek nie została jeszcze poznana. M. G. J. D. P) oraz 15 w genomie świni (układy: A. Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. M. O. R'). M. H. Z. I.czenia antygenów krwinkowych. B. Można przypuszczać. B. 11-1). przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową. które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. J. układ L bydła czy układ C świni). C. że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A. D. jak np. D. U) oraz owcy (układy: A. L. układ grupowy B bydła. w którym występuje allel „ — " określany jest jako otwarty. a drugi allel (allel „ —") koduje białko. G. M. w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). R. D. E. Przykłady takie opisano u bydła. że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. K. L. W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. F. Na drugim biegunie są układy o olbrzymim polimorfizmie.

Surowice takie są produkowane przez laboratoria. Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe. 11. Białka surowicy krwi. jakie antygeny występują na erytrocytach w poszczególnych próbkach. czyli zawierającej wiele różnych przeciwciał). Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S. Polegają one na tym. Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. Za pomocą dostępnych surowic testowych należy ustalić. W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np. a każdy z nich jest rozpoznawany przez odrębną surowicę testową. pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej. aby surowice testowe. konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie). erytrocytów i leukocytów są drugą. International Society for Animal Genetics — ISAG).mieć wiele wariantów. międzynarodowych testów porównawczych (ang. które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt. Niezmiernie istotne jest. które powinny spełniać warunek swoistości. po grupach krwi. Cel ten osiąga się poprzez cykliczne przeprowadzanie. elektroforeza w żelu poliakryloamidowym lub elektroforeza 259 . W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło.2. W efekcie wśród alleli będą takie. badanie grup krwi wymaga stosowania surowic testowych. że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt. w których zidentyfikowano kilka czy kilkanaście alleli. pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang. Na uwagę zasługuje układ grupowy A świni. oraz takie. W układzie grupowym A występują dwa antygeny A oraz O. Procedura produkcji oparta jest na immunizacji zwierząt. charakteryzowały się identyczną swoistością. Jak to już wcześniej wspomniano. wyprodukowane w różnych laboratoriach. a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej). erytrocytów i leukocytów Białka surowicy krwi. pod względem liczebności grupą markerów genetycznych klasy I. które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę). przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss. które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). comparison test). Gen S ma dwa allele: S oraz s. to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. który ma działanie epistatyczne w stosunku do locus układu A. Jego ekspresja zależna jest od dodatkowego locus S. świnie.

Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych. będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną. i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Polimorfizm białek leukocytów. nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC). Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III. Spośród ponad 25 białek najbardziej polimorficzne 260 .dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. elektrofokusing). Na przykład u koni testy takie wykonywane są dla 16 systemów białek. Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt).

u owiec także w chromosomie l (Iq42q45). PIZ. określany jako zerowy. U świń są one determinowane przez ściśle sprzężone loci (Pi1. owiec (chromosom 15). Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków. Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich. PO1A. niektóre allele są charakterystyczne dla danych ras. U świń w locus ADA znanych jest sześć alleli. Ze względu na to. mającą dwa aktywne centra wiązania żelaza. PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). jak np. Polimorficzne warianty są związane z różną aktywnością tego enzymu. przy czym u bydła jest to enzym leukocytarny. Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych.są albumina. P/3. jak świnia. Spośród białek i enzymów erytrocytarnych (tab. Najwięcej wariantów tego białka zidentyfikowano u bydła. koń i koza. przy czym jeden z alleli (ALBS) występuje u większości ras. Transferyna jest β-globuliną. Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz). Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. U koni jest ono determinowane przez 13 alleli. U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli. są one cennymi markerami genetycznymi. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D. U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach. w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). Allel ten. podczas gdy allel TfA występuje przede wszystkim u yorkshire. PO1B. kur i bydła. Z drugiej strony. które mają skłonność do wytwarzania mięsa typu DFD (ciemne. Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). natomiast jest ona aktywna w leukocytach i innych tkankach. u bydła w chromosomie l. inhibitor α-proteaz i transferyna. hampshire i duroc. występuje szczególnie często u zwierząt podatnych na stres. Locus transferyny u świń znajduje się w chromosomie 13 (13q31). PO1AB i PO1BY dla wielkiej białej polskiej. Tak więc. twarde i suche). 261 .

wśród nich bydło czarno-białe i czerwono-białe.Hemoglobina wykazuje największy polimorfizm u owiec. Większość ras bydła. Warianty tego białka różnią się tylko budową łańcucha β. bydła i kóz. u rasy Jersey i niektórych ras mięsnych. U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15 262 . kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27. jak np. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła. jest monomorficzna. Na przykład u bydła w trzech pozycjach tego łańcucha. są różne aminokwasy.

Największe zróżnicowanie allotypów lipoprotein. biorące udział w transporcie cholesterolu. Ciekawe jest. bva2 oraz bvb. αs2. wykazują właściwości antygenowe. kontrolowane przez allele bval. określane terminem allotypy. Również lipoproteiny. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin. Określenie genotypu na podstawie 263 . iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA. 11. jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). a wielkość tego wytwarzania zależy od nasilenia anemii. jest układ Lpb. 14 allotypów dla γ-globulin i 3 dla α-globulin. stwierdzono dotychczas u świń. od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek. a w piątym układzie (Lps) tylko jeden allel. W przypadku antygenów immunoglobulin u bydła. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy). układ sprzężonych alleli nazywany jest haplotypem. 11. bo liczący ponad 21 allotypów. Ze względu na ścisłe sprzężenie loci kazein. U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-.i γ-globulinach. u owiec 1. dotychczas zidentyfikowano 3 allotypy. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku. Większość tych allotypów jest determinowana przez kodominujące allele. oznaczonych symbolem Lp. Allotypy immunoglobulin i lipoprotein Antygenowe właściwości surowicy krwi. β i κ oraz białko serwatkowe — P-laktoglobulina. β. U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki. W następnych układach (Lpr.chromosom). 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. u których najbardziej polimorficzny. U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad).3. Białka mleka Głównymi białkami mleka są kazeiny αs1. Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu. są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku. U bydła zidentyfikowano 3 allotypy.4. Lpt i Lpu) znane są po dwa allele.

albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. a w wariancie A — izoleucyna. U bydła w locus kazeiny αsl wykryto pięć alleli: A. Podobnie allel G powstał wskutek tranzycji C→T w allelu A. które powodują zmianę aminokwasu. β-laktoglobulina. B. a u bydła indyjskiego — alleł C. Białko β-laktoglobuliny składa się z 162 aminokwasów.badania białka jest możliwe tylko u samic będących w okresie laktacji. tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów. bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB). co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII. powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. Allel F powstał w wyniku mutacji punktowej w allelu A. pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A. B. będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną). U bydła europejskiego najczęściej występuje wariant β-kazeiny A. a wariant A — alaninę. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny. której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. E. polegającej na tranzycji G→A. C i D. z których jedynie A i D są obecne w genotypie bydła ras europejskich. przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B. znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny. Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA. Dotychczas u bydła wykryto 6 typów κ-kazeiny. D i E. determinowanych allelami: A. W pozycji 136 łańcucha polipeptydowego B jest treonina. Białko serwatkowe mleka bydła. Podobnie jak w przypadku κkazeiny. składają się one bowiem odpowiednio z 207 i 199 aminokwasów. Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. Różnica między 264 . F i G. B. wynikające z polimorfizmu genu kodującego to białko. β-Laktoglobulina odgrywa rolę w odporności organizmu. występuje w dwóch wariantach A i B. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP. natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu. C. C.

przedstawia wysoce charakterystyczny obraz osobniczego DNA. ale także sekwencje ją otaczające. Z kolei w pozycji 118 w wariancie A jest walina (GTC).5. polegające na delecji odpowiednio 11 i 37 aminokwasów. E. w którym są 3 allele. o tyle allele D i F wykazują znacznie większe różnice. Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną. W pozostałych loci wykryto po 2 allele. oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265 . który może być wykorzystany m. B. a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości. to znaczy zawierających nie tylko sekwencję minisatelitarną. Fragmenty te pochodzą z wielu loci. D. że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. 33. który także jest już rutynowo stosowany. Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A. W mleku kóz i owiec. Ich cechą charakterystyczną jest to. Podobnie u owiec. natomiast wariant B — glicynę (GGT). 11. że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT). jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. W połowie lat 80. Sekwencje te występują w wielu miejscach (loci) genomu.6 (motyw podstawowy: AGGGCTGGAGG) i 33. Zostało to wykorzystane w opracowanym teście PCR-RFLP. Uzyskany układ prążków. z wyjątkiem locus P-laktoglobuliny (chromosom 3p28). opisano po raz pierwszy sekwencje minisatelitarne. Badanie takie wymaga zastosowania sond o dużej specyficzności. wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo. do kontroli pochodzenia i identyfikacji śladów biologicznych. Polimorfizm DNA W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące. są cztery frakcje białek. O ile allele A. B.wariantem A i B polega na tym. C i E różnią się między sobą kilkoma podstawieniami aminokwasów. Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B.5 (motyw podstawowy: GGGAGGTGGGCAGGAGG). O). Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus. zaś w B -.alanina (GCC).15 (motyw podstawowy: AGAGGTGGGCAGGTGG). DNA fingerprint). Do najbardziej znanych sekwencji minisatelitarnych należą: 33. podobnie jak bydła. nazywany niekiedy „odciskiem palca" DNA (ang. a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. C. w loci kontrolującym główne białka mleka występują po 2 allele. który reprezentuje fragmenty DNA o różnej długości. to na błonie radiograficznej pojawia się układ prążków.in. F.

Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych. po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną. Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych. za pomocą sekwencji starterowej o losowej 266 . Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili. że ich loci są położone głównie w częściach telomerowych chromosomów. Zostały one określone terminem sekwencji mikrosatelitarnych. Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika. (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. CATA) motywy podstawowe. możliwe stało się analizowanie pojedynczych loci. że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. Warto zaznaczyć. gdy za pomocą techniki PCR.(np. bo zawierających motyw podstawowy długości kilku nukleotydów. Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony. high stringency). random amplified polymorphic DNA — RAPD). Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA. że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. Do tej pory najczęściej opisywano dwu. polegający na tym. w przypadku homozygoty. Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. pochodzących z DNA wyizolowanego od danego osobnika. Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów. gdy nie są znane ani sondy molekularne. a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas. Szacuje się. lub dwóch fragmentów — u heterozygoty (ryć. 11-3 wkładka kolorowa). polimorficznego fragmentu DNA. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. także powtarzających się tandemowo. (GT)nGAT(AG)m. że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji. CA) lub czteronukleotydowe (np. tzn. Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu. ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego.durą (ang.

Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I. cichego podstawienia. Wynika z tego. że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw. to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne).4 mln miejsc SNP. np. seauence characterized amplified region). Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. w której dominują nukleotydy C i G. prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1. został następnie molekularnie opisany. których celem jest sekwencjonowanie genomów różnych gatunków. są poddawane elektroforezie. określanych symbolem SNP (ang. co doprowadziło do identyfikacji markera specyficznego SCAR. czyli nie wpływa na budowę polipetydu. jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%. W ten sposób identyfikuje się markery określane skrótem SCAR (ang. Należy zaznaczyć. Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę. spośród których większość występuje poza strukturą genów. w tym sekwencjonowanie. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD.kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów). Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli. single nucleotide polymorphism). w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP). ale może od267 . Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. Jeśli amplifikowany fragment jest wystarczająco duży. zaowocował identyfikacją nowej klasy markerów genetycznych. Na przykład. Dynamiczny rozwój badań. który zlokalizowano w chromosomie 9 u psa. Polimorficzny fragment. Badając grupę osobników można stwierdzić różnice w układzie prążków. amplifikowanego przez starter 5'-AGAATAGGC-3'. reprezentujące zazwyczaj różne loci w genomie. O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu. a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP. Zamplifikowane fragmenty. charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. wykryty za pomocą techniki RAPD. że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna.AATCGGC oraz allel 2 — AATGGGC. allel l . progressive rod-cone degeneration).

marker assisted selection). Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik. Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego. czyli markerów genetycznych klasy I.6. P (4 antygeny) i Q (3 antygeny). 268 . ALB-A. którego nie stwierdzono u jednego z rodziców. Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to. Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np. D (17 antygenów). w których występuje wiele antygenów. następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT). Warunków tych nie spełnia ogier l. C (12 antygenów) oraz S (8 antygenów). ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej. natomiast u koni układy A (7 antygenów). Wykorzystanie markerów genetycznych w hodowli zwierząt Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia. w tym sekwencjonowania DNA. Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). MAS (ang. P-ad i Q-b oraz typy białek TF-O. można wykluczyć jego ojcostwo. ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego. że potomek dziedziczy jeden allel z każdego locus od ojca. Spełnia je ogier 2. Podstawą tej kontroli jest to. E (17 antygenów) i L (12 antygenów). u bydła są to układy B (40 antygenów). Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek. Do kontroli pochodzenia najlepsze są układy grupowe. on zatem może być ojcem źrebięcia. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a. Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP. drugi od matki.działywać na ekspresję genu. PHI-I. 11. Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. ES-I. tzw. D-cgm. u świń układy M (12 antygenów). Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej.

którą jest np. druga na polimorfizmie mikrosatelitarnym. W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru: Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka. prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269 . 11-4). Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. Uzyskany obraz prążków jest charakterystyczny dla danego osobnika. Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia. sekwencja minisatelitarna.ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory. jedna jest oparta na polimorfizmie minisatelitarnym. Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą. Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne. ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć.

łączne prawdopodobieństwo wykluczenia dla wszystkich 270 . W takim przypadku określa się tzw.Jak już wspomniano. analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia.

drugi od ojca. Dwa z nich otrzymały od matki allel długości 243 pz.243 pz. matka natomiast heterozygotą (jeden allel . 271 . Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA. ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia. których częstość szacuje się na 10-2-10-5 na pokolenie. której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora. Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów. szacowaniu zmienności genetycznej i dystansu genetycznego. single nucleotide polymorphisms). jak to jest przy cechach monogenowych — jakościowych. Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks. sprawia. 1300 par zasad). Ojciec jest homozygotą pod względem allelu długości 235 pz. Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. drugi — 263 pz). przy czym allel długości 235 pz odziedziczyły po ojcu. Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków. iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia. w której stosuje się kilka markerów równocześnie. Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów.badanych loci. dodawany do każdej próby DNA analizowanej za pomocą sekwenatora. jak i obojgu rodzicach: Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. Również to. Wszystkie szczenięta są heterozygotami. W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki. określanego symbolem SNPs (ang. natomiast trzeci — allel 263 pz. Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje. dokładnie tak. przedstawiono na rycinie 11-5 (wkładka kolorowa). dostępności informacji zarówno o jednym. Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych. Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2).

Jest to cecha dziedzicząca 272 . Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych.Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła. Identyfikacji genotypu w loci tych markerów daje 99. zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech). 11-VI). marker assisted selection). Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach. warunkujących cechy użytkowości mlecznej (tab. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych. cechy użytkowości mlecznej). U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych". o istotnym wpływie na cechy użytkowe. W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną. są również pomocne w doskonaleniu niektórych cech jakościowych. Prowadzone są badania w celu znalezienia takich genów. W przypadku tych cech jest już możliwa selekcja bezpośrednia. które mają znaczący wpływ na kształtowanie się cech użytkowych. Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich. Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. Geny takie nazwano głównymi lub genami o dużym efekcie. Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. zwiększoną plenność świń. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec. dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. 11-VII). Markery genetyczne. głównie klasy II. a postęp genetyczny jest uzyskiwany w krótszym czasie. można dla młodej jałówki określić. wydajnością białka w mleku. czyli istotnych z hodowlanego punktu widzenia. brunatnego szwajcarskiego i simentali. Okazało się. Znając sprzężenie między określonym markerem genetycznym a np. jaka będzie wartość tej cechy w przyszłości. której kryteriami są genotypy zwierząt w danych loci.99% prawdopodobieństwa wykluczenia. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt.

Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich.się z dominacją całkowitą. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała). której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego. jak również intensywnej hodowli (zasiniaczenia i ukryte 273 . w których coraz więcej uwagi poświęca się dobrostanowi zwierząt.

jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia. Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów. Dotychczas wiadomo jedynie. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to. Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. ponadto jest zabiegiem kłopotliwym. 274 . zanim wystąpią objawy chorobowe. które cechuje duża zmienność genetyczna. Szacowanie dystansu genetycznego i wybór ras. a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji. Znane są już dwie sekwencje mikrosatelitarne. kontrolujący bezrożność/rogatość u bydła. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania. dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani. zwłaszcza infekcyjnych. w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi. że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources). Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób. Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne. występuje w l chromosomie. Aby tego uniknąć. Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I. ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. że locus polled. Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych. jak i klasy II. w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. które mogą być wykorzystane do tego celu. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii). coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. sprzężone z locus polled.uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji.

Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM). Organizacja DNA jądrowego W obrębie genomu występują zarówno sekwencje kodujące. Genom może być opisany za pomocą kilku parametrów. Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów. Zdecydowanie przeważają sekwencje niekodujące.1. Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). dlatego pojęcie genomu odnoszone jest do DNA jądrowego. 12-1). Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów. które stanowią około 97% całego DNA (ryć. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów. Rozmieszczenie loci genów w genomie jest nierównomierne. Miejsca te można wybarwić metodą barwienia prążkowego typu T. mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). jak i sekwencje niekodujące. że w genomie ssaków występuje około 35 tysięcy genów. Sekwencje powtarzalne 275 . wyrażona w cM. Po pierwsze. Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad. Przyjmuje się. czyli geny. Tam też znacznie częściej zachodzi crossing over. Całkowita długość genomu u ssaków. Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów.Rozdział 12 Mapy genomowe Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. 12. U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM.

W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej. Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. Oznacza to. Szacuje się. że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu. Niezależnie od tego. że genom jest bardzo silnie nimi nasycony. Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów). że liczba powtórzeń danego układu podstawowego wykazuje w obrębie 276 . ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim). z punktu widzenia przydatności tych sekwencji do analizy genetycznej.dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad. jest to. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to. sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych. którą uwidocznia się metodą barwienia prążkami C. Szczególnie cenne.

Elementy nukleotydowe to takie sekwencje. która stanowi zakończenia ramion chromosomowych. Podobnie jak poprzednio. Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. że sekwencje te. Organizacja DNA mitochondrialnego Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin). Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny. z wyjątkiem sekwencji telomerowych. Inaczej mówiąc. Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu. jest do tej pory słabo rozpoznana. Skróceniu ulegają właśnie sekwencje telomerowe. których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz. przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. 12.populacji silne zróżnicowanie. że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. ale w danym miejscu występuje tylko jedna kopia sekwencji. które również są rozproszone w wielu miejscach genomu. dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych.2. której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element). Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się. które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. w których asocjuje heterochromatyna z kilku chromosomów. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego. podobnie jak elementy nukleotydowe. 277 . jest sekwencja telomerowa (TTAGGG/AATCCC). sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element). Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną. Wiadomo. Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. leżą w pobliżu białkowych struktur kompleksów. Funkcja sekwencji powtarzalnych. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. w pobliżu końców ramion chromosomów.

Większość komórek zawiera od tysiąca do 10 tyś. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA.Mitochondria należą do organelli komórkowych przekształcających energię. w których być może replikacja mtDNA nie zachodzi. a tylko część przez mtDNA. Całkowita liczba genów w ludzkim mtDNA wynosi 37. Jego długość wynosi około 16 tysięcy par zasad. Struktura mtDNA jest inna niż DNA jądrowego. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie. Wiadomo już. Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang. W nich odbywa się większość reakcji oddychania komórkowego. przy czym kompleks V jest to syntaza ATP. Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy. kopii mtDNA. zatem muszą być syntetyzowane wewnątrz mitochondriów. Białka będące podjednostkami enzymów łańcucha oddechowego (np. oxidative phosphorylation — OXPHOS). 278 . Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli. ubichinon/koenzym Q. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka. poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. mtDNA jest bowiem kolisty. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V.

nazywa się cytogenetyczną lub fizyczną mapą genomu. c) odległościach genetycznych. b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli). różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H). 279 . co więcej. uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. Markerowa mapa genomu Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących. 12. który stanowi dominującą część genomu. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D. pozostający w asocjacji z cząsteczką macierzystą. która przebiega równocześnie. Prawie cały mtDNA zawiera sekwencje kodujące. uformowana przez krótki fragment nowego łańcucha H.DNA występujący w mitochondriach nie jest powiązany z białkami. transkrypcji podlegają obie nici kolistego DNA. ale w przeciwnych kierunkach. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego. Mapa. Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych. genów (markery klasy I). czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach.T niż łańcuch lekki (L). Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA. a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA. pomiędzy sprzężo nymi loci oraz ich uszeregowaniu. tzn. który ma większy udział nukleotydów guanylowych — G i tymidylowych . Kolejną cechą charakterystyczną mtDNA jest to. i niekodujących. że geny mitochondrialne nie zawierają intronów. dlatego niejednokrotnie mówi się o markerowej mapie genomu. w której obrębie występuje potrójna struktura DNA. a niektóre geny nawet nakładają się na siebie. na obu łańcuchach. w odróżnieniu od DNA jądrowego. Z kolei mapa opisująca sprzężenia. wyrażonych w cM. Łańcuchy komplementarne.3. która wskazuje położenia loci w chromosomach. a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech. W mtDNA występuje jedno miejsce inicjujące transkrypcję. wchodzące w skład cząsteczki mtDNA.

sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang. ale nie jedyną. cDNA (komplementarny DNA) genu. metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym. 280 . Różnica między DNA genu a jego cDNA polega na tym. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa. Fizyczna mapa genomu Podstawową. na przykład mikrosatelitę — marker klasy II.12. na bazie którego syntetyzowano cDNA. że w cDNA nie występują introny. Jest to taka sekwencja nukleotydowa. ponieważ w mRNA. reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję.1. Często sondę stanowi tzw. która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany.3.

Warto wspomnieć o dwóch: tzw.Ryć. która zawiera unikatowe sekwencje DNA wybranego chromosomu. Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu. Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. Ponadto. które stosuje się albo przed hybrydyzacją. chromosome painting) i mapowaniu na chromatynie jąder interfazowych. wykorzystuje się techniki prążkowego barwienia (G. związanego z barwnikiem fluorescencyjnym (ryć. technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków. (b) ta sama metafaza po hybrydyzacji. Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. FISH) na chromosomie 3 psa. Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. Malowanie chromosomów polega na zastosowaniu sondy. W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. 12-4 wkładka kolorowa). że do identyfikacji chromosomu. zgodnie z przyjętym wzorcem kariotypu. Q lub R). Hybrydyzacją in situ ma wiele odmian. Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. Analizę taką określa się terminem porównawczego malowania chromosomów (ang. 12-3. gdzie sonda hybrydyzowała z DNA chromosomu splicing). albo po hybrydyzacji. 12-3). jasne punkty wskazują miejsce. malowaniu chromosomów (ang. Miejsce. comparative chromosome 281 . w którym sonda połączy się z DNA chromosomu. dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów. które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt. Trzeba podkreślić. Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych. (a) chromosomy barwione metodą prążków Q. jest rozpoznawane przez obserwację mikroskopową.

że zmiany na poziomie chromosomowym. Dowodzi to. utworzoną dla jednego gatunku (np. 12-1). które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. bydła). jakie zaszły podczas ewolucji.painting) i polega ona na tym. człowieka). Należy jednak 282 . W ten sposób można wskazać. konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych. Przeprowadzone eksperymenty ujawniły. które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. że sondę chromosomowo specyficzną. są bardzo złożone. że w genomach bydła.

W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki). to stopniowo „gubione" są chromosomy. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków. z fibroblastami pochodzącymi z mięśni czy skóry bydła. przyjmuje się bowiem. naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16. 0 ich umiejscowieniu wiadomo jedynie tyle. że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku. które nie pochodzą z komórek nowotworowych.6 milionów par zasad. Sytuacja taka świadczy o tym. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci. których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym. jeżeli obejmuje segment długości co najmniej kilku milionów par zasad. którego genom jest badany — w tym przykładzie są to komórki bydlęce. naświetlaniu promieniami jonizującymi. Na przykład. Okazuje się jednak. Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA. że metoda malowania chromosomów ma ograniczoną dokładność. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. które będą się między sobą różniły liczbą zachowanych chromosomów bydła. które zawsze pojawiają się razem. Nie można natomiast wskazać. nieznana pozostaje również wzajemna odległość między nimi. czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów. np. Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. że sonda chromosomowo specyficzna da widoczny sygnał. że są położone w jednym chromosomie. a w każdej 283 . że grupa tych loci jest położona w tym samym chromosomie. której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku. Loci takie nazywa się syntenicznymi. W tym przypadku są to chromosomy bydła. ale czasami może się zdarzyć tak. że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków. który jest to chromosom 1 w jakim regionie mieszczą się badane loci. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji.zaznaczyć. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego. komórki nowotworowe myszy). utrzymywanych w hodowli. a zatem fragmentacja chromosomów. Polega ona na poddawaniu komórek gatunku mapowanego. mysich komórek nowotworowych. że jeżeli takie komórki są hodowane w warunkach in vitro. przed hybrydyzowaniem z komórkami nośnikowymi (np. Polega ona na tym. Tak wyprowadzone klony poddawane są analizie elektroforetycznej.

w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka. krzyżówka trójpunktowa). przy założonym współczynniku rekombinacji (r). Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania. loci). Jednostką odległości genetycznej jest l cM. Dalej.. które odzwierciedlają częstość. u potomstwa osobników o znanych genotypach. w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. Genetyczna mapa genomu Analiza segregacji alleli w loci markerowych. 12. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu. Dawki promieniowania jonizującego. Najpierw poszukuje się sprzężeń pomiędzy loci. 7 tyś.z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa. na tyle blisko. służy tworzeniu genetycznej mapy genomu.5) r . obliczana jako prawdopodobieństwo wystąpienia określonych genotypów. z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej.funkcja wiarogodności. Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie. wykorzystywane w mapowaniu radiacyjnym. przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia. tym mniejsze fragmenty. ze względu na zbyt małe prawdopodobieństwo zajścia crossing over. Kolejność postępowania jest następująca. W tym celu korzysta się z wiedzy o genotypach osobników 284 . Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania.3. radów. przyjmującej niezależne dziedziczenie (r = 0. L ..2. że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych. Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego. lub 12 tyś. na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci. względem hipotezy alternatywnej. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang.współczynnik rekombinacji. wynoszą zazwyczaj 5 tyś. zawierający się w przedziale (0.5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci. Odległość taka oznacza.. 0.

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r. Wśród tych ostatnich pierwszym genomem. Tak opracowane mapy określane są terminem map zintegrowanych (ang. Opublikowano ją we wrześniu 2003 r. lis polarny oraz jenot. takie jak: lis pospolity. Szczegółowe dane dotyczące map poszczególnych genomów. są zamieszczone w internetowych bazach danych (tab. analizy hybrydowych komórek somatycznych. Coraz więcej informacji pojawia się o mapach: kota. 291 . a w tym także mapowania radiacyjnego) i sprzężeniowego. są coraz lepiej poznane. 12-111). bawoła. Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe. Warto zwrócić uwagę. dla którego ustalono sekwencję nukleotydów. a także łososia i pstrąga tęczowego. jest genom psa. że również mapy genomów innych gatunków zwierząt gospodarskich. królika. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt. obok wymienionych w tabeli 12-11. a w tym i konkretnych chromosomów.) i domowych. że do 2005 r. Przewiduje się. comprehensive map). świni i kury. zostanie ustalona sekwencja genomu bydła.situ.

Hodowca wskazuje cechę. odporność na infekcje specyficznymi patogenami. że allele któregoś z markerów kosegregują z określonymi fenotypami cechy. np. pale. że cecha ta warunkowana jest monogenowo. wskazuje. polegająca na klasyfikacji fenotypów dla interesującej cechy. Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw. gen główny w przypadku cech ilościowych). marmurkowatość mięsa. homozygot recesywnych 292 . zlokalizowanych w różnych miejscach genomu. który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. jak i genotypów w jak największej liczbie loci markerowych. że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. miękkie i wodniste. dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP). Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu. odpowiedzialnych za występowanie różnych alleli. którego celem jest identyfikacja nieznanego genu. Stwierdzenie. a konkretnie przez allel recesywny. a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych. wydajność rzeźna.12. Punktem wyjścia jest precyzyjne opisanie zmienności cechy. choroby genetyczne itp. Mogą to być zatem zarówno cechy ilościowe. Najpierw ustalono. exudative — PSE). Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych). wydajność białka w mleku. która ma istotne znaczenie gospodarcze. mięso blade. Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. Następnie podejmowana jest żmudna analiza. tzn. ang. Ogólny schemat postępowania. Wykorzystanie markerowych map genomowych w hodowli Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów. Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres. bezrożność. jest pokazany na rycinie 12-6.3. tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali. Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. które z hodowlanego punktu widzenia mają istotne znaczenie. które polega na opisie struktury genu.5. jak i jakościowe. soft.

GP7. w chromosomie 6 świni (ryć. candidate gene). które okazały się ściśle sprzężone z locus HAL. Kilka lat później zidentyfikowano pierwsze markery genetyczne (m. Badania molekularne tego genu u osobników wrażliwych na stres wykazały. PGD i A1BG). Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu. za pomocą hybrydyzacji in situ. że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym. Był nim gen receptora rianodyny (RYR1). genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych (nn). Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI. Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang. który nie rozpoznaje 293 . np. Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym. 12-7a). którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. locus układu grupowego krwi H oraz loci polimorficznych białek krwi .Ryć. 12-6. Loci tych markerów umiejscowiono. która polega na zamianie argininy na cysteinę w pozycji 615.in.

jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła. (c) BMPR-IB. wiadomo było. (d) PRKAG3 oraz regionów chromosomowych. (b) MSTN. podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. Od połowy lat 80. w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy sekwencji zawierającej mutację. Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić. muscular hyperthrophy). 12-7b). Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN). wywodzących się z rasy belgijskiej 294 . Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową. W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech). Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1. który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot. że hipertrofia mięśniowa (tzw. 12-7.Ryć.

są prowadzone w licznych ośrodkach naukowych. Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. W 1994 roku ukazała się praca dowodząca. że w chromosomie 4 świni. że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania. który odpowiada za zawartość glikogenu w mięśniach. a konkretnie kontrolujący liczbę owulujących oocytów podczas rui.błękitnej i asturiana. które umiejscowione są w chromosomie 6 (ryć. że jest nim zmutowany allel genu PRKAG3. Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi. zakończyły się wieloletnie poszukiwania genu RN. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. pokrywających w miarę równomiernie większość genomu. który jest biologicznie nieaktywny. Co więcej. które w znaczący sposób wpływają na cechy użytkowe. dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. Innym przykładem jest gen RN. które ma mniejszą wartość technologiczną. Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. kwaśnego mięsa. że mutacja polegała na braku (delecji) 11 nukleotydów. Przykładem może być gen FecB. które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech. który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego. co fenotypowo objawia się hipertrofią mięśniową. w którym prawdopodobnie występuje locus genu głównego. 12-7c). Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). różnych mutacji uszkadzających funkcję białka miostatyny. W 2000 r. Okazało się. że gen FecB to zmutowana postać genu BMPR-IB. ustalono. Okazało się. Locus genu RN umiejscowiono w chromosomie 15. Analiza segregacji licznych markerów genetycznych. wpływający na plenność owiec rasy merynos booroola. Dominujący gen RN~ powoduje większą. Badania zmierzające do identyfikacji genów głównych. 12-7d). nie udało się jeszcze wskazać genów kandydujących. W 2001 r. Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101. wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). czyli genu głównego. W początkowym stadium badań zakłada się. 295 . a allel recesywny rn+ mniejszą zawartość glikogenu. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop").

a to upośledza funkcję kodowanego enzymu. występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. że w chromosomie 12. 12-7f). Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu. występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. W 2001 r. Sugestia ta została potwierdzona także w innych badaniach. który odpowiadałby za kształtowanie tych cech ilościowych. Trzeba zaznaczyć. że gen ten podlega piętnowaniu gametycznemu. w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie. ze względu na wywoływane zmiany m. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego.in. że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę. W początkowym okresie jego użytkowania stwierdzono. czyli duży efekt fenotypowy pojawia się tylko wtedy. Z badań prowadzonych w rodzinach referencyjnych wynikało.między markerami S0001 i S0067. że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. gdy zmutowany allel jest odziedziczony od ojca. Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela. Jednym z przykładów może być letalna wada rozwojowa — achondroplazja. między markerami mikrosatelitarnymi S0083 i S0090. krowa nosicielka. Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel. Oznaczało to. określana symbolem bd (ang. Można się spodziewać. że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej. bulldog disease). chore cielę — homozygota recesywna). że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. doniesiono. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja. że również wiele krów było nosicielkami zmutowanego genu bd. czego efektem jest 3-krotny wzrost ekspresji genu IGF2. Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku. wykazano. 12-7e). W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca. Z kolei w październiku 2003 r. Odnotowano też znaczące osiągnięcie dotyczące bydła. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują. w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. 296 . w budowie czaszki. którzy również byli nosicielami tego niepożądanego genu. że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka. charakteryzującego się wybitną wartością hodowlaną.

dziedziczny zanik siatkówki u owczarków francuskich). narkolepsja u dobermanów i labradorów. . że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt. Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów.W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową. a ostatnio scharakteryzowano gen oraz mutację w nim występującą. Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne. U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów. W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. Wiele z tych mutacji występuje w ściśle określonych rasach. jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów). Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują. ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli. CVM — central vertebral malformation). Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej. a opracowany test molekularny skomercjalizowano. Niestety badań tych nie opublikowano. polegającą na zniekształceniu kręgów (ang. Wśród nich są geny wywołujące takie schorzenia.

P. W. Wydawnictwo Naukowe PWN. Singer (tłum. Waśniewska-Brzeska i J. D. B. Cytobiochemia (1995). L. Węgleńskiego). Lamont. Wydawnictwo Akademii Rolniczej w Poznaniu. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997).Literatura uzupełniająca Podręczniki Biochemia (1997). J. z j. Ośrodek Wydawnictw Naukowych PAN. Poznań. z j. Krzyżosiaka. K. Cz. Michejdy). Wiedza Powszechna. P. Wężyka. Jury i H. B. Bala. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. pod red.B. A. P. Korf (przekład pod red. Wydawnictwo Naukowe PWN. Schook i S.C. L. pod red. Zwierzchowskiego. Leksykon rozrodu zwierząt (1996). J. ang. Stryer (tłum. Cz. z j. ang. Słownik terminów genetycznych (2002). J. Genetyka molekularna (1995). Brostoff.A. King. L. pod red. Wydawnictwo Naukowe PWN. Biologia molekularna w medycynie.. A. Wydawnictwo Naukowe PWN. Augustyniaka i J. pod red. Brown (przekład pod red. Elementy genetyki klinicznej (2001). Węgleńskiego. Prószyński i S-ka. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994). pod red. Immunologia (1996). Brzeski). Jeżyk genów. CRC Press Inc. ang. Biotechnologia zwierząt (1997). pod red. Genom człowieka. Wydawnictwo Naukowe PWN. Filistowicza. Wydawnictwo Naukowe PWN. II— lata 1972^-1997 (1997). Rosłanowskiego. L. Modlińskiego. Krzanowskiej.D. Wydawnictwo Naukowe PWN. Juszczaka i S. Nowicki i wsp. Warszawa. M. Warszawa. 298 . Wydawnictwo Medyczne Słotwiński Yerlag. Kłyszejko-Stefanowicz. pod red. Brema. Karty z Dziejów Zootechniki Polskiej. J. Pawlaka). Warszawa. Genomy (2001). Poznawanie zasad dziedziczenia (1997). W. pod red. Jaszczaka i J. Stansfield (przekład zbiorowy pod red. W. Leksykon biologiczny (1992). pod red. pod red. T. Genetyka człowieka. Wydawnictwo Polskiego Towarzystwa Zootechnicznego. Wydawnictwo Naukowe PWN. The Major Histocompatibility Complex Region of Domestic Animal Species (1996). USA. Prus-Głowackiego). J.J. K. Małe (tłum. Berg i M. I. Rozwiązywanie problemów medycznych (2003).R.. Roitt. R. Żeromskiego).

Kappes S. (1996). Minireview — MHC studies in domestic animals. Magiczne mikromacierze. Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence. (2002). Kamiński S. Postępy Biologii Komórki 26 (supl. Postępy Nauk Rolniczych 7 (nr 5): 87-97. polimorfizmy i choroby.. Geny oddziałujące na jakość tuszy i mięsa świń.. Dymnicki E. Kappes S. Kamiński S. Biotechnologia 3 (38): 38-50. Leymaster K..A. Sonstegard T. Goodfellow P.. Initial seąuencing and analysis of the human genome.W.M.A. Mapa genomu świni (Sus scrofa domestica). Ellis S.Artykuły przeglądowe Barsh G.. (1996)... Chromosome abnormalities in domestic sheep (Ovis aries). (1994).. (2002).M. Bartnik E.. Medycyna Weterynaryjna 52 (2): 89-93. Krzanowska H. (1998). International Human Genome Seąuencing Consortium (2001). Journal of Applied Genetics 37: 179-196. Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej. Cotinot C. Zeszyt specjalny 8: 9-18. Pareek Ch. Ohta T.P. Kirkness E. (1997).B. Keele J.W.. Pierzchała M. Freking B. Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich.. Lechniak D. A second-generation linkage map of the sheep genome.L. Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych. (1996).. Trends in Genetics 12 (8): 299-305. Medycyna Weterynaryjna 54 (2): 92-96. Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Journal of Applied Genetics 43: 123-130. Keele J. Stone R. Science 272: 67-74. The dog genome: survey seąuencing and comparative analysis. (1999).W. (1996). Mammalian Genome 9: 204-209. Grzybowski G.M. (1998).F. Population biology of antigen presentation by MHC class I molecules.G. (1996). Postępy Biologii Komórki 24 (8): 69-75.M. (1996). Charon K. i wsp. Stoughton R. Ludzki genom mitochondrialny — mutacje. (1997). Journal of Applied Genetics 38: 65-76. McGraw R.. 12): 53-58.T.A. Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt.. Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding. Smith T. (1998). Stone R.. DNA microarrays — a methodological breakthrough in genetics. Prace i Materialy Zootechniczne 49: 7-28. Seminars in Reproductwe Medicine 20: 157-167. Kurył J. De Gortari M.J. Prace i Materiały Zootechniczne 50: 69-78.. Beattie C. (1997). Current Opinion in Genetics & Development 6: 316-321. (1997). (2003). i wsp. Science 301: 1898-1903. Friend S..L. Dodds K. European Journal of Immunogenetics 21: 209-215. Naturę 409: 860-921. (2002).T. Parham P.H. Prace i Materialy Zootechniczne.M.A. 299 . Grzybowski G.. (1998).. Early steps in mammalian sex determination. Genome Research 7: 235-249. Long S. Journal of Applied Genetics 37 (3): 299-312. The genetics of pigmentation: from fancy genes to complex traits. Cuthbertson R.W.E..S. (1997). Beattie C. (1996). Kamiński S.. Charon K.P.S. Lopez-Corrales N. Metody oraz znaczenie sterowania proporcją płci u bydła. Molecular genetics of sex determination. Crawford A. A second-generation linkage map of bovine genome. Świat Nauki 4 (128): 36-43. Ramikssoon Y.

(2003). Journal of Applied Genetics 44: 1-20. Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka. Poszukiwanie genów kontrolujących cechy tuczne. (1998). Synaptonemal complexes in domestic mammals — a review. 10): 195-217. Prace i Materiały Zootechniczne 52: 37-42.. Medycyna Weterynaryjna 53 (10): 581-584.P... Waterston R. Journal of Applied Genetics 38:195-204.. Świtoński M. Słomski R.. Journal of Heredity 89 (6): 473-480. Krajowy system kontroli cytogenetycznej buhajów. . Initial seąuencing and comparative analysis of the mouse genome. Świtoński M. (1996). — Celera Genomics (2001).Z. Medycyna Weterynaryjna 59: 847-852. Świtoński M. Prace i Materiały Zootechniczne 50: 11-39. Identyfication of animal major genes in field collected data by use of statystical methods. Skiba E. Żywiecki M. Barciszewski J. (1999). Hu Z.L.. (1998). Prace i Materiały Zootechniczne 46: 29-40. Barciszewska M. Wierzbicki H.. Szydłowski M. Yenter C. 2):288-237.J. Rosochacki S. Szatkowska L. Węgrzyn J. (2002). (1998). Ruvinsky A. Kurył J.S. Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt. Basics of gametic imprinting.W. (1998). Danielak B. Postępy Biologii Komórki 25 (supl. (1997). Stranzinger G. (1997). Walawski K.. i wsp. Słota E. Kwiatkowska J.. Kulig H. Kozubska-Sobocińska A. Rohrer G. Napierała D.H. Zych S.Rejduch B. (1998).. (1998). (1994).. Beattie C. Antigenic markers of protein genes and their nomenclature in cattle. Journal of Applied Genetics 40 (2): 117-128. Postępy Biologii Komórki 25 (supl. Inheritance of colours in horses. Genome Research 6: 371-391..J. Science 291: 1304-1351. (1999). Noncoding RNA transcripts. Stachurska A. (1998).. Keele J. Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej... Aberracje chromosomowe u bydła o użytkowości mięsnej.W. opasowe i rzeźne — najnowsze osiągnięcia. Naturę 420: 520-562. Medycyna Weterynaryjna 50 (8): 379-382. (1994). Biotechnologia 2 (41): 33-56. Szymański M. Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej.A. (2003). Szwaczkowski T. Journal of Dairy Science 82 (suppl. Journal of Applied Genetics 38 (3): 319-328. Journal of Animal and Feed Sciences 2/3: 91-103.. Alexander L. Zwierzchowski L.. Zwierzchowski L. Smith T. The seąuence of the human genome. Świtoński M. Sysa P. Prace i Materiały Zootechniczne 53: 35-48. A comprehensive map of the porcine genome.. Genetic aspects of mastitis resistance in cattle. Determinacja płci u ssaków. (1997). Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt. i wsp. (1993). 10): 113-122. Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus)..

są pogrubione. na których znajduje się główny opis.Skorowidz Opracowali: Krystyna M. na których hasła znajdują się na rysunku lub w jego podpisie. Marek Świtoński Numery stron. Charon. Gwiazdką oznaczono numery stron. .

You're Reading a Free Preview

Pobierz
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->