Genetyka zwierząt

Wydanie II unowocześnione

Krystyna M. Charon Marek Switoński

WYDAWNICTWO NAUKOWE PWN WARSZAWA 2004

Autorzy
Prof. dr hab. Krystyna Małgorzata Charon
Katedra Genetyki i Ogólnej Hodowli Zwierząt, Wydział Nauk o Zwierzętach, SGGW, Warszawa

Prof. dr hab. Marek Świtoński
Katedra Genetyki i Podstaw Hodowli Zwierząt, Wydział Hodowli i Biologii Zwierząt, Akademia Rolnicza, Poznań

Okładkę i strony tytułowe projektował Edwin Radzikowski
Redaktor Krystyna Kruczyńska

Redaktor techniczny Jolanta Cłbor Podręcznik akademicki dotowany przez Ministerstwo Edukacji Narodowej i Sportu

Copyright © by Wydawnictwo Naukowe PWN SA Warszawa 2000, 2004

ISBN 83-01-14022-4

Wydawnictwo Naukowe PWN SA 00-251 Warszawa, ul. Miodowa 10 tel. (O-prefiks-22) 69-54-321 faks (O-prefiks-22) 69-54-031 e-mail: pwn @pwn.com.pl http://www.pwn.pl

Wydawnictwo Naukowe PWN SA Wydanie drugie unowocześnione Arkuszy drukarskich 20 + 12 stron ilustracji Druk ukończono w marcu 2004 r. Skład i łamanie: Fototype, Warszawa Druk i oprawa: WDG Drukarnia w Gdyni Sp. z o.o. ul. Sw. Piotra 12, Gdynia

Przedmowa

Coraz większe wykorzystywanie w hodowli zwierząt najnowszych osiągnięć genetyki sprawia, że uaktualnianie programów nauczania tego przedmiotu na kierunkach studiów związanych z nauką o zwierzętach staje się koniecznością. Cytogenetyczna i molekularna identyfikacja mutacji, kontrola pochodzenia za pomocą markerów związanych z polimorfizmem DNA czy budowanie map genomów, to tylko niektóre przykłady obrazujące obszary genetyki istotnie rozbudowane w ostatnich latach. W niniejszym podręczniku podjęto próbę zaprezentowania, obok podstawowych wiadomości z zakresu genetyki klasycznej, najnowszych osiągnięć, które znajdują zastosowanie w hodowli zwierząt. Podręcznik jest adresowany przede wszystkim do studentów kształcących się na kierunkach: zootechnika, weterynaria, biotechnologia i biologia. Mamy także nadzieję, że podręcznik będzie przydatny specjalistom, którzy profesjonalnie zajmują się hodowlą zwierząt lub prowadzeniem badań z tego zakresu. Ważną częścią niniejszego opracowania są oryginalne ilustracje, które ściśle nawiązują do wybranych zagadnień z cytogenetyki, genetyki molekularnej czy zmienności klasycznych cech jakościowych (np. umaszczenie). W przygotowaniu tej dokumentacji pomogli nam PT Współpracownicy z Katedry Genetyki i Podstaw Hodowli Zwierząt AR w Poznaniu: A. Pietrzak, J. Klukowska, A. Pieńkowska, M. Zając, D. Lechniak, D. Ładoń i J. Sosnowski oraz J. Gruszczyńska, Z. Nowak i M. Gajewska z Katedry Genetyki i Ogólnej Hodowli Zwierząt SGGW w Warszawie. Ponadto, kilka zdjęć zostało nam udostępnionych przez E. Słotę i B. Danielak-Czech z Instytutu Zootechniki w Balicach, H. Geringera z AR we Wrocławiu, K. Jaszczaka i R. Paradę z Instytutu Genetyki i Hodowli Zwierząt PAN w Jastrzębcu. Niektóre zdjęcia pochodzą z archiwum Redakcji Przeglądu Hodowlanego. Za okazaną pomoc serdecznie dziękujemy.

........................... 3............................................ 3.................................1.......................... n 1 5 16 23 31 33 37 43 3 Gen i jego ekspresja ........... 3........ Gametogeneza ....7........................................7.........................4...........7...........2....................................... Endonukleazy restrykcyjne .. Geny homeotyczne ...... Mitoza.....................................................................................2.......1........ 3... 3....... Barwienie prążkowe chromosomów ...........................................Spis treści 1 2 Wstęp — zarys historii genetyki ................................................ 3........ 4.........1...... 3................1.................... 3...............3............. Regulacja ekspresji genu .............................................................. 48 48 49 50 52 53 54 56 57 60 61 62 63 64 66 4 Metody analizy i modyfikacji genomu ..................5.................... 2............................... 3........... Kariotyp ............. .............. 3........5........................1...... RNA ....... 69 69 72 ..................... Mejoza .........................................7..........2..... Chromosomy i podziały jądra komórkowego .................................... 2... DNA ..........6......2........ Budowa kwasów nukleinowych .................... Replikacja DNA .............. ...................4..................................................... Inaktywacja chromosomu X w zarodkach żeńskich .. Budowa chromosomu ................................................................. Czynniki transkrypcyjne ......................................5.............. Translacja ........................1..................................................................................... Wektory............................ Kod genetyczny ... 2.......... Budowa genu .................................2..... 2.............................................................. 2...................................... 4.............................................................................7............3.. Piętno gametyczne ............... Transkrypcja ............................................................................................................................................. 2.1......7...................................... 3..3............................................... 3................................. Metylacja DNA ............................................. 3........4......6....................... 3...

............ Choroby monogenowe wywołujące wrodzone wady rozwojowe 5......... Rekombinacja molekularna i klonowanie ..............1..... 6...... ................ Miary zmienności ......................................... 5....... 7......... ......................................................3.......... Ograniczanie występowania chorób genetycznych.................................... Sekwencjonowanie DNA ......................................... 179 179 182 182 8 ... Przyczyny i rodzaje mutacji genowych ...... 4...............4..... Rodzaje zmienności i czynniki ją wywołujące ........ Miary skupienia ...9.......... Biblioteki genomowe i genowe .................. 146 147 147 150 152 157 160 160 161 162 163 164 164 175 176 7 Zmienność cech................1................ 5........................................................3........1..........................3. Komplementarność .......................................2... 5....2. Badanie ekspresji genów ..................2.......2......6.1... Choroby monogenowe wywołujące zaburzenia procesów bio chemicznych ........ 5........4.3...... 5.........................................1....................... 6............................................... 6........4.......... 4.......4.... Dziedziczenie cech warunkowanych jedną parą alleli ........4............ Polimorfizm fragmentów restrykcyjnych DNA (RFLP) .. 5........ 6....................4.......................5..3.... 6.....................................................4............. 5....................... 5...2...5.... Skutki mutacji genowych .4.......4........................2........ Dziedziczenie pozajądrowe ................ 6........................................... 6.................. Niezależne dziedziczenie cech (II prawo Mendla) ....4.......4.. Geny modyfikujące .2........4.5......... Sumujące działanie genów .. 4.....................3...........4. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny ................... Mutacje genowe wpływające na cechy produkcyjne zwierząt ........... 6... 5......1........... Mutacje chromosomowe ........... 7........ 4...............................................................................4.....................2.............. 5. 4.................................1. Penetracja i stopień ekspresji (ekspresywność) genów .... 5..................................... Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce .............. Mutacje genowe wywołujące choroby genetyczne ..........................1...........4..................... Współdziałanie genów z różnych lód w kształtowaniu fenotypu .......2.............................. Techniki hybrydyzacji i sondy molekularne ......8.............1............................... ................................ 6.. 6....................... Współdziałanie alleli ................5....................4................ 6.1..........................5...... 7........................1........................................................................................ Transgeneza ............................................ Mutacje genomowe ..... semiletalne i subwitalne .......................................... 5..... Amplifikacja DNA za pomocą łańcuchowej reakcji połimerazy (PCR) ....................... Mutacje genowe ........................ 76 78 82 86 87 88 91 91 5 Mutacje . 4....... 95 96 100 111 112 112 118 123 124 124 127 132 135 143 144 6 Podstawowe mechanizmy dziedziczenia cech .................................................................. Cechy sprzężone z płcią .2................... 5. Dziedziczenie cech sprzężonych . ...............10..........................4.................. Epistaza ..3.............................2.1.................1............4.4................................................. 4....... 6................4.... 6....... Mutacje w mitochondrialnym DNA ............................. Plejotropia ..... Dziedziczenie umaszczenia.................................4................................ 6. ....7...................... Geny letalne.................................2............

... 10...................1..... Genetyczne podłoże różnorodności przeciwciał ...................1. 10................... 8.. Główny układ zgodności tkankowej człowieka ................................ .. 227 227 230 231 233 236 237 239 243 243 243 244 245 247 11 Markery genetyczne ..................1.........2............. 10......... 7...4................. Polimorfizm DNA ........ Białka mleka . 11............................................ 7......1...............3...................................... Główny układ zgodności tkankowej — MHC ...........1.......... Interseksualizm ...... ............. 8........................3....1... 9........................3...3.. erytrocytów i leukocytów ............................... Znaczenie głównego układu zgodności tkankowej ...... Miary rozproszenia ......... Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych .............. 7.........4........ 10.. 253 254 259 263 263 265 268 9 ...1............. 10................................. 10..2...... Dziedziczenie cech ilościowych ........................ Genetyczna oporność na choroby .................................... Główny układ zgodności tkankowej zwierząt gospodarskich 10..1........ Geny o dużym efekcie ......................................... 10...2................ 9........... Antygeny erytrocytarne (grupy krwi) ..........................................5.................. Determinacja płci ssaków ..... Allotypy immunoglobulin i lipoprotein ......3........................................................3........2. Identyfikacja cząsteczek głównego układu zgodności tkankowej 10............5..............7.......2.. Frekwencja genów i genotypów w przypadku dominowania ......3.... Genetyczne podłoże różnorodności receptorów limfocytów T .............. 185 187 187 189 190 8 Podstawy genetyki populacji .....4.............2..............................3....3............1....... 10............................... Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami ....... 10..3.....................1.......... Związek MHC z cechami produkcyjnymi i reprodukcyjnymi 10...3........ .2......................... 210 216 221 10 Genetyczne podstawy odporności i oporności ........... 11... 11... Struktura i funkcje głównego układu zgodności tkankowej ..................... Wykorzystanie markerów genetycznych w hodowli zwierząt........... Prawo równowagi genetycznej ...............2................................3........... Główny układ zgodności tkankowej myszy ...... Zmienność cech ilościowych ..... ...... 8.........................................6. 7..... 11............................... Związek MHC z odpornością na choroby .3..3.......... Frekwencja genów ł genotypów w przypadku cech sprzężonych z płcią 8............ 198 198 201 201 204 205 210 9 Determinacja i różnicowanie płci oraz interseksualizm .......... Czynniki naruszające równowagę genetyczną .2...5........................... 8.................3.......... 10................ Zarys przebiegu reakcji odpornościowej ................ ...6...................... Białka surowicy krwi.......................... ................3......3...2...3. 11........... 8. 11.....3..... Zmienność transgresywna ......3.........1..............

...5........ Markerowa mapa genomu .... Organizacja DNA mitochondrialnego ................................. 12.............. Fizyczna mapa genomu ..............3... 301 ..........3. 12............ ..............3. 12............................................1 2 Mapy genomowe ...............................................2....3.......................................... 12................. 12................1.................. 275 275 277 279 280 284 287 289 292 Literatura uzupełniająca .....................3.......................................................... ...........1..........................................2.. Podręczniki ...................3.4.... Aktualny stan map genomowych zwierząt gospodarskich ........................ Artykuły przeglądowe ............................ Organizacja DNA jądrowego ............................. ..... 12............................................ Wykorzystanie markerowych map genomowych w hodowli .... ............ 293 298 298 Skorowidz ................................ ...... 12........3...... Genetyczna mapa genomu ............................. 12......... Strategia mapowania genomu.......................

korę mogą powstawać jedynie przez podział innych komórek. której przedmiotem badań jest zmienność i dziedziczenie cech organizmów żywych. Kilka lat później — w 1866 roku — Mendel opublikował skromną pracę pt. który faworyzuje osobniki najlepiej przystosowane do środowiska bytowania. W wieku XIX sformułowano trzy teorie o ogromnym znaczeniu dla dalszego rozwoju biologii. stanowiącą zaczątek genetyki. które stało się początkiem nauki o ewolucji. Była ona syntezą kilkuletnich obserwacji dziedziczenia siedmiu cech u grochu (Pisum sativum). umożliwiając im nie tylko przeżycie. Główną tezą tej teorii było twierdzenie. a ostatnio również informatyków. Każda z analizowanych cech miała dwie łatwo odróżnialne formy: kwiaty 11 . konstruktorów. Okazało się to niezwykle stymulujące dla rozwoju cytologii. chemików. rośliny samopylnej. Tym samym rozwój nauk biologicznych opiera się na osiągnięciach fizyków.Rozdział 1 Wstęp . podstawą ewolucji organizmów żywych jest dobór naturalny. byli Schwann i Schleiden. Autorami pierwszej z nich — teorii komórkowej budowy organizmów. Dwadzieścia lat później — w 1859 roku — Darwin opublikował dzieło pt. Zgodnie z teorią Darwina. wśród których część miała epokowe znaczenie dla rozwoju wiedzy o świecie ożywionym. komórek i ich organelli. W ten sposób powstają organizmy coraz lepiej przystosowane do danego środowiska. a z drugiej formułowaniem przełomowych hipotez i teorii. ale także przekazanie tych korzystnych właściwości potomstwu. Badania nad mieszańcami roślin. tkanek. Postęp ten znaczony był z jednej strony poznawaniem struktury i funkcji organizmów. ogłoszonej w 1838 roku. że wszystkie rośliny i zwierzęta są zbudowane z komórek. Opis struktury i funkcji organizmów na poziomie komórkowym lub wewnątrzkomórkowym jest zależny od dostępnych urządzeń i metod badawczych. czyli nauki o budowie i funkcji komórek. Powstanie tej dyscypliny stało się możliwe dzięki intensywnemu rozwojowi biologii w wieku XIX.zarys historii genetyki Genetyka stanowi wyodrębnioną dyscyplinę nauk biologicznych. O powstawaniu gatunków drogą doboru naturalnego.

Mendel uzyskał pierwsze pokolenie mieszańców (F1). Dopiero wówczas zrozumiano genialność odkryć Mendla. Przełom nastąpił w 1944 roku. Spostrzeżenia te ostatecznie pozwoliły na sformułowanie praw dziedziczenia. Niestety doniosłość tego odkrycia nie została doceniona przez ówcześnie żyjących biologów. nazwanych w 1888 roku przez Waldeyera chromosomami. Podziały jądra komórkowego zostały opisane pod koniec XIX wieku. Pomimo ogromnego zaangażowania się wielu naukowców w badania genetyczne. kiedy to trzej badacze: Avery. Bardzo skrupulatna analiza cech w obu pokoleniach dała podstawy do sformułowania wniosków. którzy niezależnie od siebie doszli do wniosków. Pierwsze doniesienia o „pałeczkowatych" strukturach. Następne lata to lawinowy rozwój nauki nazwanej przez Batesona w 1906 roku genetyką. Przez wiele lat przypuszczano. Jądro komórkowe zastało po raz pierwszy opisane przez Browna już w 1831 roku. W latach 20. Wiek XIX przyniósł także ważne odkrycia dotyczące budowy komórki. którą można uważać za początek cytogenetyki. w tym struktur związanych z dziedziczeniem. Dokonując krzyżowania między ustalonymi formami przeciwstawnymi. Ten dział genetyki określa się często jako genetykę cech ilościowych. Fischer. do końca pierwszej połowy XX wieku niewiele można było powiedzieć o chemicznej naturze informacji genetycznej. Badacze ci niezależnie od siebie sformułowali prawo równowagi genetycznej. a opis mejozy powstał w 1883 roku i zawdzięczamy go van Bendenowi i Boveriemu. że można je określać tylko jednym terminem — genetyka populacji. de Yriesa i Tschermacka. które okazały się bardzo istotnymi narzędziami badawczymi. cech ilościowych. których celem było poznanie praw rządzących dziedziczeniem cech. przy czym jedna gameta zawiera tylko jeden taki element. że dziedziczenie cech przebiega na drodze przekazywania zawiązków dziedzicznych (genów) od rodziców do potomstwa za pośrednictwem gamet. które rozmnażając się w sposób naturalny (samopylnie) dawało drugie pokolenie mieszańców (F2). że zagadnienia genetyki populacji i genetyki cech ilościowych są na tyle sobie bliskie. W 1909 roku Hardy i Weinberg stworzyli podstawy genetyki populacji. Na początku XX wieku podjęto wiele badań. za pomocą których możliwe stało się poznawanie mechanizmów odpowiedzialnych za zmienność i dziedziczenie tzw. o których różnorodności wiedziano już wówczas dość dużo. zostały podane przez polskiego botanika Strasburgera w 1880 roku. MacLeod i McCarty wykazali. nasiona żółte lub zielone itd. Rok później Morgan ogłosił chromosomową teorię dziedziczenia. Opis mitozy przedstawił w 1882 roku Flemming. Stało się to za sprawą trzech badaczy: Corrensa. że nośnikiem informacji genetycznej są białka.czerwone lub białe. W ślad za tym terminem w 1909 roku Johannsen zaproponował określenie „gen" dla czynnika dziedzicznego warunkującego pojawienie się cechy. nasiona gładkie lub pomarszczone. że 12 . które kilkadziesiąt lat wcześniej podał Mendel. Niektórzy autorzy uważają. Wright i Haldane wprowadzili do genetyki metody statystyczne.

kura czy pies. Do wniosku tego doszli na podstawie wyników eksperymentu. Doniosłym osiągnięciem stało się ogłoszenie w 1960 roku przez Jacoba i Monoda tzw. ale również jego sekwencjonowanie. liczącym ponad trzy miliardy par nukleotydów. Nirenberg i Ochoa.) czy amplifikacji fragmentów DNA za pomocą łańcuchowej reakcji polimerazy — PCR (1983 r. sekwencjonowania DNA (1975 r. że molekularne poznanie genomów człowieka. Model cząsteczki DNA przedstawili w 1953 roku Watson i Crick. w którym do niechorobotwórczych szczepów bakterii na drodze transformacji wprowadzili DNA pochodzący z zabitych bakterii wywołujących zapalenie płuc u myszy. opracowanie techniki rekombinacji i klonowania DNA (1972 r.nośnikiem informacji genetycznej jest kwas deoksyrybonukleinowy (DNA). W przypadku człowieka celem jest nie tylko mapowanie genomu. roślin czy mikroorganizmów ma ogromne znaczenie aplikacyjne związane z diagnostyką i terapią chorób genetycznych. Rozwój genetyki molekularnej i związanych z nią wyrafinowanych metod badawczych umożliwił przejście od opisu materiału dziedzicznego do prowadzenia na nim manipulacji i w ten sposób wyodrębniła się nowa dyscyplina — inżynieria genetyczna. jak świnia. przetwórstwem żywności. Dążenie do jak najgłębszego poznania informacji genetycznej zwierząt gospodarskich doprowadziło w ostatnich łatach do uruchomienia interdys cyplinarnych prpgramów mapowania genomów takich gatunków. to czas usilnych badań. W tym czasie podjęto również molekularne badania nad regulacją ekspresji genów. Celem tych programów jest wskazanie położenia genów w chromosomach oraz ustalenie odległości między genami umiejscowionymi w tym samym chromosomie. wykrywaniem 1 zwalczaniem patogenów. tzn. których celem było poznanie struktury chemicznej DNA. Warto zaznaczyć. teorii operonu. że przedsięwzięcie to przez kilka ostatnich lat było prowadzone przez dwa niezależne zespoły: 1) między narodowe konsorcjum HUGO (ang.) oraz enzymu odwrotnej transkryptazy (1970 r. która wyjaśniała mechanizm ekspresji genów u bakterii. a w lutym 2001 roku ogłoszono na łamach dwóch renomowanych czasopism: Naturę oraz Science zakończenie podstawowego etapu tych badań.. hodowlą zwierząt i roślin. ustalenie kolejności par nukleotydów w całym DNA ludzkim. ochroną środowiska itp. koń. Zostały one zakończone w pierwszej połowie lat 60.). Human Genome Organisation Project) 13 . Początek lat 50. Odkrycie enzymów restrykcyjnych (1962 r. owca. Po tym odkryciu przyszedł czas żmudnych prac zmierzających do rozszyfrowania kodu genetycznego.). W wyniku tego bakterie niechorobotwórcze nabyły cech zjadliwości. zwierząt.) to tylko najważniejsze przykłady współczesnych narzędzi i metod badawczych wykorzystywanych obecnie powszechnie w genetyce molekularnej i inżynierii genetycznej. Odkrycie to nie zostało od razu zaakceptowane przez środowisko biologów. bydło. Program ten został urucho miony w 1987 roku. Warto podkreślić. W doświadczeniu tym można upatrywać początku genetyki molekularnej. a wiodącą rolę w tych badaniach odegrali między innymi Khorana.

W grudniu 2002 roku ustalono sekwencję genomu myszy. Wydaje się. dla których podstawą teoretyczną jest wiedza z zakresu genetyki cech ilościowych oraz genetyki populacji. Pierwsze osiągnięcia zostały już opublikowane. Głównymi metodami hodowlanymi są selekcja i krzyżowanie. wysoką mięsność świń czy wydajność tłuszczu w mleku krów. Istotnym elementem pracy hodowlanej jest kontrola pochodzenia. Osiągnięcia z zakresu genetyki stały się motorem postępu nauk biologicznych i ich aplikacji. . a także człowieka powinna wywołać głębokie zastanowienie się nad tym. roślin. bowiem zamiast oceny genotypu za pomocą metod statystycznych można będzie ustalać genotyp osobnika na podstawie badań molekularnych. Obecny poziom wiedzy genetycznej i możliwości jej wykorzystania wywołują czasami również niepokój. Przewiduje się. czego jednym z licznych przykładów jest hodowla zwierząt. świni i kury. Wytwarzanie zwierząt mających wprowadzony sztucznie obcy gen (zwierzęta transgeniczne) związane jest z zastosowaniem technik inżynierii genetycznej. a we wrześniu 2003 roku ogłoszono wstępną sekwencję genomu psa. że do 2005 roku zostaną zsekwencjonowane genomy bydła. a ostatnio także polimorfizmu DNA. jakie mutacje są odpowiedzialne za hipertrofię mięśniową bydła. Ostatnio duże nadzieje są pokładane w wykorzystaniu map genomowych do molekularnej identyfikacji genów mających znaczący wpływ na kształtowanie się cech użytkowych zwierząt. wysoką plenność owiec rasy boorola i inverdale. Identyfikacja i eliminacja z populacji hodowlanych nosicieli niepożądanych mutacji chromosomowych lub genomowych wymaga zastosowania metod cytogenetycznych. Wykrycie takich genów stworzy nowe warunki do prowadzenia selekcji. że za postępującym w oszałamiającym tempie rozwojem genetyki nie nadąża niestety świadomość niektórych twórców i wielu odbiorców tych osiągnięć. której dla wspólnego dobra wszystkich organizmów zamieszkujących Ziemię nie można przekroczyć. a w przypadku mutacji genowych — metod genetyki molekularnej. Ustalono. Możliwość ingerowania metodami inżynierii genetycznej i komórkowej w informację genetyczną drobnoustrojów. gdzie jest granica.oraz 2) prywatną firmę CELERA. zwierząt. którą prowadzi się z wykorzystaniem wiedzy dotyczącej grup krwi i polimorfizmu białek.

2) każdy gen ma stałe położenie (locus) w chromosomie i 3) loci genów uszeregowane są liniowo w chromosomie. które są zbudowane z kwasów nukleinowych i białek. Głównymi tezami tej teorii było twierdzenie. mejoza). czyli są haploidalne. który w 1910 roku ogłosił chromosomową teorię dziedziczenia. Kompleksowe ujęcie tego problemu zostało dokonane przez Morgana. Tym samym organizmy te zawierają pojedynczy zestaw genów. oprócz bakterii i sinic. a za pomocą barwienia różnicującego możliwe jest ujawnienie wzoru prążków poprzecznych pojawiających się wzdłuż chromosomu. Prokarionty nie mają wyodrębnionego jądra komórkowego. Należy jednak podkreślić. Podczas podziału jądra komórkowego chromosomy podlegają procesowi kondensacji i dzięki temu możliwe jest prowadzenie ich obserwacji za pomocą mikroskopu. Niektórzy systematycy zaliczają do tej grupy także wirusy i riketsje. które podlegają podziałom (mitoza. Chromosomy w stadium metafazy podziału mitotycznego mają charakterystyczną dla siebie wielkość i morfologię. Odkrycie chromosomów i opis ich zachowania się podczas podziałów jądra komórkowego oraz wiedza o mechanizmach dziedziczenia cech u roślin i zwierząt wskazywały już na początku XX wieku na istotne znaczenie chromosomów w procesie dziedziczenia informacji genetycznej. że: 1) geny zlokalizowane są w chromosomach. Do eukariontów zalicza się wszystkie organizmy komórkowe. dwie podstawowe grupy organizmów: prokarionty (Procaryota) i eukarionty (Eucaryota).Rozdział 2 Chromosomy i podziały jądra komórkowego W podziale systematycznym organizmów żywych wyróżnia się. biorąc pod uwagę organizację informacji genetycznej i budowę komórki. Odpowiednikiem jądra komórkowego jest nukleoid. Eukarionty zbudowane są z komórek mających jądra komórkowe. Do prokariontów zalicza się bakterie i sinice. że nie 15 . W jądrze komórkowym występują chromosomy. zbudowany z „nagiej" kolistej cząsteczki DNA. zdolnego do podziałów (kariokinezy).

wiedziano wówczas. która następuje za pomocą białek histonowych i niehistonowych. Gl. Oznaczenia: P — profaza. S. A — anafaza i T — telofaza 16 . białek histonowych i niehistonowych. Dzięki kondensacji cząsteczki DNA. G2 i podział jądra :komórkowego) cyklu życiowego komórki w powiązaniu ze zmianami struktury chromosomu. Budowa chromosomu Chromosom jest strukturą jądra komórkowego zbudowaną z kwasu deoksyrybonukleinowego (DNA). 2-1. chromosom Ryć. kwasów rybonukleinowych (RNA). z jakich związków chemicznych zbudowany jest chromosom i co jest rzeczywistym nośnikiem informacji genetycznej oraz jak przedstawia się struktura wewnętrzna chromosomu. M — metafaza. 2. Fazy (GO.1. Chromosomy są łatwym obiektem do obserwacji mikroskopowej podczas podziałów jądra komórkowego.

W obszarze jąderkotwórczym umiejscowione są geny kodujące rybosomowe kwasy rybonukleinowe (rRNA) o stałej sedymentacji 5. określane inaczej jako obszar jąderkotwórczy — NOR (ang. Wówczas to chromosom ma długość rzędu kilku mikrometrów. Morfologia chromosomów obserwowanych podczas metafazy mitotycznej. określanym jako centromer. Stosunek długości ramienia długiego do długości ramienia krótkiego jest parametrem określającym morfologię chromosomu. że są siostrzane. a jego morfologia jest bardzo wyrazista i dzięki temu mikroskop świetlny jest wystarczająco czułym instrumentem pozwalającym prowadzić szczegółową analizę cytogenetyczną. subtelo-i akro-(telocentryczny) (ryć.00) i (7. W jąderkach budowane są podjednostki rybosomów. 2-2. O chromatydach mówi się.01-7.70). 18S i 28S. submeta-. 2-2). Niektóre chromosomy mają.8S. Chromatydy siostrzane zawierają po jednej cząsteczce DNA o identycznej sekwencji nukleotydów i tym samym niosą dokładnie taką samą informację genetyczną. ponieważ powstały w wyniku replikacji DNA w fazie S cyklu komórkowego (ryć.71-3. Chromosom w stadium metafazy mitotycznej jest zbudowany z dwóch chromatyd połączonych w przewężeniu pierwotnym. Część końcowa ramienia chromosomowego nazywana jest telomerem. Zależnie od położenia centromeru wyróżnia się cztery typy morfologiczne chromosomów: meta-. (3. oprócz przewężenia pierwotnego. Typy morfologiczne są wyodrębniane na podstawie wielkości stosunku długości ramion q: p 17 . 2-1).00-1. Centromer dzieli chromosom na ramię krótkie (p) oraz ramię długie (q). która obejmuje nie tylko ustalenie liczby chromosomów. który jest odpowiedzialny za uformowanie jąderek podczas interfazy. Telomery są zbudowane z powtarzającej się 6-nukleotydowej sekwencji TTAGGG/AATCCC. Wartość tego parametru dla wymienionych wyżej typów morfologicznych chromosomu mieści się odpowiednio w przedziałach: (1. także przewężenie wtórne.01-oo). (1.osiąga najmniejsze rozmiary podczas metafazy mitotycznej bądź mejotycznej. ale także opis ich morfologii i charakterystycznego układu prążków poprzecznych. Czwarta chromarydy siostrzane Ryć. nucleolar organizer region).00).

Oznacza to. Chromosomy podlegają w każdym cyklu komórkowym procesowi kondensacji — na początku podziału jądra komórkowego oraz dekondensacji — po zakończeniu podziału. nazywa się satelitą. W grupie autosomów występują identyczne pary homologiczne zarówno u płci męskiej. Chromosomy homologiczne mają identyczne uszeregowanie loci tych samych genów. morfologii. podobnie jak występuje to w obrębie par homologicznych autosomów lub pary X-X. co najważniejsze — zestawu loci genów. która z kolei zawiera jedną cząsteczkę DNA. 2-3). W tełofazie i pierwszym okresie interfazy (faza Gl) chromosomy są zbudowane z jednej chromatydy. jak i żeńskiej. układu prążków poprzecznych oraz. Konsekwencją tych różnic jest szczątkowa homologia chromosomów X i Y. Chromosomy dzielone są na dwie podstawowe grupy: autosomy i heterosomy (chromosomy płci). który występuje za przewężeniem wtórnym. Chromosomy X i Y różnią się między sobą pod względem długości (chromosom X jest przeciętnie dwa razy dłuższy niż chromosom Y). oznaczane u ssaków symbolami X oraz Y. które są w nich położone. Kwestia funkcji heterochromosomów będzie poruszona w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. która ogranicza się do niewielkiego fragmentu określanego jako obszar pseudoautosomalny. występują w układzie XX u samic oraz XY u samców. Heterochromosomy. Podobieństwo molekularne występujące w obrębie pary chromosomów homologicznych umożliwia ich koniugację podczas profazy I podziału mejotycznego.frakcja rRNA — 5S rRNA jest kodowana przez geny występujące w innych miejscach genomu. Fragment ramienia chromosomu. a drugi od ojca danego osobnika. W każdej parze jeden chromosom pochodzi od matki. Podczas fazy S następuje replikacja — 18 . że w tym obszarze występuje homologia pozwalająca na mejotyczną koniugację. Chromosom Y jest znacznie mniejszy niż chromosom X i przez to również uboższy w informację genetyczną (ryć.

która prowadzi do powstania w obrębie chromosomu dwóch chromatyd siostrzanych. charakteryzują się niezwykłą precyzją (ryć.8 obrotu DNA na oktamerze) jest nazywany rdzeniem nukleosomu i składa się ze 146 pz. Kondensacja i dekondensacja cząsteczki DNA zachodzi wielostopniowo. w wyniku czego podczas metafazy staje się on strukturą maksymalnie skróconą. inaczej par zasad (pz). że stosunek długości cząsteczki DNA do długości chromosomu w stadium metafazy wynosi około 8000:1. 1997. PWN) samoodtworzenie DNA. Wejście komórki w stadium podziału wiąże się z uruchomieniem procesu kondensacji chromosomu. Przyjmuje się. Struktura wewnętrzna chromosomu metafazowego (wg Biotechnologia zwierząt. 2-4. H3 i H4). zawierający po dwie cząsteczki histonów: H2A. H2B. Jest on zbudowany z rdzenia białkowego (oktamer histonowy. 2-4). Podstawową jednostką organizacji wewnętrznej chromosomu jest nukleosom.Ryć. Fragment DNA owinięty na oktamerze histonowym (1. w zakresie od 0 do 80 pz. ze względu na ich powtarzalność w kolejnych cyklach życiowych komórki. a procesy te. 19 . na który jest nawinięty fragment DNA długości od 165 do 245 par nukleotydów. Fragment cząsteczki DNA pomiędzy nukleosomami ma długość około 60 pz.

Pojawia się ona podczas zapłodnienia. domeny. która może ulec trwałej kondensacji. rozprzestrzenionej równomiernie na pbszarze całego jądra komórkowego. głównie powtarzalnych sekwencji DNA. a jej ostatecznym etapem jest utworzenie domen pętlo wych. Jej replikacja występuje w późnym okresie fazy S. Sekwencje DNA leżące u podstaw pętli są bogate w pary nukleotydów A-T i wiążą się z białkami rdzenia chromosomu.Nić nukleosomowa jest z kolei zwinięta spiralnie tworząc solenoid. Liczba chromosomów występująca w jądrze prawidłowej komórki somatycznej jest określana terminem diploidalnej (2n) liczby chromosomów. przykładem jest jeden z chromosomów X u osobników żeńskich. Euchromatyna podlega cyklicznym procesom kondensacji i dekondensacji. Wiadomo jednak. Heterochromatyna fakultatywna jest częścią chromatyny. zbudowanym z białek niehistonowych. W obrębie chromosomu wyróżnia się dwie frakcje chromatyny: euchromatynę i heterochromatynę. które odpowiadają za zbliżenie się sąsiednich nukleosomów. Dlatego te sekwencje DNA określane są terminem S AR (ang. wtedy bowiem haploidalny (n) zestaw chromosomów pochodzenia ojcowskiego — zawarty w plemniku — łączy się z haploidalnym zestawem pochodzenia matczynego — obecnym 20 . czyli regionami wiążącymi się ze szkieletem chromosomu. Podlega ona replikacji w początkowym okresie fazy S. Chromosomy występujące w jądrze interfazowym są zdespiralizowane i w obrazie mikroskopowym są widoczne w postaci mało zróżnicowanej chromatyny. przy czym domeny chromosomów homologicznych nie mają tendencji do łączenia się. która zawsze występuje w stanie skondensowanym. że chromatyna pojedynczych chromosomów zajmuje wyodrębnione-przestrzenie — tzw. które tworzą większe chromocentra. Przedstawiony proces kondensacji chromosomu metafazowego prowadzi do skrócenia jego długości. Heterochromatyna konstytutywna jest frakcją chromatyny. Dzięki tym zmianom chromosomy są dobrze widoczne w mikroskopie świetlnym. Chromosomy interfazowe zachowują strukturę nukleosomowa. ciałka Barra. Zbudowana jest z niekodującycK. które są zakotwiczone w rdzeniu białkowym chromatydy. Solenoid podlega dalszej spiralizacji. W niej zlokalizowane są kodujące sekwencje DNA. Heterochromatyna jest frakcją skondensowaną i dzieli się na dwa typy: heterochromatynę fakultatywną i heterochromatynę konstytutywną. należącymi do rodziny białek HMG (ang. Tendencje takie natomiast wykazują regiony heterochromatyny konstytutywnej różnych chromosomów. czyli geny. sekwencji nukleotydowych. z jednoczesnym bardzo wydatnym zwiększeniem średnicy — z 2 nm w przypadku średnicy cząsteczki DNA do 700 nm w przypadku średnicy chromatydy chromosomu metafazowego. high mobility group). W jego powstaniu istotną rolę odgrywają cząsteczki histonu Hl. scaffold attachment region). który ulega kondensacji i występuje w jądrze interfazowym w postaci tzw.

w oocycie drugiego rzędu (komórce jajowej). Chromosomy homologiczne mają loci tych samych genów. w których jeden chromosom jest pochodzenia ojcowskiego. a drugi matczynego. W wyniku tego w jądrze komórkowym zygoty oraz w potomnych komórkach somatycznych występują pary chromosomów homologicznych. ale mogą zawierać w nich różne allele 21 .

ryć.Diploidałna liczba chromosomów u zwierząt użytkowanych przez człowieka mieści się w szerokim przedziale. czyli nadliczbowe względem podstawowego ze- 22 . od 30 u norki do 78 u psa (tab. że czasami liczba chromosomów obserwowana u danego gatunku nie jest stała. Przykładem takiej sytuacji jest występowanie zmiennej liczby chromosomów B u lisa pospolitego lub jenota. 2-1. Należy podkreślić. Chromosomy B. 2-5 i 2-6).

iż są nieaktywne genetycznie. jak i pomiędzy komórkami w obrębie jednego osobnika. charakteryzują się niestabilnym zachowaniem w podziałach mitotycz-nych i mejotycznych. Efektem tego jest zmienność ich liczby zarówno między osobnikami.stawu A. Konsekwencją tego jest występowanie u lisów osobników.49 lub 48 chromosomów.2. że często są zbudowane z heterochromatyny konstytutywnej. ale także na ujawnianie na nich charakterystycznych wzorów prążków poprzecznych. chociaż wiadomo. 2. Zastosowanie przez Casperssona w 1969 roku kwinakryny do barwienia chromosomów otworzyło nowy rozdział w cytogenetyce. Prążki mają identycz23 . Drugim przykładem braku stałości liczby chromosomów w obrębie gatunku jest szerokie rozprzestrzenienie mutacji chromosomowej. Okazało się. które mogą mieć 50. może być uwidocznione za pomocą technik barwienia różnicującego. fuzji centrycznej u lisów polarnych. czyli można przypuszczać. Do tej pory nie poznano funkcji tych chromosomów. że różnorodne techniki barwienia chromosomów pozwalają nie tylko na opis ich wielkości i morfologii. Barwienie prążkowe chromosomów Zróżnicowanie wewnętrzne chromosomu. np. wynikające ze stopnia spiralizacji nici chromatynowej oraz wzajemnego stosunku ilościowego par nukleo-tydów G-C oraz A-T.

że gatunek może być charakteryzowany nie tylko przez typową dla niego diploidalną liczbę chromosomów. po wybarwieniu chromosomów roztworem fluorochromu — kwinakryny. Prążki Q (QFQ) uwidaczniane są w mikroskopie fluorescencyjnym. Zależnie od charakteru prążków przypisuje się im odpowiednie symbole. Na chromosomach pojawiają się poprzeczne prążki świecące i nie świecące 24 . ale także układ prążków na chromosomach. Wynika z tego.ny układ i wielkość na chromosomach homologicznych i dla danej pary chromosomów są stałą cechą w obrębie gatunku.

(ryć. Silne wiązanie barwnika kwinakryny następuje w miejscach. W efekcie na chromosomach 25 . 2-7a). Podobny efekt uzyskuje się po wybarwieniu chromosomów barwnikiem DAPI. gdzie dominują pary zasad A-T. Prążki G (GTG) pojawiają się na chromosomach po przeprowadzeniu wstępnego trawienia roztworem trypsyny (enzym proteolityczny). a następnie barwienia roztworem Giemsy.

Największe zagęszczenie genów występuje w obrębie izochor H3. Prążki C (CBG) wykorzystywane są do ujawnienia miejsc na chromosomach bogatych w heterochromatynę konstytutywną. są one niezbędne przy mapowaniu fizycznym genów. Oprócz opisanych wyżej metod prążkowych. w których jest też najwięcej wysepek CpG. które pozwalają na uwidocznienie charakterystycznych regionów chromosomu. Zależność ta jest szczególnie interesująca. ponieważ ponad 50% genów u ssaków poprzedzonych jest sekwencją powtarzających się niezmetylowanych dinukleotydów CpG (tzw. a pozostają trudne do usunięcia. silnie skondensowane obszary heterochromatynowe. Są one podklasą prążków R i powstają po dodatkowym ogrzaniu preparatów w 90°C. pojawiające się w układzie prążków świecących i nie świecących (opisywane symbolem RBA) powstają po wbudowaniu bromodeoksyurydyny do DNA chromosomów podczas ich replikacji i barwieniu oranżem akrydyny (ryć. które się wybarwiają roztworem Giemsy. Za pomocą barwień prążkowych możliwe jest również śledzenie zmian ewolucyjnych. Powyższe trzy rodzaje wzorów prążkowych wykorzystywane są do identyfikacji chromosomów homologicznych lub ich fragmentów w przypadku nieprawidłowości chromosomowych. Wskazuje to zatem. znane są metody. są to izochory lekkie: LI i L2 oraz izochory ciężkie: Hl. takich jak heterochromatyna konstytutywna i obszary jąderkotwórcze. 2-8). wysepki CpG). 2-7b). w których zlokalizowane są geny. które zaszły w kariotypach zwierząt. Prążki R. Oznacza to na przykład. W takich warunkach znaczna część euchromatyny zostaje usunięta. Chromosomy poddawane są działaniu kwasu solnego oraz wodorotlenku baru. po zastosowaniu barwnika Giemsy zamiast oranżu akrydyny. które polega na wskazaniu locus genu (lub anonimowej sekwencji DNA) w konkretnym chromosomie. Heterochromatyna konstytutywna 26 . Ponadto. wykorzystywanych do identyfikacji chromosomów homologicznych. a miejscami szczególnie bogatymi w loci genów są prążki T. Izochory H3 są lokalizowane przede wszystkim w obrębie prążków T.pojawiają się prążki ciemne i jasne (ryć. H2 i H3. gdzie przy barwieniu QFQ obserwowane są prążki świecące. Pozytywne prążki R (świecące lub ciemne) są bogatsze w pary nukleotydów G-C. Prążki ciemne występują w tych samych miejscach. Układ prążków R na danym chromosomie jest odwrotny "do układu prążków GTG oraz QFQ. Wzór ten można również uwidocznić w postaci prążków ciemnych i jasnych (opisywane symbolem RBG). gdzie przy barwieniu QFQ występuje prążek nie świecący. że prążki R są głównymi regionami. a prążki jasne odpowiadają nie świecącym prążkom Q. że prążek R świecący (lub ciemny przy barwieniu RBG) pojawia się na chromosomie w miejscu. Zależnie od zawartości par G-C wyróżnia się pięć klas regionów DNA (izochor) w chromosomach. a przy barwieniu GTG prążek jasny.

to barwienie azotanem srebra. W miejscach tych następuje wytrącenie metalicznego srebra. Znane są również takie gatunki zwierząt. np. 2-9a). inaczej Ag-NOR. a rzadziej na końcach.jest zlokalizowana przede wszystkim w pobliżu centromerów (ryć. czy też w częściach środkowych ramion. które w obrazie mikroskopowym ma wygląd ciemnych plam (ryć. 27 . Prążki Ag-I. 2-9b). ramiona krótkie dziesięciu par autosomów u lisa polarnego (ryć. które pozwala na ujawnienie na chromosomach aktywnych obszarów jąderkotwórczych (NOR). u których niektóre chromosomy mają całkowicie heterochromatynowe ramiona. 2-10).

28 .Diploidalna liczba chromosomów oraz ich morfologia i wzory prążkowe są cechami charakteryzującymi genomy poszczególnych gatunków. Poniżej przedstawiono podstawowe cechy opisujące chromosomy najważniejszych gatunków zwierząt domowych.

w pobliżu centromeru (ryć. Podobnie jak w przypadku bydła. w którym nie jest jeszcze zakończona kondensacja chromosomów. Koza.60 (ryć. także koza ma wszystkie autosomy akrocentryczne. a także rozmieszczenie obszarów jąderkotwórczych są podobne do obserwowanego w kariotypie bydła i kozy. a chromosom Y jest akrocentrykiem. Chromosom X jest dużym chromosomem metacentrycznym. Chromosomy płci są trudne do odróżnienia od autosomów o podobnej wielkości i morfologii. 2-5b). 2n = 54 (ryć. 2n = 60. Wśród autosomów występują trzy pary dużych chromosomów metacentrycznych oraz 23 pary akrocentryków.i submetacentrycznych) oraz 6 par akrocentrycznych. Wśród autosomów można wyróżnić grupę 13 par chromosomów dwuramiennych oraz grupę 18 par akrocentryków. 2-10a). trudnym do odróżnienia na podstawie morfologii od autosomów. a chromosom Y jest małym metacentrykiem. Świnia. a chromosom Y wykazuje ciemniejsze zabarwienie na całej długości (ryć. natomiast w chromosomie X pojawia się jedynie jako blady prążek interstycjalny w ramieniu długim. 2n = 64 (ryć. Koń. Chromosom X jest dużym akrocentrykiem. Prążki C występują w okolicy centromeru wszystkich autosomów i chromosomu X. 2-9a). Układ prążków C. Grupa chromosomów autosomalnych składa się z 12 par chromosomów dwuramiennych (meta. Chromosomy płci są łatwe do identyfikacji. 2n = 38 (ryć. a chromosom Y jest małym metacentrykiem. podobnie jak u bydła. który ma dodatkowy prążek 29 . natomiast chromosom Y ma całkowicie heterochromatynowe ramię długie. w chromosomie X widoczne są krótkie ramiona. W stadium prometafazy. Również akrocentryczny jest chromosom X. a chromosom Y jest małym metacentrykiem. Obszary jąderkotwórcze (NOR) występują w pięciu parach autosomów na końcu ramion długich. 2-6a). Obszary jąderkotwórcze występują w dwóch parach autosomów dwuramiennych. W chromosomie X brak jest centromerowego prążka C. W grupie chromosomów akrocentrycznych często obserwowane jest zjawisko polimorfizmu wielkości prążków C. Prążki C występują w okolicach centromeru wszystkich autosomów i chromosomu X. w ramionach krótkich. Heterochromatyna konstytutywna (prążki C) występuje w okolicach centromeru we wszystkich autosomach. Prążki C pojawiają się w okolicy centromerowej wszystkich autosomów.Bydło. ponieważ są to jedyne w kariotypie chromosomy dwuramienne: chromosom X jest dużym submetacentrykiem. co odróżnia go od autosomów akrocentrycznych o podobnej wielkości. Chromosom Y jest najmniejszym chromosomem metacentrycznym. Wszystkie autosomy są akrocentryczne. 2-6b). Obszary jąderkotwórcze występują. Chromosom X jest średniej wielkości metacentrykiem. 2-5a). Owca. 2n . w części telomerowej ramion długich pięciu par autosomów.

występuje liczna grupa bardzo małych chromosomów. 30 . Kura. podobnie jak u innych ptaków. wśród których jest 5 par chromosomów dwuramiennych i 3 pary akroćentryczne.interstycjalny w ramieniu długim. a chromosomy z grupy B są akroćentryczne lub subtelocentryczne. Wszystkie autosomy z grupy A są chromosomami dwuramiennymi. Liczba chromosomów B waha się od O do 7. W związku z szerokim rozprzestrzenieniem fuzji centrycznej (translokacji robertsonowskiej) obserwuje się trzy formy kariotypowe różniące się dipłoidalną liczbą chromosomów. którą można zidentyfikować barwieniem CBG jedynie w trzech parach dużych autosomów. Obszary jąderkotwórcze występują w części telomerowej ramion długich trzech par autosomów z grupy A. 2-10b). 2n = 78. oraz w chromosomie Y. 49 lub 48. W kariotypie kury. nazywanych mikrochromosomami. Lis polarny. przy czym najczęściej obserwowano l. a chromosom Y bardzo małym akrocentrykiem. a chromosom W jest małym metacentrykiem. mają bloki heterochromatynowe w okolicy centromeru. 2-7a). Obszary jąderkotwórcze występują w trzech parach autosomów: w części terminalnej ramienia krótkiego największego chromosomu oraz w części przycentromerowej dwóch małych akrocentryków (ryć. a chromosom Y bardzo małym akrocentrykiem. Chromosom Y jest w znacznej części heterochromatynowy. Wszystkie chromosomy. Kariotyp lisa pospolitego jest wyjątkowo ubogi w heterochromatynę konstytutywną. Dlatego szczegółową analizę cytogenetyczną prowadzi się jedynie w odniesieniu do dużych chromosomów autosomalnych (makrochromosomów) i chromosomów płci Z oraz W. Lis pospolity. 2-9b). Obszar jąderkotwórczy występuje tylko w jednej parze autosomów. W chromosomach B ciemny prążek C nie pojawia się i dzięki temu barwienie CBG pozwala na odróżnienie chromosomu Y od chromosomów B. 10 par dwuramiennych autosomów ma całkowicie heterochromatynowe ramiona krótkie (ryć. Chromosom X jest dużym metacentrykiem. Ponadto. 2 lub 3 chromosomy B. w okolicach centromeru. 2n = 34 +B (ryć. Chromosom X jest dużym metacentrykiem. 2n = 50. łącznie z chromosomami płci. Obszary jąderkotwórcze występują w sześciu parach autosomów w części telomerowej krótkich ramion heterochromatynowych. z grupy mikrochromosomów. którego na podstawie wielkości bądź morfologii nie można odróżnić od chromosomów B. W grupie dużych autosomów analizuje się najczęściej 8 par. Chromosom Z jest dużym metacentrykiem. Kariotyp tego gatunku jest bardzo bogaty w heterochromatynę konstytutywną. U formy podstawowej (2n = 50) występują 22 pary autosomów dwuramiennych i dwie pary akrocentryków. dla których określenie morfologii oraz wzoru prążkowego jest niemożliwe.

W fazie Gl występuje ekspresja genów związanych z funkcją danej komórki. 2-8b). Obszary jąderkotwórcze są obecne w trzech parach autosomów i chromosomie Y. mających genotyp identyczny z tym. W cyklu życiowym komórki zmianie ulega zawartość DNA w jądrze. Jeżeli ilość DNA wyrazimy za 31 .3. a także z pierwszymi etapami gametogenezy. komórki krwi. w części terminalnej ramion długich. Heterochromatyna konstytutywna jest umiejscowiona tylko w kilku parach autosomów. a chromosom Y jest małym metacentrykiem. ale także identyczną sekwencję nukleotydów w DNA. S i G2 tworzą okres międzypodziałowy — interfazę. Wszystkie autosomy są akrocentryczne. proliferacją limfocytów przy reakcji odpornościowej organizmu. nabłonka). Fazy Gl. Podział mitotyczny jest jedną z czterech faz występujących w cyklu życiowym komórki. Chromosom X jest dużym metacentrykiem. Komórki potomne mają nie tylko taką samą liczbę chromosomów. Wyraźne prążki C pojawiają się w okolicach centromerowych w czterech parach autosomów. 2n = 78 (ryć. chromosomie X (prążek centromerowy i interstycjalny w ramieniu q) i Y. 2. że komórka zmierza do podziału i dlatego faza G2 jest traktowana jako okres przygotowywania się komórki do podziału. który prowadzi do powstania dwóch komórek potomnych. Podziały mitotyczne są nierozłącznie związane z procesem wzrostu organizmu. Rozpoczęcie fazy S oznacza. a czwartą fazą jest podział. jaki miała komórka rodzicielska. odnawianiem niektórych komórek u dorosłych organizmów (np. a faza S jest związana z procesem samoodtworzenia się DNA (replikacja).Pies. Mitoza Mitoza to proces podziału jądra komórkowego.

Układanie kariotypu dla danego osobnika polega na zestawieniu par homologicznych 32 . organelle komórkowe odpowiedzialne za wytwarzanie rybosomów. Z chwilą zakończenia tego procesu rozpoczyna się anafaza. Centriołe. Chromosomy ulegają dekondensacji. w których każdy z chromosomów jest zbudowany z jednej chromatydy. dezintegracji ulega błona jądrowa. występujących w jądrze komórki somatycznej. 2-11). W końcu. Po zajściu powyższych procesów i osiągnięciu stanu maksymalnej kondensacji chromosomów następuje metafaza. Po ustawieniu się chromosomów w płaszczyźnie równikowej komórki rozpoczyna się proces podziału centromeru wzdłuż osi podłużnej chromosomu. to w jądrze komórkowym po replikacji jest 4C. Chromosomy w tej fazie są łatwym obiektem do badań z użyciem mikroskopu świetlnego — są krótkie (ich długość jest rzędu kilku (im) oraz mają wyraźną morfologię. 2. czyli podział cytoplazmy i rozdział organelli komórkowych. W wyniku kariokinezy w komórce powstają dwa jądra potomne. Chromatydy siostrzane są ze sobą połączone tylko w centromerze. którego włókienka. Kariotyp Uszeregowanie chromosomów. w pary homologiczne określane jest terminem kariotyp. odpowiedzialne za powstanie wrzeciona podziałowego. Komórka dzieli się ostatecznie na dwie komórki potomne przez przewężenie w części środkowej. wychodzące z centrosomu (obszar wokół centrioli). Po ich osiągnięciu rozpoczyna się ostatni etap kariokinezy — telofaza. Po podzieleniu chromosomu chromatydy siostrzane stają się chromosomami siostrzanymi. W telofazie zachodzą procesy odwrotne do tych. W obrębie jądra komórkowego zanikają jąderka. a centriole dzielą się na dwie parzyste struktury. a począwszy od telofazy do początku fazy S zawartość DNA wynosi 2C. mające taką samą — diploidalną — liczbę chromosomów jak komórka rodzicielska. Mitoza składa się z czterech faz: profazy.4. odbudowuje się błona jądrowa oraz jąderka. Po zakończeniu podziału komórki potomne odbudowują do niezbędnego poziomu liczbę organelli komórkowych. metafazy. W profazie rozpoczyna się proces kondensacji chromosomów. W trakcie omawiania podziału mej etycznego pokazane zostanie. Istotnym zmianom podlegają również inne organelle komórkowe. że najmniejszą zawartość DNA (1C) mają gamety (ryć.pomocą umownych wartości C. które pod wpływem kurczących się włókienek wrzeciona podziałowego przesuwają się do przeciwległych biegunów komórki. Następuje formowanie się wrzeciona podziałowego. Po zakończeniu podziału jądra komórkowego następuje cytokineza. W tej fazie chromosomy są rozprzestrzenione w całej komórce. rozchodzą się do przeciwległych biegunów komórki. łączą się z centromerami chromosomów w taki sposób. że do każdego chromosomu dochodzą włókienka z dwóch przeciwległych biegunów. 2-12). anafazy i telofazy (ryć. jakie występują w profazie.

Być. Poznań 1988) 33 . Wydawnictwo AR. d — mikrotubule wrzeciona podziałowego (wg: Genetyka zwierząt. c — dezintegrująca błona jądrowa. Zabieg wycinania jest ostatnio coraz częściej zastępowany przez specjalistyczne programy komputerowe pozwalające na analizę obrazów mikroskopowych przesłanych za pomocą kamery do pamięci komputera. Chromosomy wycinane są ze zdjęcia mikroskopowego metafazy mitotycznej. 2-12. Schemat przebiegu podziału mitotycznego. T — telofaza. Oznaczenia: P — profaza. M — metafaza. PM — prometafaza.spośród chromosomów w stadium metafazy mitotycznej obecnych w pojedynczej komórce. a — centriole. b— zanikające jaderko. C — cytokineza. Do badania kariotypu najczęściej wykorzystuje się dzielące się w warunkach pozaustrojowych (in vitro) komórki limfocytów. A — anafaza.

że często chromosomy z różnych par są podobnej wielkości i reprezentują ten sam typ morfologiczny.lub akrocentryczny) oraz wzór prążkowy uzyskiwany metodami Q. subtelo. ponieważ posługiwanie się wyłącznie kryteriami wielkości i typu morfologicznego chromosomu nie pozwala na precyzyjną identyfikację wszystkich par homologicznych. Chromosomy pochodzą z płytki metafazowej przedstawionej na ryć. submeta-. położenie centromeru wyznaczające typ morfologiczny chromosomu (meta-. G lub R. Kariotyp knura (barwienie metodą prążków G) uszeregowany zgodnie ze wzorcem ustalonym przez Komitet ds. w których wszystkie Ryć. 2-13.Chromosomy homologiczne rozpoznawane są na podstawie charakterystycznych cech morfologicznych. Standaryzacji Kariotypu Świni. kozy i psa. 2-8a 34 . Podstawowe znaczenie w układaniu kariotypu przypisuje się wzorowi prążkowemu. Skrajnym tego przykładem mogą być zestawy chromosomowe bydła. do których zalicza się: długość chromosomu. Jest to spowodowane tym.

Idiogram kariotypu świni (układ prążków G) — wg Komitetu ds.chromosomy autosomalne są akrocentryczne i można je usytuować w szeregu o stopniowo zmniejszającej się długości.1988) 35 . przy czym różnice długości pomiędzy kolejnymi parami są praktycznie niezauważalne. 2-14. Nawet w przypadku gatunków mających niewielką liczbę diploidalną oraz chromosomy Ryć. Standaryzacji Kariotypu Świni (Hereditas 109:151-157.

wielkość oraz wzór prążkowy (najczęściej prążki G lub R). 1999 . Opracowanie kariotypu. przyjętym dla danego gatunku. nazywa się idiogramem (ryć. i 85:317-324. konia. landmarks). 2001 jw. 1981 Chromosome Research 4:306-309. 1997 Hereditas 103:33-38. Brytania). bydła. Pierwsze wzorce kariotypów opracowano podczas Konferencji Standaryzacyjnej. owcy. Opracowano wówczas wzorce kariotypów barwionych metodą prążków G dla: bydła.zróżnicowane pod względem morfologicznym. R G. powstały wzorce dla lisa polarnego i pospolitego oraz opublikowano ulepszone wzorce dla świni. kozy i kota. dla których uzgodniono międzynarodowe wzorce kariotypów Gatunek Bydło Owca Koza Świnia Koń Lis polarny Lis pospolity Królik Pies Kura 36 Wzory prążkowe G. 1999 J w- Hereditas 109:151-157. Każda para homologiczna ma opisaną morfologię. które zależnie od zastosowanej metody barwienia mogą być ciemne i jasne lub świecące i nie świecące. dla poszczególnych par mogą być wskazane prążki charakterystyczne (ang. które są numerowane (ryć. owcy. Prążek taki (lub prążki) dzieli (-ą) ramię chromosomowe na regiony. która odbyła się w 1976 roku w Reading (W. R G. w zakresie wyznaczonym przez liczbę par dla danego gatunku. 1996 Cytogenetics and Celi Genetks 86:271-276. 1988 Chromosome Research 5:433-443. R Źródło Cytogenetics and Celi Genetks 92:283-299. Ag-I G. C. R G. Q. dla konkretnego osobnika polega na uszeregowaniu par chromosomów homologicznych zgodnie z międzynarodowym wzorcem. W latach 80. świni. C. Tak opracowany idiogram stanowi bardzo ważne narzędzie służące do opisywania mutacji chromosomowych oraz mapowania genów w chromosomach. obejmujące schematyczne obrazy poszczególnych chromosomów z zaznaczonym położeniem centromeru i układem prążków. 1985 Cytogenetics and Celi Genetks 31:240-248. We wzorcu poszczególnym parom chromosomowym przyporządkowane są kolejne numery. 1985 Hereditas 103:171-176. Ponadto. kozy i konia. Ag-I G G G. 2-14). Q. Natomiast w drugiej połowie lat 90. 2-14). opracowano częściowo wzorce kariotypu psa (obejmujący 22 pary spośród 39) i kury (obejmujący 9 najwiękTabela 2-11 Wykaz gatunków. czasami określanego kariogramem. 2-13). Graficzne przedstawienie kariotypu. Przykładem może być kariotyp świni (2n = 38). W obrębie regionów numerowane są także kolejne prążki. w którym rozróżnienie niektórych par wymaga zastosowania technik prążkowych (ryć. R R G. precyzyjne sporządzenie kariotypu z pominięciem technik prążkowych jest niemożliwe.

który składa się z dwóch elementów lateralnych oraz występującego pomiędzy nimi elementu centralnego (ryć. Między elementami lateralnymi występują guzki (ciałka) rekombinacyjne. tzn. 2. Podczas profazy I zachodzą ogólne zmiany o charakterze cytologicznym. W profazie pierwszego podziału mejotycznego wyróżnia się pięć stadiów: leptoten. 2-16 i 2-17). Komórki po podziale mejotycznym mają zrekombinowaną informację genetyczną. zanik jąderek oraz rozchodzenie się centrioli do przeciwległych biegunów komórki. anafaza i telofaza (ryć. Każdy element lateralny zakończony jest tarczką przylegającą. replikacją DNA w fazie S. z zaznaczeniem zastosowanych metod prążkowego barwienia chromosomów. komórki te mają zmniejszoną do poziomu 1C zawartość DNA. Obecnie są prowadzone prace nad uzgodnieniem wzorca kariotypu norki. gdzie włókienka poprzeczne wychodzące z elementów lateralnych zazębiają się. polegająca na łączeniu się i ścisłym przyleganiu na całej długości chromosomów homologicznych. W tabeli 2-II zestawione są gatunki. zygoten.szych par spośród 39) oraz poprawiono wzorzec kariotypu konia. metafaza. dezintegracja błony jądrowej. Strukturą tą jest kompleks synaptonemalny (ang. tzn. Koniugacja chromosomów zachodzi dzięki specjalnej strukturze białkowej. w których liczba chromosomów jest zredukowana o połowę.: profaza. które występują również w mitozie. Komórka rozpoczynająca podział mejotyczny zawiera 4C DNA. w ich genomie powstają unikatowe kombinacje alleli pochodzenia ojcowskiego i matczynego. W zygotenie rozpoczyna się koniugacja chromosomów homologicznych. czyli osobniki o dipoidalnej liczbie chromosomów wytwarzają gamety z haploidalną ich liczbą. Elementy lateralne 37 . Przedstawiona wyżej ogólna charakterystyka mejozy wskazuje równocześnie na najważniejsze różnice między mitozą i mejozą. Wejście komórki w podział mejotyczny poprzedzone jest. Ponadto. pachyten. pojawiającej się w zygotenie i pachytenie profazy I. Mejoza składa się z dwóch podziałów. diploten i diakinezę. która jak spoiwo łączy ze sobą dwa ułożone równolegle chromosomy homologiczne. podobnie jak w przypadku podziałów mitotycznych. które są zespołem białek odpowiedzialnych za przeprowadzenie crossing over. Mejoza Podział mejotyczny prowadzi do powstania komórek. Należą do nich: kondensacja chromosomów. synaptonemal complex — SC). Element lateralny przylega do rdzeni białkowych chromatyd siostrzanych chromosomu. 2-15).5. dla których opracowano wzorce. w których występują takie same fazy jak w mitozie. a element centralny powstaje w miejscu. która mocuje chromosom do wewnętrznej strony błony jądrowej. Oprócz tego w profazie I zachodzą bardzo ważne procesy mające podstawowy wpływ na dalszy przebieg podziału.

Tli Ryć. c — początek budowania kompleksu synaptonemalnego. DL — diploten. Pil — profaza II. Schemat przebiegu podziału mejotycznego. Ali — anafaza II. d — guzek rekombinacyjny. Wydawnictwo AR. b — centromer. a — tarczka przylegająca. 2-15. L — leptoten. P — pachyten. Oznaczenia: PI — profaza I. MI — metafaza I. TI — telofaza I. e — chiazma (wg: Genetyka zwierząt. Z — zygoten. Poznań 1988) . DK — diakineza. AI — anafaza I. MII — metafaza II. Tli — telofaza II.

że tylko niewielka część DNA homologicznych chromosomów kontaktuje się między sobą za pośrednictwem kompleksu synaptonemalnego. Białko SCP1 występuje w obrębie elementu centralnego i spełnia podstawową rolę w spinaniu struktury biwalentu. że zdecydowana ich większość jest syntetyzowana tylko w komórkach dzielących się mejotycznie. Pozostała część DNA jest ułożona wzdłuż chromosomu w postaci tzw. Wiele wskazuje na to. Ponieważ koniugacja ma charakter homologiczny. Wynika z tego. synaptonemal complex protein): SCP1. sekwencjami DNA. mieści się w granicach od 20 000 pz (inaczej 20 kpz) do 120 000 pz (120 kpz).łączą się tylko z niewielką częścią DNA chromosomów (około 1%). występującymi w tej części domen pętlo wy ch. których długość. U ssaków dobrze poznano strukturę trzech białek SCP (ang. że fragmenty DNA kontaktujące się z białkami SC są bogate w powtarzające się tandemowo sekwencje mikrosatelitarne oraz rozproszone elementy nukleotydowe (LINĘ i SINE). Badania białek SC pokazały. że crossing over może zajść. które są zakotwiczone w rdzeniu białkowym chromatydy. to białka kompleksu synaptonemalnego łączą się ze ściśle określonymi. która z kolei miała umożliwiać zajście crossing over na początku pachytenu. Koniugacja chromosomów 39 . zależnie od gatunku. SCP2 i SCP3. chociaż jeszcze nie poznanymi. zanim dojdzie do koniugacji za pośrednictwem SC. Ostatnio przeprowadzone badania pokazały jednak. Funkcja kompleksów synaptonemalnych była powszechnie łączona z przeprowadzeniem koniugacji chromosomowej. Białka SCP2 i SCP3 uczestniczą w budowie elementów lateralnych. domen pętlowych.

Wynikiem tego procesu jest pojawienie się haploidalnej liczby biwalentów. Biwalent jest także formowany przez heterochromosomy X i Y (ryć.zostaje zakończona na początku pachytenu (ryć. 2-17b). dzięki 40 . na okładce).

że SC jest w to istotnie zaangażowany. że na jednych chromosomach liczba ta byłaby znaczna. a na innych brak byłoby takich wymian. Należy jednak pamiętać. której efektem jest zmienność w świecie ożywionym. Wówczas to chromosom. co wynika z zasady. gdzie crossing over występuje w obrębie regionu pseudoautosomalnego. składające się z maksymalnie skondensowanych chromosomów homologicznych. które — jeśli się pojawią — podlegają rekombinacjom podczas mejozy. stanowiące cytologiczny dowód zajścia crossing over. pseudoautosomal region — PAR). a częściej w końcowych częściach ramion chromosomowych — w obrębie prążków T. Losowość crossing over naruszona jest również przez to. a drugi od matki. W metafazie I biwalenty. Crossing over prowadzi do powstania nowych układów alleli w obrębie pojedynczej chromatydy. Miałoby to bardzo negatywny wpływ na proces segregacji chromosomów w anafazie I. że zachodzi ono rzadziej w pobliżu centromeru. Potencjalnie mogłoby istnieć niebezpieczeństwo. dlatego poszukiwano mechanizmu gwarantującego równomierność występowania crossing over. miał zestaw alleli tylko jednego z rodziców. przy czym liczba tych zdarzeń waha się od l do 5. a w świetle ostatnich badań można przypuszczać. W ostatnim stadium profazy I — diakinezie kontynuowana jest kondensacja chromosomów oraz rozpoczyna się proces terminalizacji chiazm. zachodzi w przypadkowym miejscu biwalentu. że w obrębie pary chromosomów homologicznych jeden pochodzi od ojca. uzyskuje kombinację alleli pochodzenia ojcowskiego i matczynego. Chromatyda. Na początku pachytenu występuje zjawisko crossing over. w przeciwieństwie do sytuacji. tzn.niewielkim regionom pseudoautosomalnym (ang. ich zanikania. że ogólna liczba crossing over w komórce dzielącej się mejotycznie jest ograniczona. Przyjmuje się. że wystąpienie crossing over w określonym miejscu chromosomu wpływa ograniczająco na możliwość zajścia crossing over w pobliżu. a tym samym i jego chromatydy. w których powstają chiazmy. które uruchamiają homologiczną koniugację. która uczestniczyła w wymianie. Losowość zachodzenia crossing over jest jednak ograniczona. Po zakończeniu pachytenu — w diplotenie. które są podklasą prążków R. ponieważ brak crossing over pociąga za sobą brak chiazm. gdzie wystąpiło crossing over. czyli musi zajść w obrębie każdego biwalentu. Ponieważ tak się nie dzieje. Mechanizmem tym jest wspomniane wcześniej zjawisko interferencji. poza miejscami. Crossing over jest jednym z trzech mechanizmów odpowiedzialnych za rekombinację genetyczną (mowa jest o tym na końcu tego podrozdziału). Wiadomo. Zasada ta dotyczy także biwalentu X-Y. że pierwotnym źródłem zmienności są mutacje. zmierzają do płaszczyzny równikowej 41 . Zjawisko to określane jest terminem interferencji. Zasadniczo crossing over jest zdarzeniem losowym. że crossing over jest zjawiskiem obligatoryjnym. następuje rozkład kompleksów synaptonemalnych. które polega na wymianie fragmentów chromatyd niesiostrzanych w obrębie biwalentu. Należy podkreślić. tzn. jaka była przed crossing over.

Po zakończeniu terminalizacji chiazm rozpoczyna się anafaza I. natomiast do centromeru chromosomu homologicznego wiążą się włókna z bieguna przeciwległego. Tym samym jądro komórkowe rozpoczynające drugi podział mejotyczny zawiera 2C DNA. że do każdego z biegunów zmierza po jednym chromosomie z każdej pary homologicznej. że do centromeru przyłączają się włókna tylko z jednego bieguna. W telofazie następuje odbudowa jądra połączona z dekondensacją chromosomów (ryć. Po zakończeniu pierwszego podziału mejotycznego następuje drugi podział. Oznacza to. czego wynikiem jest zmniejszenie o połowę liczby chromosomów w jądrach powstałych po pierwszym podziale mejotycznym. 42 . który nie jest poprzedzony replikacją DNA. 2-18b). Włókna wrzeciona podziałowego rozpoczynają proces łączenia biegunów komórki z centromerami w taki sposób.komórki (ryć. 2-18c). 2-18a). w której chromosomy homologiczne rozchodzą się do przeciwległych biegunów komórki (ryć.

można podzielić na: chromosomowe. Gametogeneza męska przebiega w kanalikach plemnikotwórczych gonady męskiej — jądrach. 2) podział mejotyczny spermatocytów (spermatocytogeneza) oraz 3) spermio43 .6.Drugi podział ma przebieg zgodny z mitozą. W procesie spermatogenezy można wyróżnić trzy główne etapy: 1) podziały mitotyczne spermatogonii (spermatogoniogeneza). Włókna wrzeciona podziałowego rozciągają chromatydy siostrzane do przeciwległych biegunów komórki. a niektóre mają zrekombinowany układ alleli. Trzystopniowa rekombinacja sprawia. Po ustawieniu się chromosomów podczas metafazy II (ryć. wśród których jedne są pochodzenia ojcowskiego. Wreszcie w anafazie II do przeciwległych biegunów komórki rozchodzą się losowo chromatydy. z tym jednak że uczestniczy w nim już tylko haploidalna liczba chromosomów. W trakcie anafazy I chromosomy homologiczne rozchodzą się losowo do przeciwległych biegunów komórki. Rekombinacje genetyczne zachodzące podczas mejozy. 2. Chromosomy haploidalnego zestawu są zbudowane z pojedynczych chromatyd. Gdy jednochromatydowe chromosomy siostrzane osiągną bieguny. rozpoczyna się telofaza. Podczas pachytenu profazy I w wyniku crossing over powstają chromatydy składające się z fragmentów o pochodzeniu ojcowskim i matczynym — jest to rekombinacja wewnątrzchromatydowa (rekombinacja w ścisłym sensie). chromatydowe i wewnątrzchromatydowe. obok mutacji. w której zachodzą procesy odwrotne do tych. W wyniku tego procesu w telofazie I powstają jądra komórkowe zawierające kombinacje chromosomów pochodzenia ojcowskiego i matczynego. a w tym czas i tempo tego podziału oraz procesy prowadzące do powstania w pełni wykształconych gamet sprawiają. Ten typ określany jest jako rekombinacja chromatydowa. rozumiane w szerokim sensie. a ich chromatydy mają zrekombinowane układy alleli. Po zakończeniu podziału mej etycznego zawartość DNA w jądrach komórkowych maleje do poziomu 1C. 2-18d) w płaszczyźnie równikowej następuje podział centromeru i rozpoczyna się anafaza II. Ten fenomen. jest główną przyczyną obserwowanej ogromnej zmienności genetycznej wśród organizmów. przy czym chromatydy tych chromosomów mogą być już zrekombinowane — jest to rekombinacja chromosomowa. Przebieg mejozy. inne matczynego. że pomiędzy gametogenezą męską (spermatogeneza) i żeńską (oogeneza) występują znaczne różnice. jakie występują w profazie mitotycznej. Gametogeneza Proces tworzenia gamet jest nierozłącznie związany z podziałem mejotycznym. które mogą być zrekombinowane lub mieć układ alleli pochodzenia ojcowskiego albo matczynego. że wśród gamet nie występują dwie o tym samym zestawie alleli.

w której zgrupowane są mitochondria. a druga podlega dalszym podziałom. która stanowi przedłużenie wstawki. które są umiejscowione po przeciwnej. po zakończeniu mejozy. Taki sposób podziału pierwotnego spermatogonium jest typowy dla komórek pierwotnych (ang. w których komórki linii płciowej lokują się w części korowej gonad. 2-19). powstaje grupa licząca kilkaset spermatyd połączonych mostkami cytoplazmatycznymi. W ten sposób wszystkie oogonia. które wykazują zdolność do samoodnawiania. które rozpoczynają podział mejotyczny. 2) zgrupowaniu mitochondriów w pobliżu centrioli. podlegają głębokim przeobrażeniom podczas procesu spermiogenezy. W przypadku bydła następuje to około 60 dnia rozwoju płodowego. Umieszczone są one zazwyczaj pojedynczo w pierwotnych pęcherzykach jajnikowych. Spermatydy. Pierwszy podział prowadzi do powstania dwóch spermatogoniów. które niezwłocznie rozpoczynają podział mejotyczny. wstawki znajdującej się u podstawy główki. Oocyty przechodzą w stan spoczynkowy. który okrywa górną część jądra komórkowego znajdującego się w główce plemnika. polegają na: 1) przekształceniu aparatu Golgiego w akrosom. 3) wykształceniu na bazie centrioli włókna osiowego witki. 2-20). w stosunku do akrosomu. Oocyty I rzędu po osiągnięciu stadium diplotenu profazy I mejozy zatrzymują rozwój. Stan ten osiągany jest u bydła powyżej 100 dnia rozwoju płodowego. Podziały te są zsynchronizowane. jako komórki niezróżnicowane. nie kończą się cytokinezą. a jest ich najczęściej sześć. z których jedna komórka zajmuje miejsce pierwotnego spermatogonium. jakie zachodzą podczas spermiogenezy. która prowadzi do powstania z niezróżnicowanych haploidalnych spermatyd wyspecjalizowanych gamet męskich — plemników (ryć. Następne podziały mitotyczne spermatogoniów. Ostatecznie. Również kolejnym dwóm podziałom mejozy nie towarzyszy cytokinezą. stronie jądra komórkowego. Po ukierunkowaniu rozwoju osobniczego na płeć żeńską niezróżnicowane gonady płodowe przekształcają się w jajniki. które występowały w jajniku. Intensywne podziały mitotyczne spermatogonii w jądrach dojrzałych samców umożliwiają masowe wytwarzanie plemników. w której jest umiejscowione jądro komórkowe i akrosom. a powstające kolejne pokolenia spermatogonii są połączone mostkami cytoplazmatycznymi. oraz witki. Po zakończeniu cyklu mitoz spermatogonia przekształcają się w spermatocyty I rzędu. który jest nazywany diktiotenem. Główne zmiany. która jest określana jako syncytium. stem cells). Gametogeneza żeńska u ssaków rozpoczyna się już w życiu płodowym (ryć. czego skutkiem jest utrata struktury nukleosomowej przez chromatynę jądra plemnika.geneza. 44 . w wyniku którego powstają plemniki. Dojrzały plemnik zbudowany jest z główki. 4) usunięciu prawie całej cytoplazmy obecnej w spermatydzie i 5) zamianie białek histonowych na białka protaminowe w chromosomach. Pierwotne oogonia po przejściu kilku podziałów mitotycznych przekształcają się w oocyty I rzędu. będące w stadium diktiotenu. zostają przekształcone w oocyty I rzędu. czyli komórek nie w pełni zróżnicowanych.

Komórki przemieszczają się w jajowodzie i jeżeli podczas wędrówki natrafią na plemniki. Tym samym zapłodnienie jest niezbędnym warunkiem zakończenia oogenezy. Dzieje się to na drodze wyrzucenia przez oocyt zawartości 45 . przy równoczesnym zablokowaniu dostępu innych plemników do wnętrza oocytu. a w nich rozrasta się również oocyt. pewna część pęcherzyków rozpoczyna wzrost.Dalsze etapy oogenezy następują po osiągnięciu przez samicę dojrzałości płciowej. przed owulacją następuje ponowne uruchomienie podziału mejotycznego. Obie komórki umieszczone są w glikoproteinowej osłonce przejrzystej (zona pellucida) i w takim stadium rozwoju dochodzi do owulacji. Oocyt I rzędu kończy pierwszy podział mejotyczny. których wzrost był wystarczająco intensywny. w wyniku którego powstaje oocyt II rzędu oraz ubogie w cytoplazmę ciałko kierunkowe. regulowanych hormonalnie. W kolejnych cyklach płciowych. który jest wspomagany przez otaczające komórki pęcherzykowe. Zapłodnienie oocytu przez plemnik stymuluje dokończenie mejozy żeńskiej. to może nastąpić dokończenie oogenezy. W pęcherzykach. Oocyt znajduje się w stadium metafazy II.

znajdujących się pod powierzchnią oocytu. Powoduje to „utwardzenie" osłonki przejrzystej. Chromosomy pozostałe w oocycie tworzą przedjądrze żeńskie. Zapłodniony oocyt II rzędu przekształca się w zygotę. Rozpoczyna się anafaza II i dochodzi do „wyrzucenia" drugiego ciałka kierunkowego. do przestrzeni pomiędzy błoną oocytu a osłonką przejrzystą. w której występują dwa haploidalne przedjądrza: jedno powstałe z jądra plemnika. a chromatyna plemnika. po czym następuje telofaza II. które pozostały w oocycie 46 . podlega dekondensacji i powstaje przedjądrze męskie.ziaren korowych. która staje się barierą nie do pokonania dla plemników. który zapłodnił oocyt. Po wniknięciu plemnika oocyt ponownie podejmuje podział mejotyczny. a drugie reprezentujące zestaw chromosomów żeńskich.

kriokonserwacja zarodków i zapłodnienie pozaustrojowe (in vitro). a dalej następuje anafaza oraz telofaza i powstaje zarodek zbudowany z dwóch komórek (blastomerów). U gatunków tych można znaleźć oocyty I rzędu w stadium pachytenu w jajnikach nowo urodzonych osobników żeńskich. które umożliwiają uzyskiwanie potomstwa pożądanej płci. można wprowadzić techniką elektrofuzji komórkę somatyczną. Od przedstawionego wyżej schematu oogenezy występują odstępstwa u niektórych gatunków. . Jedna z najpowszechniej obecnie wykorzystywanych technik dotyczy manipulacji na oocytach II rzędu.po zakończeniu drugiego podziału mejotycznego. Zawartość DNA wzrasta do poziomu 4C. W taki właśnie sposób sklonowano słynną owcę Doiły. Ostatnio do praktyki hodowlanej wprowadzane są kolejne techniki. jak i klonowanie zwierząt również bazują na manipulacjach prowadzonych na oocytach II rzędu. Z kolei u królika owulacja jest bezpośrednio indukowana przez akt krycia lub inseminacji. inseminacja. przenoszenie zarodków (stadium moruli lub blastocysty) pozyskanych od tzw. Poznanie procesów gametogenezy oraz wczesnego rozwoju zarodkowego umożliwiło rozwój biotechnologii gamet i zarodków. W stadium metafazy pierwszego podziału mitotycznego zygoty dochodzi do połączenia się przedjądrzy (syngamii). samic dawczyń do rogów macicy tzw. z tym jednak że każdy z nich jest zbudowany z dwóch chromatyd siostrzanych. Do takich oocytów. co powoduje. samic biorczyń. zarodkach. Warto zauważyć. że zygota jest gotowa do rozpoczęcia podziału mitotycznego. który dalej będzie wzrastał na drodze kolejnych podziałów mitotycznych. zygotach. profaza I nie zostaje zakończona w życiu płodowym u psa i niektórych gryzoni. do uzyskania której wykorzystano komórkę nabłonkową pochodzącą z gruczołu mlekowego dorosłej owcy. Należy do nich oznaczanie płci zarodków i segregowanie plemników na frakcję z chromosomem X i frakcję z chromosomem Y. a także hodowanych w warunkach pozaustrojowych komórkach somatycznych. Na przykład. Chromosomy przedjądrza żeńskiego podlegają dekondensacji i równolegle z chromatyną przedjądrza męskiego przechodzą proces replikacji DNA. które są określane jako enukleowane. Chromosomy ulegają kondensacji i początkowo nadal występują jako dwa oddzielne zestawy chromosomów. pochodzącą z hodowli pozaustrojowej (komórka taka może być zmodyfikowana genetycznie). że zarówno produkcja zwierząt modyfikowanych genetycznie (zwierzęta transgeniczne). W hodowli zwierząt na szeroką skalę stosowane są następujące biotechniki wspomagające rozród: konserwacja nasienia w niskich temperaturach (kriokonserwacja). z których usunięto mikrochirurgicznie wrzeciono podziałowe (chromosomy w stadium metafazy II).

McCarty. C. DNA charakteryzuje się trzema właściwościami. które są niezbędne do pełnienia funkcji nośnika informacji genetycznej. w sekwencji nukleotydów zapisana jest. Po trzecie. Budowa kwasów nukleinowych Zapis informacji genetycznej oraz jej ujawnienie się w postaci cechy (ekspresja genu) związane są z funkcjonowaniem kwasów nukleinowych. Po drugie. informacja o pierwszorzędowej strukturze białek. a także o strukturze cząsteczek rybosomowego (rRNA).Rozdział 3 Gen i jego ekspresja Znaczenie kwasu deoksyrybonukleinowego (DNA) jako nośnika informacji genetycznej zostało udowodnione w 1944 roku dzięki eksperymentowi. Po pierwsze. Crick przedstawili model budowy DNA. za pomocą kodu genetycznego. Efektem tego doświadczenia było nabycie przez niektóre bakterie niepatogenne cech zjadliwości.D. które z kolei podlegają rekombinacjom podczas mejozy.1. przypisując poszczególnym trójkom nukleotydów odpowiednie aminokwasy. który polegał na transformacji niepatogennych bakterii — dwoinek zapalenia płuc z wykorzystaniem DNA wyizolowanego ze szczepu patogennego. U zdecydowanej większości organizmów nośnikiem informacji genetycznej jest DNA. Tylko u nielicznych wirusów (retrowirusy) informacja genetyczna jest zawarta w kwasie rybonukleinowym (RNA). Watson i F. W 1953 roku J. czyli procesowi generującemu pierwotną zmienność genetyczną. DNA może podlegać mutacjom.T. transportującego (tRNA) i niekodującego (ncRNA) kwasu rybonukleinowego. DNA ma zdolność do samoodtwarzania się. Badania te przeprowadzili badacze amerykańscy O. Avery. a przez następne lata rozszyfrowywano kod genetyczny. Z kolei proces ekspresji 48 . 3. czyli replikacji. MacLeod i M. W ślad za tym odkryciem nastąpiły następne.M.

które są organellami komórkowymi odpowiedzialnymi za przeprowadzenie translacji. W rdzeniu każdego łańcucha polinukleotydowego cząsteczki deoksyrybozy połączone są ze sobą poprzez resztę kwasu fosforowego wiązaniami fosfodiestrowymi między atomem węgla w pozycji 5' jednej cząsteczki cukru i atomem węgla 3' sąsiedniej cząsteczki deoksyrybozy. rRNA (rybosomowy RNA) — stanowiący część strukturalną rybosomów. w którego skład wchodzą: zasada azotowa. który jest zaangażowany w proces translacji poprzez dostarczanie do rybosomów właściwych aminokwasów. które zaliczane są do puryn: adenina (A) i guanina (G) lub pirymidyn: ty mina (T) i cytozyna (C). i tRNA (transportujący RNA). 3.genu jest nierozerwalnie związany z RNA. DNA Cząsteczka DNA składa się z dwóch owiniętych prawoskrętnie wokół siebie łańcuchów polinukleotydowych. występującym w trzech podstawowych wariantach: mRNA (informacyjny RNA) — powstający podczas transkrypcji genu. W DNA występują cztery zasady azotowe. helix). Struktura ta określana jest w języku polskim terminem podwójna helisa (ang.1. a rzadziej podwójny heliks. cukier deoksyryboza i reszta kwasu fosforowego (ryć.1. Podstawową jednostką struktury DNA jest deoksyrybonukleotyd. Cząsteczki zasad azotowych połączone są wiązaniami N-glikozydowymi 49 . 3-1).

Liczba tych obszarów jest cechą charakterystyczną kariotypu danego gatunku. powstaje pre-rRNA o stałej sedymentacji 45S. Pomiędzy zasadami powstają słabe wiązania wodorowe. Ze względu na ich szerokość określa się je jako bruzdę większą i mniejszą. tzn. inaczej nazywanych przewężeniami wtórnymi. prowadzonej przez polimerazę I RNA. RNA Kwasy rybonukleinowe są cząsteczkami zbudowanymi z pojedynczych łańcuchów polinukleotydowych. w których zamiast deoksyrybozy występuje ryboza oraz zamiast zasady pirymidynowej — tyminy (T) występuje inna pirymidyna — uracyl (U). lecz częściej stosuje się określenie liczba par zasad (skrót: pz w jęz. że sekwencja nukleotydów w jednej nici jest różna od sekwencji nukleotydów w drugiej nici. W jąderku zlokalizowane są cztery rodzaje rRNA.2. Przyjmuje się.z atomami węgła występującymi w pozycji l' cząsteczki deoksyrybozy i są skierowane do wnętrza podwójnej helisy. a w parze GC trzy takie wiązania. określaną wielkością S — stała sedymentacji. Trzy rodzaje rRNA: 5. a naprzeciw guaniny znajduje się cytozyna. który wraz z białkami tworzy strukturę rybosomów i uczestniczy w przeprowadzaniu translacji. Długość cząsteczki DNA wyraża się liczbą par nukleotydów. W ogólnej puli RNA występujących w komórce najliczniej reprezentowany jest rybosomowy RNA (rRNA).1. Polaryzacja łańcuchów ma bardzo ważne znaczenie dla przebiegu procesu replikacji i transkrypcji. które są wyróżniane ze względu na wielkość cząsteczki. Zwijające się wokół siebie łańcuchy polinukleotydowe tworzą na powierzchni podwójnej helisy dwie bruzdy biegnące spiralnie. że w obszarze jęderkotwórczym występuje nawet kilkadziesiąt powtórzeń genu kodującego prekursorową cząsteczkę 45S rRNA. Taka organizacja podwójnej helisy DNA sprawia. 3. Polaryzacja łańcucha związana jest z występowaniem na jego końcach wolnych atomów węgla. Podczas transkrypcji.8S. Przeciwna polaryzacja polega na tym. którego długość wynosi około 14 000 pz. Ułożenie zasad azotowych w łańcuchach polinukleotydowych podwójnej helisy DNA oparte jest na zasadzie komplementarności. 18S i 28S są kodowane przez geny umiejscowione w obszarach jąderkotwórczych (ang. a w przypadku mRNA także dla procesu translacji. polskim lub bp od słów angielskich base pairs). Łańcuchy polinukleotydowe DNA są przeciwnie spolaryzowane. z której po obróbce formowane są wspomniane wyżej trzy rodzaje rRNA. że naprzeciw końca 3' jednego łańcucha znajduje się koniec 5' drugiego łańcucha. czyli każdy łańcuch ma koniec 3' i 5'. natomiast liczba aktyw50 . tak więc w parze AT są dwa wiązania wodorowe. bo skierowane do wnętrza podwójnej helisy zasady azotowe stanowią jakby szczeble drabiny. naprzeciw adeniny zawsze występuje tymina. nucleolar organizer region — NOR).

jest zmienna. występujący w wielu powtórzeniach w innej części genomu. W strukturze tRNA wyróżnia się cztery pętle: 1) pętla I (licząc od końca 5') — uczestniczy w wiązaniu się z enzymem syntetazą aminoacylową. zatem 18S rRNA występuje w podjednostce małej (40S) rybosomu. 51 . która katalizuje związanie tRNA z. Cząsteczka tRNA jest zbudowana z mniej niż 100 nukleotydów. Na końcu 3' cząsteczki tRNA występuje sekwencja CCA. Geny 5S rRNA są transkrybowane przez polimerazę III RNA. zlokalizowane są w podjednostce dużej (60S).nych obszarów. 4) pętla IV — zaangażowana jest w wiązanie się kompleksu aminoacylo-tRNA z rybosomem.właściwym aminokwasem. W nici takiej mogą jednak występować fragmenty komplementarne. Dobrze poznanym rodzajem RNA jest transportujący RNA (tRNA). które podlegają transkrypcji. co oznacza. 2) pętla II — antykodonowa. 3-2). Wymienione rodzaje rRNA uczestniczą w budowie rybosomu. o mało poznanej funkcji. Czwarty rodzaj — 5S rRNA jest kodowany przez gen.8S i 28S. czyli takich. zawiera układ trzech nukleotydów. Liczba różnych cząsteczek tRNA występujących w komórce zawiera się w przedziale od 40 do 60. które po połączeniu wiązaniami wodorowymi między komplementarnymi zasadami azotowymi tworzą strukturę przestrzenną takiej cząsteczki. tzn. Tak jak w przypadku innych cząsteczek RNA także i ten rodzaj zbudowany jest z pojedynczego łańcucha polinukleotydowego. 3) pętla III — dodatkowa. które są komplementarne do kodonu aminokwasu transportowanego przez tRNA. a trzy pozostałe rodzaje. a jej struktura jest bardzo charakterystyczna i przypomina liść koniczyny (ryć. że przekracza liczbę znanych aminokwasów. w której do rybozy nukleotydu adenylowego jest przyłączany aminokwas. 5S. 5. który jest zaangażowany w dostarczanie aminokwasów do rybosomów.

a średnia wielkość jednego replikonu wynosi około 150 000 par nukleotydów. Replikon zawiera miejsce rozpoczęcia i zakończenia replikacji.2. z tym jednak że przed drugim podziałem mejotycznym nie dochodzi do replikacji. 3. modyfikacji nukleotydów. Replikacja DNA Proces samoodtwarzania się (replikacji) DNA przebiega w fazie S cyklu życiowego komórki i jest niezbędnie potrzebny do przeprowadzenia podziału jądra komórkowego. liczba replikonów w genomie ssaków szacowana jest na około 25 000. Struktura cząsteczek mRNA jest opisana w części dotyczącej procesu transkrypcji. Każdy podział mitotyczny musi być poprzedzony replikacją. noncoding RNA).Informacyjny RNA (mRNA) powstaje podczas transkrypcji genów ulegających ekspresji w komórce i z tego względu jest to najbardziej zróżnicowana klasa kwasów rybonukleinowych. Na przykład. Z powodu ogromnej długości cząsteczek DNA zawartych w chromosomach replikacją rozpoczyna się równocześnie w wielu miejscach. które określane są jako replikony. określana terminem niekodujący RNA (ncRNA — ang. czyli mitozy. a także regulacji ekspresji genów. że jest to bardzo ważna grupa RNA. 52 . Podobnie jest w przypadku mejozy. Ostatnie badania wykazują. Na uwagę zasługuje jeszcze jedna klasa RNA. która bierze udział w procesie wycinania intronów z pre-mRNA. bądź mejozy.

Tryplet AUG. Nić syntetyzowana w sposób ciągły jest nazywana prowadzącą. jest on uniwersalny. Po drugie. to ogółem możliwe jest utworzenie 64 trójek (tab. Rozplecione łańcuchy polinukleotydowe stanowią matryce. że po replikacji dwie nowo powstałe cząsteczki DNA składają się z jednego starego łańcucha i jednego nowego. który ma być wbudowany w procesie biosyntezy białka. na których w sposób komplementarny syntetyzowane są drugie łańcuchy. np. fragmenty Okazaki). Tym samym tylko jeden z tych łańcuchów zawiera informację i nić ta nazywana jest sensowną. Kod genetyczny Informacja genetyczna jest zapisana w DNA za pomocą kodu genetycznego. Po pierwsze. 3. a ich wystąpienie powoduje zatrzymanie procesu biosyntezy polipeptydu. Taki sposób replikacji nazywany jest semikonserwatywnym (półzachowawczym). są różne. Przyłączanie kolejnych nukleotydów katalizowane jest przez enzym polimerazę DNA. Oznacza to. widełki replikacyjne (ryć. tryplet) w DNA zawierają informację o aminokwasie. 3-3). tzn. o czym była już mowa wyżej. 3-1). Wśród nich jest 61 trójek sensownych oraz trzy kodony nonsensowne.Replikacja obejmuje dwa zasadnicze etapy: rozplecenie podwójnej helisy DNA i dobudowanie komplementarnych łańcuchów polinukleotydowych. Drugi. Ponieważ każdy kodon składa się z trzech spośród czterech nukleotydów. Wynika z tego. że kierunek budowania komplementarnego łańcucha jest ściśle określony i postępuje od końca 5' w kierunku 3' (5'→3'). kodon UGA w kodzie uniwersalnym jest 53 . tzn. Od tej zasady są tylko nieliczne wyjątki. Komplementarne ułożenie nukleotydów w dwóch łańcuchach polinukleotydowych cząsteczki DNA sprawia. komplementarny łańcuch polinukleotydowy pełni funkcję matrycy (nić matrycowa) w procesie transkrypcji. kod ma charakter trójkowy. Na drugim łańcuchu dobudowywane są krótkie fragmenty (tzw. które nie kodują żadnego aminokwasu. takie. W efekcie tylko na jednym łańcuchu matrycowym replikującej cząsteczki DNA dobudowywanie nowego łańcucha przebiega w sposób ciągły. trzy kolejne nukleotydy (kodon. a nić powstająca w sposób nieciągły opóźnioną. W ten sposób powstają tzw. który odpowiada za powstanie wiązania estrowego między atomem węgla 3' (wolna grupa 3'-OH) wydłużanego łańcucha i nowym nukleotydem (trifosforanem nukleozydu). w całym świecie ożywionym funkcjonuje ten sam system kodowania informacji genetycznej. które następnie są łączone przez enzym ligazę w ciągłą nić. Kod genetyczny ma kilka cech o podstawowym znaczeniu dla jego funkcjonowania. że sekwencje nukleotydów w tych łańcuchach. mającego charakter trójkowy. tzn. rozpoczyna część kodującą genu. które dotyczą niektórych kodonów w mitochondrialnym DNA. który odpowiada za wbudowanie metioniny w łańcuchu polipeptydowym. w obrębie danego odcinka DNA.3.

kodonem stop, a w mitochondrialnym DNA ssaków odpowiada za włączenie tryptofanu do łańcucha polipeptydowego. Po trzecie, kod genetyczny jest zdegenerowany, co wynika z faktu znacząco większej liczby kodonów niż aminokwasów. W rezultacie prawie każdy aminokwas, z wyjątkiem metioniny i tryptofanu, jest kodowany przez więcej niż jedną trójkę (maksymalnie przez sześć kodonów, w przypadku leucyny i argininy). Po czwarte, kod genetyczny jest nie zachodzący na siebie i bezprzecinkowy, czyli kodony są ułożone kolejno jeden za drugim bez nukleotydów je rozdzielających. W efekcie podczas translacji sekwencja nukleotydów w mRNA jest odczytywana w sposób ciągły.

3.4. Transkrypcja
Pierwszym etapem procesu ekspresji genu jest transkrypcja, która polega na syntezie informacyjnego kwasu rybonukleinowego (mRNA) na matrycowej nici DNA. Transkrypcja rozpoczyna się od rozplecenia podwójnej helisy DNA i przyłączenia polimerazy RNA do sekwencji promotora, która poprzedza część strukturalną genu. Związanie się polimerazy RNA z pro54

motorem jest uzależnione od równoczesnego przyłączenia się w tym miejscu zespołu białek (czynniki transkrypcyjne), które kontrolują przebieg transkrypcji. Łańcuch mRNA jest syntetyzowany w kierunku od końca 5' do końca 3' (5'→3'), czyli kierunek tej reakcji jest taki sam jak przy replikacji. Z kolei matrycowa nić DNA (komplementarna do nici sensownej) jest odczytywana w kierunku 3'→5'. Dzięki temu powstający mRNA ma sekwencję nukleotydów zgodną z sekwencją nici sensownej DNA (ryć. 3-4). Ponieważ u organizmów eukariotycznych geny zbudowane są w części strukturalnej z fragmentów kodujących (eksony) i niekodujących (introny), to z pierwotnego transkryptu FINA (pre-mRNA) muszą być usunięte introny. Proces polegający na ich wycinaniu nazywany jest składaniem RNA (ang. splicing) i stanowi istotną część tzw. obróbki potranskrypcyjnej pre-mRNA, która jest drugim etapem ekspresji genu. Poza wycięciem intronów, na końcu 3' mRNA

dobudowana jest sekwencja poliA, a na końcu 5' dołączona zostaje 7-metyloguanozyna (tzw. czapeczka lub inaczej kapturek, ang. cap). Podczas transkrypcji powstają obok cząsteczek mRNA, pełniących funkcję matrycy, na której syntetyzowany jest łańcuch polipeptydowy, także inne cząsteczki kwasów rybonukleinowych, mających zasadniczą rolę w translacji (tRNA i rRNA).

3.5. Translacja
Po zakończeniu obróbki potranskrypcyjnej mRNA przechodzi do cytoplazmy i tam łączy się z rybosomami, co rozpoczyna kolejny etap ekspresji genu, jakim jest translacja. W procesie tym na matrycy mRNA budowany jest łańcuch polipeptydowy (ryć. 3-5). Synteza łańcucha polipeptydowego rozpoczyna się zawsze od aminokwasu metioniny, który jest kodowany przez trójkę nukleotydów AUG znajdującą się na końcu 5' mRNA. Metionina łączy się z tzw. inicjatorowym tRNA dla metioniny i taki kompleks jest wiązany z rybosomem, a antykodon tego tRNA wiąże się komplementarnie z pierwszym kodonem na końcu 5', jakim jest zawsze AUG. Następnie do rybosomu dostarczany jest kolejny aminokwas, przez właściwy tRNA, którego antykodon jest komplementarny do drugiego kodonu mRNA. Po wprowadzeniu drugiego aminokwasu dochodzi do powstania wiązania peptydowego między nim i metioniną w taki sposób, że nie związana grupa karboksylowa pierwszego aminokwasu — metioniny łączy się z nie związaną grupą aminową drugiego aminokwasu. Wynika z tego, że polipeptyd jest wydłużany od końca NH 2 do końca COOH. Zsyntetyzowany dipeptyd jest związany z tRNA dla drugiego aminokwasu, a rybosom przesuwa się o jeden kodon w kierunku końca 3' uwalniając jednocześnie inicjatorowy tRNA dla metioniny. Synteza łańcucha polipeptydowego postępuje w ten sposób do momentu, kiedy rybosom obejmie jeden z trzech kodonów nonsensownych, a więc kodonów stop (UAA, UAG lub UGA). Z chwilą osiągnięcia kodonu stop następuje zakończenie translacji i uwolnienie łańcucha polipetydowego. Uwolniony łańcuch polipeptydowy podlega modyfikacjom potranslacyjnym, w wyniku których zostaje uformowana ostateczna postać białka. Modyfikacje potranslacyjne obejmują zmiany dotyczące wiązań chemicznych (np. rozerwanie wiązania peptydowego) w obrębie polipeptydu, modyfikacje końca aminowego lub karboksylowego polipeptydu oraz modyfikacje łańcuchów bocznych aminokwasów wchodzących w skład polipeptydu. Ostatnia z wymienionych kategorii modyfikacji potranslacyjnych jest najczęściej spotykana i polega na przyłączaniu różnych grup chemicznych w wyniku np.: glikozylacji (przyłączanie reszt cukrowych), fosforylacji (przyłączanie grup fosforanowych, głównie reszty kwasu fosforowego), metylacji (przyłączanie grupy metylowej), acetylacji (przyłączanie grupy reszty acetylowej) itp. 56

3.6. Budowa genu
Gen jest podstawową jednostką dziedziczności i zajmuje ściśle określone miejsce (locus) w chromosomie lub też występuje poza jądrem komórkowym, wewnątrz mitochondriów i chloroplastów (dotyczy roślin). Zmiany w obrębie genu — mutacje genowe prowadzą do powstania form allelomorficznych,
57

czyli alleli. Zatem, cechą genu jest także podleganie mutacjom, które mogą się ujawniać fenotypowo. Należy jednak zaznaczyć, że nie każda mutacja przejawia się fenotypowo. Jeśli mutacja nie zmieni sensu zapisu genetycznego, np. zmutowany kodon odpowiada za włączenie tego samego aminokwasu co kodon niezmutowany (kod genetyczny jest zdegenerowany) lub mutacja wystąpi w obrębie intronu (introny są wycinane w trakcie obróbki potranskrypcyjnej pre-mRNA), to ujawnienie fenotypowe nie nastąpi. Mutacja nie wywołująca zmiany w budowie kodowanego produktu doprowadzi jedynie do powstania allelu, którego obecność może być wykryta poprzez bezpośrednie badanie DNA. W takiej sytuacji można mówić o polimorfizmie DNA danego genu. Gen jest również podstawową jednostką uczestniczącą w rekombinacji genetycznej podczas podziału mejotycznego. Pod względem molekularnym gen jest regionem DNA, który podlega transkrypcji. W ramach genu rozumianego jako jednostka transkrypcyjna należy wyróżnić część strukturalną genu, czyli ten fragment DNA, w którym zawarta jest informacja genetyczna o produkcie (białko, rRNA, tRNA), oraz sekwencje regulatorowe, które odpowiadają za uruchomienie transkrypcji (ryć. 3-6). Część strukturalna genu składa się z eksonów, czyli sekwencji, które po transkrypcji uczestniczą w translacji, oraz intronów, które są wycinane z pre-mRNA podczas składania RNA (ang. splicing) i nie uczestniczą w translacji. Oprócz tego z obu stron części strukturalnej (na końcu 5' i 3') występują sekwencje oskrzydlające (ang. untranslated region — UTR) części kodujące pierwszego i ostatniego eksonu. Sekwencje oskrzydlające nie podlegają translacji. Zgodnie z wcześniej opisanym fenomenem polarności cząsteczki DNA należy podkreślić, że początek genu znajduje

58

się na końcu 5', a koniec genu na końcu 3'. Pierwszy ekson (koniec 5') rozpoczyna sekwencja ATG, która koduje metioninę (kodon AUG w mRNA) — pierwszy aminokwas każdego polipeptydu. Z kolei na końcu 3' genu, po sekwencji „stop" (kodony TAA, TAG lub TGA), pojawia się sekwencja AATAAA, która koduje sygnał rozpoczęcia poliadenylacji pre-mRNA podczas obróbki potranskrypcyjnej, a za nią znajduje się sekwencja (GT)n odpowiedzialna prawdopodobnie za zakończenie transkrypcji. Część regulatorowa genu obejmuje sekwencje promotora, wzmacniacza (ang. enhancer) i wyciszacza (ang. silencer). Promotor bezpośrednio poprzedza część strukturalną genu i pełni kluczową rolę w rozpoczęciu transkrypcji. W obrębie promotora występują dwie sekwencje o szczególnym znaczeniu. W odległości około 30 pz od miejsca inicjacji transkrypcji występuje sekwencja TATA (ang. TATA-box), której obecność jest niezbędna do przyłączenia polimerazy II RNA. Przyłączenie polimerazy wymaga równoczesnego powiązania grupy białek (czynniki transkrypcyjne) z promotorem. Sekwencja CAAT znajduje się około 70-90 pz przed miejscem rozpoczęcia transkrypcji. Przypuszcza się, że również ta sekwencja bierze udział w procesie regulacji transkrypcji. Warto wreszcie zwrócić uwagę, że większość genów (około 56%) zawiera w obrębie promotora sekwencję składającą się z licznych powtórzeń dinukleotydu CG, które są nazywane wysepkami CpG. Wysepki CpG towarzyszą wszystkim genom ulegającym powszechnej ekspresji, tzn. we wszystkich komórkach. Są to geny pełniące funkcję gospodarza komórki (ang. housekeeping genes), czyli ich ekspresja jest konieczna do funkcjonowania komórki. Sekwencje regulujące typu wzmacniacza i wyciszacza mogą być położone w znacznej odległości od genu, którego ekspresja znajduje się pod ich kontrolą, dzięki oddziaływaniu na nie czynników transkrypcyjnych. Wzmacniacz jest odpowiedzialny za nasilenie transkrypcji genu, a wyciszacz za spowolnienie tego procesu. Położenie tych sekwencji względem genu jest bardzo zróżnicowane i może występować przed lub za genem, a nawet w jego obrębie, w jednym z intronów. Wielkość genu, a konkretnie jego części strukturalnej, mieści się w bardzo szerokich granicach od kilkuset par nukleotydów (pz) do ponad dwóch milionów pz. Przykładem bardzo małego genu jest gen SRΥ, który zawiera tylko jeden ekson, składający się z 669 nukleotydów. Produktem tego genu jest białko o długości 223 aminokwasów, odpowiedzialne za ukierunkowanie rozwoju niezróżnicowanej gonady płodowej w jądro. Gigantycznym genem jest ludzki gen DMD kodujący białko dystrofinę, które jest zbudowane z 3685 aminokwasów. Gen ten jest zbudowany z około 2,5 min pz i w jego skład wchodzi 79 eksonów i 78 intronów, ale tylko 0,6% długości tego genu obejmuje część kodującą. Mutacje w tym genie odpowiedzialne są za rozwój groźnej choroby genetycznej człowieka — dystrofii mięśniowej Duchenne'a, która prowadzi do zaniku mięśni. 59

Z drugiej strony. Podczas wycinania intronów możliwe jest zróżnicowane składanie ostatecznego transkryptu. replikacja DNA. badania serologiczne — grupy krwi. Jest to bardzo złożony proces. czyli ich fenotypowe ujawnianie się w postaci odpowiedniej cechy. czyli dobudowa60 . Podczas rozwoju ontogenetycznego. Wśród nich znaczną grupę stanowią geny pełniące tzw. budowa struktur komórkowych itp. Ekspresja genu obejmuje procesy: transkrypcji. co ma oczywiście związek z ekspresją genów. Regulacja ekspresji genów zachodzi najczęściej na poziomie transkrypcji. regulacji stabilności mRNA i jego transporcie do cytoplazmy oraz potranslacyjnej modyfikacji białek. W przypadku cech uwarunkowanych przez dużą liczbę genów o nie poznanej jeszcze funkcji (tzw.) lub też można obserwować właściwość fenotypową organizmu będącą efektem obecności określonego białka (np. które mogą występować w układzie homo. podatność na stres itp. obok genów ulegających powszechnej ekspresji. Warto pamiętać.3.lub heterozygotycznym. Ukształtowane w ten sposób białko można zidentyfikować i analizować metodami laboratoryjnymi (np. które są zaangażowane w kontrolę ekspresji genów.). elektroforeza białek. wśród których geny o działaniu sumującym mają podstawowe znaczenie) fenotyp opisuje się za pomocą estymatorów statystycznych. Zakończenie transkrypcji związane jest z sekwencją AAUAAA. obejmuje także inne procesy. oprócz zmian opisanych w podrozdziale poświęconym transkrypcji. translacji i potranslacyjnej modyfikacji białka. potranskrypcyjnej modyfikacji mRNA. którego całościowe poznanie wymaga jeszcze wielu lat badań. umaszczenie. w zróżnicowanej komórce ekspresja niektórych genów może być okresowo włączana lub wyłączana. Budowa mRNA może być modyfikowana również przez wybór miejsca terminacji transkrypcji. poligeny. Produkty kodowane przez te geny są zaangażowane w podstawowe procesy życiowe komórki. hybrydyzacja ze znakowanym przeciwciałem itp. Mechanizm ten nazywa się alternatywnym składaniem mRNA. zależnie od tego. jest włączana i wyłączana ekspresja różnych genów. takie jak: przemiany energetyczne. Regulacja ekspresji genu W genomie ssaków występuje około 35 tysięcy genów. że w komórce somatycznej każdy gen (oprócz genów położonych w chromosomach płci u samców) reprezentowany jest przez dwa allele. housekeeping genes). że w odległości około 10-30 nukleotydów od tego miejsca powinna nastąpić poliadenylacja transkryptu. Geny z tej grupy podlegają ekspresji we wszystkich komórkach. funkcje gospodarza komórki (ang. która wskazuje. Modyfikacja mRNA. Niemniej znanych jest już wiele mechanizmów. w skład którego będą wchodziły różne kombinacje eksonów. że kontrola ekspresji może również polegać na potranskrypcyjnej modyfikacji mRNA. obecność rogów. zatem poznanie mechanizmów odpowiedzialnych za podjęcie transkrypcji przez dany gen ma znaczenie podstawowe. w jakim kierunku różnicuje się dana komórka.7. Należy jednak pamiętać.

który jest krótszy o dwa eksony w porównaniu z mRNA dla formy zakotwiczonej w błonie plazmatycznej limfocytów B. dodatkowego kodonu stop. Czynniki transkrypcyjne. Czynniki transkrypcyjne Czynnikami transkrypcyjnymi nazywane są białka. Forma rozpuszczalna tego białka powstaje na matrycy mRNA. W przypadku hormonów steroidowych regulacja ekspresji genów przebiega z udziałem receptorów wewnątrzkomórkowych. Białka te w swojej strukturze zawierają dwa istotne obszary.7. białka o strukturze typu heliks-skręt-heliks (ang.nie sekwencji poliA (tzw. przed przejściem do cytoplazmy. Ekspresja genów kodujących czynniki transkrypcyjne może zależeć od innych czynników transkrypcyjnych lub pozostawać pod kontrolą stymulatorów pozakomórkowych. Taką formę modyfikowania mRNA opisano m. odpowiedzialne za syntezę polipeptydów o różnej długości. leucine zipper). powstałe na bazie tego samego matrycowego DNA. Efektem tego może być na przykład pojawianie się w transkryptach. zinc finger). 3. ogonek poliA) na końcu 3' mRNA. Hormon steroidowy po wniknięciu do komórki łączy się z właściwym białkiem receptorowym. czyli od jego stabilności. w przypadku niektórych genów kodowanych przez mitochondrialny DNA (mtDNA). zależnie od ich struktury trzeciorzędowej. Wymienione struktury wchodzą w kontakt z nicią DNA. modyfikacjom polegającym na zmianie sekwencji nukleotydów. Okazuje się. że niektóre geny mogą mieć kilka miejsc poliadenyłacji i dlatego na tej samej matrycy DNA mogą powstawać różne transkrypty. Przykładem takiej sytuacji jest występowanie dwóch miejsc poliadenyłacji w genie łańcucha ciężkiego immunoglobulin. są zaliczane do następujących grup: białka zawierające tzw. Jeden odpowiada za wiązanie się czynnika transkrypcyjnego z właściwą sekwencją nukleotydów w obrębie promotora lub wzmacniacza. Kompleks hormon-receptor wnika do jądra komórkowego i tam wiąże się z sekwencjami regulatorowymi genu docelowego lub genu kodującego odpowiedni czynnik 61 . Proces ten nazywa się redagowaniem mRNA. a drugi obszar zaangażowany jest w łączenie się z polimerazą RNA lub innymi czynnikami transkrypcyjnymi. takich jak hormony.1. Intensywność procesu biosyntezy łańcuchów polipeptydowych zależy od liczby kopii mRNA wędrujących z jądra do cytoplazmy oraz od czasu trwania mRNA w cytoplazmie. palce cynkowe (ang. Sposób oddziaływania hormonów na ekspresję genów jest zróżnicowany (ryć. helix-turn-helix) i białka o strukturze określanej terminem zamek leucynowy (ang. Wreszcie mRNA powstały podczas transkrypcji może ulegać. które wiążąc się z sekwencjami regulatorowymi genu umożliwiają przyłączenie polimerazy RNA i rozpoczęcie transkrypcji. powstających w niektórych tkankach. 3-7).in. Funkcjonują wówczas dwa rodzaje mRNA.

R — receptor hormonu peptydowego. 3. których mechanizm działania jest jeszcze słabo rozpoznany. gdy do receptora jest przyłączony hormon steroidowy. HS — hormon steroidowy. Poznanie genów od62 . insulina itp. RS — receptor hormonu steroidowego. 3-7. T1 T2 — przekaźniki wewnątrzkomórkowe. co można uznać za regulację ekspresji genów na etapie potranslacyjnym. W ich wyniku sygnał zostaje przeniesiony od zaktywowanego receptora błonowego do jądra komórkowego za pomocą wewnątrzkomórkowych przekaźników.7. lub też z udziałem przekaźników modyfikujących białka w cytoplazmie. Pl P2 — promotory genów. a z drugiej strony od różnicowania się komórek.2. Geny homeotyczne Ukształtowanie się wielokomórkowego organizmu z jednokomórkowej zygoty zależy z jednej strony od intensywnych podziałów komórkowych.) nie wnikają do wnętrza komórki.Ryć. Receptor hormonu steroidowego ma domenę wiążącą DNA oraz domenę wiążącą hormon. Domena wiążąca DNA jest aktywna tylko wówczas. Wiązanie takie wywołuje wiele reakcji. G2 — części strukturalne genów transkrypcyjny uczestniczący w regulacji ekspresji kolejnego genu. Gj. Hormony peptydowe (np. a jedynie wiążą się z receptorami błonowymi. Schemat regulacji ekspresji genów za pomocą hormonów. Oznaczenia: HP — hormon peptydowy. hormon wzrostu.

Struktura tych genów wykazuje zaskakujące podobieństwo. Do promotorów mających niezmetylowaną cytozynę w wysepkach CpG mogą się przyłączyć czynniki transkrypcyjne niezbędne do ekspresji genu. że metylacja DNA w sekwencjach regulatorowych może mieć istotne znaczenie dla ekspresji genu. położonych w jednym chromosomie. Wynika z tego. które w genomie muszki owocowej występują w dwóch kompleksach. Postęp w tym obszarze wiedzy osiągnięto dzięki badaniom prowadzonym na muszce owocowej. U ssaków geny te. 3. Geny o podobnej budowie i funkcji zidentyfikowano także u kręgowców i nazwano je genami HOX. Wreszcie za różnicowanie się poszczególnych segmentów odpowiadają geny homeotyczne. HOX3 i HOX4. która koduje fragment białka (tzw. W obrębie kompleksu loci genów ułożone są w porządku włączania ich ekspresji. Domena ta jest odpowiedzialna za utworzenie struktury charakterystycznej dla czynników transkrypcyjnych typu heliks-skręt-heliks. a wyjątek stanowią dinukleotydy CpG (wysepki CpG) występujące w obrębie promotorów w genach aktywnych transkrypcyjnie. Geny te funkcjonują w układzie hierarchicznym. ich ekspresja następuje w ściśle określonej kolejności. HOX2. Rozwój muszki owocowej przebiega pod kontrolą genów. ANT-C i BX-C. Następnie kilka grup genów kieruje ukształtowaniem się segmentów ciała wzdłuż osi podłużnej. tzn. Oznacza to. Pierwszy segment zawiera geny odpowiedzialne za różnicowanie głowy i przedniej części tułowia. że mają one sekwencję o długości około 180 pz (tzw. Ekspresja kolejnych genów odpowiada za różnicowanie się kolejnych segmentów ciała. domena białkowa) o długości 60 aminokwasów. Trzeba jednak podkreślić. w liczbie około 30. Obok wielu genów. Metylacja wywołuje zmianę powinowactwa DNA do czynników transkrypcyjnych oraz reorganizację nici nukleosomowej. która polega przede wszystkim na przyłączaniu grupy metylowej do cytozyny. że nie wszystkie geny mają w obrębie promotora sekwencje CpG — szacuje się. homeoboks).powiedzialnych za rozwój zarodkowy i płodowy ma podstawowe znaczenie dla zrozumienia podłoża licznych wrodzonych wad rozwojowych. Najpierw uaktywniają się geny odpowiedzialne za orientację zarodka na część przednią i tylną.7. których transkrypcja jest hamowana poprzez metylację cytozyny w nukleotydach występujących 63 . a drugi za różnicowanie tylnych segmentów tułowia i segmentów odwłoka. Prawie cały DNA zawiera zmetylowaną cytozynę. które odpowiadają za poszczególne etapy morfogenezy. że brak metylacji wysepek CpG nie jest uniwersalnym sposobem uaktywniania ekspresji genów. zgrupowane są w czterech kompleksach: HOX1. Metylacja DNA Ważnym procesem wpływającym na ekspresję genów jest modyfikacja struktury DNA. że około 56% genów zawiera te sekwencje.3. Okazało się. czego skutkiem jest przejście DNA w stan nieaktywny.

w części poprzedzającej gen. Piętno gametyczne W klasycznym podejściu do zagadnienia ekspresji genów przyjmuje się równoważność alleli w parze. Jedynie zarodki zawierające zarówno genom żeński. Po replikacji nowo wbudowane nukleotydy zawierające cytozynę podlegają metylacji. wówczas gdy w matrycowej cząsteczce DNA naprzeciw guaniny występowała metylowana cytozyna. czyli ze strony końca 5'. rozwijały się dość dobrze. jak i męski rozwijały się prawidłowo. Jeśli pacjent odziedziczył tak uszkodzony chromosom od ojca. Zjawisko to niekiedy dotyczy całych regionów chromosomowych. a także w komórkach somatycznych organizmu dorosłego. gametic imprinting). typowy dla danej płci (ryć. W obu przypadkach dochodziło do obumarcia zarodka. czyli nie wpływa na prawidłowość replikacji wysepek CpG. Dopiero podczas gametogenezy dotychczasowe piętno gametyczne zostaje zniesione i ustala się wzór piętna. Piętno utrzymuje się podczas rozwoju zarodkowego i płodowego. w które zaangażowane są fragmenty podlegające piętnowaniu. czyli uczestniczące w formowaniu łożyska. genotyp Aa jest równoważny genotypowi aA. Piętno gametyczne prowadzi do zróżnicowanego fenotypowo ujawnienia się niektórych mutacji chromosomowych. znane są liczne geny. od którego z rodziców pochodzi allel A. dobrze rozwijały struktury trofoblastu.7. jeśli pochodzą od ojca. czy allel pochodzi od ojca. zależną od tego. Stan metylacji DNA badany jest z użyciem dwóch enzymów restrykcyjnych. 3. w której cytozyny nie są metylowane. tzn. czyli nieistotne jest. to 64 . od matki. jak i genom matki. tzn. 3-8). Jeden z nich -— HpaII przecina sekwencję CCGG. że do rozwoju osobniczego niezbędny jest zarówno genom ojca. tzn. znaleziono przy okazji obserwacji rozwoju partenogenetycznych zarodków myszy. czy od matki. były zdecydowanie niedorozwinięte. zawierające dwa genomy żeńskie. gdy pochodzą np. mające dwa genomy męskie. Natomiast zarodki androgenetyczne. lub aktywne. z tym jednak że struktury wywodzące się z trofoblastu. czy cytozyna jest metylowana. a nie tylko diploidalna liczba chromosomów. dla których nie obserwuje się zależności między transkrypcją i metylacją DNA. Jednak w przypadku niektórych genów stwierdza się zróżnicowaną ekspresję. czy niemetylowana. Piętnowanie alleli czy całych regionów chromosomu związane jest prawdopodobnie z metylacją DNA i występuje podczas gametogenezy (ang. Powstałe na drodze manipulacji zarodki ginogenetyczne. które mogą być nieaktywne. Metylacja cytozyny nie narusza komplementarności wiązania z guaniną. Dowód na to. a od którego allel a.4. Przykładem niech będzie delecja fragmentu przycentromerowego ramienia długiego chromosomu 15 (delecja 15ql-q3) u ludzi. a drugi — MspI przecina tę sekwencję niezależnie od tego. niedorozwinięty zaś był sam zarodek.

podczas gdy w zespole Angelmana dotyczy to właściwie tylko jednego genu (UBE3A — ang. że fragment chromosomu 15 podlega piętnowaniu gametycznemu. gdy paq"ent ma dwie kopie tego fragmentu chromosomowego pochodzące od matki (matczyna disomia). 3-8. a ekspresja odpowiadającego fragmentu chromosomu ojcowskiego jest wyłączona lub pacjent ma dwie ojcowskie kopie tego fragmentu chromosomowego (disomia ojcowska). ubiquitin protein ligase E3) pochodzenia matczynego. Wynika z tego. W zespole Angelmana brakuje fragmentu chromosomu 15 pochodzenia matczynego. otyłość i niedorozwój umysłowy).M r ZYGOTA 2ENSKA M P ZYGOT-A MĘSKA Ryć. W zespole Pradera-Willego stan jest następujący: brakuje fragmentu w chromosomie odziedziczonym od ojca.in. że w zespole Pradera-Willego występuje utrata ekspresji wielu genów pochodzenia ojcowskiego. Podobna sytuacja powstaje. smali nuclear ribonucleoprotein polypep65 . głębokie upośledzenie umysłowe. M — chromosom pochodzący od matki wówczas rozwija się zespół zmian fenotypowych (m.in. Fragment podlegający piętnowaniu w spermatogenezie jest zaciemniony. W efekcie pacjent nie ma żadnej aktywnej kopii genów występujących w części chromosomu objętego delecją. P — chromosom pochodzący od ojca. brak mowy.in. natomiast kilka genów (m. Piętnowanie gametyczne. jeśli pochodzi od ojca. Przyjmuje się. a fragment piętnowany w oogenezie jest zaznaczony kolorem czerwonym. który nosi nazwę zespołu Pradera-Willego. Tak więc. Natomiast odziedziczenie takiej samej mutacji od matki wywołuje zespół zmian (m. a inny w gametogenezie żeńskiej. Wiadomo. tylko jeden gen — UBE3A nie podlega ekspresji. drgawki) określanych jako zespół Angelmana. a odpowiedni homologiczny fragment w chromosomie pochodzącym od matki nie podlega ekspresji. że w krytycznym regionie 15ql-15q3 inny fragment jest piętnowany w gametogenezie męskiej. gen SNRPN — ang.

do którego nie może się przyłączyć białko (represor). Sytuacja ta jest spowodowana tym. W momencie przejęcia kontroli nad rozwojem zarodka przez jego własny genotyp oba chromosomy X są aktywne w zarodkach żeńskich (układ XX). Na przykład. a także 11 i 12 podlegają piętnowaniu. albo matczynego. które podlegają metylacji. które zachodzi podczas wczesnego rozwoju zarodkowego. nie ulega ekspresji. Okazało się. Podczas wtórnego piętnowania dochodzi do metylacji fragmentu promotora genu ojcowskiego. czyli aktywny pozostaje albo chromosom pochodzenia ojcowskiego. Przykładem może być gen Igf2 (ang. insulin growth factor type 2) u myszy. Szczegółowe badania przeprowadzone u myszy ujawniły obecność wielu regionów chromosomowych. który podlega piętnowaniu podczas gametogenezy żeńskiej. W efekcie oba allele są transkrybowane. W komórkach żeńskich występują dwa chromosomy X. ale podobnie jak w komórkach męskich tylko jeden chromosom X wykazuje aktywność transkrypcyjną. Obecnie znane są 34 geny. wywołujące zahamowanie transkrypcji.tide N). że piętnowanie w gametogenezie żeńskiej prowadzi do metylacji miejsca. 3. W zygocie oraz we wszystkich potomnych pokoleniach komórek somatycznych stan napiętnowania genu (-ów) jest utrzymywany. W momencie przechodzenia ze stadium moruli do stadium blastocysty następuje losowa inaktywacją jednego z chromosomów X. W komórkach męskich występuje tylko jeden chromosom X. a w zarodkach starszych oraz komórkach osobnika dorosłego występuje monoalleliczna ekspresja genu matczynego.5. że inaktywacją chromosomu X jest formą piętnowania. Stan taki określany jest terminem hemizygotyczności. które podlegają piętnowaniu gametycznemu u myszy. Inaktywacja chromosomu X w zarodkach żeńskich Szczególnym przykładem trwałej inaktywacji dużej części chromatyny jest fenomen związany z inaktywacją jednego z chromosomów X w zarodkach żeńskich. obok chromosomu Y.7. Powoduje to wstrzymanie ekspresji allelu ojcowskiego. W genie tym występują dwa regiony. 66 . duże fragmenty chromosomu 7. które są objęte zjawiskiem piętnowania gametycznego. Nałożenie się obu rodzajów piętnowania oraz obecność tkankowe specyficznego białka (czynnik transkrypcyjny) regulującego ekspresję genu prowadzi do ostatecznego ukształtowania się wzoru ekspresji genu w kolejnych stadiach rozwojowych i odpowiednich tkankach. Może się jednak zdarzyć. że gen napiętnowany podczas gametogenezy będzie powtórnie piętnowany podczas rozwoju osobniczego. co oczywiście uniemożliwia przyłączenie czynników transkrypcyjnych. niezbędnych do podjęcia transkrypcji. jeśli są położone w chromosomie pochodzącym od matki. W stadium przedimplantacyjnym zarodka oba allele (ojcowski i matczyny) podlegają ekspresji.

.

W cyklu życiowym komórki chromosom ten podlega typowym przemianom związanym z okresową kondensacją (przed i w trakcie podziału jądra komórkowego) i niepełną dekondensacją (podczas interfazy). Spełnia on funkcję regulacyjną. albo w chromosomie ojcowskim. albo matczynym. że w ludzkim chromosomie X centrum to występuje w ramieniu długim w obrębie prążka Xql3. 3-9). W ślad za ekspresją genu Xist w jednym z chromosomów X przebiega stopniowo inaktywacja kolejnych regionów tego chromosomu. . ciałka Barra. X inactive specific transcript).Wzór inaktywacji jest następnie utrzymany we wszystkich komórkach potomnych. w zakresie zmiany struktury chromatyny inaktywowanego chromosomu X. a część pochodzenia matczynego (ryć. W centrum inaktywacji zidentyfikowano locus Xist (ang. Proces inaktywacji rozpoczyna się od miejsca określanego jako centrum inaktywacji chromosomu X. Warto zaznaczyć. który to stan jest utrzymywany w komórkach potomnych. Początkowo ekspresji podlega tylko gen Xist położony w chromosomie ojcowskim i to odbywa się jeszcze przed rozpoczęciem procesu inaktywacji chromosomu X. Później. ekspresja genu Xist pojawia się losowo. Wiadomo. że nieaktywny chromosom X jest replikowany w późnym okresie fazy S. W konsekwencji organizm żeński jest swoistą mozaiką. które odzwierciedlają tempo replikacji poszczególnych regionów chromosomowych. Rozróżnienie aktywnego i nieaktywnego chromosomu X w metafazie mitotycznej jest możliwe po zastosowaniu metody barwienia prążkami R. że produktem locus Xist jest niekodujący RNA (ncRNA). a jego obecność ujawnia się w postaci tzw. w której część komórek ma aktywny chromosom pochodzenia ojcowskiego. Inaktywacja jest związana z metylacją DNA danego chromosomu. który pełni główną rolę w uruchomieniu inaktywacji. Inaktywowany chromosom X podlega kondensacji (heterochromatynizacji) w jądrze interfazowym. Barwienie to pokazuje.

że pierwsza litera stanowi skrót nazwy rodzaju bakterii. strawienia) DNA. Obecnie znanych jest już ponad 1000 restryktaz (w handlu dostępnych jest ponad 200) i tyleż samo metylaz. które rozpoznają te same sekwencje nukleotydów i modyfikują (metylują) je tak. substratów i produktów. wyizolowanie określonego odcinka DNA lub podzielenie cząsteczki DNA danego organizmu na krótsze fragmenty do dalszych szczegółowych badań. Nazewnictwo endonukleaz tworzone jest w ten sposób.Rozdział 4 4. np. by nie zostały przecięte przez endonukleazy. System ten polega na tym. w zależności od ich mechanizmu działania. W celu ochrony własnego DNA przed działaniem restryktaz. obce cząsteczki DNA. metody in situ) bądź w wyizolowanym DNA lub RNA. Endonukleazy restrykcyjne Analiza materiału genetycznego może być przeprowadzana bezpośrednio w komórkach (tzw. Endonukleazy dzieli się na trzy klasy. Do klasy I enzymów 69 . co umożliwia np. Większość metod wymaga fragmentacji (pocięcia. a także kofaktorów. bakterie wykształciły system restrykcji-modyfikacji. ponadto podawana jest cyfra rzymska oznaczająca numer kolejny enzymu wyizolowanego z danego gatunku bakterii. że bakterie wytwarzają dwa rodzaje enzymów. serotyp d i jest to trzeci (III) z kolei enzym uzyskany od tego gatunku i serotypu bakterii. Na przykład. Ponieważ obcy. niszcząc niepożądane. rozpoznające i przecinające (inaczej trawiące) określone sekwencje nukleotydów. druga i trzecia — gatunku. Endonukleazy restrykcyjne służą bakteriom do obrony przed inwazją wirusów. niszczony jest przez endonukleazy bakterii. DNA nie jest odpowiednio oznaczony (zmetylowany). następnie może być również stosowana litera określająca nazwę szczepu lub serotypu bakterii. wirusowy. W celu przecięcia cząsteczki DNA w ściśle określonym miejscu stosowane są izolowane z bakterii endonukleazy restrykcyjne. Jeden to endonukleazy.1. drugi to metylotransferazy (zwane też metylazami). nazywane inaczej enzymami restrykcyjnymi bądź restryktazami. enzym HindIII pochodzi z bakterii Haemophilus influenzae.

Tabela 4-1 Przykłady enzymów restrykcyjnych 70 . ale wzmacnia ich aktywność). które wykazują aktywność nukleazy. Klasę III stanowią restryktazy mające podobne właściwości do restryktaz klasy I. jony magnezu (Mg2+) i S-adenozylometionina. jak ATP. a ich działanie zależy od obecności takich kofaktorów. Przykłady endonukleaz klasy I i III zawarte są w tabeli 4-1. że odległość sekwencji rozpoznanej od sekwencji przecinanej przez enzym klasy III jest dla danego enzymu stała i wynosi średnio 25 nukleotydów. ale przecinają cząsteczkę DNA niespecyficznie w pewnej odległości (nawet do 1000 nukleotydów) od rozpoznanej sekwencji. jest to. Cechą tych enzymów. czyli wymagają obecności ATP i Mg2+ (obecność Sadenozylometioniny nie jest niezbędna. iż wprawdzie rozpoznają specyficzne sekwencje nukleotydów. utrudniającą ich wykorzystywanie w analizie DNA.zaliczane są te restryktazy. Różnica między tymi dwiema klasami polega na tym.

4-1). Enzymy te rozpoznają najczęściej sekwencje DNA złożone z 4 lub 6. tępe końce. sekwencje palindromowe). mogą być różne. rozpoznają te same sekwencje DNA. Niektóre enzymy przecinają cząsteczkę DNA w miejscach znajdujących się naprzeciw siebie.Najbardziej przydatne w analizie materiału genetycznego są enzymy restrykcyjne zaliczane do klasy II (przykłady w tab. lepkich końcach. Są to izoschizomery. czego konsekwencją jest powstawanie fragmentów DNA o tzw. Jednak miejsca. Końce te ułatwiają łączenie fragmentów DNA ze sobą w procesie rekombinacji molekularnej. w których enzymy przecinają te sekwencje. rzadziej 8 nukleotydów. dając fragmenty mające tzw. charakteryzujące się dwustronną symetrią (tzw. mimo że pochodzą z różnych szczepów bakterii. Fragmenty o tępych i lepkich końcach wyglądają następująco: Enzym Thal (pochodzący z bakterii Thermoplasma acidophilum) rozpoznaje i tnie sekwencję: Niektóre enzymy. Jednak większość endonukleaz przecina cząsteczki DNA w dwóch różnych miejscach. Izoschizomery Smal (Serratia marcescens) i Xmal (Kanthomonas mafaacearum) przecinają rozpoznaną sekwencję w różnych miejscach: .

in. do którego fragment ten został uprzednio włączony (rekombinacja molekularna). Warunki optymalne dla aktywności poszczególnych enzymów restrykcyjnych różnią się przede wszystkim temperaturą.3' 3'. • powinny mieć jeden lub kilka silnych promotorów tak. 4.od rozpoznawanej sekwencji. do sporządzania map genomowych..2. opisane pod względem fizycznym i genetycznym. diagnostyki chorób genetycznych (wykrywanie mutacji genowych) lub w analizie polimorfizmu długości fragmentów restrykcyjnych DNA (RFLP).GAAGA(N)8'. Niektóre enzymy potrzebują takich samych buforów. plazmidowy.. • miejsce rozpoznania przez enzym restrykcyjny nie powinno się znajdować w takim rejonie cząsteczki. drożdżowy) jest zdolny do autonomicznej replikacji. Wprowadzenie (transformacja) fragmentu DNA do komórki biorcy następuje za pośrednictwem wektora.CTTCT(N)7. HinPI) tną jednoniciowy DNA.. fagowy...5' podobnie enzym FokI (Flavobacterium okeanokoites): 5'.. • mają miejsca rozpoznawane przez różne endonukleazy restrykcyjne (uzyskanie lepkich końców)... Wektory charakteryzują się następującymi cechami: • są to niewielkie cząsteczki DNA. wykorzystywanym m.CCTAC(N)13. izolacji i identyfikacji genów. klonowania molekularnego i rekombinacji genów czy fragmentów genomu. Dokładne informacje o tych warunkach dostarczane są wraz z enzymami przez firmy biotechnologiczne.. Na przykład enzym MboII (Moraxella bovis) tnie cząsteczkę DNA następująco: 5'.. w której mieszanina DNA z enzymem jest inkubowana. Wykrycie bakteryjnych enzymów restrykcyjnych miało ogromne znaczenie dla rozwoju technik molekularnych.3' 3'. sekwencjonowania DNA... aby wstawiając 72 . Wektor (np. W zarysie klonowanie polega na namnożeniu fragmentu DNA w komórkach mikroorganizmów (głównie bakterii).5' Ponadto większość endonukleaz klasy II przecina dwuniciowe cząsteczki DNA. Są one podstawowym narzędziem.. mające zdolność do samodzielnej replikacji w cytoplazmie gospodarza... oraz składem buforu. Wektory Wektory są podstawowym narzędziem klonowania DNA. którego uszkodzenie powodowałoby zaburzenie możliwości jej replikacji. a tylko nieliczne enzymy (np..GGATG(N)9'.

Dzięki temu kosmidy łączą zalety wektorów plazmidowych i fagowych. Sekwencja cos umożliwia upakowanie DNA faga w otoczkę białkową. plazmidy i kosmidy. geny oporności na antybiotyki. „polilinker" (miejsce wielokrotnego klonowania). np. za pomocą których można je ziden tyfikować. np. gen β-galaktozydazy oznaczony symbolem lacZ. Wektory fagowe Spośród wektorów fagowych największe znaczenie ma fag λ. i dlatego są wykorzystywane w badaniach wielu genów eukariotycznych oraz do tworzenia bibliotek genomowych. którego sekwencje są rozpoznawane przez wiele enzymów restrykcyjnych. eliminacja miejsc rozpoznawanych przez enzymy restrykcyjne) otrzymano wiele pochodnych tego faga. długości 10-40 kpz.w ich sąsiedztwo fragment obcego DNA można było uzyskać efektywną ekspresję wprowadzonych genów. • ze względów etycznych wektor nie powinien mieć genów. umożliwiający bakteriom transformantom rozwój na pożywce zawierającej antybiotyk. • zawierają znaczniki (markery). Wektor plazmidowy musi zawierać region inicjacji replikacji DNA — replikon oznaczony symbolem ori. Kosmidy służą do klonowania większych cząsteczek DNA. Dzięki temu w wektor taki można wstawiać odcinki klonowanego DNA uzyskane przez trawienie odpowiednimi enzymami. przedstawiony jest na rycinie 4-1. • nie są zdolne do przeżycia poza komórką gospodarza. Przykładowy wektor plazmidowy pUC19. Do niektórych wektorów wprowadzono sekwencję umożliwiającą łatwą identyfikację zrekombinowanych bakterii. RODZAJE WEKTORÓW Wektorami najczęściej używanymi do klonowania DNA w komórkach prokariotycznych są bakteriofagi (fagi). Metoda selekcji rekombinantów zostanie omówiona w podrozdziale: Rekombinacja molekularna i klonowanie. gen oporności na antybiotyk. rozkładający barwny substrat. Najczęściej jest to gen kodujący enzym. Wektory plazmidowe Plazmidami są występujące u wielu gatunków bakterii kowalentnie zamknięte koliste cząsteczki DNA. który ma długość 2686 par zasad. Plazmidy stosowane w technice klonowania jako wektory są specjalnie konstruowane z fragmentów naturalnych plazmidów bakteryjnych. Podobnie jak 73 . Kosmidy Kosmid jest plazmidem zmodyfikowanym przez dodanie do niego sekwencji cos z faga λ. korę mogą stanowić zagrożenie ekologiczne. Większość wektorów plazmidowych ma wstawiony syntetyczny oligonukleotyd. Za pomocą modyfikacji molekularnych (np.

komórkach ssaków) stosowane są: Wektory — pochodne wirusów Pochodne niektórych wirusów są wektorami stosowanymi do wprowadzania DNA do komórek roślinnych i zwierzęcych. do wektorów fagowych wprowadzono polilinkery. jak 74 . Są one również stosowane w somatycznej terapii różnych schorzeń. coli. Do klonowania fragmentów DNA w organizmach eukariotycznych (np.Ryć. Sztuczny chromosom bakteryjny (BAC) Do klonowania długich fragmentów DNA (100-300 kpz) jest wykorzystywany sztuczny chromosom bakteryjny BAĆ (ang. Wektory fagowe są stosowane do klonowania fragmentów DNA mniejszych niż w wektorach plazmidowych. krowianki. geny markerowe i silne promotory. Obecnie coraz częściej stosuje się retrowirusy zapewniające dużą efektywność transfekcji (transfekcja jest to wprowadzanie fragmentów DNA do komórek eukariotycznych). Najwcześniej był stosowany wirus SV40. Papilloma. wadą natomiast organiczona długość wbudowanego obcego DNA. W przypadku komórek zwierzęcych są to pochodne wirusów SV40. którego zaletą jest duża wydajność uzyskiwania zrekombinowanego genu. bacterial artificial chromosome) skonstruowany na bazie plazmidowego czynnika F bakterii E. bakulowirusów. 4-1. Wektory drożdżowe Wektory te wykazują zdolność replikacji tak w komórkach drożdży. ale efektywność tego działania jest większa. adenowirusów i retrowirusów. Schemat wektora plazmidowego pUC19. drożdżach. Zaznaczono miejsca restrykcyjne dla niektórych endonukleaz w przypadku wektorów plazmidowych.

i komórkach bakteryjnych. Zdolność ta wynika z występowania odrębnych sekwencji startu replikacji i genów markerowych. Typowy wektor drożdżowy jest skonstruowany z części prokariotycznej (zawiera sekwencję ori i marker selekcyjny) i eukariotycznej (zawiera sekwencję ori rozpoznawaną przez polimerazę eukariotycznego gospodarza, marker selekcyjny i sekwencje umożliwiające ekspresję genu). Taka konstrukcja pozwala na klonowanie genów w E. coli, a następnie badanie ich ekspresji w drożdżach. Do wektorów tych należą także sztuczne chromosomy drożdżowe — YACs (ang. yeast artificial chromosomes), skonstruowane po raz pierwszy w 1983 roku. Są one stosowane do klonowania bardzo długich fragmentów DNA, do 5 milionów par zasad. Są także wykorzystywane m.in. w budowie map genomowych. Oprócz sekwencji typowych dla wektorów drożdżowych, sztuczne chromosomy drożdżowe mają sekwencje umożliwiające replikację chromosomów i ich segregację w trakcie podziałów mitotycznych.
Sztuczne chromosomy ludzkie

Po skonstruowaniu sztucznego chromosomu drożdży rozpoczęto intensywne prace nad konstrukcją ludzkiego sztucznego chromosomu — HAC (ang. human artificial chromosome). Było to możliwe dzięki poznaniu sekwencji telomerowych chromosomów i sekwencji, od których zaczyna się replikacja cząsteczki DNA. O wiele większym problemem okazało się wydzielenie części chromosomu nazwanej centromerem. Dotychczasowe badania zaowocowały skonstruowaniem sztucznego chromosomu ludzkiego złożonego z telomerowego DNA, fragmentów DNA rozpoczynających replikację oraz, zamiast centomerowego DNA, α-satelitarnego DNA (sekwencja powtarzająca się, długości 171 par zasad) (ryć. 4-2). Wszystkie te fragmenty DNA zostały wprowadzone do komórek ludzkiej linii nowotworowej, hodowanych in vitro. Komórki te, w przeciwieństwie do komórek prawidłowych, mają zdolność nieograniczonej liczby podziałów. Uzyskany dotychczas sztuczny chromosom, nazwany mikrochromosomem, różni się znacznie od chromosomu funkcjonalnego. Jeżeli konstrukcja sztucznego chromosomu ludzkiego zakończy się powodzeniem, chromosomy te (HACs) będą mogły być użyteczne do badania ekspresji genów oraz jako wektory stosowane w terapii genowej (dostarczanie genów do komórek somatycznych in vivo).

75

4.3. Rekombinacja molekularna i klonowanie
Rekombinacja molekularna, będąca podstawową metodą inżynierii genetycznej, polega na łączeniu ze sobą różnych cząsteczek DNA lub RNA. Metoda rekombinacji DNA umożliwia uzyskanie za pomocą klonowania bardzo dużej liczby kopii wybranego fragmentu DNA. Klonowaniem molekularnym nazywamy replikację w komórkach biorcy (np. bakterii) zrekombinowanych wektorów zawierających DNA dawcy, uzyskany za pomocą jednej z następujących metod: • wycięcie odpowiedniego fragmentu DNA dawcy za pomocą enzymów restrykcyjnych, • wyizolowanie z komórek dawcy określonego rodzaju mRNA, stano wiącego transkrypt pojedynczego genu, a następnie zastosowanie reakcji odwrotnej transkrypcji (przepisanie sekwencji mRNA na komplementarną sekwencję mRNA → cDNA), • chemiczna synteza fragmentu DNA. Ligacja. Fragment DNA, który zamierzamy sklonować, musi być połączony z odpowiednim wektorem. By połączenie to było możliwe, konieczny jest wytwarzany przez bakterie enzym nazwany ligazą DNA. In vivo ligazą bierze udział w procesie replikacji DNA oraz naprawie uszkodzeń DNA, katalizując powstawanie wiązań fosfodiestrowych między nukleotydami. Dzięki swym właściwościom ligazą bierze udział w tworzeniu wiązań między cząsteczkami DNA pochodzącymi od -różnych organizmów. Do rekombinowania DNA stosowana jest ligazą, którą uzyskuje się z komórek Escherichia coli zakażonych fagiem T4 (ligazą jest kodowana przez gen tego faga). Ligazą ma zdolność łączenia ze sobą fragmentów o końcach zarówno lepkich, jak i tępych, jednak wydajność tego procesu jest większa w przypadku końców lepkich. Z reguły do przecięcia wektora używany jest ten sam enzym restrykcyjny, którym był trawiony DNA. Transformacja. W celu wprowadzenia zrekombinowanych cząsteczek DNA do komórki bakteryjnej wykorzystywana jest naturalna zdolność wielu bakterii do pobierania cząsteczek DNA z podłoża. Właściwość tę odkrył w 1928 roku Griffith w doświadczeniu na myszach zarażanych dwoinką zapalenia płuc. Bakteria E. coli, która jest często używana w biologii molekularnej, nie ma zdolności pobierania cząsteczek DNA z podłoża. Dlatego wprowadzenie cząsteczek DNA do jej wnętrza musi być dokonane na drodze indukcji chemicznej (destabilizowanie błony komórkowej jonami wapnia — inkubacja komórek z CaCl2 w temperaturze bliskiej 0°C) bądź elektroporacji (działanie impulsów pola elektrycznego w urządzeniu zwanym elektroporatorem). Wydajność transformacji zależy od stosowanej metody, w pierwszym przypadku (działanie jonami wapnia) możliwe jest uzyskanie około 106 transformantów z l μg zrekombinowanego DNA, w drugim natomiast znacznie więcej, maksymalnie do 1010.
76

Wprowadzenie zrekombinowanych cząsteczek DNA do komórek eukariotycznych nosi nazwę transfekcji. Jest kilka metod transfekcji, m.in. mikroiniekcji DNA, elektroporacji oraz indukcji chemicznej fosforanem wapnia lub dekstranem. Selekcja transformantów (bakterii, które zawierają zrekombinowany wektor). Jedna z metod selekcji transformantów wykorzystuje zjawisko αkomplementacji. Jest ona możliwa do stosowania w przypadku wektora plazmidowego z serii pUC. Właściwie można mówić o dwustopniowej selekcji komórek bakterii po transformacji. Pierwsza zachodzi podczas hodowli bakterii na pożywce zawierającej antybiotyk. Ponieważ wektor plazmidowy ma gen oporności na antybiotyk, uzyskuje się wzrost kolonii bakterii, które mają wektor. Drugi etap selekcji umożliwia odróżnienie komórek zawierających zrekombinowany wektor od komórek z wektorem niezrekombinowanym (ryć. 4-3). Wektory z serii pUC mają promotor genu β-galaktozydazy (enzym ten jest kodowany przez gen oznaczony symbolem lacZ) i sekwencję kodującą N-końcową część tego białka (fragment alfa βgalaktozydazy). Z kolei stosowane do transformacji komórki bakterii dostarczają C-końcową sekwencję genu lacZ (fragment omega). W wyniku połączenia, po pobraniu przez bakterię wektora, obu sekwencji genu lacZ (zjawisko α-komplementacji) (ryć. 4-3) powstaje funkcjonalny gen β-galaktozydazy. Dzięki syntezie tego enzymu kolonie bakterii zawierających plazmid, hodowane na podłożu z chromogenem X-gal, będą miały barwę

Ryć. 4-3. Zasady α-komplementacji (połączenie fragmentów genu lacZ z plazmidu i bakterii) — synteza funkcjonalnego genu enzymu β-galaktozydazy

77

niebieską. Jeżeli do wektora (w obręb polilinkera znajdującego się w części „plazmidowej" genu lacZ) zostanie wprowadzony obcy fragment DNA, synteza N-końcowej części (β-galaktozydazy zostanie zablokowana, co spowoduje brak syntezy aktywnego białka i białe zabarwienie kolonii bakterii zawierających zrekombinowany wektor.

4.4. Amplifikacja DNA za pomocą łańcuchowej reakcji polimerazy (PCR)
Łańcuchowa reakcja polimerazy — PCR (ang. polymerase chain reaction) jest podstawową techniką badawczą i diagnostyczną wykorzystującą zdolność DNA do replikacji. Reakcja ta jest katalizowana, podobnie jak to się dzieje w komórkach, przez polimerazy DNA, zwane także replikazami. Łańcuchowa reakcja polimerazy znana jest od ponad 10 lat, a jej twórcą był Kary Mullis, który za swoje badania otrzymał Nagrodę Nobla w roku 1993. O ogromnym znaczeniu tej metody decyduje to, iż umożliwia ona analizę DNA nawet w przypadku bardzo małej jego ilości (np. w kryminalistyce — ślady krwi). PCR jest enzymatyczną metodą amplifikacji (powielania) określonych sekwencji DNA, a jej czułość pozwala na zwielokrotnienie (uzyskanie wielu milionów kopii) ściśle określonych sekwencji DNA, mimo obecności innych sekwencji. Można amplifikować poszukiwane odcinki DNA, dysponując DNA wyizolowanym nawet z pojedynczych komórek. Jednak najlepszy DNA do celów diagnostycznych uzyskujemy, gdy pochodzi z minimum 103 komórek. Z reguły amplifikacja określonego fragmentu DNA jest możliwa wtedy, gdy znana jest jego sekwencja nukleotydowa, na podstawie której syntetyzowane są krótkie, zazwyczaj około dwudziestonukleotydowe oligonukleotydy, tzw. startery (ang. primer), komplementarne do badanego DNA (jeden starter do jednej, drugi do drugiej nici). Aby mogła zajść łańcuchowa reakcja polimerazy, niezbędne są następujące warunki: obecność jednoniciowej matrycy DNA (badany dwuniciowy DNA jest rozdzielany na dwie nici przez denaturację termiczną, proces ten nazywany jest inaczej topnieniem), wspomnianych już starterów, trifosforanów deoksynukleotydów (dATP, dCTP, dGTP i dTTP) oraz enzymu polimerazy DNA. Konieczny jest również bufor reakcyjny uzupełniający niezbędne do aktywności enzymu jony metali (potasu i magnezu). Trifosforany w trakcie amplifikacji uczestniczą w wydłużaniu sekwencji starterów zgodnie z regułą komplementarności zasad azotowych względem amplifikowanej nici DNA. Enzym katalizujący reakcję — Taq polimeraza DNA — pochodzi z bakterii Thermus aquaticus, żyjącej w gorących źródłach. Dlatego polimeraza (nazwana od skrótu gatunku bakterii Taq polimeraza) zachowuje swą aktywność nawet w bardzo wysokiej temperaturze (> 90°C). Zanim wykryto ten enzym, przeprowadzenie reakcji amplifikacji było ogromnie
78

pracochłonne i wymagało wielokrotnego dodawania enzymu. Obecnie może być stosowana także inna polimeraza, PrimeZyme, pochodząca z innej termofilnej bakterii Thermus brockianus. Reakcja amplifikacji DNA składa się z powtarzających się cykli, a każdy z nich przebiega w trzech etapach (ryć. 4-4): 1 — denaturacja dwuniciowego DNA (ang. denaturation), zachodząca w temperaturze 92-96°C (zależnie od rodzaju probówki i termocyklera, którym jest termostat z automatycznie zmieniającą się temperaturą); 2 — przyłączenie (ang. annealing) starterów do komplementarnych sekwencji na zdenaturowanej matrycy DNA, w temperaturze 37-72°C. Temperatura przyłączania starterów zależy głównie od zawartości w tych starterach nukleotydów G i C. Można ją w przybliżeniu określić, wykorzys tując wzór (Mazaras i wsp., NAR 19:4783, 1991): T = 69,3°C + 41 x (G + C)/L - 650/L gdzie: (G + C) — łączna liczba nukleotydów guanylowych i cytydylowych L — łączna liczba wszystkich nukleotydów; 3 — wydłużanie starterów (ang. elongation) polegające na dołączaniu, począwszy od wolnego końca 3'-OH startera, nukleotydów komplementar nych względem amplifikowanej nici DNA; proces ten zachodzi w temperaturze 72°C.
79

W wyniku wydłużenia starterów powstają syntetyzowane „de novo" nici DNA, które zawierają miejsce wiązania dla startera w następnym cyklu. Zatem każda nowa nić DNA staje się matrycą w kolejnym cyklu amplifikacji, co prowadzi do zwiększania się liczby amplifikowanych fragmentów w postępie logarytmicznym. Po 30 cyklach tej reakcji jest już 230, czyli 1073 741 824, powielonych fragmentów DNA. Długość powstających fragmentów determinują końce 5' starterów. Denaturacja DNA w pierwszym i wydłużanie starterów w ostatnim cyklu przebiegają w nieco dłuższym czasie niż w cyklach pozostałych. Dla każdego fragmentu DNA, który ma być zamplifikowany, należy dobrać właściwe warunki reakcji, przede wszystkim temperaturę przyłączania starterów. Całkowity czas trwania łańcuchowej reakcji polimerazy wynosi z reguły najwyżej kilka godzin. Po zakończeniu reakcji zamplifikowany fragment DNA, czyli tzw. produkt PCR, może być przechowywany w temperaturze 4°C, do momentu następnego etapu badań. Metoda PCR ma wiele zastosowań, między innymi do: • wykrywania obecności w genomie określonych odcinków/genów oraz identyfikacji nosicieli mutacji powodujących choroby genetyczne • wykrywania obecności w organizmie wirusowego lub prowirusowego DNA • zwiększenia ilości wybranych odcinków DNA do późniejszego sekwencjonowania lub tworzenia biblioteki genów. Opracowane zostały modyfikacje łańcuchowej reakcji polimerazy: Wewnętrzna (ang. nested) PCR. Stosowana jest w przypadku braku pewności, że zamplifikowany został właściwy fragment DNA. Metoda ta polega na amplifikacji mniejszego odcinka DNA, zawartego w obrębie wcześniej zamplifikowanego dłuższego fragmentu. Oczywiście w tej drugiej reakcji stosowane są inne startery. Za pomocą tej metody możemy także zwiększyć czułość reakcji, dzięki dodatkowej amplifikacji produktów wcześniejszej reakcji. RAPD (ang. random amplified polymorphic DNA). Jest to metoda losowej amplifikacji fragmentów DNA, w której, w odróżnieniu od metody PCR, stosowany jest tylko jeden starter. Również warunki reakcji są nieco inne, niższa jest temperatura przyłączania starterów do matrycowego DNA, a liczba cykli reakcji jest większa (40-50). Przykład wzoru prążkowego (losowo zamplifikowanych fragmentów DNA) przepiórki japońskiej uzyskanego w wyniku reakcji RAPD przedstawiono na rycinie 4-5. LCR (ang. ligase chain reaction). Ligazowa reakcja łańcuchowa; zbliżona jest do PCR. Różnice polegają m.in. na tym, że w LCR oligonukleotydy są dłuższe (50-60 nukleotydów) i tak przygotowane, by po hybrydyzacji, odpowiednio do końca 5' i 3' matrycowego DNA, nie pozostała między nimi
80

że komplementarne do normalnego allelu cztery diagnostyczne startery hybrydyzują z komplementarnymi sekwencjami na matrycy DNA. mutacja punktowa). a produkty ligacji stają się matrycami do hybrydyzacji w kolejnych cyklach. która łączy specyficznie dwa przyległe oligonukleotydy. Jeśli jest idealna komplementarność między matrycą i zhybrydyzowanymi z nią oligonukleotydami (starterami). Ochłodzenie mieszaniny reakcyjnej do 60°C powoduje. Odwrotna transkrypcja-PCR. W pierwszym etapie reakcji matryca — DNA jest poddawana denaturacji (rozdzielana na dwie nici) przez działanie wysoką temperaturą (94°C).przerwa. gdy są one zhybrydyzowane z komplementarną matrycą. Oligonukleotydy są amplifikowane podczas cykli termicznych w obecności drugiej pary starterów. reverse transcription-polymerase chain reaction). O znakowaniu biotyną będzie jeszcze mowa w podrozdziale: Techniki hybrydyzacji i sondy molekularne. Reakcja ta stosowana jest do wykrywania mutacji punktowych. RT-PCR (ang. Te dwa etapy są powtarzane. co jest szczególnie istotne z medycznego punktu widzenia (diagnostyka chorób monogenowych). Enzymem używanym do tej reakcji jest termostabilna ligaza. wówczas nie tworzy się wiązanie między starterami i nie ma produktu amplifikacji. amplifikując badany gen (odcinek DNA). Łańcuchowa reakcja polimerazy umożliwia amplifikację jedynie kwasu deoksyrybonukleinowego. Jeśli nie ma komplementarności w miejscu połączenia starterów z matrycą DNA (np. np. z zastosowaniem biotyny. W celu identyfikacji produktu LCR stosowane są nieradioaktywne metody znakowania barwnego. wówczas termostabilna ligaza tworzy kowalentne wiązanie między oligonukleotydami. Nie może być natomiast 81 .

Efektem denaturacji jest uzyskanie jednoniciowych łańcuchów DNA. jak również do wykrywania wirusów. Zdenaturowany DNA allelu zmutowanego może przyjmować inną konformację niż allelu prawidłowego i w konsekwencji fragmenty te będą migrowały podczas elektroforezy z różną szybkością. które przyjmują określoną konformację przestrzenną.wykorzystana w badaniach ekspresji genów. między nićmi DNA:DNA. jest to technika często wykorzystywana do wstępnej identyfikacji mutacji punktowych w badanym fragmencie DNA. Końcowym etapem jest amplifikacja uzyskanego cDNA na drodze łańcuchowej reakcji polimerazy. które jest oczywiście najbardziej precyzyjne. to wówczas na elektroforegramie pojawiają się prążki (fragmenty) reprezentujące allel prawidłowy oraz allel zmutowany. RFLP lub sekwencjonowania. W tych przypadkach może być stosowana metoda RT-PCR. RNA: RNA i RNA: DNA istnieją wiązania wodorowe. polegająca na tym. single stranded conformation polymorphism). Jeśli badany DNA pochodzi od nosiciela zmutowanego genu. Badanie polega na amplifikacji techniką PCR wybranego fragmentu DNA. bowiem pomiędzy niektórymi sekwencjami wchodzącymi w skład łańcucha będą powstawały wiązania wodorowe między komplementarnymi zasadami azotowymi. a następnie jego denaturacji i elektroforezie. np. SSCP (ang. 4. Stwierdzenie takiej formy polimorfizmu wskazuje jedynie na to. w których określana jest ilość mRNA. Polimorfizm konformacji jednoniciowych łańcuchów DNA. Konformacja ta zależy od sekwencji nukleotydów. Jak wiadomo. Nie można jednak na tej podstawie zidentyfikować typu mutacji ani określić miejsca mutacji. podczas której na matrycy mRNA syntetyzowany jest komplementarny DNA (nazwany cDNA). że testowany osobnik jest heterozygotą w obrębie amplifikowanego fragmentu DNA. które ułatwiają ten 82 . Reakcja ta przebiega dzięki zastosowaniu enzymu odwrotnej transkryptazy. iż łańcuchowa reakcja polimerazy jest poprzedzona odwrotną transkrypcją. Dzięki temu szybkość migracji jednoniciowych łańcuchów DNA podczas elektroforezy zależy nie tylko od ich wielkości/ale także konformacji przestrzennej. których materiałem genetycznym jest RNA. Poszukiwanie określonego fragmentu DNA lub RNA może być przeprowadzane także bezpośrednio w komórkach i tkankach za pomocą metody PCR in situ. Dlatego szczegółowa analiza mutacji wymaga zastosowania dodatkowych metod. Techniki hybrydyzacji i sondy molekularne Hybrydyzacja DNA jest możliwa dzięki zdolności kwasów nukleinowych do rozdziału na pojedyncze nici komplementarne i ponownego łączenia się w struktury dwuniciowe.5.

dCTP i UTP a 32P. kwas nukleinowy znajdujący się w żelu musi być zdenaturowany (rozdzielony na pojedyncze nici poprzez działanie roztworem kwasu solnego). Southern blotting jest metodą przenoszenia odpowiednio przygotowanego DNA na filtr nitrocelulozowy lub nylonowy. gdy nie jest dokładnie znana cała sekwencja nukleotydowa badanego fragmentu DNA. wirusów lub organizmów wyższych). Najczęściej stosowanymi izotopami są: • fosfor radioaktywny (32P). Izotop ten jest stosowany do znakowania DNA i RNA.71 MeV — megawoltów). 83 . lżejsze. Znakowanie izotopowe charakteryzuje się dużą czułością. northern blotting (RNA) czy PCR (hybrydyzacja starterów z matrycą). czas półtrwania 14. Przeniesienie fragmentów DNA z żelu na filtr następuje przez bufor transferowy. Technika northern blotting. by było możliwe wykrycie powstałej hybrydy. Sonda musi być odpowiednio wyznakowana. Przygotowanie DNA polega na trawieniu jednym lub kilkoma enzymami restrykcyjnymi i rozdzieleniu elektroforetycznym uzyskanych fragmentów w żelu agarozowym (dłuższe. stosowana w hybrydyzacji kwasu rybonukleinowego. jednak niewielką rozdzielczością. klonowane sekwencje lub syntetyczne oligomery stosowane w PCR. do 500 par zasad). nie wymaga etapu denaturacji.proces. Wadą sond znakowanych izotopem jest również to. Zjawisko to stało się podstawą metod analizy kwasów nukleinowych. Ogromną zaletą hybrydyzacji jest to. który przenikając przez żel zabiera ze sobą fragmenty DNA. Sondy molekularne są to odcinki DNA mające sekwencję nukleotydów komplementarną do badanej.3 dnia. takich jak hybrydyzacja Southern blotting (DNA). Sygnał jest wykrywany metodą autoradiografii przez ekspozycję błony fotograficznej na działanie promieniowania powstałej hybrydy. Znakowanie sond. czyli cięższe fragmenty) lub poliakryloamidowym (krótsze. Sondami molekularnymi mogą być fragmenty DNA bezpośrednio pochodzące z genomu (np. a jego podstawowym źródłem są radioaktywne nukleotydy wyznakowane w pozycji α: dATP. Znakowanie izotopowe (radioaktywne) — przez wprowadzenie do cząsteczki sondy izotopu promieniotwórczego. Przeniesiony DNA należy utrwalić na filtrze działając wysoką temperaturą bądź promieniami UV. Sposób znakowania sond można podzielić na dwie główne grupy: 1. który emituje wysokoenergetyczne promieniowanie β (energia promieniowania E = 1. Fragmenty te są następnie zatrzymywane na filtrze. Tak przygotowany DNA można nawet kilkakrotnie hybrydyzować z sondami molekularnymi. który jest nicią pojedynczą. iż muszą być stosowane wkrótce po ich wyznakowaniu. By była możliwa hybrydyzacja sondy z badanym DNA. że można ją stosować nawet wówczas.

emitujący promieniowanie β. okres półtrwania 12. Na wydajność hybrydyzacji wpływają także inne czynniki. w zależności od zastosowanego znacznika. Kinetyka tych procesów w dużej mierze zależy od różnicy między temperaturą topnienia — Tm (jest to temperatura.018 MeV). Atom tlenu w grupie fosforanowej α i γ P może być zastąpiony przez S. Detekcja immunologiczna jest bardzo dobra do hybrydyzacji na filtrach. z wyjątkiem obecności sondy. Hybrydyzacja jest poprzedzona prehybrydyzacją. w której 50% długości nici jest zdysocjowane) hybrydy a temperaturą. że różnica ta powinna wynosić 20-25°C. Sam proces hybrydyzacji polega na długotrwałej inkubacji (na przykład przez całą noc) badanego DNA w buforze zawierającym wyznakowaną sondę. tak powstają pochodne nukleotydów. biotyny. Ten rodzaj znakowania wymaga dodatkowego mechanizmu detekcji (immunologicznego lub fluorescencyjnego). digoksygeniny). głównie DNA. który emituje promieniowanie β (energia promieniowania E = 0. Znakowanie sond można przeprowadzać za pomocą kilku różnych metod. jak ilość kwasu nukleinowego związanego z filtrem (nie mniej niż 10 μg). 2. Hybrydyzację przeprowadza się z reguły w temperaturze 68°C. okres półtrwania 87. w której przebiega hybrydyzacja. iż stosunkowo duża ilość kwasu nukleinowego może być związana z filtrem i wyeksponowana na działanie sondy. Znakowanie nieizotopowe zapewnia dobrą rozdzielczość. 4-6).167 MeV). Podczas tej inkubacji zachodzą wielokrotnie procesy asocjacji i dysocjacji sondy z próbką DNA. Znacznik (izotopowy lub nieizotopowy) może być równomiernie rozmieszczony w całej sekwencji sondy bądź sonda może być znakowana na końcach (terminalnie). Siarka radioaktywna jest stosowana do znakowania kwasów nukleinowych. Przyjmuje się. Hybrydyzacja na filtrach. • tryt (3H). 84 . Zaletą tej metody jest to. używany jest do znakowania kwasów nukleinowych. Podstawowym źródłem trytu jest trytowana tymidyna.1 dnia. Roztwór prehybrydyzacyjny ma taki sam skład jak hybrydyzacyjny. Znakowanie nieizotopowe (nieradioaktywne) przez dołączenie do sondy lub wbudowanie w nią znacznika fluorescencyjnego (np.26 roku. Ponadto niezhybrydyzowana sonda jest odpłukiwana po inkubacji. gdy jest on unieruchomiony na filtrze. a detekcja sygnału jest poprzez autoradiografię (ryć. które jest około 10 razy słabsze niż fosforu (energia promieniowania E = 0.• izotop siarki (35S). Po hybrydyzacji nadmiar sondy jest odpłukiwany (najczęściej w temperaturze 65-70°C). stężenie sondy molekularnej w roztworze hybrydyzacyjnym (optimum to 50-1200 ng/ml) i stężenie jonów Na+. głównie DNA. Hybrydyzację z wyizolowanym DNA można przeprowadzać. której celem jest wysycenie miejsc na filtrze mogących niespecyficznie związać sondę. ale daje mniejszą czułość detekcji.

określana jako technika mikromacierzy DNA. również hybrydyzacja może być przeprowadzana na preparatach chromosomowych. Podobnie jak metoda PCR. pozwala ustalać genotyp albo analizować ekspresję setek lub tysięcy genów. Metoda hybrydyzacji służy m. Metoda „odcisku palca" DNA jest stosowana w kontroli pochodzenia oraz do oceny zmienności genetycznej wewnątrz i między rasami/populacjami. fingerprint) stosowana jest sonda molekularna komplementarna do sekwencji minisatelitarnej (metoda ta jest opisana w rozdziale: Markery genetyczne). Jej różne warianty są opisane w rozdziale: Mapy genomowe. Hybrydyzacja w zminiaturyzowanej postaci. 85 . Metoda ta nosi nazwę hybrydyzacji in situ (ISH).Wykorzystanie metody hybrydyzacji. l cm2) umieszczone są sondy oligonukleotydowe dla poszczególnych mutacji (genotypowanie) lub genów (ekspresja). Na niewielkiej płytce (ok. w diagnostyce chorób). W metodzie zwanej „odcisk palca" DNA (ang. do wykrywania ściśle określonych fragmentów DNA (np. Detekcja hybrydyzacji sondy z wyizolowanym DNA (genotypowanie) lub z DNA (ekspresja) jest zautomatyzowana.in.

. Duże fragmenty będą więc widoczne w postaci prążków znajdujących się w żelu w mniejszej odległości od miejsca rozpoczęcia rozdziału. Następnie pocięty DNA jest rozdzielany elektroforetycznie w żelu agarozowym lub poliakryloamidowym. Enzym restrykcyjny Hindlll rozpoznaje i przecina 6-nukleotydową sekwencję: 5'. Obraz elektroforetycznego rozdziału uzyskanych fragmentów DNA umożliwia identyfikację poszczególnych alleli danego genu. natomiast dalej będą prążki o zmniejszającej się masie.5' Dowolny zamplifikowany za pomocą łańcuchowej reakcji polimerazy (PCR) odcinek DNA poddany działaniu tego enzymu (trawiony) zostanie pocięty na fragmenty różnej długości.. restricted fragment length polymorphism) uwarunkowany jest różnicami w sekwencji nukleotydów w obrębie genu.. tym szybciej. Poniższy przykład obrazuje sposób identyfikacji genotypu w określonym locus.A-.3' 3'.AGGCTAT 86 . Polimorfizm fragmentów restrykcyjnych DNA znajduje zastosowanie w testach identyfikacji nosicielstwa określonego allelu danego genu (metoda PCR-RFLP).ATCCAGTCCTCGCCTGATTTCGAA. Polimorfizm fragmentów restrykcyjnych DNA (RFLP) Polimorfizm fragmentów restrykcyjnych DNA (ang.TTCGA.6.. Odcinek DNA przed trawieniem ma następującą sekwencję (pogrubionym drukiem zaznaczono motyw rozpoznawany przez enzym Hindlll): GTCGGCAAGCTTAGGTCAGGAGCGGACTAAAGCTTCCGATA CAGCCGTTCGAATCCAGTCCTCGCCTGATTTCGAAGGCTAT Po trawieniu (cięciu) DNA enzymem otrzymujemy fragmenty DNA: GTCGGCA'AGCTTAGGTCAGGAGCGGACTAA'AGCTTCCGATA CAGCCGTTCGA. czyli lżejsze.. Mutacje te mogą powodować powstanie lub likwidację istniejącego miejsca cięcia dla enzymu restrykcyjnego. Enzymy restrykcyjne rozpoznają specyficzne dla nich sekwencje nukleotydowe i przecinają DNA w określonym miejscu.. Cząsteczki DNA (także RNA) mają ładunek ujemny i w zależności od masy cząsteczkowej (długości) wędrują z różną prędkością w kierunku anody — im krótsze.4..ATAGCTT . Zamplifikowany (powielony) za pomocą łańcuchowej reakcji polimerazy (PCR) fragment badanego genu poddawany jest działaniu określonego enzymu lub kilku enzymów restrykcyjnych.

Biblioteki dużych genomów najczęściej składają się z bibliotek dla poszczególnych chromosomów (biblioteki chromosomowe). wśród nich są geny determinujące cechy jakościowe. 4. Natomiast biblioteka genowa (inaczej biblioteka lub bank cDNA) jest to zbiór sekwencji kodujących białka. jak kosmidy. quantitative trait loci — QTLs) oraz odpowiedzialne za rozwój chorób genetycznych czy odporność na niektóre patogeny. Metoda PCR-RFLP jest wykorzystywana w hodowli zwierząt do identyfikacji genotypów pod względem genów. których budowa molekularna jest znana. Kolejnym krokiem jest „przepisanie" za pomocą reakcji odwrotnej transkrypcji (katalizowanej przez enzym odwrotną transkryptazę) informacji z mRNA na DNA. Do tworzenia bibliotek (banków) genomowych i genowych wykorzystywana jest. Dla prokariontów i niższych eukariontów stosowane są wektory plazmidowe lub fagowe. natomiast dla wyższych eukariontów niezbędne są bardziej pojemne wektory. metoda rekombinacji molekularnej. Geny o dużym efekcie. a także ilościowe (ang. Biblioteka genomową powinna się składać z fragmentów DNA tworzących razem cały genom określonego gatunku. omówiona wcześniej. Interseksualizm. czyli eksony. Tak powstałe fragmenty DNA są wprowadzane za pomocą wektora do bakterii. Przykłady takich cech są przedstawione w podrozdziałach: Mutacje genowe. Po wyizolowaniu RNA z tkanek należy oddzielić mRNA. Tak otrzymany cDNA zawiera tylko sekwencje kodujące.7. Tworzenie biblioteki genomowej Materiałem wyjściowym jest DNA wyizolowany z tkanek i strawiony (pocięty) enzymem restrykcyjnym. sztuczny chromosom bakteryjny (BAĆ) lub sztuczny chromosom drożdżowy (YAC). Klony bakteryjne zawierające fragmenty DNA lub cDNA mogą być przechowywane w stanie zamrożonym do momentu ich wykorzystania. Materiałem wyjściowym w tym przypadku jest RNA. Jest on amplifikowany 87 . Tworzenie biblioteki genowej (cDNA) Tworzenie biblioteki genowej jest znacznie trudniejsze niż genomowej. 11 pz i 7 pz. wprowadzonych za pomocą wektorów do bakterii. Biblioteki genomowe i genowe Biblioteką (bankiem) genomową nazywamy zbiór klonów bakterii zawierających zrekombinowane wektory niosące fragmenty DNA. W zależności od wielkości fragmentów DNA używane są różne wektory. Proces ten jest opisany w części dotyczącej klonowania DNA.Po rozdziale elektroforetycznym fragmenty DNA ułożą się w kolejności 23 pz.

Jeśli zamierzamy poznać organizację całego genu łącznie z intronami i promotorem. Rolą tych dideoksynukleotydów (tzw. 4-7). chromosome walking). ddGTP lub ddTTP (ryć. przede wszystkim do analizy sklonowanych fragmentów DNA lub produktów łańcuchowej reakcji polimerazy. jest stosowane dość często w genetyce molekularnej. Fragment końcowy sekwencji sprzężonej traktowany jest jako sonda. której pierwszym krokiem jest znalezienie w bibliotece klonu zawierającego gen bądź marker sprzężony z poszukiwanym genem. Inną metodą poszukiwania określonego genu jest zastosowanie reakcji immunologicznej. Surowica zawierająca przeciwciało identyfikujące określone białko (antygen) służy jako swego rodzaju „sonda" do przeglądania zbioru biblioteki. Sekwencjonowanie można przeprowadzać za pomocą dwóch różnych metod: enzymatycznej i chemicznej. mieszaninę deoksynukleotydów. 4. Sekwencjonowanie DNA Sekwencjonowanie DNA. Biblioteka genomowa jest również przydatna w poszukiwaniu genu. która jest wykorzystywana do poszukiwania klonu zawierającego sąsiadujący. Stosowana jest wówczas metoda zwana „spacerem po chromosomie" (ang. przeprowadzane są cztery oddzielne reakcje syntezy DNA.metodą PCR. gdy w którymś z kolejnych odcinków znajdziemy poszukiwany gen. a następnie rekombinowany z wektorem i wprowadzany do bakterii. Zasadniczym elementem tych badań jest odnalezienie klonu zawierającego interesujący nas gen. polegające na określeniu sekwencji nukleotydów. Sangera. bufor reakcyjny. Postępujemy tak do momentu. czyli reakcji antygen-przeciwciało. polimerazę DNA oraz jeden z dideoksynukleotydów (ddNTP): ddATP. Do badania ekspresji genu wykorzystuje się bibliotekę cDNA. Podstawą tej metody jest enzymatyczna (przeprowadzana przez polimerazę DNA) synteza komplementarnej nici na zdenaturowanej (jednoniciowej) matrycy DNA. Metoda ta umożliwia także wykrycie miejsc mutacyjnych i opracowanie testu molekularnej identyfikacji genotypów zwierząt pod kątem nosicielstwa określonych alleli. wykorzystuje się bibliotekę genomową. terminatorów) jest zakończenie syntezy nici 88 . ddCTP. starter. Metoda enzymatyczna została opracowana w 1977 roku przez F. Każda z czterech probówek zawiera matrycowy DNA. nieznany jeszcze fragment. Wykorzystanie określonego rodzaju biblioteki zależy od celu badań. Ponieważ w nici DNA są cztery rodzaje nukleotydów (różniące się zasadą). W ten sposób każdy klon bakterii ma cały określony gen. o którym niewiele wiadomo. Najczęściej stosowaną metodą analizy bibliotek jest hybrydyzacja z sondami molekularnymi (metoda hybrydyzacji DNA została już opisana wcześniej).8. W tym celu należy doprowadzić do syntezy przez bakterie białka kodowanego przez ten gen.

grubości 0. Schemat sekwencjonowania DNA metodą enzymatyczną Sangera. 4-7.. metodą autoradiografii. w reakcji wykorzystywane są wyznakowane izotopowe (izotop fosforu lub siarki) deoksynu89 . Postępy Biologii Komórki. 1998) komplementarnej w miejscu włączenia określonego dideoksynukleotydu. by tylko część syntetyzowanych fragmentów DNA uległa terminacji.2-0. kończące się odpowiednim nukleozydem. ponieważ stosunek dideoksynukleotydów (ddNTP) do deoksynukleotydów (dNTP) jest tak dobrany.autoradiogram żelu sekwencyjnego Ryć. W celu detekcji prążków DNA.6 mm). 25 supl. 10 :219-237. W wyniku każdej z czterech reakcji otrzymujemy fragmenty DNA o różnej długości. kolorem szarym zaznaczono nukleotyd serii dideoksy (wg: Nuć i wsp. zależnie od użytego w reakcji dideoksynukleotydu. Zatrzymanie syntezy komplementarnej nici następuje po powstaniu pełnej sekwencji jednej cząsteczki. Po zakończeniu reakcji syntezy powstały DNA jest denaturowany i rozdzielany w drodze elektroforezy wysokonapięciowej (około 2000 V) w żelu poliakryloamidowym (długości 40-100 cm.

Do rozszczepiania wykorzystywane są hydrazyna. Można również zastosować detekcję fluorescencyjną lub wyznakowanie biotyną. Sekwencjonowanie metodą chemiczną przeprowadza się. 1998) 90 . Do mieszaniny reakcyjnej dodawana jest także piperydyna. Postępy Biologii Komórki. które mają zdolność modyfikacji zasad w cząsteczce DNA. w czterech oddzielnych probówkach. ma bardzo dużą rozdzielczość i pozwala na sekwencjonowanie odcinka DNA długości około 500-700 nukleotydów. siarczan dimetylu (DMS) i kwas mrówkowy. opracowana w 1977 roku przez Maxama i Gilberta. 25 supl.. że jest szybka. podobnie jak przy metodzie enzymatycznej. 4-8): autoradiogramżelusekwencyjnego Ryć. polega na degradacji sekwencjonowanego fragmentu DNA poprzez chemiczne rozszczepienie poszczególnych nukleotydów. Schemat sekwencjonowania DNA metodą chemiczną Maxama-Gilberta. Metoda chemiczna.kleotydy lub wyznakowany starter. Przebiegają w nich reakcje rozszczepień prowadzonych w 4 wariantach (ryć. kolorem szarym zaznaczono znakowany nukleotyd (wg: Nuć i wsp. 10 :219-237. 4-8. która powoduje przerwanie łańcucha DNA w miejscu zmodyfikowanym przez jeden z wymienionych związków chemicznych. Enzymatyczna metoda sekwencjonowania ma tę zaletę.

które w swoim genomie zawierają zintegrowany DNA pochodzący od innego osobnika. Jedna z wymienionych metod. Reakcja ta przebiega na mikropłytkach (96 dołków na płytce) po dodaniu substratów i enzymów do dołka zawierającego badaną próbę DNA.10. 4. pozwala także na wyróżnienie grup komórek. Zwierzęta transgeniczne to takie. Następnym etapem. natomiast samice były niepłodne. Różnią się one od innych komórek ekspresją pewnych genów. ale są inne pod względem biochemicznym. 4. Sekwencjonowanie kwasów nukleinowych zostało zautomatyzowane. Samce transgeniczne przekazywały swojemu potomstwu obcy gen. Badanie ekspresji genów Ekspresja genu może być badana na etapie transkrypcji (hybrydyzacja in situ na skrawkach tkanek. Jednym z pierwszych eksperymentów transgenezy było wprowadzenie na początku lat 80.W wyniku tych reakcji otrzymujemy fragmenty DNA zaczynające się zawsze od wspólnego radioaktywnego końca. kilka firm oferuje specjalistyczną aparaturę. do zygoty myszy szczurzego genu hormonu wzrostu. Metoda ta umożliwia sekwencjonowanie fragmentów DNA długości około 250-300 nukleotydów. zamienionego na pik proporcjonalny do liczby nukleotydów włączonych do nici komplementarnej do matrycowego DNA (badana próba). hybrydyzacja in situ na skrawkach tkanek. autoradiografia i odczytanie sekwencji nukleotydów.9. Sekwencja badanego fragmentu DNA jest odczytywana przez specjalną kamerę połączoną z komputerem (z oprogramowaniem do analizy tych danych) na podstawie sygnału świetlnego. których długość zależy od miejsca rozszczepienia łańcucha DNA. jest rozdział elektroforetyczny tych fragmentów w żelu poliakryloamidowym. RT-PCR) i translacji (western blotting). Podobne 91 . Głównym efektem tego zabiegu było szybsze tempo wzrostu i wyraźne wydłużenie ciała myszy transgenicznych. podobnie jak w metodzie enzymatycznej. przy czym przy włączeniu każdego nukleotydu powstaje sygnał świetlny. znacznie różni się od powyższych metod. Najnowsza metoda sekwencjonowania. Wykorzystuje ona bowiem enzymatyczne (z udziałem 4 enzymów i specyficznych substratów) dobudowywanie nici komplementarnej do badanego fragmentu DNA. Transgeneza Transgenezą nazywamy technikę modyfikowania genomu metodami inżynierii genetycznej. pyroseąuencing. tzw. nieaktywnych w komórkach zdrowych. które morfologicznie nie różnią się od sąsiednich. northern blotting. Przykładem mogą być komórki nowotworowe badane bezpośrednio po transformacji.

Wykorzystanie techniki transgenezy 1. Technika ta może być stosowana do: • uzyskania zwierząt o przyspieszonym tempie wzrostu (wzrost produk cji mięsa) przez wprowadzenie do ich genomu genów kodujących polipeptydy wpływające na wzrost. Skutki tego procesu w zależności od miejsca inkorporacji transgenu mogą być różne. w gruczole mlecznym). Ponadto istnieje pewne niebezpieczeństwo replikacji wirusa. najczęściej męskiego. Wielkość fragmentu DNA. Należy jednak zauważyć. Doskonalenie zwierząt gospodarskich Transgeneza stwarza duże możliwości poprawy cech użytkowych zwierząt gospodarskich poprzez modyfikację ich genomu. • transfer materiału genetycznego przez zakażanie zrekombinowanymi retrowirusami. około 8 kpz. Materiał genetyczny wprowadza się do komórki zazwyczaj za pomocą jednej z następujących technik: • bezpośrednia mikroiniekcja genu lub fragmentu DNA do przedjądrza. który może być wprowadzony tą metodą. 92 . umożliwiającej ukierunkowaną ekspresję transgenu (np. W metodzie tej wykorzystuje się zdolność pierwot nych komórek zarodkowych do wzrostu in vitro. ogranicza jej stosowanie. Na razie nie mamy żadnego wpływu na to. Jest to główna metoda uzyskiwania transgenicznych zwierząt gospodarskich. growth hormone — GH). nawet niekorzystne. że w procesie transgenezy wprowadzane są konstrukty genowe. Dotychczas stosowane metody wprowadzania transgenu nie dają możliwości sterowania tym procesem. Jak dotychczas opisana technika jest stosowana z sukcesem u myszy. Po mikroiniekcji DNA dokonywany jest transfer zarodków do hormonalnie przygotowanych biorczyń. blastocyst pozbawionych węzła zarodkowe go). które zazwyczaj złożone są z części strukturalnej wprowadzanego genu i części promotorowej innego genu. które można zmniejszyć przez stosowanie zmodyfikowanych wirusów zdolnych do jednego tylko cyklu replikacyjnego. Zrekombinowany fragment DNA wprowadzany jest do hodowanych w warunkach in vitro ESC. Transformację komórek można też wykonać na drodze elektroporacji komórki biorcy lub lipofekcji (dostarczenie do komórki obcego DNA w liposomach). embryonic steam cells). • zastosowanie pierwotnych komórek zarodkowych — ESC (ang. Następnie komórki te są wprowadzane ponownie do enukleowanych oocytów lub pęcherzy trofoblastycznych (tzn. zapłodnionej komórki jajowej. np. w którym miejscu genomu włączy się transgen. które wcześniej zostały pozyskane z węzłów zarodkowych blastocysty. gen struktury hormonu wzrostu (ang.rezultaty otrzymano po wprowadzeniu myszom ludzkiego genu czynnika uwalniającego hormon wzrostu.

poprzez wprowadzenie do genomu owiec genów białek keratynowych. W tabeli 4-II przedstawione są niektóre możliwości modyfikacji składu mleka w drodze transgenezy.• modyfikacji składu mleka. Duże nadzieje wiąże się z uzyskiwaniem transgenicznych zwierząt wykazujących tolerancję lub odporność na patogenne wirusy i bakterie. na przykład poprawy jakości i tempa wzrostu wełny. • modyfikacji cech biochemicznych u zwierząt. duże nadzieje wiąże się z poprawą jakości białek mleka. Odporność na choroby można uzyskać przez wprowadzenie do komórek 93 .

kodujące syntezę białek otoczki wirusów lub antygeny powierzchniowe bakterii. Na myszach transgenicznych prowadzone są badania endokrynologiczne z hormonem wzrostu. Prowadzone na nich badania powinny przyczynić się do wykrycia hormonu mającego działanie antagonistyczne w stosunku do hormonu wzrostu. Wyniki tych badań mogą mieć zastosowanie w leczeniu pacjentów ze zwiększoną zawartością hormonu wzrostu. laktację. blokujących w ten sposób namnażanie wirusów i ekspresję ich genów. z powodu nadostrej reakcji układu immunologicznego biorcy. Medycyna Zwierzęta transgeniczne mogą służyć medycynie człowieka jako „bioreaktory" do produkcji białek o działaniu leczniczym. . Badania naukowe Obiecujące są wyniki badań regulacji ekspresji genów prowadzone na zwierzętach transgenicznych. Szczególnie ważne dla badań biomedycznych jest tworzenie nowych modeli zwierzęcych. świnie z ludzkim genem kodującym IX czynnik krzepliwości krwi (jego niedobór powoduje hemofilię). najlepiej dominujące. Wyniki najnowszych badań wskazują możliwość uzyskania transgenicznych zwierząt (np. prowadzącej do odrzucenia przeszczepionego narządu. Uzyskano już transgeniczne owce z genem cdantytrypsyny (niedobór tego białka powoduje przede wszystkim u osób palących rozedmę płuc). Dotychczasowe próby przeszczepu zwierzęcych narządów człowiekowi kończyły się niepowodzeniem. świnie) z genami człowieka kontrolującymi odpowiedź układu immunologicznego na obce gatunkowo antygeny. Zaletą tej metody jest to. Transgeniczne zwierzęta mogą być wykorzystywane do badań biomedycznych. których obecność w organizmie stymulowałaby wytworzenie odpowiednich przeciwciał. których celem jest ocena jego wpływu na wzrost. wykazujące karłowatość. metabolizm węglowodanów i lipidów. krowy wytwarzające mleko z ludzką laktoferyną. Ptaki odporne na infekcje wirusowe i bakteryjne można uzyskać wprowadzając geny.zwierząt genów kodujących mRNA o sekwencji „antysensównej" do wirusowych kwasów nukleinowych. Ekspresję obcych białek można skierować do gruczołu mlecznego wykorzystując promotory genów białek mleka i przyłączając do nich geny struktury innych białek. Rozważana jest możliwość wykorzystania transgenezy w celu uzyskania zwierząt dawców narządów (tzw. 2. 3. W doświadczeniach żywieniowych zwierzęta transgeniczne mogą służyć do badań ekspresji genów różnych czynników metabolicznych. Uzyskano również myszy ze specyficznym analogiem hormonu wzrostu. iż samice transgeniczne wytwarzają mleko zawierające obce białko. ekspresję genu w niewłaściwej tkance lub ekspresję genów zmutowanych. ksenotransplantów) dla ludzi. które wykazują nadekspresję określonych genów.

które były korzystne lub obojętne dla organizmu. nazywane też aberracjami chromosomowymi. Wreszcie mutacje genowe dotyczą zmian w budowie genu. cel hodowlany jest realizowany zazwyczaj tylko przez kilka najbliższych 95 . Hodowla zwierząt jest oczywiście procesem nieporównywalnie krótszym w stosunku do ewolucji. a także naprawa uszkodzeń powstałych pod wpływem czynników mutagennych. Należałoby zatem rozróżnić proces przenoszenia mutacji. gdy jej skutkiem nie jest śmierć lub niepłodność nosiciela. jako wynik błędów w przebiegu niektórych procesów komórkowych. promieniowanie jonizujące. za pośrednictwem komórek płciowych. Ponieważ mutacja ma charakter przypadkowy i bezkierunkowy. niektóre związki chemiczne). Ich identyfikacja odbywa się przede wszystkim na drodze obserwacji mikroskopowej. a ich diagnoza jest dokonywana również metodą analizy mikroskopowej. a poznanie ich podłoża wymaga zastosowania metod molekularnych. Długotrwała ewolucja pozwalała na utrwalenie tylko tych mutacji. a ponadto. Mutacje genomowe dotyczą zmian w liczbie całych genomów lub pojedynczych chromosomów. Mutacje są pierwotnym źródłem zmienności genetycznej i dlatego są nierozerwalnie związane ze zmianami ewolucyjnymi. przez następne pokolenia. Dzieli się je na: genomowe. Oczywiście mutacja może być odziedziczona przez potomstwo jedynie wówczas. czyli takich. które uszkadzają DNA lub strukturę chromosomu (np. W przypadku powstania mutacji w komórce somatycznej jej trwanie ograniczone jest okresem życia organizmu. obserwowanymi wśród organizmów żywych. takich jak replikacja DNA czy podział jądra komórkowego. Mutacje chromosomowe.Rozdział Mutacje Mutacje to nagłe i trwałe zmiany w informacji genetycznej. przez kolejne pokolenia komórek (mutacja w komórkach somatycznych) od dziedziczenia mutacji. powstałych de novo. chromosomowe i genowe. Mutacje mogą powstawać samoistnie. dlatego większość z nich jest niekorzystna dla organizmów. związane są z naruszeniem budowy chromosomu.

Zakłócenie przebiegu mejozy może nastąpić podczas anafazy I i wówczas nie dochodzi do wyrzucenia pierwszego ciałka kierunko wego. Powstawanie w zygocie mutacji genomowych typu euploidii może być wynikiem różnych nieprawidłowości. Dotyczy to przede wszystkim mutacji genomowych i chromosomowych. 96 . wśród których do najważniejszych zalicza się (ryć. z jakimi spotykamy się w hodowli zwierząt gospodarskich. Znane są i inne mutacje. 5. że hodowca jest zainteresowany utrzymaniem mutacji w populacjach zwierząt. W przypadku mutacji genowych kwestia ta nie jest już tak oczywista. Na przykład. Także w takim przypadku przedjądrze żeńskie będzie miało diploidalną liczbę chromoso mów. 5-1): 1. zamiast dwóch genomów (2n) w komórce pojawiają się trzy (3n — triploidia) albo cztery (4n — tetraploidia) genomy lub tylko jeden genom (n — haploidia. W dalszej części tego rozdziału duży nacisk położymy na omówienie negatywnych skutków mutacji. 2. takie jak: hipertrofia mięśniowa u niektórych ras bydła mięsnego (mutacja genu miostatyny). Klasycznym przykładem są mutacje odpowiadające za barwę okrywy włosowej. Zdarzenia takie określa się mianem połispermii. a oocyt II rzędu ma diploidalną liczbę chromosomów. głównie żeńskiej. Dlatego można bez większych zastrzeżeń przyjąć. Po replikacji i zlaniu przedjądrzy powstaje zygota triploidalna. Mutacje genomowe Mutacje genomowe dzieli się na dwie kategorie: euploidie i aneuploidie. a hodowca jest zazwyczaj zainteresowany eliminacją nosicieli nowo powstających i niektórych utrwalonych mutacji. Euploidia jest mutacją prowadzącą do zmiany liczby genomów w komórce. prowadzące do powstania oocytów II rzędu o niezredukowanej (2n) liczbie chromosomów. wysoka plenność u niektórych ras owiec (np.pokoleń. monoploidia). to stan ten określa się jako poliploidalność. pojawiające się od czasu do czasu na fermach zwierząt futerkowych. Do zaburzenia wyrzucenia ciałka kierunkowego może dojść również podczas anafazy II. Zaburzenie przebiegu mejozy.1. ponieważ obok mutacji szkodliwych (np. co daje początek zygocie triploidalnej (zapłodnienie przez dwa plemniki) czy tetraploidalnej (zapłodnienie przez trzy plemniki). że mutacje są zjawiskiem ogólnie niepożądanym w populacjach hodowlanych. Jeżeli powstają układy o większej liczbie genomów niż dwa. która odbywa się już po wniknięciu plemnika do oocytu. choroby genetyczne) znanych jest wiele przykładów pokazujących. które wpływają korzystnie na cechy produkcyjne zwierząt. Zapłodnienie takiego oocytu przez haploidalny plemnik daje początek triploidalnej zygocie. mutacja w genie BMPR-IB) itp. Zapłodnienie haploidalnego oocytu II rzędu przez więcej niż jeden plemnik.

tetraploidalne oogonium. zazwyczaj we wczesnym okresie rozwoju zarodkowego. czego skutkiem jest rozwój haploidalnego zarodka. które powstało w wyniku zakłócenia cytokinezy po mitotycznym podziale jądra komórkowego. Euploidie są mutacjami letalnymi. Tym samym każdy przypadek takiej mutacji zalicza się do kategorii nowo powstałych (de novo). takich na przykład jak brak cytokinezy po podziale jądra komórkowego. Podjęcie podziału mejotycznego przez spermatogonium lub oogonium o nieprawidłowym poziomie ploidalności. np. 4. Praktycznie nie spotyka się tego rodzaju mutacji w okresie pourodzeniowym. Ponieważ komórki te wywodzą się z jednej zygoty. że prowadzą one do śmierci osobnika.Ryć. Jest to skutek zakłóceń w pierwszych podziałach mitotycznych zarodka. Aktywacja partenogenetyczna polegająca na podjęciu podziałów mitotycznych przez niezapłodniony oocyt (ginogeneza). to znaczy takiego. Z komórki takiej po zakończeniu mejozy i zapłodnieniu powstaje triploidalna zygota. np. układ taki klasyfikowany jest jako mozaicyzm. Mutacje te są jedną z przyczyn niepowodzeń 97 . W trakcie rozwoju zarodkowego może dojść do uformowania układu miksoploidalnego. co oznacza. 5-1. Niektóre mechanizmy powstawania mutacji genomowych typu euploidii 3. 2n i 4n czy 2n i 3n itd. gdzie w obrębie zarodka występują komórki różniące się poziomem ploidalności.

Jeśli zmiany wystąpią równocześnie w dwóch parach chromosomów. Aneuploidie tylko niektórych chromosomów nie prowadzą do śmierci nosiciela. jaka jest skala tego problemu. że aneuploidie w postaci czystej prowadzą prawdopodobnie do śmierci osobnika. Jeżeli gamety takie będą uczestniczyły w zapłodnieniu. że podczas rozwoju zarodkowego dochodzi do nieprawidłowej segregacji chromosomów siostrzanych. którym na ogół nie towarzyszą wyraźne zaburzenia w rozwoju somatycznym. 5-2a). Zdecydowana większość aneuploidii jest letalna. Wskazuje to. Błąd segregacji chromosomów siostrzanych podczas podziału komórek somatycznych (np. w którym obok linii komórkowej z prawidłowym zestawem chromosomowym występowała jedna lub więcej linii aneuploidalnych. W mejozie momentem krytycznym jest segregacja chromosomów do przeciwległych biegunów komórki podczas anafazy I. Klacz obarczona tą mutacją ma kariotyp 98 . Zazwyczaj mutacje te stwierdzano w układzie mozaikowym. to powstaną zarodki obarczone trisomia (2n +1) lub monosomią (2n —1). Aneuploidia to druga kategoria mutacji genomowych. Jeśli natomiast występuje brak obu chromosomów w parze. Nieprawidłowa segregacja w jednym biwalencie. prowadzi do powstania gamet o liczbie chromosomów n + 1 oraz n —1. Trudno jednak określić. Aneuploidie są spowodowane nieprawidłowościami w przebiegu podziałów komórkowych. Aneuploidie chromosomów płci prowadzą zazwyczaj do niepłodności. Wśród zidentyfikowanych u zwierząt gospodarskich aneuploidii dominują właśnie przypadki dotyczące chromosomów płci. Z badań prowadzonych na zarodkach uzyskiwanych metodą zapłodnienia in vitro wynika. a nadmiar chromosomów to trisomia (2n +1). Tak więc brak chromosomu nazywa się monosomią (2n — 1). a obecność czterech chromosomów homologicznych nazywany jest tetrasomią (2n + 2). gdy oba chromosomy zmierzają do jednego bieguna komórki.w rozrodzie zwierząt. to stan taki określany jest jako nullisomia (2n —2). to stan taki określany jest jako podwójna monosomią (2n —l —1) lub podwójna trisomia (2n + l + l). Również podczas podziałów mitotycznych (lub drugiego podziału mejotycznego) może dojść do powstania komórek z nieprawidłową liczbą chromosomów. że co najmniej kilkanaście procent tak uzyskanych zarodków może być obarczonych mutacjami typu poliploidii lub haploidii. Wyjątek stanowią aneuploidie chromosomów płci. jednak powodują powstanie licznych wad rozwojowych. która związana jest ze zmianą liczby chromosomów w pojedynczych parach homologicznych. Równocześnie wynika z tego. to w komórkach potomnych powstaną układy 2n + l (oba chromosomy siostrzane po podziale centromeru przeszły do jednego bieguna) oraz 2n — l (do bieguna nie przeszedł żaden z chromosomów siostrzanych). Aneuploidia najczęściej opisywaną u zwierząt jest monosomią chromosomu X u klaczy (ryć. zarodka) prowadzi do mozaicyzmu. Gdy podczas anafazy mitotycznej chromosomy siostrzane nie rozejdą się symetrycznie do przeciwległych biegunów komórki.

99 .XXY lub występuje u nich układ mozaikowy 60.XX. Zwierzęta takie mają zasadniczo normalny eksterier. zazwyczaj nie wykazują objawów rui i są bezpłodne ze względu na niedorozwój jajników.X0 („0" oznacza brak chromosomu X) lub częściej jest to kariotyp mozaikowy 63.2n = 63. Osobniki takie mają diploidalną liczbę chromosomów 61.XO/64. W związku z tym hodowca nie może znaleźć przyczyny jałowości takiej klaczy.XY/61. dopóki nie zdecyduje się na przeprowadzenie badania cytogenetycznego.XXY. Znane są również przypadki trisomii XXY u buhajów.

2. w wyniku której pojawia się około 50% gamet z chromosomem X oraz około 50% gamet z układem XX. co może być stosunkowo łatwo zauważone przez hodowcę czy lekarza weterynarii. Jeżeli pęknięcie nie zostanie naprawione. że aneuploidie ilekroć się pojawiają. niezidentyfikowanie nosiciela wśród zwierząt hodowlanych może być przyczyną dużych strat ekonomicznych hodowcy. Zapłodnienie tych ostatnich prowadzi do powstania zarodka z trisomią. albo głębokie zaburzenia rozwojowe lub bezpłodność. bez zastosowania metod cytogenetycznych. Za przyczynę powstania izochromosomów uznaje się nieprawidłowy podział centromeru w płaszczyźnie prostopadłej do osi chromosomu. Stwierdzenie wymienionych zaburzeń jest wystarczającą podstawą wybrakowania takiego osobnika. której zdiagnozowanie. jest niemożliwe. Przedstawione wyżej prawidłowości wskazują. Mogą powstać także inne nietypowe struktury. to zazwyczaj mają pochodzenie de novo. nie ma ryzyka przeniesienia tej mutacji na następne pokolenia. 5. ze względu na dość częste występowanie u klaczy monosomii chromosomu X. podczas podziału komórkowego. Możliwe jest również nieprawidłowe przeprowadzenie naprawy uszkodzenia. W potomstwie takich samic mogą się pojawić zwierzęta obarczone trisomią XXY lub XXX. Jest to skutek segregacji chromosomów w anafazie I. a zatem i szerokiego rozprzestrzenienia w populacji. poza nielicznymi wyjątkami. Wówczas dochodzi do przegrupowania fragmentów w obrębie jednego chromosomu (inwersja) lub kariotypu (fuzja centryczna. Sytuacja taka jest szczególnie dotkliwa dla hodowców koni. Przykładem może być niepłodna suka o prawidłowym eksterierze (ryć. to nastąpi utrata fragmentu chromosomu (delecja). Przyczyną mutacji chromosomowej może być również niezrównoważona wymiana fragmentów chromatyd 100 . że osobniki mające w swoim kariotypie trzy chromosomy X są płodne. translokacja wzajemna). Niemniej jednak. Przypadki trisomii chromosomu X opisywano znacznie rzadziej. a następnie połączenia tych miejsc z równoczesną utratą małych fragmentów na obu końcach chromosomu. Dzięki temu. z tym jednak że zazwyczaj towarzyszy temu wolniejsze tempo wzrostu somatycznego oraz widoczny niedorozwój jąder. tandem fuzja. wynikających z kosztów odchowu oraz utrzymania zwierzęcia o upośledzonych funkcjach rozrodczych. W przeciwieństwie do monosomii X0 oraz trisomii XXY dość często się zdarza. 5-2b).Również w przypadku tej chromosomopatii nosiciel dotknięty jest bezpłodnością. Mutacje chromosomowe Pierwotną przyczyną zmian w budowie chromosomu jest jego uszkodzenie (pęknięcie). gdyż skutkiem ich wystąpienia jest albo śmierć nosiciela. Z kolei chromosom kolisty może powstać w wyniku dwóch pęknięć na przeciwległych końcach chromosomu. takie jak izochromosomy (są zbudowane z dwóch identycznych ramion) lub chromosomy koliste. przez odpowiedzialne za to systemy naprawy komórkowej.

Inne — tzn.i paracentryczne. prowadząca do powstania chromosomów z brakiem (delecja) lub z podwojeniem (duplikacja) jakiegoś fragmentu. które w momencie powstania mają charakter zrównoważony. gdy ilość informacji genetycznej w komórce została zmieniona. duplikacje. że mutacje chromosomowe niezrównoważone. że zdecydowana większość tych przypadków nie jest identyfikowana. Zaliczane są do nich: fuzje centryczne. jeżeli w komórce nie nastąpiła zmiana ilości informacji genetycznej. padnięcie po urodzeniu lub ubój z konieczności. bardzo rzadko są zgłaszane przez hodowców czy lekarzy weterynarii do badań cytogenetycznych i dlatego można przyjąć. U zwierząt gospodarskich najczęściej diagnozowane są mutacje chromosomowe w układzie zrównoważonym. wśród których wyróżniane są inwersje peri. translokacje wzajemne. buhaje). że przegrupowanie w pobliżu jakiegoś genu może wywołać jego ekspresję lub jej zanik. Ma to związek zarówno z funkcjonowaniem sekwencji poprzedzających gen (promotor. Szczególna 101 . podobnie jak aneuploidie. czego skutkiem jest uruchomienie procesu nowotworowego. fuzje centryczne. wyciszacz). inwersje. Pewne mutacje chromosomowe są ze swojej natury klasyfikowane już od momentu powstania do grupy niezrównoważonych (delecje. zauważalnych zmian fenotypowych. których skutkiem jest przegrupowanie informacji genetycznej w kariotypie. ponadto hodowcy są bardziej zainteresowani poznaniem przyczyny zmniejszonej płodności. Znane są liczne przykłady u ludzi. a także i zwierząt laboratoryjnych wpływu takich przegrupowań chromosomowych na aktywację onkogenów lub inaktywację antyonkogenów. Wynika to przede wszystkim z tego. występując pierwotnie w układzie zrównoważonym. fuzje tandemowe. mogą prowadzić poprzez zakłócony przebieg segregacji chromosomowej w anafazie I do powstania gamet niezrównoważonych. inaczej centromerowe (translokacje robertsonowskie). Mutacja chromosomowa może wystąpić w układzie zrównoważonym. bo osobniki takie z urzędu mogą być objęte badaniami cytogenetycznymi (np. translokacje wzajemne i inwersje. prowadzą do zmiany sąsiedztwa genów. Zmiana taka może pociągnąć za sobą naruszenie procesów kontroli ekspresji genów. Z kolei mutacje zrównoważone. Dziedziczenie mutacji chromosomowych możliwe jest oczywiście jedynie wówczas. wzmacniacz. odnotowywane jako martwe urodzenie. to szansa na wykrycie nosicielstwa mutacji jest znacznie większa. Jeżeli dotknie to osobnika o dużej wartości genetycznej. lub też w układzie niezrównoważonym. W dalszej części tego rozdziału będzie mowa o mutacjach chromosomowych.niesiostrzanych podczas crossing over. Przypadki takie. izochromosomy). a dalej do powstania zygot o zmienionej zawartości materiału genetycznego. Zdarzyć się może. Mutacje chromosomowe. nie wywołując zazwyczaj efektu w postaci zauważalnych zmian fenotypowych. jak i ze strukturą samego genu. mają najczęściej negatywny wpływ na płodność nosiciela mutacji. są letalne lub prowadzą do poważnych. tandem fuzje. gdy występuje ona w komórkach linii płciowej.

gdy dwa chromosomy akrocentryczne pękną w pobliżu centromeru. a następnie uszkodzenie to zostanie niewłaściwie naprawione (ryć. 5-3a.uwaga będzie poświęcona mechanizmom powodującym zmniejszenie płodności u nosicieli tego typu mutacji. Fuzja centryczna (translokacja robertsonowska) powstaje wówczas. 102 .

29). Ryć. natomiast małe fragmenty okołocentromerowe zostają zagubione podczas następnych podziałów komórkowych (nie wchodzą do jąder komórkowych odbudowujących się podczas telofazy). nie odbija się negatywnie na nosicielu. kozioł. Duże fragmenty. chromosom translokacyjny oraz chromosomy pici są wskazane. barwienie roztworem Giemsy. Translokacje robertsonowskie: (a) rob(l. zostają połączone w centromerze i w efekcie powstaje jeden duży dwuramienny chromosom. 5-4.7).5-4a). buhaj. kompleksy synaptonemalne obserwowane w transmisyjnym mikroskopie elektronowym. triwalent oraz biwalent X-Y są wskazane 103 . (b) rob(5. reprezentujące prawie cale ramiona długie chromosomów. Utrata małych fragmentów z okolicy centromeru. który zawiera przede wszystkim niekodujące sekwencje powtarzalne.

podczas której chromosom dwuramienny przechodzi do jednego bieguna. mimo iż połowa z nich (niosąca dwuramienny chromosom) będzie miała n —l chromosomów. gdy fuzja obejmie chromosomy wywodzące się z różnych par homologicznych. Zupełnie inaczej przedstawia się sytuacja. że jej nosiciele mają zmniejszoną płodność o około 5%. w którym chromosomy akrocentryczne koniugują z homologicznymi ramionami chromosomu powstałego w wyniku fuzji (ryć. Jeżeli fuzji uległy chromosomy homologiczne. a w tym również w Polsce.Skutkiem tej mutacji jest zmniejszenie liczby chromosomów o jeden. na wszystkich kontynentach. Jednakże liczba ramion chromosomowych w obu rodzajach gamet będzie taka sama. że połowa gamet będzie typu n —l (układ powstający na biegunie. Prowadzi to oczywiście do tego. 5-4b). co w rzeczywistości odpowiada układowi n + 1. Fuzje 1/29 zidentyfikowano w ponad 50 rasach bydła. w których uczestniczyły chromosomy z różnych par. 5-3b. W anafazie I zazwyczaj dochodzi do zrównoważonej segregacji. ale najpowszechniejsza jest fuzja obejmująca chromosomy z pary l i 29 (ryć. Opisano wiele różnych fuzji. Jeżeli komórka taka rozpocznie podział mejotyczny. a dalej zygoty o nieprawidłowej liczbie ramion chromosomowych. a druga będzie miała n chromosomów. które z dużym prawdopodobieństwem zginą już podczas rozwoju embrionalnego bądź płodowego.). szczególnie ras mięsnych. z równoczesnym zachowaniem nie zmienionej liczby ramion chromosomowych. natomiast w anafazie I do jednego bieguna przejdzie tenże dwuramienny chromosom. Zarodki takie będą ginęły w okresie życia zarodkowego lub płodowego. Pięć lat później ten sam badacz wykazał. to podczas anafazy I mejozy nastąpi nieprawidłowa segregacja chromosomów. jak poprzez badanie cytogenetyczne. że nosiciele fuzji mają prawidłowy fenotyp i nie można ich zidentyfikować w inny sposób. 5-4a). W pachytenie profazy I nowo powstały chromosom dwuramienny pozostanie jako uniwalent. 104 . Fuzje centryczne są często identyfikowane u bydła. to w pachytenie profazy I uformuje się triwalent. czyli ukształtuje się układ aneuploidalny. Najwięcej przypadków fuzji stwierdza się w rasach mięsnych (montbelliard. Mutację tę po raz pierwszy opisał w 1964 roku Gustavsson u czerwono-białego bydła szwedzkiego. z tym jednak że wśród nich będzie chromosom dwuramienny. W niewielkiej części komórek w stadium anafazy I może dojść do niewłaściwej segregacji triwalentu i wówczas powstaną gamety. Należy zaznaczyć. Hodowca będzie wówczas odnotowywał zmniejszoną płodność takiego osobnika. W przypadku zapłodnienia powstają zygoty aneuploidalne. do którego nie przeszedł chromosom dwuramienny). a oba chromosomy akrocentryczne do drugiego bieguna komórki. Wówczas w komórce powstaje układ składający się z jednego chromosomu dwuramiennego oraz po jednym chromosomie z dwóch par akrocentrycznych. podczas gdy na drugim biegunie zabraknie jednego chromosomu. W efekcie powstają gamety o zrównoważonej informacji genetycznej. blonde d'Aquitaine itp.

W Polsce. nr 23 i 24). W tym przypadku można wręcz mówić o polimorfizmie kariotypowym. białe bydło rrytyjskie. natomiast niektóre opracowania wskazują na zwiększoną plenność samic o kariotypie 2n = 48. jest lis polarny. bowiem około 50% zwierząt ma kariotyp heterozygotyczny ze względu na fuzję (dotyczy ona. Dziedziczenie translokacji robertsonowskiej na przykładzie bydła. Gatunkiem. Oprócz fuzji 1. jedynych w kariotypie lisa. Chromosomy biorące udział w fuzji przedstawiono schematycznie 105 . w których zaangażowane były chromosomy z innych par. Ryć. u którego fuzja centryczna występuje bardzo często. Przykładem może być fuzja między chromosomami z pary 5 i 22. 5-5. obowiązkowymi badaniami objęte są wszystkie młode buhaje. a około 30% ma kariotyp podstawowy — 2n = 50 oraz pozostałe około 20% ma kariotyp homozygotyczny ze względu na fuzję — 2n = 48. dwóch par akrocentryków. Szwecja była pierwszym krajem. że u tego gatunku nie stwierdza się zmniejszonej płodności zwierząt o 2n = 49. którą opisano w Polsce. Obserwowane zmniejszenie płodności jest skutkiem wczesnej zamieralności zarodków o niezrównoważonym kariotypie. począwszy od 1989 roku. włoskie bydło rasy podolian czy bydło korsykańskie). Szerokie rozprzestrzenienie fuzji centrycznych u bydła i związane z tym zmniejszenie płodności stało się główną przyczyną wprowadzenia w wielu krajach do praktyki hodowlanej obowiązkowych badań cytogenetycznych buhajów przed ich dopuszczeniem do użytkowania rozpłodowego. Ciekawe. przed ich wprowadzeniem do stacji produkcji nasienia.a niekiedy także w małych izolowanych rasach lokalnych (np. który wprowadził taką regulację.29 zdiagnozowano wiele innych przypadków.

pochodzących z dwóch różnych chromosomów. Jeżeli translokacją wzajemną będą objęte chromosomy niehomologiczne (ryć. Segregacja symetryczna (2:2) nie gwarantuje jeszcze. prowadzą do uformowania niezrównoważonej (delecje. w wyniku której do jednego bieguna wędrują po jednym nie zmienionym (prawidłowym) chromosomie z obu par. Oczy wiście segregacja niesymetryczna (3: l lub 4:0) również powoduje utworze nie gamet genetycznie niezrównoważonych. 5-7). W ten sposób segregacja naprzeciwległa odpowiada za powstanie gamet o zrównoważonej ilości informacji genetycznej. jeśli oczywiście wystąpi w linii komórek płciowych. że suma informacji genetycznej zawarta w dwóch chromosomach. 5-6b. to podczas pachytenu profazy I zostanie uformowany tetrawalent (ryć. a do drugiego przechodzą chromosomy. że szerokie rozprzestrzenienie fuzji centrycznych w populacjach zwierzęcych (głównie bydło. że około 50% gamet wytwarzanych przez 106 . 5-6a. Translokacja wzajemna powstaje w wyniku niewłaściwego połączenia podczas procesu naprawy pęknięć nici chromatynowych. to podczas mejozy dojdzie do powstania gamet. który zazwyczaj będzie segregował w anafazie 1 w układzie 2:2. Przyjmuje się. Skutek takiej translokacji będzie zazwyczaj letalny. bądź duplikacją. Wśród trzech możliwych segregacji symetrycznych tylko jedna warunkuje powstanie biegunów o zrównoważonej ilości informacji genetycz nej. tzn. które będą obarczone bądź delecją. lisy polarne. określane jako sąsiednie. 5-8). Dwa pozostałe rodzaje segregacji. Na niezrównoważenie ilości informacji genetycznej wpływa również crossing over. jest taka sama jak w dwóch nie zmienionych chromosomach. duplikacje) ilości informacji genetycznej w gametach. gdy rozród jest oparty na sztucznej inseminacji. które uczestniczyły w trans lokacji. Należy zaznaczyć. a nie częstego powstawania de novo. że powstaną gamety o zrównoważonej informacji genetycznej. dwa chromosomy przejdą do jednego bieguna i dwa chromosomy do drugiego bieguna komórki. a w mniejszym stopniu także owce i kozy) jest skutkiem ich dziedziczenia. Jeżeli na przykład u bydła zostaną skojarzeni ze sobą nosiciele tej samej fuzji centrycznej. jak łatwo mutacja taka może zostać rozprzestrzeniona w populacji. jeśli zajdzie na odcinku między punktem pęknięcia i wymiany fragmentów chromosomowych a centromerem. Przedstawione obserwacje wskazują.Należy podkreślić. że fuzja centryczna jest dziedziczona przez połowę potomków nosiciela. Jest to segregacja naprzeciwległa. które podlegały translokacji. szczególnie wówczas. 0 2n = 58 (ryć. Pokazuje to jedno cześnie. Jeżeli mutacji takiej będą podlegały chromosomy homologiczne i wymienione zostaną nierówne fragmenty chromosomów. to u potomstwa możemy się spodziewać 25% osobników o normalnym kariotypie 2n = 60. Podobnie jak w przypadku fuzji centrycznej. 50% nosicieli fuzji o 2n = 59 i 25% osobników będących homozygotami ze względu na fuzję. 5-5). także translokacją wzajemna jest mutacją dziedziczną. tak jak to najczęściej obserwuje się przy mutacjach niezrównoważonych.

5-6. Hodowca odnotuje 107 . to doprowadzą do powstania zygot. Translokacja wzajemna: (a) schemat powstawania. (b) segregacja tetrawalentu podczas mejozy nosiciela translokacji jest niezrównoważonych genetycznie i dlatego jeżeli będą one uczestniczyły w zapłodnieniu. w którym crossing over wystąpiło między centromerem i punktem pęknięcia/wymiany Ryć. które będą ginęły zazwyczaj w życiu płodowym.*Schemat nie uwzględnia segregacji tetrawalentu.

.

Stan taki towarzyszy nosicielstwu translokacji wzajemnej. Jeżeli tandem fuzja zajdzie między dwoma homologicznymi 109 . W efekcie duże fragmenty chromosomowe zostają połączone tandemowo — jeden za drugim. po których uzyskano mioty o obniżonej liczebności (poniżej 8 prosiąt w miocie).wówczas około 50-procentowy spadek płodności (lub plenności) u takiego osobnika. w rozmaitych rasach. Bezpłodność samców nosicieli jest wynikiem zablokowania procesu spermatogenezy we wczesnych stadiach mejozy (pachyten profazy I). Jedno z nich występuje w części końcowej ramienia w chromosomie jedno. Podobnie normalny fenotyp mają lochy nosicielki. 5-7). że ma to związek z przedwczesnym uaktywnieniem chromosomu X podczas spermatogenezy. Potomstwo o niezrównoważonym kariotypie zazwyczaj ginie w okresie życia płodowego lub wkrótce po urodzeniu. Właśnie te gamety są odpowiedzialne za przenoszenie translokacji wzajemnej do następnego pokolenia. a drugie tuż pod centromerem w ramieniu długim chromosomu akrocentrycznego. że nosiciele translokacji (kariotyp zrównoważony) mają prawidłowy fenotyp i niczym nie odróżniają się od osobników o prawidłowym kariotypie. U samic nosicielek stwierdza się jedynie zmniejszenie płodności. a małe fragmenty (okołocentromerowy z chromosomu akrocentrycznego i dystalny z drugiego chromosomu) zostają zagubione. a obraz nasienia (koncentracja. Przypuszcza się.lub dwuramiennym. Na krótkie omówienie zasługuje specjalna kategoria translokacji wzajemnych. Oczywiście stan taki może być spowodowany różnymi czynnikami. ponad 90 różnych translokacji wzajemnych. W ostatecznym rozrachunku po nosicielu skojarzonym z osobnikami o prawidłowym kariotypie uzyska się potomstwo. Na przykład we Francji badania cytogenetyczne wykonywane są u knurów. morfologia czy ruchliwość plemników) nie różni się w porównaniu z nasieniem knurów o prawidłowym kariotypie. podobnie jak w przypadku fuzji centrycznej. Jedyną wskazówką sugerującą nosicielstwo takiej mutacji są obniżone wskaźniki płodności lub plenności. Jej powstanie związane jest z nieprawidłową naprawą pęknięć w dwóch chromosomach. które były rozprzestrzenione w populacjach w różnym stopniu. w którą zaangażowany jest chromosom X (translokacja typu X-autosom). która prowadzi do bezpłodności samców nosicieli. Do tej pory zidentyfikowano na świecie. podobnie jak w przypadku translokacji typu autosom-autosom. Trzeba podkreślić. w którym wystąpią dwa translokowane chromosomy. w którym polowa będzie miała prawidłowy kariotyp. Translokacje wzajemne najczęściej są rozpoznawane u świń (ryć. Druga połowa gamet będzie miała zrównoważoną ilość informacji genetycznej. Niemniej obserwacje takie powinny być traktowane jako sygnał skłaniający do przeprowadzenia badań cytogenetycznych. Knury nosiciele mają prawidłowe libido. ale wśród nich połowa będzie miała układ. a połowa będzie nosicielami translokacji. Fuzja tandemowa jest mutacją podobną do fuzji centrycznej.

analogicznie do schematu przedstawionego dla translokacji robertsonowskich. spowodowanej zamieraniem zarodków o niezrównoważonym kariotypie.chromosomami akrocentrycznymi. to nieprawidłowość jest określana jako inwersja paracentryczna. Jeżeli odwrócony fragment nie obejmuje centromeru. Uwaga ta dotyczy 110 . to wówczas inwersja jest określana jako pericentryczna. to podczas mejozy. chociaż w rasie czerwonej duńskiej jej rozprzestrzenienie w latach 70. która zapewnia zachowanie homologicznej koniugacji wzdłuż całego biwalentu. dojdzie do powstania aneuploidalnych gamet. Mutacja ta jest dziedziczona przez połowę potomków nosiciela. Inwersja pericentryczna zazwyczaj zmienia morfologię chromosomu. Oceniano wówczas. z wyjątkiem sytuacji. w którym wystąpiły dwa pęknięcia. może powodować nieznaczne zmniejszenie płodności z powodu zamierania zarodków. 2) chromosomy częściowo pozostają nieskoniugowane — w części. oraz 3) pełna koniugacja. gdy pęknięcia wystąpiły w równych odległościach od centromeru w obu ramionach chromosomowych. Inwersje dość rzadko opisywano u zwierząt gospodarskich. Taki przebieg mejozy prowadzi oczywiście do powstania gamet o niezrównoważonej ilości informacji genetycznej i ostatecznie do zmniejszenia płodności nosiciela mutacji. Najmniej korzystny. z jednoczesną możliwością powstania chromosomów dicentrycznych (mających dwa centromery) oraz acentrycznych (pozbawionych centromeru). że zmniejszenie płodności wywołane przez tę mutację było rzędu 10%. która częściowo jest niehomologiczna. tzn. które powstały na bazie gamet o niezrównoważonej ilości informacji genetycznej. podobnie jak przy fuzji centrycznej. Jeżeli w obrębie odwróconego fragmentu występuje centromer. to bardzo łatwo można ją przeoczyć podczas obserwacji mikroskopowej. to wówczas powstaną gamety obarczone delecją lub duplikacją. gdzie na jednym z chromosomów występuje odwrócony fragment. może przebiegać w trojaki sposób: 1) chromosomy tworzą pętlę inwersyjną. Brak koniugacji lub koniugacja niehomologiczna uniemożliwia zajście w tym obszarze crossing over i tym samym nie ma ryzyka powstania gamet obarczonych wymienionymi nieprawidłowościami. Niewątpliwie jest to częściowo wynikiem trudności w ich rozpoznawaniu. że fragment pomiędzy punktami pęknięć został odwrócony o 180°. w obrębie fragmentu objętego inwersją na jednym z chromosomów. a następnie zostały one niewłaściwie naprawione w taki sposób. Powstanie tandem fuzji między chromosomami niehomologicznymi wywołuje analogiczne skutki jak fuzja centryczna. Znane są nieliczne przypadki tej mutacji u bydła. jest pierwszy sposób koniugowania. podczas którego dochodzi do uformowania pętli inwersyjnej. Jeżeli zajściu inwersji nie towarzyszy widoczna zmiana morfologii. Tandem fuzja była rzadko opisywana u zwierząt gospodarskich. z punktu widzenia skutków gametogenezy. było dość duże. Przebieg koniugacji podczas pachytenu profazy I. Jeżeli w obrębie pętli zajdzie crossing over. Inwersja jest mutacją zachodzącą w obrębie jednego chromosomu. tam gdzie fragment odwrócony koniuguje z fragmentem prawidłowym.

wszystkich inwersji paracentrycznych, ale także niektórych przypadków pericentrycznych. Dotychczas zdiagnozowano na świecie co najmniej siedem przypadków inwersji pericentycznych u bydła i trzy u świń oraz tylko jeden przypadek inwersji paracentrycznej u świni. W przypadku dwóch inwersji u świni analizowano proces formowania kompleksów synaptonemalnych i w żadnym z nich nie stwierdzono obecności pętli inwersyjnej. Nie wiązano również jednoznacznie tych mutacji ze zmniejszoną płodnością ich nosicieli.

5.3. Mutacje genomowe i chromosomowe zidentyfikowane u zwierząt hodowanych w Polsce
Badania cytogenetyczne zwierząt gospodarskich mają w Polsce długą tradycję. W okresie ostatnich 25 lat zdiagnozowano wiele przypadków nieprawidłowości chromosomowych. Były wśród nich mutacje typu aneu-

Oznaczenia: rób — translokacja robertsonowska; rep — translokacja wzajemna (w nawiasach wskazano numery chromosomów zaangażowanych w mutację); rcp(?;?) — translokacja wzajemna, dla której nie ustalono, jakie chromosomy w niej uczestniczyły; inv — inwersja; chimeryzm — występowanie dwóch linii komórkowych XX oraz XY w limfocytach (patrz: frymartynizm); * — część przypadków ma kariotyp mozaikowy, np. XX/XO lub XXY/XY
111

ploidii chromosomów płci, a także mutacje chromosomowe, takie jak fuzje centryczne, translokacje wzajemne i inwersje. Oprócz tych typowych chromosomopatii zidentyfikowano także liczną grupę zwierząt będących nosicielami chimeryzmu w komórkach krwi, polegającego na wystąpieniu linii żeńskiej XX i linii męskiej XY. Nieprawidłowość tę szczegółowo omówiono w podrozdziale: Interseksualizm. Sumaryczne zestawienie wyników przeprowadzonych badań przedstawione jest w tabeli 5-1. Zgromadzona wiedza o występowaniu mutacji genomowych i chromosomowych w krajowej populacji bydła sprawiła, że już w 1989 roku wprowadzono obowiązkowe badania cytogenetyczne młodych buhajów przed ich dopuszczeniem do użytkowania w stacjach produkcji nasienia. Aktualne regulacje (1999 r.) prawne obowiązkiem takim objęły także rozpłodniki innych gatunków wykorzystywane w inseminacji: knury, ogiery, tryki i kozły. Dzięki temu można skutecznie zapobiegać rozprzestrzenianiu się nieprawidłowości chromosomowych.

5.4. Mutacje genowe 5.4.1. Przyczyny i rodzaje mutacji genowych
Mutacje genowe są to zmiany sekwencji nukleotydów w obrębie genu. Mutacje te mogą zachodzić samoistnie, głównie na skutek błędów w procesie replikacji DNA, rzadziej na drodze modyfikacji chemicznych zasad azotowych w DNA. Mutacje te noszą nazwę mutacji spontanicznych. W odróżnieniu od nich mutacje indukowane są powodowane działaniem mutagennych czynników chemicznych lub fizycznych. Czynniki te mogą powstawać w wyniku przemian metabolicznych zachodzących w komórkach lub mogą pochodzić ze środowiska zewnętrznego. Do najsilniej działających czynników mutagennych należą: • promieniowanie jonizujące (np. Roentgena), które powoduje zmiany struktury zasad lub rozrywanie mostków wodorowych między zasadami w DNA. Wrażliwość organizmów na promieniowanie jonizujące zależy od posiadanych przez nie mechanizmów naprawy. Na przykład, niektóre rodzaje bakterii czy gatunki owadów są znacznie bardziej odporne na promieniowanie jonizujące niż człowiek i zwierzęta; • promieniowanie nadfioletowe (UV), intensywnie pochłaniane przez DNA, indukujące zmiany w zasadach pirymidynowych, np. ich dimeryzację (dimery pirymidynowe powstają w wyniku wytwarzania kowalencyjnych wiązań między leżącymi obok siebie w łańcuchu DNA zasadami pirymidynowymi) lub rozrywanie podwójnej helisy DNA; • hydroksyloamina wywołująca zmianę cytozyny na pochodną uracylu, co prowadzi do tranzycji C→T; 112

• kwas azotawy powodujący deaminację zasad w DNA i RNA. Na rrzykład na skutek deaminacji cytozyny powstaje uracyl, który podczas replikacji przyłącza adeninę zamiast guaniny, komplementarnej do cytozyny; • związki alkilujące, które dzięki posiadanym grupom etylowym, metylowym lub bardziej złożonym powodują alkilację (metylowanie lub etylowanie) zasad w kwasach nukleinowych; • barwniki akrydynowe (np. proflawina, oranż akrydynowy, akryflawina), które wnikają między zasady w łańcuchu DNA, powodując deforma cje podwójnej helisy DNA; • analogi zasad (np. 5-bromouracyl, analog tyminy oraz 2-aminopuryna, analog adeniny), które mogą być wbudowywane w DNA. Pomimo dużej różnorodności czynników mutagennych, mogą one powodować te same typy mutacji w różnych organizmach. Dzieje się tak dlatego, iż wszelkie typy uszkodzeń w DNA wywołane mutagenami stanowią tylko zmiany premutacyjne, które w wyniku procesów naprawy mogą zostać zlikwidowane. W przypadku nieskutecznej naprawy dochodzi do utrwalenia zmian mutacyjnych. Niekorzystne skutki działania czynników mutagennych są łagodzone przez enzymatyczne procesy naprawy. Analizując procesy naprawy można wyróżnić naprawę bezpośrednią (przez wycinanie) i pośrednią (poreplikacyjną, zwaną też naprawą w nici potomnej). Naprawa bezpośrednia — NER (ang. nucleotide excision repair) polega na wycinaniu nukleotydu (usuwane są duże uszkodzenia) bądź zasady, uszkodzonej przez promieniowanie jonizujące i czynniki alkilujące. W uproszczeniu proces ten przebiega tak, iż po rozpoznaniu uszkodzenia specyficzny enzym (zależna od ATP endonukleaza) nacina nić DNA po obu stronach uszkodzenia, następnie jednoniciowy, kilku- lub kilkunastonukleotydowy fragment z uszkodzeniem jest usuwany. Powstała przerwa jest wypełniana przez polimerazę, a nić DNA jest scalana przez ligazę. Przypuszczalnie w komórce funkcjonują dwa rodzaje NER, jeden polega na naprawie nici transkrybowanej genów aktywnych transkrypcyjnie (ang. transcription-coupłed repair), drugi natomiast polega na naprawie pozostałej części genomu (ang. global genome repair), czyli nici kodującej i DNA nieaktywnego transkrypcyjnie. Zwykle uszkodzenia nici transkrybowanej usuwane są dwa lub trzy razy szybciej niż uszkodzenia nici kodującej. Mechanizmy naprawy są dokładnie zbadane u organizmów prokariotycznych, natomiast proces usuwania uszkodzeń w komórkach zwierzęcych jest nadal słabo poznany. Wiadomo jednak, iż w komórkach zwierzęcych rodzaj i umiejscowienie uszkodzeń zależą nie tylko od sekwencji nukleotydów w nici DNA, ale również od struktury chromatyny. Wyższy poziom organizacji chromatyny zwiększa dostępność DNA dla niektórych czynników mutagennych. Na przykład, promieniowanie jonizujące wytwarza więcej wiązań krzyżowych między białkiem i DNA w chromatynie czynnej w porównaniu z nieczynną.
113

Naprawa pośrednia zachodzi po zreplikowaniu uszkodzonego DNA. U bakterii E.coli znany jest kompleks enzymatyczny, który rozpoznaje zmiany konformacyjne nowo replikowanego DNA, będące efektem niekomplementarności zasad. Kompleks ten odróżnia nowo zsyntetyzowaną nić DNA od nici matrycowej i dokonuje wycięcia niewłaściwie wstawionych nukleotydów oraz uzupełnia powstałe braki komplementarnymi nukleotydami. Niestety analogiczny proces w komórkach zwierzęcych nie jest jeszcze dokładnie poznany. Mutacje genowe zachodzące w komórkach rozrodczych powodują trwałe zmiany przekazywane z pokolenia na pokolenie. Mutacje te mogą zachodzić w genach kodujących strukturę białka lub rzadziej w genach kodujących strukturę tRNA lub rRNA. Mutacje genowe zachodzące w komórkach somatycznych nie są dziedziczne. Mutacje te w zależności od okresu rozwoju zarodka mogą dotyczyć wszystkich komórek lub tylko pewnych części komórek dorosłego organizmu. W fenotypie osobnika z mutacją somatyczną można zaobserwować tzw. mozaikowość, polegającą na miejscowym występowaniu zmienionej cechy, np. czarny królik mający niebieskie plamki czy kura o jednej nodze żółtej, a drugiej białej. Znacznie większe znaczenie mają mutacje somatyczne, zachodzące już po urodzeniu, u osobników w różnym wieku. Są one zazwyczaj indukowane przez czynniki mutagenne. Jeżeli mutagen taki odpowiada za uruchomienie transformacji nowotworowej, to określany jest jako karcynogen. Mutacje takie, prowadząc do defektów lub zaburzeń ekspresji genów związanych z proliferacją komórek czy naprawą uszkodzeń DNA, powodują nie kontrolowany, inwazyjny wzrost tych komórek oraz zasiedlanie przez nie innych, nawet odległych narządów. Mutacje genowe spontaniczne charakteryzuje odwracalność i powtarzalność. Odwracalność procesu mutacji polega na tym, że allel, który powstał dzięki mutacji genu, może zmutować wstecznie do formy wyjściowej tego genu. Graficznie można to przedstawić następująco:

przy czym A i a są allelami, natomiast u i v oznaczają częstość mutacji w obu kierunkach. Potwierdzeniem odwracalności mutacji jest bezrożność i rogatość u owiec. Zarówno owce bezrogie w rasie dorset horn, jak również owce rogate w rasach bezrogich mogą być wynikiem mutacji w tym samym locus. Lepiej poznane są zmiany normalnego allelu w kierunku mutanta, ale mutacje odwrotne — zmutowanego allelu do normalnego również są obserwowane.
114

Mutacja wsteczna nie zawsze jest jednak wynikiem powrotu do pierwotnego zapisu genetycznego, może ona być następstwem tzw. mutacji supresorowej, zachodzącej w obrębie tego samego genu, w którym nastąpiła mutacja pierwotna, lub w zupełnie innym genie. Istotą powtarzalności mutacji genowej jest to, iż określona mutacja może wystąpić ponownie, dając zbliżone, a często nawet takie same skutki fenotypowe. Przykładem tego może być recesywna achondroplazja, występująca u kilku ras bydła. Podatność na mutacje nie jest jednakowa wśród wszystkich genów. Mając to na uwadze, można podzielić geny na mniej i bardziej labilne lub stabilne. Do genów labilnych można zaliczyć gen czynnika VIII krzepliwości krwi. Wśród chorych na hemofilię aż 1/3 przypadków tej choroby jest wynikiem mutacji de novo. Z kolei genem bardzo stabilnym jest gen choroby (pląsawicy) Huntingtona, ciężkiego neurodegeneracyjnego zaburzenia dziedzicznego, pojawiającego się z częstością l: 10000 osób w większości populacji pochodzenia europejskiego. Choroba ta ujawnia się najczęściej w wieku powyżej 40. roku życia i prowadzi do śmierci. Została ona opisana w 1872 roku przez Johna Huntingtona, stąd jej nazwa, znana była jednak od XVII wieku. Pojawiła się w Europie i przez emigrantów została przeniesiona na inne kontynenty. Dotychczas nie wiadomo, czy były jakieś inne ogniska początku tej choroby. Wynika z tego, że diagnozowane przypadki choroby Huntingtona są efektem dziedziczenia mutacji w genie huntingtyny, a nie jej pojawiania się de novo. Częstość, z jaką występują mutacje w różnych loci, jest niejednakowa. W przypadku niektórych genów wykazano, iż większość spontanicznych mutacji zachodzi w kilku miejscach charakterystycznych dla danego genu, nazwanych gorącymi miejscami (ang. hot spots). Badania genu hemofilii A u ludzi potwierdziły, iż takimi gorącymi miejscami są sekwencje dinukleotydowe CG, zwane wyspami CpG. Więszość mutacji zarejestrowanych w obrębie genu hemofilii A polegało na zamianie dinukleotydowej sekwencji CG na TG, rzadziej CG na CA. Również w obrębie genu DMD, zlokalizowanego w chromosomie X u ludzi, warunkującego chorobę zwaną dystrofią mięśniową Duchenne'a, stwierdzono istnienie dwóch regionów (gorące miejsca), w których najczęściej występują mutacje. Pierwszy region znajduje się w odległości 0,5 miliona par zasad od promotora, w regionie DXS164/DXS206, drugi natomiast w części centralnej genu, tj. 1,2 miliona par zasad od promotora. Na częstość mutacji genowych spontanicznych mogą mieć wpływ również czynniki dziedziczne. U muszki owocowej (Drosophila melanogaster) wykryto gen MuF, zlokalizowany w chromosomie 2 pary, warunkujący większą podatność innych genów na mutacje. Większość mutacji jest dla organizmu szkodliwa, a nawet letalna. Czasem jednak mutacja zmienia właściwości organizmu tak, że zyskuje on cechy korzystne. Zdarzają się również mutacje zupełnie lub niemal zupełnie 115

obojętne dla organizmu. W wyniku takich mutacji powstały, na przykład, serie alleli wielokrotnych, które są omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech. Rodzaje mutacji genowych i ich skutki można analizować na poziomie DNA lub na poziomie polipeptydu. Rozpatrując mutację na poziomie DNA można wyróżnić następujące zmiany w sekwencji nukleotydów w danym genie (ryć. 5-9): 1) tranzycja — zamiana jednej zasady purynowej na drugą purynową lub pirymidynowej na inną pirymidynową (w podwójnej helisie będą zamiany par zasad A/T ←→G/C), 2) transwersja -- zamiana zasady purynowej na pirymidynową i od wrotnie pirymidynowej na purynową; w podwójnej helisie będą to zamiany:

3) delecja — wypadnięcie (utrata) jednej lub kilku par nukleotydów, 4) insercja — wstawienie jednej lub kilku par nukleotydów. Przyczyną samorzutnej zamiany jednej pary nukleotydów na inną, według hipotezy Watsona i Cricka, mogą być tautomeryczne przekształcenia zasad azotowych, zachodzące pod wpływem działania czynników zewnętrznych. Przekształcenia te polegają na zmianie położenia przestrzennego poszczególnych atomów oraz zmianie rozkładu elektronów

Ryć. 5-9. Mutacje genowe — zmiany sekwencji nukleotydów

116

Z kolei. iż z pokolenia na pokolenie zwiększa się (znacznie rzadziej zmniejsza) liczba powtórzeń tych sekwencji. Błąd włączania polega na tym. a w konsekwencji zmianę konfiguracji połączeń wodorowych występujących między zasadami purynowymi i pirymidynowymi. Adenina w formie ketonowej łączy się z tyminą dwoma mostkami wodorowymi. nazwanej dojrzewaniem. U ludzi zdrowych liczba powtórzeń wynosi 10-36. guanina w normalnej formie (ketonowej) łączy się z cytozyną. odzyskując zdolność łączenia się z zasadami komplementarnymi dla tych form. Inną 117 . zaś ketonowej na enolową (=C—OH). W dwuniciowej helisie DNA zasady komplementarne tworzą wiązania między grupami aminowymi (—NH2) i ketonowymi (—CO). zlokalizowanego w chromosomie 4. gdy na przykład w DNA podczas replikacji tyminą ulega przekształceniu z formy ketonowej w enołowa i zamiast z adeniną łączy się z guanina. Tautomeryczne formy enolowe są nietrwałe i po pewnym czasie wracają samorzutnie do formy ketonowej. obróbce mRNA. czyli tzw. Na przykład choroba Huntingtona jest wynikiem zwielokrotnienia liczby powtórzeń sekwencji CAG w eksonie l genu kodującego białko huntingtynę. zespół kruchego chromosomu X. Tautomeryczna forma tyminy powraca do formy ketonowej i w następnej replikacji łączy się z adeniną. z których 10 powoduje choroby genetyczne. Z zaburzeniami tymi wiąże się zjawisko zwane antycypacją. że enołowa forma tyminy łączy się z guanina. Im większy stopień zwielokrotnienia danej sekwencji. Dotychczas wykryto je u ludzi w 12 loci. dystrofię miotoniczną. W przypadku choroby Huntingtona (HD) i dystrofii miotonicznej młodociana postać choroby jest związana z dziedziczeniem ojcowskim (antycypacja odojcowska). Z kolei.i protonów w cząsteczce zasady. prowadząca do powstania alleli: F (delecja 3 eksonów) i D (delecja l eksonu). Mutacje genowe mogą być także następstwem zakłóceń w splicingu. Skutkiem przemian tautomerycznych może być błąd włączania bądź błąd replikacji. w wyniku którego powstaje mRNA zawierający tylko sekwencje kodujące (eksony). Przekształcenie tautomeryczne powoduje zamianę grupy aminowej na iminową (=NH). Przykładem takiej mutacji jest delecja w genie as1kazeiny mleka. Splicing polega na wycinaniu intronów z pierwotnego transkryptu (pre-mRNA). Błąd replikacji zachodzi wówczas. Od niedawna znany jest bardzo specyficzny rodzaj mutacji genowych — mutacje dynamiczne. między innymi chorobę Huntingtona. a w formie tautomerycznej z tyminą. Mutacje te związane są z tzw. należącymi do powtarzających się sekwencji mikrosatelitarnych i polegają na tym. Skutkiem tego będzie pojawienie się pary G-C w miejscu. przekroczenie liczby 36 powtórzeń powoduje wystąpienie choroby. gdzie przed błędem replikacji była para Oba rodzaje błędów występują także po przekształceniach tautomerycznych innych zasad. natomiast w formie enolowej łączy się trzema mostkami z cytozyną. niestabilnymi sekwencjami DNA. w następnej replikacji do guaniny przyłączy się komplementarna do niej cytozyną. tym wcześniej rejestrowany jest początek objawów chorobowych.

dlatego nazywane są cichymi podstawieniami (ang. Dzięki temu RFLP określonych loci może być wykorzystywany jako marker genetyczny. Na przykład tranzycja U→C powoduje zmiany aminokwasu w łańcuchu polipeptydowym.4. Analizując skutki mutacji genowych na poziomie polipeptydu można wyróżnić następujące typy mutacji: 118 . Zjawisko to jest charakterystyczne także dla innych zaburzeń wywołanych mutacjami dynamicznymi. Jedynie metionina (AUG) i tryptofan (UGG) są kodowane przez pojedyncze kodony. różnica w długości sekwencji może dochodzić do 50%. polegających na pojedynczej zmianie sekwencji nukleotydów w określonym genie. Przypuszcza się. 5. trypletów). różnica w liczbie powtórzeń u potomka w stosunku do liczby powtórzeń u matki może wynieść do 4. Jeśli allel zmutowany pochodzi od matki. jak i intronu. jest polimorfizm fragmentów restrykcyjnych — RFLP (ang.cechą charakterystyczną mutacji dynamicznej w genie HD jest tzw. Również mutacja w obrębie eksonu może nie powodować zmiany produktu genowego. Skutki mutacji genowych Mutacje genowe nie zawsze powodują zmiany w składzie aminokwasowym polipeptydu. białka mleka) czy odpowiedzialnych za powstanie choroby genetycznej. Mutacje w obrębie intronu nie wpływają zazwyczaj na funkcję genu. Technika RFLP opisana w rozdziale: Metody analizy i modyfikacji genomu znajduje również zastosowanie w ustalaniu genotypów pod względem zmutowanych alleli genów głównych (QTL) kontrolujących cechy jakościowe (np. gdyż spośród 20 aminokwasów aż 18 jest kodowanych przez 2 do 6 trójek nukleotydowych (kodonów. Należy podkreślić.2. Przeważająca część mutacji genowych nie powoduje żadnych zmian w produkcie genowym. mającym szczególne znaczenie dla molekularnej analizy DNA. gdyż kodon AAC również koduje asparaginę. Taka sytuacja jest możliwa. Jednym ze skutków mutacji genowych. Natomiast jeśli ojciec przekazuje zmutowany allel. Polimorfizm ten jest wynikiem mutacji punktowych zarówno w obrębie eksonu. piętno gametyczne. Są one wykorzystywane w analizie polimorfizmu DNA. iż jest to spowodowane niestabilnością tej sekwencji w spermatogenezie. restriction fragment length polymorphism). Natomiast jej skutkiem może być powstanie miejsca rozpoznawanego przez enzym restrykcyjny lub utrata miejsca restrykcyjnego dla danego enzymu. ani kodowanego przez ten gen białka. identyfikacji markerów genetycznych przydatnych w programach mapowania genomów. substitution at silent site). iż mutacje genowe powodujące zauważalny efekt fenotypowy stanowią jedynie małą część mutacji zachodzących w DNA.

Jak już wcześniej wspomniano. przejawiająca się zmniejszeniem odporności cieląt. Mutacje typu nonsens (mutacja stop) .1. w wyniku której w pozycji 64 łańcucha polipeptydowego typu A zamiast glicyny jest kwas asparaginowy.na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu (kodon sensowny) zostaje zamieniony na jeden z trzech kodonów nonsensownych (terminacyjnych) - Ryć. Mutacje typu zmiany sensu i zmiany fazy odczytu w locus E u bydła 119 . roku życia osobników homozygotycznych pod względem zmutowanego genu. 2. 5-10. oraz T→C (zapis dla DNA. Przykładem allelu powstałego w drodze tego rodzaju mutacji jest allel Ed w locus E (Extension) u bydła. odnoszącym się do polimorficznych białek.. Na przykład. Wynikiem mutacji typu zmiany sensu są niektóre geny warunkujące umaszczenie czy polimorficzne białka. Szerzej mutacja ta i inne tego typu zostaną omówione w części dotyczącej molekularnej diagnostyki chorób. Mutacje typu zmiany sensu .na skutek tranzycji lub transwersji kodon dla jakiegoś aminokwasu zostaje zamieniony na kodon dla innego aminokwasu. której następstwem jest śmierć przed ukończeniem 1. mleka. Allel dominujący E d jest wynikiem tranzycji tyminy w cytozynę w kodonie 99 allelu dzikiego E+. Konsekwencją takiej mutacji w 383 nukleotydzie genu kodującego podjednostkę CD18 p2-integryny jest choroba BLAD (ang. Mutacja ta jest przedstawiona na rycinie 5-10. Różnica między allelem A i B β-laktoglobuliny polega na zamianie A-»G. skutki tego mogą być dla organizmu letalne. która w łańcuchu peptydowym powoduje zamianę aminokwasu leucyny na prolinę. jest locus β-laktoglobuliny (białko mleka). bovine leukocyte adhesion deficiency). mutacje genowe nie zawsze mają niekorzystny skutek. Innym przykładem mutacji typu zmiany sensu. w mRNA: U→ęcej informacji o genetycznym uwarunkowaniu i znaczeniu polimorficznych białek surowicy krwi. nasienia i jaj zawiera rozdział: Markery genetyczne. warunkujący czarne umaszczenie. jeśli kodon GAU dla kwasu asparaginowego w wyniku tranzycji A→G zostanie zmieniony na kodon GGU kodujący glicynę.

Przykładem następstwa mutacji typu nonsens jest recesywna wada metaboliczna . powstaje nieaktywny peptyd złożony z 85 aminokwasów. które nie kodują aminokwasów.amber (UAG). Wynikiem tej mutacji jest zmiana długości polipeptydu kodowanego przez dany gen. powstał w drodze mutacji typu zmiany fazy odczytu spowodowanej delecją jednej zasady. Schemat tej mutacji przedstawiono na rycinie 5-10. przy czym dotychczas stwierdzono 20 mutacji w genie kodującym syntetazę argininobursztynianową. iż recesywny allel nie ma miejsca restrykcyjnego dla enzymu Mspl. Tranzycja cytozyny na tyminę w 86 kodonie genu syntetazy argininobursztynianowej (enzym biorący udział w cyklu mocznikowym) powoduje zamianę kodonu CGA dla argininy na kodon TGA kończący translację. a powstający polipeptyd ma od miejsca mutacji do końca C nieprawidłowo włączone aminokwasy. następnie roz120 . Cytrulinemia występuje również u ludzi. a w konsekwencji zmniejszenia płodności krów. Jest ono przyczyną zamierania zarodków. Podobnie jak mutacje typu zmiany sensu. ochrę (UAA) lub opal (UGA). Mutacje zmiany fazy odczytu — na skutek delecji lub insercji jednej lub kilku par nukleotydów (liczba par nie może być podzielna przez 3) następuje przesunięcie fazy odczytu.cytrulinemia. Opracowano test molekularny identyfikacji nosicielstwa genu czerwonego umaszczenia. w którym delecją guaniny (oznaczona na schemacie symbolem ∇) powoduje przesunięcie fazy odczytu. występuje u bydła. Cielęta homozygotyczne pod względem tego zmutowanego genu padają w pierwszym tygodniu życia na skutek zaburzeń w wydalaniu mocznika z organizmu. 3. powstaje krótszy N-końcowy fragment tego polipeptydu. lecz stanowią sygnał zakończenia translacji. Jest to schorzenie nazwane DUMPS (ang. wykorzystujący to. Począwszy od kodonu 104 (GGT) dla glicyny. We wspomnianym już locus E u bydła allel recesywny e. kodujący u zwierząt homozygotycznych ee umaszczenie czerwone. Zamplifikowany za pomocą PCR fragment genu jest trawiony enzymem. czego następstwem jest zamiana kodonu CGA (dla argininy) na kodon TGA kończący translację białka. deficiency uridine monophosphate synthase). również i ten rodzaj mutacji może mieć skutki obojętne dla organizmu. występująca u bydła rasy holsztyńsko-fryzyjskiej. Mutacje te wynikają z cechy bezprzecinkowości kodu genetycznego. Podobna mutacja polegająca na zamianie cytozyny na tyminę w 405 kodonie genu syntazy urydynomonofosforanowej. Bydło holsztyńskie ma umaszczenie z reguły czarno-białe. zamiast aktywnego enzymu składającego się z 412 aminokwasów. ale są także zwierzęta czerwono-białe pojawiające się w wyniku kojarzenia czarno-białych nosicieli recesywnego allelu czerwonego umaszczenia. Następstwem tego jest skrócenie łańcucha polipeptydowego (utrata większości C-końcowych 76 aminokwasów) i utrata przez enzym funkcji katalitycznych. natomiast allel dominujący ma takie miejsce. w procesie translacji przyłączane są inne aminokwasy. W jej konsekwencji.

płuc i oskrzeli. oznaczona symbolem ΔF508 (ryć. U chorych na mukowiscydozę przewody wyprowadzające z narządów wewnętrznych zostają zaczopowane przez bardzo gęstą wydzielinę. a nawet śmiertelnych chorób genetycznych. Przykładem mutacji typu delecja aminokwasu jest mukowiscydoza u ludzi. dwóch prążków (201 pz i 331 pz) w przypadku allelu dominującego. a na ich miejsce pojawi się inny aminokwas (jeśli „wypadną" zasady z dwóch kolejnych kodonów). Uzyskany ełektroforegram (obraz prążków) wkazuje obecność jednego prążka długości 531 pz w przypadku allelu recesywnego. przy czym najczęściej jest stwierdzana mutacja w eksonie 10. 4. wynosi l: 2500 osób. Mutacje te mogą prowadzić do poważnych zaburzeń. cystic fibrosis transmembrane conductance regulator). możliwe jest także pojawienie się kodonu „stop". polegająca na zakłóceniu transportu jonów chlorkowych. zamianę fazy odczytu.dzielany elektrofor etycznie. zwanego CFTR (ang. Insercja trójki może spowodować: dodanie aminokwasu – w białku. Dotyczy to przede wszystkim trzustki. W obrębie tego genu wykryto wiele mutacji. prowadzącej do przedwczesnej śmierci. Mutacja ta prowadzi 121 . jeśli trójka nukleotydów zostanie wstawiona między kodony. W przypadku delecji trójki nukleotydów może nastąpić: utrata dwóch aminokwasów w łańcuchu peptydowym. Mutacje typu delecja lub insercja aminokwasu — delecja lub insercja trzech par nukleotydów stanowiących kodon dla aminokwasu (lub wielokrotności liczby 3) w łańcuchu DNA powoduje najczęściej utratę lub dodanie jednego bądź kilku aminokwasów w białku kodowanym przez dany gen. utrata jednego aminokwasu (delecja kodonu) lub powstanie kodonu „stop". 5-11). Częstość występowania tej wady. Prawidłowy gen warunkuje syntezę białka będącego regulatorem przewodnictwa błonowego. pełniącego funkcję kanału chlorkowego. jeśli trójka „rozerwie" istniejący dotychczas kodon.

Gen C warunkuje wytwarzanie enzymu tyrozynazy. Przykładem mutacji typu insercja aminokwasu jest wspomniana już wcześniej choroba Huntingtona u ludzi. skrócenie kręgosłupa u bydła i psów. Jednym z najlepiej poznanych bloków metabolicznych u ludzi są nieprawidłowości w przemianie aminokwasów fenyloalaniny i tyrozyny (ryć. przekształcającego fenyloalaninę w tyrozynę. powoduje uszkodzenie układu nerwowego oraz niedorozwój umysłowy i fizyczny.3 eksony kodujące 37 aminokwasów. a także umaszczenie zwierząt i inne. na przykład białko determinowane przez locus Albino (C). najczęściej enzymu koniecznego do prawidłowego przebiegu jakiegoś procesu. Również niektóre allele genu determinującego warianty białka mleka αs1-kazeiny u kóz powstały w wyniku zaburzeń w procesie obróbki pre-mRNA. powoduje powstanie domeny glutaminowej. W przypadku allelu D podczas wycinania intronów został dodatkowo wycięty ekson kodujący 11 aminokwasów. Mutacje jednego z genów warunkujących określony enzym tego bloku powodują następujące schorzenia: A. na przykład wielopalczastość. Zwielokrotnienie powtarzającej się sekwencji CAG. Fenotypowy efekt mutacji genowych może być zauważalny wkrótce po urodzeniu osobnika. splicing) pre-mRNA --w wyniku zaburzeń w procesie wycinania intronów powstaje nieprawidłowy mRNA. zwanej składaniem (ang.do utraty jednego aminokwasu — fenyloalaniny w 508 pozycji kodowanego przez ten gen łańcucha polipeptydowego. W wyniku większości mutacji genowych następuje utrata lub modyfikacja zdolności organizmu do wytworzenia specyficznego białka. Częstość tych mutacji wynosi 10-40%. w którym produkt jednej przemiany enzymatycznej stanowi substrat dla następnej przemiany. 5. i glicyna — 509 póz. jaka jest zakodowana w sekwencji (CAG)n. W następstwie nieprawidłowej obróbki potranskrypcyjnej mRNA powstają allele zmutowane. ale może być również rozpoznawalny w okresie późniejszym. Białko takie może mieć inne właściwości katalityczne niż białko prawidłowe. 5-13). łańcucha) odczytywany jest kodon ATT (inny tryplet dla izoleucyny). na przykład w pierwszym tygodniu życia (cytrulinemia) lub pierwszym roku życia (BLAD). Fenyloketonuria — brak lub niedobór enzymu hydroksylazy fenyloalaninowej. kodującej aminokwas glutaminę. o czym pisano już wcześniej. 5-12 wkładka kolorowa). Często są to zaburzenia przebiegu szlaku metabolicznego (tzw. czego konsekwencją jest synteza zmienionego białka. natomiast w allelu F . Podczas procesu translacji zamiast kodonu ATC dla izoleucyny (w 507 pozycji łańcucha polipeptydowego) i następujących po nim kodonów TTT i GGT (fenyloalanina — 508 póz. a następnie sekwencja GGT dla glicyny. Mutacje zachodzące podczas obróbki potranskrypcyjnej. złożonej z takiej liczby glutamin. oklapnięte uszy u kotów szkockich zwisłouchych czy skrócenie ogona u kotów bobtail (ryć. 122 . blok metaboliczny).

Bloki metaboliczne mogą dotyczyć również enzymów związanych z przemianami innych związków. kwas homogen tyzynowy jest odkładany w stawach.brak oksydazy kwasu homogentyzynowego. np. prze kształcającego ten kwas w kwas maleiloacetooctowy. biorącego udział w przemianie tego kwasu w kwas homogentyzynowy. Alkaptonuria -. przekształ cającego 3.4. a przeświecające przez nią naczynia krwionośne nadają jej różowe zabarwienie. białe włosy. jest gen hormonu wzrostu — somatotropiny (ang. cukrów czy lipidów.. C. E. powodując jego ciemnienie na powietrzu.4-dihydroksyfenyloalaninę (DOPA) w barwnik skóry — melaninę.B. którego polimorficzne formy wykazują związek z różnymi cechami użytkowymi zwierząt gospodarskich. Kretynizm tarczycowy — brak enzymu katalizującego przemianę tyrozyny w hormon tarczycy (tyroksynę i trijodotyroninę). nie powodujący wyraźnie złych skutków dla organizmu.niedobór enzymu hydroksylazy kwasu p-hydroksyfenylopirogronowego. Jednym z genów. Albinizm. 5. growth hormone — GH). 123 . chrząstkach i skórze wywołując stany zapalne. Albinizm występuje także u zwierząt. czyli bielactwo . D.3. powodujący różny stopień nasilenia niedorozwoju umysłowego. Mutacje genowe wpływające na cechy produkcyjne zwierząt Mutacje genowe mogą mieć znaczący wpływ na efektywność hodowli zwierząt. tęczówka oka nie jest zabarwiona. brwi i rzęsy. a jego nadmiar jest wydalany z moczem.brak enzymu tyrozynazy. osobniki albinotyczne mają bardzo jasną skórę. Tyrozynoza -.

U trzody chlewnej stwierdzono związek między polimorfizmem genu receptora estrogenu (ang. Opłacalność hodowli zwierząt w dużej mierze zależy od cech reprodukcyjnych.4. U bydła cecha ta warunkowana jest zmutowanym allelem genu miostatyny (locus w chromosomie 2). Szerzej mutacje te są opisane w rozdziale: Zmienność cech (podrozdział: Geny o dużym efekcie).4. Podobny efekt fenotypowy ma gen FecX' sprzężony z płcią. Poszczególne allele tego genu warunkują wzrost liczebności miotu o 1.15 prosięcia u świń bardzo plennej rasy meishan i 0. a szczególnie wrodzonych wad rozwojowych. Stąd poznanie podłoża wielu chorób genetycznych. psychicznych itp. metabolicznych. odpornościowych. endokrynologicznych. estrogen receptor gene — ESR) a wielkością miotu. które mogą się przejawiać zaburzeniami rozwojowymi o charakterze morfologicznym lub upośledzeniem różnych funkcji organizmu. Wykryte dotychczas mutacje u świń wpływające na jakość mięsa dotyczą: receptora rianodyny (RYR1) — mutacja powodująca gorączkę złośliwą oraz locus PRKAG3 — mutacja powodująca tzw. Spośród wykrytych dotychczas mutacji. kwaśne mięso (RN). O podłożu molekularnym niektórych chorób metabolicznych wspomniano już w podrozdziale: Skutki mutacji genowych.42 prosięcia u wielkiej białej. największe znaczenie ma mutacja w genie BMPR-IB wykryta u owiec rasy merynos booroola. Geny letalne.4. gen Thoka u owiec islandzkich i gen Belle-Ile u owiec utrzymywanych w północnej Francji. że rozwój niektórych chorób genetycznych zależy również od wpływu czynników środowiskowych. semiletalne i subwitalne Wpływ szkodliwego działania zmutowanych genów jest różny.1.6 jagnięcia. Pojedyncza kopia każdego z tych genów powoduje wzrost liczebności miotu o około 0. U owiec natomiast hipertrofia mięśniowa (CLPG) jest determinowana mutacją locus kodującego ncRNA. Inne mutacje to: gen FecJ u owiec jawajskich. wykryty u owiec rasy romney. 5. W pojedynczej kopii allel zmutowany zwiększa liczebność miotu o l jagnię. np. Mutacje genowe wywołujące choroby genetyczne Mutacje genowe często prowadzą do powstania chorób genetycznych.Inne mutacje genowe nie mają tak wszechstronnych skutków jak mutacje w genie hormonu wzrostu. sprawia dużo trudności.4. U bydła i owiec wykryto mutacje powodujące hipertrofię mięśniową. Zależnie od stopnia penetracji tych genów można je podzielić na: 124 . wpływających na liczbę jagniąt rodzonych przez owcę w jednym miocie. Należy jednak pamiętać. 5.

Również okres w życiu osobnika. w którego genotypie wystąpią. 5-14 wkładka kolorowa). Gen siwej barwy karakułów powoduje śmierć osobników homozygotycznych w wieku 4-9 miesięcy wskutek zaburzeń w funkcjonowaniu przywspółczulnego układu nerwowego. które osłabiają wydolność fizjologiczną i mogą powodować śmierć od 10 do 50% osobników. białopyskie. Gen platynowej barwy u lisów (W p ) jest wynikiem mutacji genu w. warunkujący umaszczenie tzw. uzyskamy wówczas lisy zdolne do życia. który jest letalny w podwójnej dawce. U kur gen achondroplazji (Cp) w układzie hetero- 125 . w układzie heterozygotycznym zaznacza swą obecność skróceniem odnóży (krótkonogie bydło nazwane dexter). powodujących poważne zakłócenia procesu trawienia. Z punktu widzenia ekonomicznego korzystniejsze są kojarzenia heterozygotycznego osobnika platynowego z homozygota pod względem genu srebrzystego ubarwienia. również heterozygoty WpW nie są zdolne do życia i giną przed urodzeniem. WW) działają letalnie. w którym dany gen przejawia działanie letalne. Geny letalne warunkują nieprawidłowości rozwojowe i zakłócenia w procesach fizjologicznych. ale także i heterozygotycznych osobników same się eliminują i mutacja taka nie utrwala się w populacji. gen siwej barwy (sziras) wełny u owiec rasy karakuł czy gen achondroplazji u bydła i kur. Geny letalne o niezupełnej dominacji sygnalizują swoją obecność w pojedynczej dawce. Jedne geny letalne powodują śmierć zygoty we wczesnym stadium życia embrionalnego. Niektóre z nich. homozygota recesywna). ale dają zauważalny efekt fenotypowy. powodujące w aktywnej dawce śmierć od 50 do 90% osobników. Innym genem. nie ograniczając na ogół przeżywalności czy sprawności życiowej. będącym również wynikiem mutacji genu ω. Gen achondroplazji stwierdzony po raz pierwszy u bydła irlandzkiej rasy kerry. może być różny. inne zaś później. w których genotypach wystąpią w dawce aktywnej (np. • geny subwitalne. z nie wyjaśnionych dotąd przyczyn. natomiast u osobników heterozygotycznych nie są letalne. Kojarzenie między sobą lisów platynowych bądź białopyskich powoduje zmniejszenie plenności wskutek zamierania zarodków homozygotycznych. powodując śmierć nie tylko homo-. Geny letalne dominujące ujawniają swoje działanie niekorzystne już w układzie heterozygotycznym. w stosunku l platynowy: l srebrzysty (ryć. warunkującego srebrzystą barwę włosa. Przykładem jest gen platynowego ubarwienia u lisów. jest gen W. • geny semiletalne. Geny te działają letalnie w układzie homozygotycznym. w okresie pourodzeniowym lub u dorosłych osobników. powodujące śmierć ponad 90% osobników. Oba zmutowane geny w układzie homozygotycznym (WpWp.• geny letalne. powodują śmierć osobnika.

Przykurcz mięśni kończyn i szyi (cecha recesywna) płodów owiec. Zarodki o genotypie CpCp zamierają w okresie od 3 do 4 dnia inkubacji.zygotycznym (Cpcp) warunkuje krótkonożność. U samców gen ten jest letalny. nieszkodliwe zaś dla osobników znajdujących się w dobrych warunkach. Przykładem genu letalnego o niezupełnej dominacji sprzężonego z płcią jest gen oznaczony symbolem A31. jak achondroplazja recesywna. Z kojarzenia krowy homozygotycznej pod względem tego genu z buhajem normalnym w potomstwie uzyskuje się W przypadku gdy matka jest heterozygotą. U krów heterozygotycznych nieowłosione pasma są ledwie dostrzegalne. iż zwierzęta obarczone nimi mogą żyć tylko w szczególnych warunkach środowiskowych i pod troskliwą opieką hodowców. w potomstwie występuje stosunek samców do samic l: 2. warunkujący pasmowy brak owłosienia u bydła rasy holsztyńsko-fryzyjskiej. jak też od interakcji ze środowiskiem. Niektóre geny letalne mogą także powodować śmierć matki. 126 . Te same geny mogą być letalne dla swych nosicieli przebywających w złych warunkach środowiskowych. Nosiciele tych genów (heterozygoty) fenotypowo niczym się nie różnią od osobników normalnych. Cecha ta występuje tylko u samic. Zakres działania tych genów jest różny. Stopień fenotypowego przejawienia się genu letalnego zależy zarówno od współdziałania danego genu z innymi genami. bydła i świń powoduje częste padanie matek na skutek utrudnionych porodów. Zmienność tej cechy u krów jest duża. od niewielkich zmian (np. natomiast u homozygotycznych — bardzo wyraźne. Kojarzenie to przedstawia schemat: Większość genów letalnych ma charakter recesywny autosomalny. Ponadto niektóre z tych genów mogą być letalne w stosunku do jednych zwierząt. co obrazuje schemat: jedynie samice. natomiast u innych mogą tylko zmniejszać sprawność fizjologiczną. miejscowy brak nabłonka u bydła ayrshire) do rozległych zaburzeń. Wrodzona katarakta u bydła lub brak gałek ocznych oraz wiele innych podobnych nieprawidłowości powodują. gdyż ich działanie zależy między innymi od czynników środowiskowych. Geny semiletalne często jest trudno odróżnić od genów letalnych. Krowy takie są wrażliwe na zimno i źle znoszą czyszczenie.

obarczone nimi zwierzęta nazywane są potworkami. 3) braki (defekty czy usterki) — są to drobne zmiany nie mające większego znaczenia dla życia zwierzęcia. przypominające mutanty. Teratologia. chromosomowych lub genomowych. Na przykład buhaje dotknięte spastycznym niedowładem kończyn (wada ta ma dwie postacie — występuje do 8 tygodnia życia lub dopiero w wieku 2-3 lat) niechętnie kryją i są eliminowane z rozpłodu.2. Przykład takiego bloku podano już wcześniej. inne ujawniają się w późniejszym okresie życia (np. Ponieważ większość wad dziedzicznych jest uwarunkowana genami letalnymi. wady te nie dziedziczą się. Nie każda wada wrodzona jest zatem uwarunkowana genetycznie. Niektóre z wad są zauważalne już w chwili przyjścia na świat osobnika. Przyczyny powstawania wad wrodzonych mogą być dwojakiego rodzaju: 1) genetyczne — będące wynikiem mutacji genowych. następny podrozdział dotyczy wad wrodzonych. Wady takie. Wiele wad determinowanych genami subwitalnymi dotyczy układu rozrodczego. W przypadku prowadzenia kontroli wrodzonych wad dziedzicznych i ograniczania ich występowania istotnym problemem jest odróżnienie fenokopii od wady mającej podłoże genetyczne. a jednocześnie zmniejszają odporność zwierząt na choroby i niekorzystne czynniki środowiskowe. bloki metaboliczne.4.Geny subwitalne powodują odchylenia od normy w budowie anatomicznej i procesach fizjologicznych. 5. sposobów dziedziczenia i ograniczania występowania tych wad w hodowli zwierząt gospodarskich. Niektóre z tych genów są przyczyną zaburzeń metabolicznych. a powstałe pod wpływem czynników środowiskowych. powstające w okresie płodowym. epilepsja u bydła). nauka zajmująca się zaburzeniami rozwojowymi. noszą nazwę fenokopii. 2) wady — są to pewne zaburzenia w prawidłowej budowie.4. Większość wad wrodzonych dziedzicznych ma określony obraz fenotypowy. mimo że są pochodzenia pozagenetycznego. Choroby monogenowe wywołujące wrodzone wady rozwojowe Wrodzonymi wadami rozwojowymi nazywamy wszelkie nieprawidłowości budowy ciała. ich rodzajów. do złudzenia przypominają nieprawidłowości uwarunkowane założeniami genetycznymi. Można to uczynić biorąc pod uwagę: 127 . 2) środowiskowe — powstałe na skutek działania niekorzystnych czyn ników środowiskowych na rozwijający się płód. powodując niepłodność czy utrudniając akt kopulacji. Zdarza się jednak. powodując tzw. W niektórych przypadkach na powstanie takiej nieprawidłowości mają wpływ równocześnie czynniki środowiskowe i genetyczne. że niektóre anomalie. wyodrębnia trzy grupy tych zaburzeń: 1) potworności — są to bardzo rozległe zmiany w wyglądzie ciała.

Gen ten jest letalny u większości homozygot między 3 a 4 dniem inkubacji. wpływa pośrednio na zwięzłość budowy. Jest to prosta cecha recesywna. Do anomalii towarzyszących tego rodzaju zaburzeniom rozwojowym należą: skrócenie części twarzowej głowy. polegającą na insercji 4 nukleotydów w genie. przepuklina mózgowa i pępkowa oraz rozszczepienie podniebienia. Nosicielstwo allelu achondroplazji. dała początek nowej rasie bydła — dexter). U bydła wada ta występuje u ras mięsnych (np. oznaczonego symbolem bd (ang. kodowany przez ten gen. creeper — pełzacz). czyli zahamowanie rozwoju układu kostnego. Achondroplazja może być także uwarunkowana genem recesywnym i w takim przypadku objawia się głównie zaburzeniami w rozwoju kości głowy lub deformacją szkieletu i kończyn. 3) ujawnienie się tej samej wady u potomstwa jednego rozpłodnika. Poszczególne wady wrodzone często występują w połączeniu z innymi nieprawidłowościami. 5-15 wkładka kolorowa). Gen karłowatości u osobnika heterozygotycznego. skutkiem czego krótszy jest o 1/3 łańcuch polipetydowy. stwierdzono u francuskiego buhaja rasy holsztyńsko-fryzyjskiej. ulegają poronieniu zwykle przed ósmym miesiącem (ryć. cechująca się skróceniem kończyn. jak i dalszych. powodując tylko nieznaczne skrócenie kończyn. bulldog disease). Badania genetyczne wykazały. U drobiu achondroplazja jest warunkowana genem niezupełnie dominującym Cp (ang. u którego występuje recesywna karłowatość chondrodysplastyczna (ang. Mutacja ta powoduje powstanie kodonu terminacyjnego. charakteryzującego się wybitną wartością hodowlaną. że płody dotknięte tą wadą. W 2002 roku w Australii wykryto odpowiedzialną za tę wadę mutację. skrócenie lub brak żuchwy. Osobniki heterozygotyczne charakteryzują się skróconymi odnóżami. OPIS NIEKTÓRYCH WRODZONYCH WAD ROZWOJOWYCH Wady układu kostnego Jednym z najwcześniej poznanych zaburzeń rozwojowych była achondroplazja. U japońskiego bydła mięsnego. homozygotyczne pod względem genu niezupełnie dominującego. japońscy badacze wykryli dwie mutacje (substytucja zasad i delecja) w genie zlokalizowanym w chromosomie 6 i oznaczonym symbolem LBN (LIMBLIN). 128 . chondrodysplastic dwarfism). którego lokalizacja nie została ujawniona (zapewne test molekularny zostanie opatentowany).1) zgodność wyglądu danej anomalii z opisem genetycznie uwarun kowanych wad wrodzonych w danej rasie. 2) wystąpienie wady u noworodka pochodzącego z kojarzeń krewniaczych zarówno bliskich. 4) pojawienie się podobnej anomalii u zwierząt spokrewnionych z ro dzicami noworodka. Do mutacji wpływających na cały kościec należy karłowatość. u herefordów). Nieprawidłowość ta występuje głównie u bydła (po raz pierwszy została opisana w Irlandii.

której następstwem jest zmiana aminokwasu waliny na kwas glutaminowy w pozycji 700 łańcucha polipeptydowego) w genie receptora czynnika wzrostu fibroblastów (ang. świń i owiec. Ze względu na zmieniony sposób siedzenia suki te nazwane są „pawianowatymi". a nawet niepłodność. żeber i mostka oraz części pyskowej (garbaty nos). świń. obserwowana głównie u bydła. Możliwe więc. Anomalią układu kostnego. Anomalia ta często występuje w połączeniu z zespołem wad typu achondroplastycznego. Jest ona wynikiem mutacji (transwersja adeniny na tyminę. a nawet płci wykazuje różny stopień letalności. a także u owiec. Szczenięta obarczone tą wadą cechuje mniejsza żywotność. a nawet ludzi jest tzw. spider syndrome). Ogólne zesztywnienie stawów notowane jest u bydła. amputacja kończyn (akroteriaza) (ryć. U osobnika dotkniętego tą wadą odnóża kończą się blisko stawu łokciowego. Natomiast samce prawdopodobnie nie osiągają dojrzałości. pojawiła się wada budowy kośćca określana mianem zespołu pajęczego (ang. a u tych. fibroblast growth factor receptor 3 -. rozdwojenie podniebienia i brak większości zębów. brakowi gałek ocznych 129 . bezpośrednio po urodzeniu można je rozpoznać po skróconym ogonie. jest autosomalna recesywna cecha skrócenie kręgosłupa. Prostą autosomalna cechą recesywna u bydła jest skrócenie żuchwy. stwierdza się osłabione zdolności rozrodcze. Genetycznym podłożem tej wady jest autosomalny gen recesywny. U owiec niektórych ras mięsnych (suffolk. które przeżyły. 5-16 wkładka kolorowa). Śmiertelność wśród jagniąt dotkniętych zespołem pajęczym jest bardzo wysoka.FGFR3). Może ona natomiast towarzyszyć: wodogłowiu. pęcinowego lub kolanowego. Anomalia ta uwarunkowana jest genem recesywnym.Zaburzeniem. która zależnie od gatunku. polega na niezrośnięciu się kości czaszki. Wada ta jest oddzielną jednostką w odróżnieniu od podobnej anomalii występującej w przypadku tzw. amputacji kończyn. U bydła mlecznego formą tej wady jest wrodzone zniekształcenie kręgów — CVM (ang. hampshire) w Stanach Zjednoczonych w latach 80. cieląt i prosiąt sztywność stawów przy urodzeniu jest połączona z dziedzicznym przykurczem mięśni. że jest to cecha letalna dla jednej płci. U jagniąt. Wadzie tej często towarzyszą: skrócenie żuchwy. Wada ta. Do najczęściej spotykanych anomalii w budowie głowy zalicza się przepuklinę mózgową uwarunkowaną recesywnym genem letalnym. W układzie homozygotycznym allel zmutowany powoduje kątową deformację kończyn. Do wrodzonych wad w budowie kończyn należą: zesztywnienie stawów i wielopalczastość. Jest ona letalna u bydła i indyków. central vertebral malformation). Natomiast osobniki heterozygotyczne charakteryzuje delikatna budowa kośćca z wyraźnym wydłużeniem kości długich. U psów skrócenie kręgosłupa nie jest letalne dla suk. rozmnażają się one prawidłowo. przepuklinie mózgowej. któremu towarzyszy twór różnych rozmiarów wypełniony przeważnie płynem. deformację grzbietu. które występuje u większości ras bydła.

lub zesztywnieniu stawów. a to z kolei może spowodować śmierć w pierwszych tygodniach życia. Opisana wada układu powłokowego (rybia łuska) występuje także u ludzi. Prawie połowa piskląt dotkniętych tym zaburzeniem zamiera w ciągu ostatnich 2-3 dni inkubacji. Schorzenie to przybiera najostrzejszą formę. jak wodogłowie. że wszystkie bezwłose psy (tzw. U drobiu wadą układu powłokowego jest nagość. Cielęta dotknięte tą wadą w warunkach naturalnych giną. natomiast najłagodniejszą. duck). które przeżyją i będą odchowywane w temperaturze wyższej niż zwykle. królików i kotów anomalia ta jest determinowana recesywnym genem autosomalnym. Normalna skóra i włosy pokrywają jedynie okolice nadgarstka i stepu. Nienormalność ta jest prostą cechą recesywna. Na podstawie szczegółowych badań można sądzić. że osobniki homozygotyczne rodzą się martwe. że wada ta ma charakter semiletalny i jest rezultatem działania autosomalnego recesywnego genu oznaczonego symbolem dek (ang. niedorozwój części twarzowej czaszki lub cyklopia (dwie gałki oczne w jednym oczodole). Wady układu powłokowego Wady układu powłokowego odnoszą się nie tylko do skóry. jak włosy i pióra. naked). Inną wadą dziedziczną układu powłokowego jest brak owłosienia. gdyż gen bezwłosowości w podwójnej dawce powoduje tak duże nieprawidłowości. Skóra nowo narodzonego cielęcia składa się jakby z rogowych płytek przypominających duże łuski. psy tureckie. u bydła rasy Jersey. u bydła ayrshire. która powstaje w wyniku wytwarzania nadmiernej ilości keratyny i w następstwie — nieprawidłowego rogowacenia nabłonka. Wyniki badań wskazują. oznaczonym symbolem n (ang. chińskie. uwarunkowana recesywnym genem sprzężonym z płcią. ale i takich jej wytworów. Ptaki. U bydła. perskie lub meksykańskie) są heterozygotami. 130 . Anomalia ta polega na skróceniu dolnej części dzioba. Zaburzeniem wykazującym dużą zmienność u różnych ras bydła jest cecha recesywna określana jako miejscowy brak nabłonka. w których rosną włosy. skrócenie szczęki. Miejsca nie pokryte nabłonkiem najczęściej występują na kończynach powyżej pęcin i na głowie za śluzawicą. Nieśność kur obarczonych tą wadą jest znacznie zmniejszona. Płytki te są porozdzielane rowkami. prowadzącą do śmierci płodów lub noworodków. U psów brak owłosienia uwarunkowany jest genem dominującym. U owiec obserwowana jest również cecha recesywna — brak żuchwy. W pewnym sensie odpowiednikiem skrócenia żuchwy u bydła jest typ dziobu „kaczor Donald" u kurcząt. w wieku 4-5 miesięcy pokryją się rzadkim upierzeniem. U bydła wada ta może występować samodzielnie lub w połączeniu z innymi nieprawidłowościami wrodzonymi. Jedną z najpoważniejszych letalnych wad dziedzicznych skóry jest rybia łuska u bydła. Jednakże i u cieląt rasy ayrshire miejsca chore mogą ulegać zakażeniu.

U indyków i kur notowane jest wrodzone zaburzenie równowagi. następnie upadkiem. Schorzenie to nazywane jest drżeniem i ujawnia się w wieku od 18 do 35 dni. Z punktu widzenia anatomicznego schorzenie to jest spowodowane nadmiarem płynu nagromadzonego w komorach mózgowia lub niekiedy w przestrzeniach między oponą pajęczą i miękką. Cielęta dotknięte tą wadą rodzą się zazwyczaj żywe. U drobiu występuje również recesywne. U świń gen warunkujący tę wadę wykazuje działanie plejotropowe. powodując jego rozjaśnienie. usztywnieniem nóg oraz drżeniem ciała. U większości cieląt homozygotycznych pod względem genu warunkującego epilepsję objawy pojawiają się w wieku od 3 do 6 miesięcy. rasy houdan i polskie czubatki). Anomalie układu nerwowego wyrażają się między innymi bezmózgowiem lub niedorozwojem móżdżku (hipoplazja móżdżku). u których jest prostą cechą recesywną. warun131 . Cechą dziedziczną u wielu gatunków zwierząt jest epilepsja. świń i drobiu jest wodogłowie wewnętrzne. pod którym czaszka jest silnie wysklepiona wskutek ciśnienia powiększonych półkul mózgowych. Obie nienormalności warunkowane są genem recesywnym. Prosięta z wodogłowiem wewnętrznym padają do drugiego dnia życia. sprzężone z płcią zaburzenie zwane paroksyzmem. Badania anatomiczne wykazują znaczne zmniejszenie móżdżku lub patologiczne zmiany w warstwie korowej. u koni natomiast okrężnicy. Kurczęta w wieku około 2 tygodni lub starsze reagują na hałas i raptowne oświetlenie biegiem. powodującą wczesne zejście śmiertelne lub prowadzącą do uboju z konieczności. wykazują powiększenie czaszki. U bydła nienormalność ta dotyczy jelita biodrowego. crest). ale nie mogą stać. determinowana u bydła genem dominującym. to prosta autosomalna cecha recesywną występująca zarówno u bydła. nie potrafią utrzymać się na nogach i giną w ciągu 2 dni. U drobiu wodogłowie uwarunkowane jest niezupełnie dominującym genem Cr (ang. jak i u koni. Podobna nieprawidłowość obserwowana u kur jest warunkowana recesywnym genem sprzężonym z płcią. Zwierzęta dotknięte tą wadą rodzą się żywe.Wady układu pokarmowego Najczęściej obserwowanymi wadami związanymi z układem pokarmowym są brak odbytu i niedrożność jelit. natomiast heterozygoty mają piękny czub. Wady układu nerwowego Wady dziedziczne układu nerwowego stanowią około 16% zaburzeń rozwojowych u bydła. podczas gdy u białych kaczek (crested white) osobniki homozygotyczne giną. Większość z tych kurcząt ginie przed 15 tygodniem życia. Brak odbytu jest recesywną cechą letalną. Atak taki trwa około 10 sekund. przy czym u kur gen ten nie jest letalny (np. natomiast u królików — recesywnym. Prostą autosomalna cechą występującą u bydła. Niedrożność jelit zaś. Niedorozwój móżdżku najlepiej został poznany u bydła i owiec. Bezmózgowie występuje na ogół w połączeniu z rozszczepieniem kręgosłupa i zaburzeniami w rozwoju narządów wewnętrznych. wpływa bowiem na umaszczenie.

loco).3. pić i giną w ciągu kilku dni. Niepłodność obserwowana jest także u buhajów. powstającą w wyniku zaburzeń ośrodkowego układu nerwowego jest spastyczne porażenie kończyn tylnych. Obustronne wnętry są niepłodne również po takim zabiegu. nasieniowodów. związanym z niedorozwojem przodomózgowia. ale nie mogą jeść. której objawy mogą być dwojakie: paraliż wszystkich kończyn bądź tylko kończyn tylnych. dlatego nazwano je „gałkowatymi". Dlatego konieczne jest usuwanie z hodowli rozpłodników obarczonych wnętrostwem. występujący u bydła. Jest to prosta. Ten typ niepłodności występuje u buhajów homozygotycznych pod względem recesywnego genu kn (ang. takie jak: niedorozwój (hipoplazja) jąder.kowane recesywnym genem letalnym lo (ang. a równocześnie dobrze poznane są anomalie budowy i czynności układu rozrodczego. niedrożność jajowodów czy wnętrostwo.4. Trudność tę powiększa to. jest trudne do identyfikacji. Inne przykłady zaburzeń rozwoju cech płciowych są omówione w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm.4. Podłoże genetyczne zaburzeń natury biochemicznej. szczególnie u buhajów. jajników. 5. świń i owiec. iż objawy pojawiają się u zwierząt w różnym wieku. jak na przykład brak lub niedobór pewnych enzymów czy hormonów. Wady układu rozrodczego Dość często występujące. Zaburzeniem rozwojowym układu rozrodczego spotykanym najczęściej u psów. ogierów i samców innych ssaków jest wnętrostwo. Wada ta czasami ujawnia się dopiero w wieku 10-12 lat. Pisklęta obarczone tą wadą kłują się dobrze. ale także u knurów. 132 . czyli szczytowej części główki. czyli niezstąpienie jednego lub obu jąder przez kanał pachwinowy do moszny. autosomalna cecha recesywna. macicy. Anomalią o dużej częstości występowania. Anomalia ta jest prawdopodobnie wynikiem plejotropowego działania genu białego umaszczenia w połączeniu z nieznaną liczbą genów z innych loci. Fenotypowym obrazem tej wady jest spionizowanie stawu skokowego w wyniku skurczu mięśnia brzuchatego. W przypadku jednostronnego wnętrostwa osobnik jest płodny i może przekazywać tę wadę potomstwu. knurl). Nienormalność tę można usunąć zabiegiem chirurgicznym. jest paraliż i przykurcz mięśni kończyn i szyi. U białych jałówek rasy belgijskiej błękitnej i shorthorn bezpłodność wynika z niedorozwoju pochwy i macicy. Plemniki buhajów dotkniętych tą nieprawidłowością cechuje znaczne zgrubienie akrosomu. Zaburzeniem układu nerwowego. Choroby monogenowe wywołujące zaburzenia procesów biochemicznych Wpływ genów na budowę morfologiczną i anatomiczną zwierząt jest znacznie łatwiejszy do rozpoznania niż ich oddziaływanie na procesy fizjologiczne.

Oprócz ogromnej liczby wrodzonych wad dziedzicznych. gdyż świnie obarczone tym defektem nie są uczulone na światło słoneczne. która jest produktem rozkładu chlorofilu. których podłoże genetyczne jest dobrze poznane. a także owiec. Są dwa rodzaje tego schorzenia: hemofilia A — cechuje się brakiem czynnika VIII (globulina przeciwhemofilowa). Należą do nich przypadki wielokończynowości.Typową nieprawidłowością natury biochemicznej jest porfiria występująca u bydła i świń. Uczulenie na promienie słoneczne występuje również u owiec. Również innego rodzaju mutacje — aberracje chromosomowe mogą być przyczyną wad bądź zmniejszenia wartości cech użytkowych. Ta nieprawidłowość metaboliczna ujawnia się u osobników homozygotycznych. wynicowce (niezrośnięcie powłok brzusznych lub klatki piersiowej. powodująca śmierć w dwa do trzech tygodni po pojawieniu się pierwszych objawów. wywoływana działaniem genu recesywnego sprzężonego z płcią. i hemofilia B. U świń porfiria jest prawdopodobnie warunkowana genem dominującym i schorzenie to ma inne podłoże niż u bydła. U szczeniąt chorych na hemofilię A pierwsze objawy pojawiają się w wieku od 6 tygodni do 3 miesięcy. reagują powstawaniem pęcherzy na skórze. Często nawet niewinna zabawa szczeniąt może spowodować śmierć osobnika chorego na hemofilię. Genetycznym podłożem tej wady u bydła jest gen recesywny. składnika hemoglobiny. Zwierzęta dotknięte porfiria są bardzo wrażliwe na promienie słoneczne. wytwarzany w nadmiernych ilościach i odkładany we krwi. Schorzeniem notowanym u ludzi i psów. a w skrajnych przypadkach — wrzodów. 133 . Zagadnienie to jest omówione w podrozdziale: Mutacje chromosomowe oraz rozdziale: Determinacja i różnicowanie płci oraz interseksualizm. istnieje wiele anomalii. a w konsekwencji tego wydostanie się zawartości jamy brzusznej lub klatki piersiowej na zewnątrz) oraz przepukliny. Zestawienie ważniejszych chorób monogenowych dziedzicznych jest zawarte w tabeli 5-II. zębach i innych częściach ciała. Wątroba jagniąt dotkniętych tą anomalią nie wydziela fikoerytryny. niezbędnego do wytwarzania tromboplastyny osocza. charakteryzującym się zmniejszoną krzepliwością krwi na skutek braku jednego z czynników biorących udział w tym procesie jest hemofilia. które są niewątpliwie dziedziczne. zroślaki (zrośnięte dwa płody). U bydła na skutek zaburzeń metabolicznych powstaje czerwony barwnik porfiryna. Schorzenie to wiąże się z zahamowaniem enzymatycznym tworzenia hemu. ale mechanizm ich dziedziczenia nie jest jeszcze wyjaśniony. mająca łagodniejszy przebieg. lecz jest ono jednak innej natury niż porfiria u bydła. Locus kontrolujący syntezę czynnika VIII u owiec znajduje się w długim ramieniu chromosomu X w regionie Xq24-q33. U owiec hemofilia A jest chorobą śmiertelną dla większości obarczonych nią zwierząt. który przyspiesza przemianę protrombiny w trombinę. Fenotypowym obrazem tej wady jest egzema na pysku i uszach. kościach. Omówione wyżej wady są uwarunkowane allelami powstałymi w wyniku mutacji genowych. a dotycząca czynnika IX (czynnik Christmas).

134 .

ale w swoim genotypie 135 .4. Zapobieganie rozprzestrzenianiu się wad dziedzicznych w pogłowiu zwierząt odbywa się przez usuwanie ich nosicieli. które są uwarunkowane genami dominującymi (o zupełnej lub niepełnej dominacji). Opisane wyżej wady są dziedziczone w prosty sposób (jedna para alleli).4. Większość wad jest jednak uwarunkowanych genami recesywnymi i trudno je wyeliminować z populacji hodowlanych.4.5. są zauważalne i łatwe do eliminacji. Terminem nosiciel określamy osobnika. Istnieją jednak akty prawne dotyczące ograniczania występowania tych zaburzeń. niestety. Tam gdzie prowadzona jest dokładna rejestracja przypadków wad wrodzonych połączona z ograniczeniem ich występowania. ale jedynie te. Ograniczanie występowania chorób genetycznych Częstość występowania genetycznie warunkowanych wad rozwojowych u zwierząt gospodarskich jest różna w różnych krajach. W Polsce. który jest fenotypowo normalny. kontrola wad wrodzonych nie jest jeszcze dobrze zorganizowana. częstość jest niewielka.

głównie wykorzystywanych w sztucznej inseminacji (np. Natomiast wśród jego córek połowa będzie normalnych. a u połowy ujawni się wada dziedziczna.ma gen letalny (czy semiletalny) w układzie heterozygotycznym. Nosicielami mogą być tylko osobniki płci homogametycznej (u ssaków są to samice. Na przykład od koguta nosiciela recesywnego genu letalnego sprzężonego z płcią. skojarzonego z normalnymi kurami. Kojarzenie samca (domniemanego nosiciela) z dużą liczbą samic. wśród których można się spodziewać obecności nosicielek recesywnego allelu. fenotypowo ujawniają swą obecność wówczas. Schemat takiego kojarzenia jest następujący: Jeżeli testowany osobnik jest nosicielem allelu recesywnego. Geny te. W przypadku genów sprzężonych z płcią wykrycie nosicielstwa tych genów nie stwarza większych trudności. to po wykluciu stosunek liczbowy płci u potomstwa będzie odbiegał od oczekiwanego 1 : 1 i będzie wynosił 2:1. a połowa nosicielami niepożądanego genu. 2. Znane są trzy klasyczne metody testowania rozpłodników na nosicielstwo genów recesywnych: 1. 136 . że aż 18% osobników jest nosicielami niepożądanego allelu. będą pochodzić wszyscy synowie fenotypowo normalni. Ujawnienie się jakiejś wady w populacji u 1% osobników oznacza. Zatem nosicielstwo niepożądanego genu może być potwierdzone lub wykluczone poprzez zastosowanie odpowiednich kojarzeń. Znaczne trudności sprawia wykrywanie nosicieli autosomalnych genów letalnych o charakterze recesywnym. Jeśli będzie to gen letalny powodujący zamieranie zarodków. gdy występują w stanie homozygotycznym. Testowanie takie jest możliwe jedynie wtedy. Kojarzenie testowanego samca z samicami o genotypie homozygoty recesywnej. gdy homozygoty recesywne wykazujące wadę żyją i są płodne. u ptaków samce). jednakże połowa z nich będzie homozygotami dominującymi. jak już wspomniano. buhaje). Postępowanie to ma na celu wykrycie nosicielstwa u rozpłodników. Wyjaśnienie tego wyliczenia znajduje się w rozdziale: Podstawy genetyki populacji. to około 50% jego potomków będzie homozygotami recesywnymi.

że samice matki tych córek są homozygotyczne (AA). W hodowli bydła młode buhaje. 3. Celem zasadniczym jest ocena wartości genetycznej rozpłodnika w zakresie cech użytkowości mlecznej na podstawie potomstwa (metoda ta jest opisana w podręcznikach z zakresu metod hodowlanych). Rejestracja ta z jednej strony daje obraz częstości występowania tych wad. to wśród córek połowa będzie miała genotyp AA.Pojawienie się w potomstwie pochodzącym z takich kojarzeń osobnika obarczonego wadą świadczy o obecności poszukiwanego allelu recesywnego w genotypach testowanego rozpłodnika oraz matki noworodka. Wówczas schemat kojarzenia testowego jest następujący: Kojarzenie rozpłodnika (ewentualnego nosiciela) z jego własnymi córkami powinno dać w potomstwie rozszczepienie w stosunku 7 normalnych do l obarczonego wadą. lecz trudną do zaakceptowania ze względów hodowlanych. zakupione przez Stacje Hodowli i Unasieniania Zwierząt. a połowa Aa. test automatyczny). a samiec jest heterozygotyczny. Ponadto należy rejestrować i zgłaszać w zakładach unasieniania lub w okręgowych stacjach hodowli zwierząt wszystkie przypadki rodzenia się zwierząt żywych lub martwych z wadami wrodzonymi. Jeśli oboje rodzice mają genotyp heterozygotyczny w danym locus. Dokładną metodą identyfikacji nosicielstwa recesywnego genu. jest kojarzenie samca z jego własnymi córkami. Zatem jednym ze sposobów unikania w hodowli masowej strat powodowanych dziedzicznymi wadami wrodzonymi jest niedopuszczanie do kojarzeń krewniaczych. Jeśli przyjmiemy. 137 . kojarzone są z losowo wybranymi samicami. Całkowita eliminacja z populacji genów letalnych o nieznanej budowie molekularnej jest niemożliwa. z drugiej natomiast umożliwia usuwanie z hodowli nosicieli (zwłaszcza męskich). w potomstwie może się ujawnić z prawdopodobieństwem równym 1/4 niepożądana cecha recesywna. Przeprowadzone kojarzenie może umożliwić także wykrycie obecności w genotypie zwierząt recesywnych genów letalnych (tzw.

Pewnym niebezpieczeństwem rozprzestrzeniania tej choroby jest to. Jest ona warunkowana zmutowanym recesywnym allelem (oznaczonym symbolem D128G) genu ITGB2. w których występuje gen odpowiedzialny za powstanie dziedzicznej wady wrodzonej czy choroby genetycznej. Analiza rodowodowa wykazała. w USA frekwencja nosicieli niekorzystnego allelu D128G wynosiła około 15% wśród buhajów i 6% wśród krów. leukocyte adhesion deficiency). Osobniki heterozygotyczne (nosiciele niekorzystnego zmutowanego allelu) cechuje jednocześnie wysoka wartość hodowlana. W diagnostyce tych chorób stosowane są techniki biologii molekularnej. Białko to odgrywa istotną rolę w odporności organizmu. po raz pierwszy opisano go w 1983 roku. Zagadnienie to opisano niżej. fenotypowo zdrowe). Ponieważ jest to gen recesywny. że mutacja genu ITGB2 wystąpiła u buhaja urodzonego w USA w 1952 roku. występująca również u ludzi pod nazwą LAD (ang. spowodowana wrodzonym niedoborem leukocytarnych cząsteczek adhezyjnych. Najbardziej rozpowszechnioną chorobą genetyczną w hodowli bydła rasy holsztyńsko-fryzyjskiej jest BLAD (ang. iż przypuszczalnie geny korzystnych cech ilościowych są istotnie sprzężone z locus genu ITGB2. szczególne znaczenie ma identyfikacja jego nosicieli (osobniki heterozygotyczne. bovine leukocyte adhesion deficiency) — zmniejszona odporność cieląt. który koduje strukturalną podjednostkę CD18 p2-integryny. które prowadzą do zmiany sekwencji kodującej skład aminokwasowy określonego białka. powodująca zamianę w pozycji 128 łańcucha polipeptydowego kwasu asparagino138 . tym samym wprowadzono do puli genowej naszego bydła niekorzystny allel D128G. Jest to choroba autosomalna recesywna. rozpoczął się intensywny import do Polski bydła rasy holsztyńsko-fryzyjskiej w celu poprawy wartości genetycznej rodzimego bydła czarno-białego. Jednak molekularna identyfikacja allelu D128G (BLAD) nastąpiła dopiero w 1992 roku. Stwierdzona w pozycji 383 nukleotydu mutacja. U bydła zespół BLAD był znany od kilkunastu lat.Rozwój genetyki molekularnej pozwala coraz częściej na identyfikację nosicielstwa zmutowanych alleli poprzez testy oparte na analizie restrykcyjnej (RFLP) zamplifikowanych metodą PCR fragmentów DNA. DIAGNOSTYKA MOLEKULARNA NIEKTÓRYCH CHORÓB GENETYCZNYCH Większość chorób genetycznych zwierząt gospodarskich jest spowodowana mutacjami genowymi. Na początku lat 90. a następnie rozdział tych fragmentów za pomocą elektroforezy (patrz rozdział: Metody analizy i modyfikacji genomu). głównie PCR-RFLP. W latach 70. która polega na ustalaniu długości fragmentów restrykcyjnych DNA przez cięcie (trawienie) zamplifikowanego DNA enzymami restrykcyjnymi (endonukleazy). Ostatnie lata przyniosły postęp w poznawaniu podłoża molekularnego chorób dziedzicznych.

jest podstawą testu molekularnego umożliwiającego wykrywanie nosicielstwa. Mutacja ta została już przedstawiona wcześniej. Nosiciele cytrulinemii mają genotyp ASAS/asas i fenotypowo są normalni. ta sama mutacja punktowa powoduje powstanie drugiego miejsca restrykcyjnego dla enzymu HaeIII. recesywny allel genu warunkującego syntezę enzymu syntetazy argininobursztynianowej. które nie wpływa na sekwencję aminokwasową białka kodowanego przez ten gen. Natomiast w allelu zmutowanym D128G mutacja punktowa zmienia sekwencję rozpoznawaną przez enzym TaqI i w następstwie tego enzym nie przecina cząsteczki DNA. Z kolei. Obraz elektroforetycznego rozdziału wygląda następująco: W obrębie genu kodującego podjednostkę β2-integryny stwierdzono także drugą mutację. Jej podłożem genetycznym jest zmutowany. Opracowany test diagnostyczny cytrulinemii z zastosowaniem techniki PCR-RFLP wykorzystuje to. podejmowane są środki prewencyjne. Ze względu na możliwość wprowadzenia tego niekorzystnego allelu do genotypów bydła w innych krajach. Inną chorobą genetyczną bydła rasy holsztyńsko-fryzyjskiej jest cytrulinemia. Wykorzystuje się do tego celu istnienie różnych miejsc cięcia dla enzymów restrykcyjnych Haelll i Tacjl zależnie od normalnych i zmutowanych sekwencji nukleotydowych.wego na glicynę. iż zmutowany allel nie ma miejsca restrykcyj139 . jaki allel występuje w badanym DNA. tzw. natomiast cielęta homozygotyczne asas/asas padają 5-6 dnia po urodzeniu z powodu upośledzenia zdolności usuwania mocznika z organizmu. W allelu prawidłowym znajduje się miejsce restrykcyjne rozpoznawane przez enzym Haelll i miejsce restrykcyjne dla enzymu TaqI. Za pomocą analizy fragmentów restrykcyjnych określa się. Po zamplifikowaniu fragmentu genu β2-integryny produkt PCR długości 58 par zasad poddaje się trawieniu jednym z wymienionych enzymów. ciche podstawienie 775 nukleotydu. a następnie uzyskane fragmenty rozdziela elektroforetycznie (metoda RFLP). który bierze udział w cyklu mocznikowym. opisana po raz pierwszy u bydła mlecznego w Australii w 1986 roku. W 1993 roku stwierdzono jej występowanie również u bydła tej rasy w USA.

występujące po zmianie diety. których skutkiem byłoby zmniejszenie płodności krów (zamieralność zarodków homozygotycznych). jest recesywna mutacja genu syntazy urydynomonofosforanowej. W obrębie genu syntetazy argininobursztynianowej stwierdzono także tranzycję cytozyny na tyminę. deficiency uridine monophosphate synthase). Prawidłowy gen syntazy urydynomonofosforanowej będzie przez ten enzym trawiony. krowy takie charakteryzuje większa wydajność mleka i zawartość białka w mleku. Zmutowany allel genu UMPS. konieczna jest identyfikacja genotypów heterozygotycznych (nosicieli). nie dającą żadnych skutków fenotypowych. powodującą polimorfizm w 175 kodonie dla proliny (CCC→CCT). niemożliwa jest analiza DNA osobników homozygotycznych. powoduje zamieranie homozygotycznych zarodków około 40 dnia ciąży. ale wykazują obniżony poziom aktywności enzymu.nego dla enzymu Avall w kodonie 86. U koni dotychczas poznano molekularne tło dwóch chorób genetycznych. natomiast allel zmutowany (DUMPS) — nie będzie. 36 pz i 89 pz Ze względu na letalny efekt allelu DUMPS w układzie homozygotycznym. okresie głodzenia. Konsekwencją tego jest podwyższony poziom kwasu orotowego w mleku i moczu krów heterozygotycznych. do identyfikacji nosicielstwa zmutowanego allelu stosowana jest metoda PCR-RFLP. dla heterozygotycznego trzy prążki: 194 pz. pojawiający się u koni „ąuarter" w USA. Odpowiedzialna za tę chorobę jest mutacja w genie kanału sodowego mięśni. za140 . Wynikiem testu molekularnego dla osobnika homozygotycznego pod względem allelu zmutowanego jest jeden prążek długości 194 pz. Z drugiej jednak strony. określony symbolem DUMPS (ang. Zamplifikowany fragment genu trawiony enzymem Avol da następujący obraz rozdziału elektroforetycznego: osobniki homozygotyczne (zdrowe) — dwa prążki: 53 pz i 36 pz osobniki heterozygotyczne (nosiciele) — trzy prążki : 53 pz. Osobniki heterozygotyczne są fenotypowo normalne. również wcześniej przedstawioną mutacją letalną. a dla normalnej homozygoty dwa prążki 118 pz i 72 pz. polegająca na transwersji C→G w transbłonowej domenie IVS3 podjednostki a genu kanału sodowego (zamiana fenyloalaniny na leucynę w regionie między 1358 a 1514 aminokwasem w białku). dlatego nazwano go „genem zamieralności zarodków". natomiast buhaje mają wyższą wartość hodowlaną w zakresie cech użytkowości mlecznej. Objawami tej choroby są ataki drżenia mięśni i paraliżu. Mutacja ta w kodonie 405 genu UMPS znosi miejsce restrykcyjne dla enzymu Aval. Kolejną. występującą u czarno-białego i czerwono-białego bydła holsztyńsko-fryzyjskiego. 118 pz i 72 pz. nazwany HYPP (ang. Aby nie dopuszczać do kojarzeń nosicieli tego niekorzystnego genu. Prowadzone są jednak badania blastocyst przewidzianych do embriotransferu pochodzących z kojarzeń osobników heterozygotycznych. hyperkalemic periodic paralysis). Podobnie jak w przypadku poprzednich mutacji. Pierwsza z nich to okresowy paraliż.

indukując zmiany ich konformacji. scrapie — drapać) u owiec. Przypuszcza się. Gen kodujący białko komórkowe oznaczono symbolem PrPc. chorób prionowych. Choroba ta jest śmiertelna i charakteryzuje się długim okresem inkubacji. Omawiając choroby genetyczne nie sposób pominąć tzw. bo około 250 lat temu. iż białko prionowe i białko komórkowe (normalne) są kodowane przez ten sam gen. że nie występuje ona w polskiej populacji koni arabskich. z zastosowaniem enzymu restrykcyjnego Tagi. Jedną z najdawniej. Selekcja koni na podstawie wyników gonitw na torze wyścigowym może prowadzić do wzrostu frekwencji tego niekorzystnego allelu. co powoduje załamanie się układu immunologicznego. u koni homozygotycznych objawy są silniejsze niż u heterozygotycznych. natomiast u bydła i owiec w długim ramieniu chromosomu 13. Mutację tę stwierdzono u koni czystej krwi arabskiej hodowanych w USA. Diagnostyka molekularna nosiciela zmutowanego ałlelu prowadzona jest za pomocą metody PCR-RFLP. na granicy prążka 12 i 13 (20pl2-pl3). namnażają się w ten sposób. W czasie jej rozwoju przekształcone cząsteczki białka gromadzą się w mózgu i niektórych tkankach. którym jest białko. Białkowe cząsteczki infekcyjne. dobrze umięśnionych. Źrebięta o genotypie homozygoty recesywnej padają wkrótce po urodzeniu wskutek rozwoju różnorodnych infekcji. Za rozwój tej choroby odpowiedzialna jest mutacja polegająca na delecji 5 nukleotydów w genie kodującym katalityczną podjednostkę kinazy białkowej zależnej od DNA (DNA-PK). Z tego powodu określane są gąbczastymi encefalopatiami (ang. jego zmutowany allel. severe combined immunodeficiency disease — SCID). u owiec — 13ql7-ql8. Znane choroby prionowe powodują często ubytki w mózgu i w konsekwencji prowadzą do śmierci. trwającym miesiące lub lata bez żadnych objawów. a różnica między nimi wynika z zakłóceń w wycinaniu intronów tego genu (splicing mRNA). Druga choroba genetyczna o znanym podłożu molekularnym występująca u koni to ciężki złożony brak odporności (ang. spongiform encephalopathies). Podobna choroba od 50 lat znana jest u ludzi. nazwane prionami. iż przekształcają prawidłowe cząsteczki białka w szkodliwe. Gen ten u człowieka znajduje się w krótkim ramieniu chromosomu 20. jednak predyspozycje do tych chorób mogą być warunkowane mutacją genową. Okresowy paraliż występuje u koni cennych pod względem wartości genetycznej. Mutacja HYPP dziedziczy się z niezupełną dominacją. Choroba ta charakteryzuje się brakiem limfocytów T oraz B. przy czym u bydła w pozycji 13ql7. Wprawdzie są one wywoływane przez nietypowy czynnik zakaźny.działaniu czynnika stresogennego lub spożyciu siana z lucerny bogatej w potas. warunkujący białko prionowe — symbolem PrPSc. natomiast badania przeprowadzone w Polsce wykazały. jak P 141 . poznanych chorób prionowych u zwierząt jest trzęsawka (ang.

Znacznie większe możliwości eliminacji scrapie stwarzają techniki biologii molekularnej. W obrębie genu PrPc u owiec szczególnie istotne są trzy mutacje punktowe w następujących kodonach: 136 (kodon dla waliny zmieniony w kodon dla alaniny. które powinny przyczynić się do wyjaśnienia genetycznego tła tej choroby. Diagnozowanie choroby jest oparte na pośmiertnym klinicznym badaniu mózgu. które wywołuje scrapie u owiec. Jest to choroba ośrodkowego układu nerwowego. kóz i bydła. że częściej występuje 6 powtórzeń. Dotychczas stwierdzono. że najbardziej odporne są owce o genotypie AA136RR154RR171.śledziona czy węzły chłonne. Nadekspresja tego genu w mózgu może powodować inną chorobę neurodegeneracyjną. rok później została opisana jej patologia. W ciągu ostatnich 20 lat czyniono próby ograniczenia występowania scrapie przez selekcję owiec odpornych na nią i brakowanie podatnych. Wydaje się. Metoda ta okazała się jednak zbyt droga i długotrwała. a jej rezultaty nie były zadowalające. Jednak duża zmienność rasowa w podatności na scrapie ogromnie utrudnia określenie genotypu „podatnego" i „odpornego". Jej charakterystyczną cechą jest tworzenie i gromadzenie białka amyloidowego (odpornego na działanie enzymów proteolitycznych) w mózgu zakażonych zwierząt. związany z różnicą w liczbie ośmiopeptydowych powtórzeń (5 lub 6 powtórzeń) (ryć. R/Q) (tab. downstream prion-like protein) lub doppel. 5-17). R/H) oraz 171 (arginina/glutamina. Pierwszy przypadek tej choroby zanotowano w 1985 roku w Wielkiej Brytanii. 6:5 i 5:5) najrzadziej występuje genotyp homozygotyczny — pięć powtórzeń. bovine spongiform encephalopathy — BSE). Ponadto tylko ten genotyp nie występował u krów z BSE. prion-doppel). a najbardziej podatne owce o genotypie W136RR154QQ17j (genotyp ten występuje jednak bardzo rzadko). Białko to ma około 250 aminokwasów. 5-III). 142 . Wykryto już kilka mutacji w tym genie u owiec. oznaczenia literowe V/A). Gen ten koduje białko określane jako Dpl (ang. W genie PrPc u bydła (w chromosomie 13 —BTA13ql7) wykryto polimorfizm. U bydła chorobą prionową jest rozmiękczenie mózgu (ang. Prowadzone są intensywne badania na myszach transgenicznych z bydlęcym genem PrPc. Spośród trzech możliwych genotypów (6:6. Czynnikiem zakaźnym BSE jest to samo białko prionowe. że w pobliżu genu białka prionowego znajduje się gen Prnd (ang. Ostatnie badania wykazały. 154 (arginina/histydyna. które wykazuje 25% homologii w składzie aminokwasowym z białkiem prionowym.

5. determinujący odporność na kleszcze. bydło jest szczególnie podatne na inwazje kleszczy. głównie w północnej Australii i innych regionach tropikalnych. ale jednocześnie powoduje to zmniejszenie produkcyjności potomstwa krzyżówkowego. Tę odporność można przenosić na mieszańce poprzez krzyżowanie z rasami podatnymi. w przeważającej mierze wywoływane enterotoksycznymi szczepami Escherichia coli. Należą do nich biegunki okresu noworodkowego u prosiąt. powodujące rocznie padnięcie około 10 min prosiąt na świecie. Australijscy badacze wykryli u linii pochodzących z krzyżowania bydła mięsnego ras hereford i shorthorn gen o dużym efekcie. Z kolei. Podatność na te biegunki zależy od obecności receptorów na powierzchni komórek nabłonka jelita cienkiego u zwierząt.5. bydło indyjskie jest bardzo odporne na kleszcze. Z kolei. umożliwiających adhezję bakterii i ich rozwój. Mutacje genowe odpowiedzialne za odporność/podatność zwierząt na patogeny Gen odporności na kleszcze W niektórych krajach. jak również w Europie.4. Wykorzystanie tego genu stwarza możliwość stosunkowo szybkiego zwiększenia odporności na kleszcze różnych ras bydła. występowanie tych 143 . Gen K88 i F18 U świń odporność na niektóre choroby infekcyjne jest kontrolowana przez pojedynczy gen.

wykazuje ścisłe sprzężenie z genem ECF18R. Mutacje te mogą być dziedziczone po matce. Przyczyną tego może być brak w mitochondriach mechanizmów naprawy uszkodzeń DNA. Stwarza to szansę wczesnego wykrywania prosiąt podatnych na infekcje E. coli F18).2-fukozylotransferazy. Mutacja ta likwiduje miejsce trawienia DNA dla enzymu CfoI. coli F18. mogą także powstawać de novo w komórce jajowej lub w zarodku we wczesnym stadium rozwojowym. U prosiąt w późniejszym wieku (4-12 tygodni) występuje choroba obrzękowa.receptorów warunkowane jest genem głównym (o dużym efekcie). W jednym z nich (FUT1) wykryto dwie mutacje. coli F18 na podstawie testu diagnostycznego dla mutacji M307 w locus α-fukozylotransferazy. 5. której objawami są m. iż zwierzęta mające te receptory charakteryzują się zwiększonymi dobowymi przyrostami masy ciała w przedziale wagowym od 24 do 100 kg. Niedawno stwierdzono sprzężenie między locus ECF18R a dwoma loci (FUT1 i FUT2) dla α-l. oraz takie samo sprzężenie allelu ECF18RB (podatność na biegunki i chorobę obrzękową) z ałlelem normalnym M307G. W badaniach szwajcarskich wykazano 100% sprzężenie allelu ECF18R1'. Mutacje w mitochondrialnym DNA Mutacje w mitochondrialnym DNA (mtDNA) zachodzą znacznie częściej niż mutacje w DNA jądrowym. Loci receptorów dla E. warunkującego odporność na infekcje E. a ich charakterystyczną cechą jest to. polegająca na tranzycji G-»A w kodonie 307 (w łańcuchu peptydowym zamiana alaniny na treoninę). ataksja. Receptory te prawdopodobnie pełnią także jakieś funkcje fizjologiczne. znajdujący się w chromosomie 6 i wchodzący w skład halotanowej grupy sprzężeniowej. Podatność jest cechą dominującą (allel B). stwierdzono bowiem. schorzenia wywoływane przez enterotoksyny wytwarzane przez zasiedlający powierzchnię jelita cienkiego szczep F18 E. Odporność/podatność na adhezję tej bakterii jest kontrolowana przez locus ECF18R (locus receptora dla E. coli K88 zlokalizowano w chromosomie 13. oznaczona symbolem M307. Część mutacji w mitochondrialnym DNA zachodzi w ciągu całego życia osobnika. blisko locus Tf (transferyny). a odporność recesywną (allel b). iż mogą 144 . z których jedna. z ałlelem zmutowanym M307A.in. Analiza polimorfizmu DNA przeprowadzona metodą RFLP wykazuje obecność dwóch prążków (93 pz i 328 pz) u osobników homozygotycznych MSOZA/A (allel zmutowany). trzech prążków (93. Badania przeprowadzone w Polsce wykazały wysoką frekwencję allelu odporności w rasie złotnicka pstra. konwulsje i paraliż oraz biegunka poodsadzeniowa (kolibacilloza jelitowa). coli (bakterie te mają fimbrie).5. 241 i 87 pz) u homozygot M307G/G (allel normalny) oraz wszystkich czterech prążków u zwierząt heterozygotycznych.

Wiadomo na przykład. iż w tkance występują razem gen prawidłowy i jego zmutowany allel bądź dana mutacja może występować w każdej cząsteczce mtDNA we wszystkich tkankach. Niestety brak jest efektywnych metod leczenia chorób wywoływanych tymi mutacjami. wywoływaną przez wirus.dotyczyć całych tkanek. polegającego na zaburzeniach funkcjonowania szpiku kostnego u dzieci i niewydolności trzustki. Mutacje w mitochondrialnym DNA. Skutkiem tranzycji są takie choroby u człowieka. inne natomiast u odpornych. drugi natomiast mutacją homoplazmatyczną. Należą do nich przede wszystkim choroby ośrodkowego układu nerwowego i układu mięśniowego. polegają na substytucjach nukleotydów (głównie tranzycja). Miejsce i zasięg występowania danej mutacji powodują. jak dziedziczna neuropatia nerwu wzrokowego — zespół Lebera (LHON) i neuropatia obwodowa mięśni połączona z ataksją i barwnikowym zwyrodnieniem siatkówki (NARP).in. kwasica mleczanowa i napady udaropodobne). Przykładem pierwszej sytuacji jest wspomniana już choroba LHON. poszarpane czerwone włókna (MERRF). jak i synom. że niektóre allele genu karboksylazy fosfoenolopirogronianowej (enzym biorący udział w szlaku glukoneogenezy) występują u kurcząt podatnych na chorobę Mareka. mutacja w pozycji 8993 genu syntazy ATP warunkuje chorobę NARP oraz zespół Leigha (śmiertelna choroba wieku dziecięcego). Cechą charakterystyczną chorób powodowanych mutacjami w mtDNA jest to. Pierwszy rodzaj mutacji nazywany jest mutacją heteroplazmatyczną. podobnie jak w DNA jądrowym. . ale dalszym pokoleniom cechę tę przekazują tylko córki. Mutacje w mitochondrialnym DNA są przyczyną bardzo poważnych chorób genetycznych u ludzi. Podstawienia nukleotydów w genach kodujących tRNA powodują m. Z kolei. Większość mutacji w mtDNA cechuje specyficzna relacja między genotypem a fenotypem. Badania występowania i skutków mutacji genów mitochondrialnych u zwierząt są nieliczne. insercji bądź delecji nukleotydów. pojedynczych komórek lub nawet poszczególnych cząsteczek mtDNA tej samej komórki. iż mutacja jest przekazywana przez komórkę jajową od chorej matki zarówno córkom. padaczkę miokloniczną i tzw. Określona choroba może być wywołana mutacjami w różnych genach i odwrotnie — dana mutacja może być przyczyną różnych chorób. mitochondrialną miopatię. dziedziczną miopatię i kardiomiopatię (MMC) oraz zespół chorobowy oznaczony skrótem MELAS (encefalomiopatia mitochondrialną. której podłożem genetycznym są mutacje w 6 różnych podjednostkach dehydrogenazy NADH lub mutacja w genie apocytochromu b. chroniczny postępujący paraliż mięśni oka — CEOP) i zespołu Pearsona. Z kolei mutacje typu insercja-delecja są przyczyną większości miopatii ocznych (np.

układy grupowe krwi itd. a ich ujawnienie się zależy przede wszystkim od założeń genetycznych.Genetyka klasyczna (mendlowska) jako cechę określa właściwość organizmu. kolor upierzenia u drobiu. Ogólnie cechy można podzielić na jakościowe i ilościowe. umaszczenia. owiec i kóz. a nawet kilkadziesiąt par genów. że jeden gen warunkuje sekwencję aminokwasów w polipeptydzie. Natomiast podłoże genetyczne cech ilościowych jest bardziej złożone. 146 . Mechanizm dziedziczenia cech jakościowych jest zróżnicowany. bowiem na ich ekspresję wpływa kilkanaście. Dzięki osiągnięciom genetyki biochemicznej powstała hipoteza jeden gen — jeden enzym. że identyfikacja różnych wariantów fenotypowych danej cechy jest względnie prosta. jak: umaszczenie zwierząt. barwa umaszczenia. W myśl tej hipotezy synteza każdego enzymu jest kontrolowana przez określony gen. posiadanie/brak rogów). Mechanizm dziedziczenia cech ilościowych jest omówiony w rozdziale: Zmienność cech. Znane są również przykłady. w przypadku wielu cech ilościowych ich wartość jest modyfikowana przez czynniki środowiskowe. Oznacza to. rogatość lub bezrożność bydła. Do cech jakościowych zalicza się takie. kiedy jeden gen wpływa na kształtowanie się kilku cech. Ponadto. która jest łatwa do odróżnienia w zespole innych właściwości (np. rzadziej kilkoma współdziałającymi ze sobą parami genów. np. Zjawisko to nazywa się plejotropią. Dalsze badania spowodowały uściślenie tej hipotezy: jeden gen — jeden łańcuch polipeptydowy. W opisie mechanizmów dziedziczenia łatwiej jest posługiwać się mendlowskim pojęciem cechy jako pewnej właściwości. Cechy jakościowe są warunkowane jedną. Wspólną właściwością tych cech jest to. Wpływ czynników środowiskowych na ekspresję tych cech jest niewielki i dotyczy tylko nielicznych przypadków.

A-a). nazywa się homozygotą (AA lub aa). W przypadku kojarzenia heterozygot w potomstwie wystąpi rozszczepienie cech. która zawiera dwa jednakowe geny z danej pary alleli. drugi natomiast od matki. Dziedziczenie cech warunkowanych jedną parą alleli 6. Potomek dziedziczy zatem jeden allel z danej pary od ojca. Jak już wspomniano. natomiast mająca dwa różne geny — heterozygotą (Aa). Fenotyp jest opisywany na podstawie obserwacji lub pomiaru cechy oraz analiz molekularnych (identyfikacja białek). Można wyróżnić następujące rodzaje tego współdziałania: 1) dominowanie całkowite — typ Pisum 2) dominowanie niezupełne (dziedziczenie pośrednie) — typ Zea 3) kodominowanie 4) naddominowanie. Podstawowe reguły dziedziczenia cech zawarte są w prawach Mendla. dając wszystkie możliwe formy danej cechy. Współdziałanie alleli Cechy jakościowe kontrolowane przez jeden gen są wynikiem współdziałania między parą alleli tego genu. Genotyp jest ustalany na podstawie fenotypu osobnika lub jego krewnych bądź przez bezpośrednie badanie DNA.1. cechy jakościowe mogą być warunkowane jedną lub kilkoma parami genów współdziałających ze sobą.Zestaw genów występujących w komórkach jednego osobnika nazywamy genotypem. Wybór litery zwykle jest związany z angielską nazwą pierwszego wariantu allelu wykrytego w danym locus. W procesie gametogenezy allele z danej pary rozchodzą się do gamet.1. 6. a zespół cech warunkowanych przez genotyp i czynniki środowiskowe — fenotypem. Kojarzenie jednakowych homozygot między sobą daje zawsze potomstwo jednolite pod względem interesującej nas cechy. Allelomorficzną parę genów oznacza się tą samą literą — wielką lub małą (np. Podczas zapłodnienia dochodzi do losowego łączenia się alleli w pary.1. Geny te nazywane są parą alleli lub allelomorfów. Zygota. I prawo Mendla. mówi o tym. drugi natomiast — nieallelicznego (kilka par genów). zwane prawem czystości gamet. Para genów warunkujących powstanie określonej cechy zajmuje określone miejsce (locus) w dwóch homologicznych chromosomach. 147 . Pierwszy rodzaj współdziałania nosi nazwę allelicznego (1 para genów). że gameta zawiera tylko jeden gen z danej pary alleli.

Kojarząc zwierzęta umaszczone czerwono ze zwierzętami białymi. to stosunek liczbowy osobników czerwonych. Dominowanie niezupełne genów z jednej pary alleli polega na tym. będących homozygotami alternatywnymi (PP i pp) pod względem locus polled. Para rodziców. Innym przykładem jest biały pas u czarno umaszczonych świń rasy hampshire. zawsze da potomstwo heterozygotyczne. czarne umaszczenie u bydła. Kojarząc te osobniki między sobą uzyskamy w następnym pokoleniu 3/4 zwierząt bezrogich (PP i Pp) i 1/4 rogatych (pp). U bydła rasy shorthorn obok zwierząt czerwono umaszczonych zdarzają się osobniki o umaszczeniu białym oraz zwierzęta mające umaszczenie pośrednie — mroziate. jednolite umaszczenie (dominuje) i łaciatość u bydła. upierzenie kur andaluzyjskich (czarne. białe i stalowoniebieskie). Wiele cech zwierząt domowych dziedziczy się tak jak cecha umaszczenia u shorthornów. długość uszu u owiec rasy karakuł i inne. Przykładem tego typu współdziałania allelicznego jest grupa 148 . jest poniższy przykład. Przedstawiony na przykładzie sposób dziedziczenia z dominowaniem całkowitym nazywany jest również dziedziczeniem typu Pisum. Krzyżowanie międzyrasowe świń obu tych ras przedstawiono na rycinie 6-1. Allel ten u osobników heterozygotycznych nie ujawnia się w fenotypie. gdyż gen dominujący P maskuje jego ekspresję. Są to na przykład: szurpatość u kur (pióra nastroszone i pozwijane). otrzymuje się potomstwo (pokolenie Fl) mroziate. część zaś białe. iż cecha bezrożności/rogatości jest kontrolowana przez locus polled (znajdujący się w l chromosomie). Wszystkie zwierzęta (bydło) rogate są homozygotyczne pod względem recesywnego allelu p. Z kolei u świń rasy cornwall. nazywanego również dziedziczeniem typu Zea. część mroziate. Są one zatem w stosunku do siebie równorzędne. który ma dwa allele: P — dominujący allel bezrożności i p — recesywny gen rogatości. z którego część ma umaszczenie czerwone. że u osobników heterozygotycznych pod względem danej pary alleli występuje pośrednia forma cechy. również czarno umaszczonych. Ilustracją tego typu dziedziczenia. dominujące nad czerwonym i inne. Charakterystyczną cechą tego typu dziedziczenia jest to. że fenotyp zwierzęcia odzwierciedla jego genotyp. jednolitego umaszczenia. kontrolowany przez allel dominujący Bew z locus Be. W przypadku kodominowania w fenotypie ujawniają swą obecność obydwa geny z określonej pary alleli. wykazujące dominującą formę cechy. mroziatych i białych w pokoleniu F2 wyniesie 1:2:1. Do cech dziedziczących się z dominowaniem całkowitym należą także: bezrożność (cecha dominująca) i rogatość kóz.Przykładem całkowitej dominacji może być bezrożność u bydła. Stwierdzono. w locus tym występuje allel be. Natomiast z kojarzenia osobników mroziato umaszczonych uzyskuje się potomstwo (pokolenie F2). Jeżeli obserwacje będą prowadzone na dużej grupie zwierząt.

w których u różnych osobników znajdują się więcej niż trzy allele. w której oba allele LA i LB ulegają ekspresji w jednakowym stopniu. obok dotychczasowej pary alleli pojawia się allel trzeci. Zdarzają się również takie loci. Przedstawione dotychczas rodzaje współdziałania dotyczyły genów występujących w postaci par alleli mających tylko dwie alternatywne formy. dając jedynie inną jej formę lub natężenie. Naddominowanie polega na tym. Układ taki. w wyniku mutacji genowych (patrz rozdział: Mutacje). który warunkuje tę samą cechę co allele pierwotne. W przypadku niektórych loci. w którym w jakiejś populacji 149 . że genotyp heterozygotyczny (Aa) warunkuje większą ekspresję cechy niż genotyp homozygotyczny (AA lub aa).krwi AB w układzie ABO u ludzi.

czerwone). Edp.występują więcej niż dwa allele. czyli będą czarne. Oznacza to. nazywamy szeregiem (serią) alleli wielokrotnych. Jeśli rozpatrywane jest dziedziczenie dwóch lub więcej takich cech równocześnie.1. natomiast gamety osobnika rasy shorthorn (czerwone. Allele wielokrotne charakteryzują się tym. Dzieje się tak 150 . Zwierzęta z pokolenia Fj będą mieć genotyp EdePp. bezrogie) zawierają dominujące geny Ed i P. to liczba genotypów będzie się równała: Przedstawione przykłady dziedziczenia dotyczyły tylko jednej cechy kontrolowanej przez jedną parę alleli. jak i heterozygotycznych pod względem jakichkolwiek dwóch alleli • liczba różnych genotypów w populacji zależy od liczby alleli w danym szeregu. to ich segregacja jest praktycznie niezależna.2.in. badając m. ep. Każdy osobnik z tego pokolenia wytwarza 4 różne rodzaj gamet: EdP. Warunkiem niezależnego dziedziczenia się cech jest umiejscowienie determinujących je genów w różnych parach chromosomów. Niezależne dziedziczenie cech (II prawo Mendla) Niezależne dziedziczenie cech stwierdził Grzegorz Mendel. bezrogie. rogate) — allele recesywne e i p. Również gdy loci genów znajdują się w tym samym chromosomie w dużej odległości od siebie. Niezależne dziedziczenie cech obrazuje przykład krzyżowania zwierząt różniących się dwiema cechami — umaszczeniem (czarne. że podczas mejozy segregacja alleli jednej pary jest niezależna od alleli drugiej pary. to mogą się one dziedziczyć niezależnie od siebie lub zależnie (cechy sprzężone). warunkowanym parą alleli Ed-e (z locus Extension umiejscowionego w chromosomie 18) i bezrożnościa/rogatością (allele P-p z locus polled w chromosomie 1). iż: • warunkują tylko jedną cechę • każdy osobnik może mieć tylko dwa allele z danego szeregu • wśród zwierząt stanowiących populację można napotkać wiele geno typów zarówno homozygotycznych pod względem któregokolwiek allelu z tego szeregu. mówiące o niezależnym dziedziczeniu się cech. Wszystkie gamety osobnika aberdeen-angus (bydło czarne. sposób dziedziczenia barwy kwiatów i kształtu nasion u groszku. eP. Jeśli szereg składa się z n liczby alleli. Na podstawie uzyskanych wyników sformułował prawo (II prawo Mendla). 6.

151 .

dlatego. rogate): 3 (czerwone. a tylko kilka do kilkudziesięciu chromosomów. gdyż te dwie pary genów znajdują się w innych parach chromosomów homologicznych. w którym występuje przynajmniej jeden gen dominujący z każdej pary. rogate) (ryć. cechy kontrolowane przez te geny będą się dziedziczyć razem. że allele Ed-e przechodzą do komórek rozrodczych niezależnie od alleli P-p. iż geny umiejscowione w różnych chromosomach zachowują się niezależnie podczas mejozy. inaczej mówiąc. Najłatwiej przedstawić wszystkie możliwe genotypy w pokoleniu F2. a najmniej liczną grupę (tylko l na 16 możliwych) stanowią osobniki podwójnie recesywne homozygotyczne (ee pp — czerwony. 6-2). rogaty). bezrogie): l (czerwone. Liczbowy stosunek rozszczepienia cech w pokoleniu F2 (9:3:3:1) wystąpi tylko wtedy. Podczas procesu gametogenezy geny znajdujące się w określonym chromosomie będą przekazane do powstającej komórki rozrodczej łącznie. Spośród 16 możliwych kombinacji genów w pokoleniu F2 uzyskuje się tylko 4 różne fenotypy w następującym stosunku liczbowym: 9 (czarne. Natomiast gdy jedna cecha dziedziczy się według typu Pisum. gdy obie cechy dziedziczą się z dominowaniem całkowitym. to w wyniku losowego połączenia się gamety męskiej i żeńskiej może powstać 4 x 4 = 16 możliwych kombinacji. Zatem każdy chromosom zawiera wiele genów.1. Jednak organizmy żywe mają tysiące. Jeśli będzie rozpatrywana większa liczba cech równocześnie. a druga według typu Zea. sporządzając szachownicę genetyczną Punneta. lecz 9 różnych fenotypów. Ponieważ każdy osobnik wytwarza 4 rodzaje gamet. liczbę oczekiwanych fenotypów i genotypów w pokoleniu F2 można obliczyć ze wzorów: liczba różnych gamet = 2n liczba fenotypów = 2 n liczba genotypów = 3 n 6. Najliczniejszą grupę potomstwa stanowią osobniki o genotypie.3. zwiększy się liczba możliwych fenotypów. istnieje możliwość ujawnienia się 6 różnych fenotypów. Liczbę gamet wytwarzanych przez osobniki heterozygotyczne pod względem n par alleli. W tym przypadku można mówić o niezależnej segregacji chromosomów. W przypadku obu cech dziedziczących się z dominowaniem niezupełnym (typ Zea) należy spodziewać się nie 4. Podany wyżej wzór na obliczanie liczby różnych gamet (2n) nie może 152 . Dziedziczenie cech sprzężonych Podstawę II prawa Mendla o niezależnym dziedziczeniu się cech stanowi to. bezrogie): 3 (czarne. dziesiątki tysięcy różnych genów. Cechy takie nazywamy sprzężonymi.

Jednak w celu lepszego zrozumienia zostaną przyjęte symbole B (barwa ciała dzika — dominująca) i V (kształt skrzydeł dziki — dominujący). jakie allele u osobnika heterozygotycznego (dominujące czy recesywne) z dwu loci sprzężonych są przenoszone przez ten sam chromosom. zwanej crossing over. normalne skrzydła są dłuższe od odwłoka.być stosowany do tych cech. dzikiej) każdej cechy u muszki. w którym licznik oznacza jeden chromosom. genotyp dla cech sprzężonych jest zapisywany w postaci ułamka. W odróżnieniu od cech segregujących niezależnie. 153 . skrzydła szczątkowe (gen recesywny v — vestigal). Sposób segregacji genów znajdujących się w tym samym chromosomie zależy od odległości między nimi. Sposób określania sprzężenia (odległości) loci przedstawia poniższy przykład. W rozdziale: Chromosomy i podziały jądra komórkowego wspomniano o tym. bądź w różnych chromosomach i jest to faza odpychania (trans). mianownik drugi chromosom z tej pary. Częstość tej wymiany jest tym większa. Dla muszki dzikiej genotyp pod względem dwóch rozpatrywanych cech jest następujący: Natomiast genotyp podwójnej homozygoty recesywnej: W celu określenia. Normalny fenotyp barwy ciała muszki to barwa jasnobrunatna. została przyjęta nazwa faza sprzężenia. Geny dominujące z tych loci mogą się znajdować w tym samym chromosomie i wtedy mówimy. Przyjmuje się symbol „ + " na oznaczenie allelu normalnej formy (tzw. Prawidłowość ta została wykorzystana w opracowywaniu map genetycznych ukazujących względne położenie poszczególnych loci w chromosomach. pojawią się kombinacje cech w innym układzie niż u rodziców. U muszki owocowej (Drosophila melanogaster) w drugim chromosomie znajdują się między innymi geny warunkujące czarną barwę ciała (gen recesywny b — black) i kształt skrzydeł. W wyniku crossing over u części osobników potomnych. złożone z homologicznych chromosomów. Dochodzi wówczas do wymiany odcinków między niesiostrzanymi chromatydami. rekombinantów. im dalej od siebie znajdują się geny. iż w profazie I podziału mejotycznego zachodzi koniugacja chromosomów i powstają biwalenty. że są one w fazie przyciągania (cis). tzw.

jest ona iloczynem częstości przypadków pojedynczych crossing over. że cechy sprzężone dają w krzyżówkach zawsze zbliżony procent rekombinantów.Ewentualne sprzężenie cech najłatwiej jest sprawdzić krzyżując osobniki heterozygotyczne z homozygotami recesywnymi — jest to klasyczne krzyżowanie testowe.5 cM. W danym przykładzie rekombinanty stanowią około 18. Procent rekombinacji przyjęto za jednostkę odległości między genami. Wynika to z tego. Podwójny crossing over zachodzi znacznie rzadziej niż pojedynczy. jeśli pojedynczy 154 . iż częstość. jest stała. od nazwiska twórcy chromosomowej teorii dziedziczenia Tomasza Morgana).5% całego potomstwa z tej krzyżówki. W naszym przykładzie odległość między loci B i V wynosi 18. czyli l cM = 1% rekombinacji. Można jednak przewidzieć częstość występowania podwójnego crossing over. Doświadczalnie zostało udowodnione. z jaką crossing over zachodzi między sprzężonymi loci. W przedstawionym wyżej przykładzie nie została uwzględniona możliwość zajścia podwójnego crosing over. natomiast pozostałe 39 miało genotypy rekombinacyjne (osobniki takie są nazywane rekombinantami). Zatem rodzicielski układ alleli wystąpił u 172 osobników (są to typy rodzicielskie fenotypu). której symbolem jest cM (centymorgan. Na przykład.

02x0. natomiast skutkiem pojedynczego crossing over w obszarze II między genami C i V będą gamety BCv i bcV.1%. a nie za pomocą przyjętego dla nich symbolu „ + ". Jeśli skrzyżujemy osobniki różniące się allelami w trzech loci sprzężonych. Trzecią cechą rozpatrywaną będzie kolor oczu. 155 . umożliwiające dokładne ustalenie położenia loci względem siebie. Rekombinanty są osobnikami mającymi nowe kombinacje genów sprzężonych. iż zajście crossing over w jakimś odcinku chromosomu zmniejsza prawdopodobieństwo drugiego crossing over w pobliżu tego odcinka. Jeśli przyjmiemy. a gen recesywny c (cinnabar). w celu lepszego uwidocznienia efektu crossing over.001. Sposób ustalenia sprzężenia między trzema genami przedstawiony zostanie na omawianym przykładzie muszki owocowej. układ genów będzie taki. W pokoleniu rodzicielskim jedna płeć musi mieć genotyp potrójnie heterozygotyczny: Natomiast drugi rodzic ma genotyp: W wyniku pojedynczego crossing over w obszarze I między genami B i C powstaną gamety bCV i Bcv. Z kolei. krzyżówki trzypunktowe.02 (2%). By tego uniknąć. Przyczynę stanowi to. allele dominujące będą oznaczone literami alfabetu. Zjawisko to nosi nazwę interferencji. warunkuje kolor cynobrowy. a w obszarze II — 0. Jeśli jednak zajdzie podwójny crossing over.05 = 0. czyli 0. Również w tej krzyżówce.05 (5%). że kolejność ułożenia loci w chromosomie jest następująca: A-B-C.crossing over w obszarze I zachodzi z częstością 0. Ponadto możliwe będzie ustalenie kolejności ułożenia trzech rozpatrywanych loci w chromosomie. Jest to jednak wartość przybliżona. jak przed tą wymianą i nie będzie można odróżnić rekombinantów. to na podstawie fenotypów potomstwa wykryjemy wszystkie przypadki pojedynczych i podwójnych crossing over między skrajnymi loci. U muszki owocowej dominuje czerwony kolor oczu (dziki). Skutkiem tego będzie zmniejszona liczba rekombinantów i błąd w obliczeniu odległości między loci sprzężonymi. stosuje się tzw. to obliczona odległość między loci A i C powinna być sumą odległości między A i B oraz B i C. to częstość występowania podwójnego crossing over wynosi 0. podwójny crossing over w obszarze I i II da gamety o następującym zestawie alleli: bCv i BcV. gdyż w naturze jest ona niższa.

Odległości mapowe są obliczone z częstości rekombinacji między analizowanymi genami i kolejno sumowane.W potomstwie uzyskano następujące genotypy i liczebności: Obliczanie odległości między loci sprzężonymi: Odległość między genami B i C jest stosunkiem sumy rekombinantów powstałych w wyniku crossing over w I obszarze i rekombinantów powstałych po podwójnym crossing over do wszystkich fenotypów. W celu okreś156 . wyrażonym w procentach: Analogicznie do tego odległość między loci C i V wynosi: Odcinek chromosomu 2 Drosophila melanogaster zawierający rozpatrywane loci wygląda następująco: Dla każdej grupy genów sprzężonych można ustalić odległości między nimi oraz ich wzajemne położenie w chromosomie. W ten sposób tworzone są mapy genetyczne.

należy zastosować inne metody badania (cytogenetyczne). 6. Powstaje wówczas mapa fizyczna. U zwierząt płci heterogametycznej wszystkie cechy sprzężone z płcią zależą od jednego genu. ponieważ genotyp cechy sprzężonej z płcią wyznaczany jest u nich tylko jednym genem. Sposób dziedziczenia cechy sprzężonej z płcią obrazuje poniższy przykład.in. Gdy jest odwrotny układ (cecha dominująca u osobnika homogametycznego).lenia. Sposób ich dziedziczenia jest inny niż cech autosomalnych. iż u osobnika diploidalnego występuje tylko jeden gen z danej pary. O mapach genetycznych i fizycznych oraz ich zastosowaniu jest mowa w rozdziale: Mapy genomowe. Cechy sprzężone z płcią Cechy. Najczęściej zjawisko to odnosimy do położenia genu w chromosomie X ssaków lub chromosomie Z ptaków. a osobnika — hemizygotą. nazywamy cechami sprzężonymi z płcią. występująca u ludzi. samce zaś heterogametyczne (XV). Układ genetyczny polegający na tym. 157 . a synowie po matce). cecha będzie się dziedziczyć tak jak prosta cecha autosomalna. nazywamy hemizygotycznym. w którym chromosomie znajduje się dana grupa genów sprzężonych.1. samce nie mogą być heterozygotami (nosicielami genu hemofilii). Natomiast u ptaków płcią homogametyczną są samce (określane dla odróżnienia od ssaków — ZZ). U ssaków samice są homogametyczne (XX). Dominujący allel z tej pary (H) warunkuje prawidłową krzepliwość krwi. a heterogametyczną samice (ZW).. obserwujemy zjawisko dziedziczenia na krzyż (córki dziedziczą po ojcu. Cecha zmniejszonej krzepliwości krwi (hemofilia). Gdy płeć heterogametyczną ma cechę dominującą. że chromosomy te mają nieporównywalnie więcej loci genów niż chromosom Y (ssaki) i chromosom W (ptaki). psów i niektórych zwierząt gospodarskich. których geny są umieszczone w chromosomach płci. że odległości genetyczne między sprzężonymi loci szacuje się za pomocą funkcji Kosambiego.4. Dzieje się tak dlatego. uwarunkowana jest recesywnym genem h. Wszystkie możliwe fenotypy i genotypy pod względem tego locus można zapisać symbolami w dwojaki sposób: Fenotyp Samice Samce Samice Samce Jak wynika z tego zestawienia. a pleć homogametyczną cechę recesywną. a nie — jak u płci homogametycznej — od pary genów. W rozdziale tym pokazano m.

tj. Gen ten hamuje okresowo odkładanie się czarnego pigmentu podczas wzrostu pióra. 6-4 wkładka kolorowa).Ryć. u których zaraz po 158 . dominuje nad jego allelem b (gen czarnej barwy upierzenia). Skutkiem tego jest obecność czarnych i jasnych prążków w chorągiewce. Dlatego koguty homozygotyczne pod względem tego genu są jaśniejsze niż hemizygotyczne kurki (ryć. warunkujący cechę jastrzębiatości upierzenia. „dziedziczenie na krzyż" Dziedziczenie na krzyż przedstawiono na rycinie 6-3 na przykładzie jastrzębiatości upierzenia u kur: Gen B. Cechy sprzężone z płcią wykorzystano w hodowli kur do wytworzenia ras lub mieszańców autoseksingowych. 6-3. takich. Obecność w genotypie dwóch kopii genu B zahamowuje odkładanie pigmentu na dłuższy okres niż obecność jednego genu. Dziedziczenie barwy upierzenia u kur — cecha sprzężona z płcią. w pokoleniu F.

rasa sussex) i złocistości upierzenia (rhode island red). Jest ono następstwem tego. iż allele czarnego i rudego umaszczenia ujawniają się fenotypowo niezależnie od siebie. Wpływ płci na fenotypowa ekspresję genów jest także obserwowany w przypadku cech. co wynika z losowości inaktywacji chromosomu X pochodzenia ojcowskiego lub matczynego podczas rozwoju zarodkowego. dwarf — karłowaty). Różnice w fenotypie wystąpią u zwierząt heterozygotycznych — samce będą rogate. orange). Różna ekspresja fenotypowa tego samego genotypu u osobników obu płci jest następstwem oddziaływania hormonów wytwarzanych przez daną płeć. część z nich przedstawiono w rozdziale: Mutacje. inne — rude (genotyp Oo) (ryć. ale ich ekspresja jest uzależniona od płci. Samce mogą być tylko czarne (o-) lub rude (O-). Znane są przypadki cech sprzężonych z płcią warunkowanych szeregiem alleli wielokrotnych. Ciekawym przykładem cech sprzężonych z płcią u kotów jest czarna i ruda barwa sierści. Niektóre z nich to tzw. Rasą autoseksingową są polbary. warunkowana przez locus O (ang. wytworzone przez polską badaczkę Laurę Kaufman. Do produkcji mieszańców autoseksingowych można wykorzystać geny srebrzystości (np. Gen karłowatości u homozygotycznych (dwdw) samców wpływa na zmniejszenie masy ciała osobnika dorosłego o około 40% w porównaniu z ptakiem dorosłym.wykluciu można rozróżnić płeć. ale ujawniają się tylko u jednej płci. mając taki sam genotyp. Potomstwo (brojlery) pochodzące z kojarzenia koguta DwDw z kurą dw. Zwierzęta homozygotyczne pod względem dominującego genu bezrożności będą bezrogie niezależnie od płci. Natomiast kury mające ten gen (dw-) zużywają około 25% mniej paszy niż kury o genotypie Dw-. 6-5 wkładka kolorowa). geny kontrolujące tempo opierzania się skrzydeł i ogona (K-k) czy gen karłowatości (dw. których założenia genetyczne znajdują się u osobników obu płci. cechy związane z płcią. Cechy te nazywane są cechami 159 . Przykładem takiej cechy jest rogatość owiec rasy dorset horn. Innymi przykładami cech związanych z płcią są: mahoniowo-białe i czerwono-białe umaszczenie bydła rasy ayrshire oraz broda u kozłów. zlokalizowany w chromosomie X. Geny warunkujące te cechy należą do autosomalnych (umieszczone w autosomach). Nie wszystkie cechy typowe dla danej płci są sprzężone z chromosomem X. mające gen jastrzębiatego upierzenia. ang. Barwa upierzenia u gołębi jest kontrolowana przez szereg złożony z trzech alleli: B A (popielatoczerwone). samice zaś bezrogie. U zwierząt domowych jest wiele cech sprzężonych z płcią. U samic heterozygotycznych występuje umaszczenie szylkretowe — część włosów czarnych. B (niebieskie dzikie) i b (czekoladowe). Osobniki męskie i żeńskie. mogą się różnić fenotypowo. natomiast osobniki homozygotyczne recesywne będą rogate. Taki dobór par rodzicielskich jest opłacalny z ekonomicznego punktu widzenia.będzie miało masę ciała tylko o 3% mniejszą niż brojlery po normalnych rodzicach.

wpływa zatem na inne właściwości organizmu. pracę serca i aktywność procesów trawiennych.1. kiedy jeden gen oddziałuje na powstanie kilku cech.5. gdy gen plejotropowy oddziałuje na kilka odrębnych ośrodków. Lisy platynowe w przeciwieństwie do osobników umaszczonych standardowo są mniej żywotne i bardziej pobudliwe. które nie chroni ptaka przed nadmierną utratą ciepła. w wyniku łącznego działania. Osobniki homozygotyczne pod względem tego genu nie są zdolne do życia i zamierają w okresie prenatalnym. Przykładem jest gen warunkujący platynową barwę u lisów. Współdziałanie genów z różnych loci w kształtowaniu fenotypu W omawianych dotychczas przykładach jedna para współdziałających ze sobą genów allelomorficznych warunkowała powstanie jednej cechy.ograniczonymi płcią lub ograniczonymi do płci. Z kolei ten związek ma różnorodne funkcje fizjologiczne. Jednakże nie tylko geny należące do tej samej pary mogą współdziałać ze sobą w wytworzeniu cechy. Przyczyny plejotropii właściwej mogą mieć podłoże biochemiczne. Podobnie gen warunkujący siwą (sziras) barwę włosów u karakułów powoduje śmierć jagniąt homozygotycznych w wieku 4-9 miesięcy. hormonu). Zmiany te są jednak następstwem nieprawidłowego opierzenia. która z kolei rzutuje (w zależności od wpływów środowiska) na zróżnicowanie innych cech. W podrozdziale tym omówiony jest także plejotropowy efekt genów umaszczenia u innych gatunków zwierząt. Również u koni niektóre geny umaszczenia wykazują działanie plejotropowe. Plejotropia właściwa występuje wtedy. opisany w podrozdziale: Dziedziczenie umaszczenia. powodują pojawienie się nowej formy cechy jakościowej. W przypadku wielu cech geny z różnych par alleli. Plejotropia może być właściwa lub rzekoma. który bierze udział w syntezie jakiegoś związku (np. W przypadku plejotropii rzekomej gen kontroluje jakąś cechę. Plejotropia O plejotropii mówimy wówczas. 6. Na przykład gen warunkuje syntezę enzymu. wnętrostwo czy przepuklina mosznowa u samców. nieśność samic ptaków.2. 160 . Należą do nich: zdolność wydzielania mleka u samic ssaków. 6. na tempo przemiany materii. Na przykład u około 1/4 potomstwa pochodzącego z kojarzenia między sobą koni srokatych (overo) występuje zespół „białych źrebiąt".in. Na przykład gen warunkujący szurpatość (zmiany w budowie piór) u drobiu wpływa także m.

Współdziałanie między genami z różnych par alleli w kształtowaniu fenotypu nosi nazwę współdziałania nieallelicznego. 6-6a. Jest kilka rodzajów tego współdziałania. 6-6a). Ryć. W wykształceniu czterech form tej cechy biorą udział geny z dwóch różnych /ócz: R-r oraz P-p.1. Współdziałanie dopełniające dwóch par genów w przypadku krzyżowania kur z grzebieniem różyczkowym i groszkowym 161 . Komplementarność Jednym z najprostszych przykładów współdziałania genów nieallelicznych jest dziedziczenie kształtu grzebienia u kur (ryć. 6.2.

Typ grzebienia pojedynczego jest zatem recesywny zarówno w stosunku do grzebienia groszkowego. gdyż brak w ich genotypach genu C. w którym wystąpią 4 fenotypy w stosunku 9:3:3:1. której genotyp może mieć kilka różnych wariantów. podobna do wspomnianej wyżej u świń. która blokuje syntezę tyrozynazy — enzymu biorącego udział w wytwarzaniu melaniny. całkowicie różny od obojga rodziców. natomiast gen P powoduje powstanie grzebienia groszkowego. pojawia się również nowy typ — grzebień pojedynczy.2. jak i różyczkowego. którego nie było w dwóch pokoleniach przodków. Ich genotyp pod względem tej pary alleli jest homozygota recesywna (cc). 6-6b wkładka kolorowa).2. plymouth rock) mają upierzenie białe. Gen dominujący z locus I (inhibitor) hamuje ujawnienie się barwy kolorowej mimo obecności w genotypie genów barwnego umaszczenia.Gen R warunkuje kształt różyczkowy grzebienia. Gen. że od obecności genu z określonej pary alleli zależy ekspresja innej pary alleli. Ptaki te są również białe. że w pokoleniu Fl pojawia się nowy fenotyp. która powstaje w wyniku działania każdego z nich osobno. Z krzyżowania osobników o ustalonej cesze kształtu grzebienia. 6. Epistaza Kolejnym rodzajem współdziałania genów nieallelicznych jest epistaza. natomiast w pokoleniu F 2 . Różnice między wynikami tego krzyżowania a krzyżowania uwzględniającego dwie niezależnie dziedziczące się cechy polegają na tym. Zjawisko epistazy może wyjaśnić poniższy przykład. ale mają 162 . warunkującego wytwarzanie pigmentu (melaniny) w piórach. Dwa dominujące geny z różnych par alleli. z grzebieniem różyczkowym (Rrpp) i groszkowym (rrPP). natomiast gen hamowany to gen hipostatyczny. współdziałające razem i wytwarzające odmienną formę cechy niż ta. charakteryzująca się tym. tj. Kury niektórych ras (np. warunkujący go genotyp to podwójna homozygota recesywna — rrpp. Zjawisko epistazy występuje na przykład w dziedziczeniu umaszczenia u świń niektórych ras biało umaszczonych. który hamuje ujawnienie się genu z innej pary. wyandotte. Natomiast w pokoleniu F2 nastąpi rozszczepienie cech w stosunku 9 orzeszkowych : 3 różyczkowe : 3 groszkowe : l pojedynczy. U białych leghornów jest inna sytuacja. jego allel p — grzebienia pojedynczego (ryć. nazywany jest genem epistatycznym. W wyniku współdziałania genów R i P powstaje czwarta forma cechy — grzebień orzeszkowy. w pokoleniu Ej wszystkie ptaki będą podwójnymi heterozygotami RrPp i będą miały grzebień orzeszkowy. nazywamy genami komplementarnymi lub dopełniającymi się. a jego allel r — pojedynczy. gdyż wystarczy obecność jednego genu dominującego z każdej pary alleli (R_P_).

Jednak nie zawsze jedna para genów maskuje ekspresję tylko jednej innej pary genów.Ryć. 6. Przedstawiony wcześniej rodzaj współdziałania komplementarnego jest także formą oddziaływania epistatycznego genu dominującego jednej pary wobec układu homozygotycznego recesywnego drugiej pary. Różny stopień białej plamistości spowodowany działaniem genów modyfikujących w swych genotypach gen C. Na przykład geny modyfikatory wpływają na zasięg i rozmieszczenie białych plam u bydła (ryć. Działanie tego genu jest jednak hamowane przez inny dominujący gen z locus I. zwane modyfikatorami. który w układzie homozygotycznym całkowicie uniemożliwia syntezę melaniny w piórach. W przypadku albinizmu układ epistatyczny w stosunku do genów barwy stanowią dwa geny recesywne cc (z tego samego locus co gen C). warunkowanej zwykle jedną parą genów. 6-7). Geny modyfikujące Istnieje pewna grupa genów. Podobnie umaszczenie białe u świń jest wynikiem epistatycznego działania genów z locus L Genotyp biało umaszczonych świń (np. 163 . psów i kotów.2. którego dziadkowie należeli do dwóch ras białych — leghornów i wyandotte (iicc). rasy cornwall): aa ii EE. Geny epistatyczne mogą tłumić działanie wielu innych par. Genotyp leghornów pod względem barwy upierzenia jest następujący: IICC. powodują duże zróżnicowanie cechy u osobników o jednakowych założeniach warunkujących tę cechę. które modyfikują przejawianie się jakiejś prostej cechy. 6-7. Allele z locus E i A są opisane w dalszej części tego rozdziału. natomiast czarno umaszczonych (np. mimo iż cecha łaciatości warunkowana jest inną parą alleli. Geny te.3. W potomstwie F2. Gen epistatyczny nie zawsze jest dominujący w swojej parze. Inne przykłady epistatycznego współdziałania genów nieallelicznych przedstawione są także w podrozdziałach: Dziedziczenie umaszczenia i Antygeny erytrocytarne. dotyczącej dziedziczenia umaszczenia. oprócz ptaków białych pojawią się osobniki o upierzeniu barwnym w stosunku 13 białych : 3 barwnych. rasy wielkiej białej i landrace pod względem trzech podstawowych loci jest następujący: aa II EPEP.

kortykotropina i hormon melanotropowy — MSH (ang.6. syntetyzowane z metabolitów DOPA-chromu. U ptaków większość kolorów jest związana z obecnością pigmentów karoteinowych.2. iż tyrozynaza jest jedynym enzymem niezbędnym do wytwarzania pigmentu. i feomelaniny (kolor czerwony lub żółty).4. biała w zimie. Ostatnie badania wykazały. natomiast wysoki poziom tyrozynazy powoduje produkcję eumelaniny. Mechanizm działania genów połimerycznych omówiony jest w podrozdziale: Zmienność cech ilościowych. wpływając na przykład na zmianę ilości wytwarzanego pigmentu.3. że kształtowanie się tych cech zależy również od wpływu czynników środowiskowych. Dziedziczenie umaszczenia Umaszczenie zwierząt zależy przede wszystkim od pigmentu zawartego we włosach i piórach. Jest to enzym zawierający miedź i katalizujący trzy różne reakcje w procesie biosyntezy melaniny (ryć. Zmiany te spowodowane są działaniem niektórych hormonów. Wyróżnia się dwa podstawowe typy melanin — eumelaniny (kolor brązowy lub czarny). 6. Geny te nazywane są genami polimerycznymi.). Niski poziom tyrozynazy prowadzi do wytwarzania feomelaniny. iż wiele (nawet kilkadziesiąt) genów z różnych loci warunkuje jedną cechę. wydajność mleczna. natomiast u ssaków pigmentacja zależy od syntezy i rozmieszczenia melanin w rdzeniu włosa i korze włosowej oraz naskórku skóry właściwej. powodując różne jej nasilenie. 164 . ale czynniki środowiskowe mogą modyfikować umaszczenie. 6-8): 1) hydroksylację tyrozyny do 3. Zjawisko to polega na tym. Synteza. wytwarzane z metabolitów cysteinylo-DOPA-chinonu.4-dihydroksyfenyloalaniny (DOPA) 2) oksydację DOPA do DOPA-chinonu 3) oksydację 5. Sumujące działanie genów Inną formą współdziałania nieallelicznego genów jest polimeria. U wielu zwierząt ubarwienie sierści zmienia się w zależności od pory roku (np.6-dihydroksyindolu (DHI) do indolochinonu. Ich sumujące się działanie jest podstawą dziedziczenia cech ilościowych (np. Należy pamiętać. nieśność itd. rozmieszczenie i wielkość ziarenek tego pigmentu są determinowane genetycznie przez wiele różnych loci. Do niedawna uważano. addytywnymi lub poligenami. takich jak gonadotropiny. melanocyte stimulating hormone). a czarna lub brązowa w lecie). Enzymem włączonym w syntezę obu typów pigmentu jest tyrozynaza. że przypuszczalnie również inne geny specyficzne dla procesu syntezy pigmentu mogą modulować pigmentację. zależne od sumującego się ich działania.

Jest wiele genów. Wytwarzanie melanin u ssaków jest kontrolowane przez geny działające na różnych poziomach: tkankowym. Receptor ten jest determinowany przez locus E (Extension). Hormon ten stymuluje produkcję poszczególnych melanin na przemian. Ta wędrówka melanocytów znajduje się pod ścisłą kontrolą genów.Ryć. Następstwem działania tego receptora jest wzrost poziomu tyrozynazy i produkcja eumelaniny. zwany również intermedyną lub melanotropiną. W determinację koloru jest włączonych wiele loci. Reakcja na działanie tego hormonu jest kontrolowana przez locus A (Agouti). Melaniny są wytwarzane w melanocytach. REGULACJA NA POZIOMIE TKANKOWYM Regulacja genetyczna na poziomie tkankowym polega na kontroli liczby i rozmieszczenia melanocytów. Główną jego funkcją natomiast jest regulacja syntezy czarnego pigmentu (eumelanina). Wiele genów. Natomiast receptor hormonu melanotropowego (MSH) kontroluje poziom tyrozynazy wewnątrz melanocytu. jeśli nie wszystkie związane z wytwarzaniem pigmentu. komórkowym i subkomórkowym. Geny. które współdziałają ze sobą w sposób kompleksowy. które zostały już sklonowane. Melanocyty pochodzą z rdzenia nerwowego. jest wytwarzany przez część pośrednią części gruczołowej przysadki. ma działanie plejotropowe na rozwój i różnicowanie organizmu. a hamowanie produkcji feomelaniny wewnątrz melanocytów. warunkujące pigmentację ssaków i działające na poziomie tkankowym to przede wszystkim: gen srokatości (Piebaldism) i gen nabytego bielactwa (Vitiligo). 6-8. Schemat biosyntezy melaniny Aktywność tyrozynazy jest regulowana przez hormon melanotropowy (MSH) i receptor MSH. a podczas rozwoju embrionalnego wędrują do powstającej skóry. Hormon melanotropowy. Badania genetycznego tła umaszczenia są najbardziej rozwinięte w od165 .

Następstwem działania tego białka jest niski poziom tyrozynazy i wytwarzanie feomelaniny. które działają na pigmentację ssaków na poziomie subkomórkowym. A (Agouti — dziki). U osobników ze zmutowanym allelem w locus D dendryty melanocytów są istotnie mniej rozwinięte niż u osobników normalnych (typu dzikiego). wpływają bezpośrednio na ilość i typ wytwarzanej melaniny.pełna barwa). Należą do nich geny z loci D (Dilute — rozjaśniony). REGULACJA NA POZIOMIE KOMÓRKOWYM Geny regulujące wytwarzanie pigmentu na poziomie komórkowym oddziałują na strukturę i/lub funkcje istniejących melanocytów.stalowy.dominujący biały nakrapiany i Steel (Sl) .niesieniu do myszy. Locus ten kontroluje ilość eumelaniny. gdzie krytyczną rolę odgrywa synteza i ekspresja różnych melanogenicznych enzymów i inhibitorów. zmapo-wanych w genomie myszy należą także loci: Splotch (Sp) . Locus A (Agouti) kontroluje syntezę białka będącego antagonistą receptora MSH i mającego zdolność blokowania działania tego receptora. które wydaje się istotne dla rozdziału ziaren melaniny do peryferyjnych melanocytów. pełniący istotną rolę w interakcji melanocytów z hormonem melanotropowym. odwracalna zamiana wytwarzania czarnej eumelaniny na produkcję żółtej feomelaniny). Mutacje w tych loci wpływają wyraźnie na kolor oczu. nazywanych agouti. Do loci działających na poziomie tkankowym. E (Extension . co wpływa na koloryt (układ barw). W wyniku ich działania może nastąpić istotny wzrost lub zmniejszenie ilości pigmentu tworzonego w melanocytach (np. Na przykład u bydła zwierzęta homozygotyczne ee będą umaszczone żółto lub czerwono. lub też mogą wystąpić zmiany typu syntetyzowanej melaniny (np. 166 . brak syntezy melaniny w przypadku albinizmu). Większość z tych mutacji ma wpływ plejotropowy na rozwój. Dominant White Spotting (W) . Geny. podczas gdy locus Extension działa w melanocytach.plamisty.. Pa (Pallid — blady) i P (Pink-eyed dilution — gen rozcieńczonych różowych oczu). Locus D koduje strukturalne białko. Locus Agouti działa wewnątrz mikrośrodowiska mieszków włosowych. oba typy melanin nie są więc syntetyzowane jednocześnie. melanocyty wytwarzają w różnym czasie eumelaninę lub feomelaninę. w jednolity typowy sposób. U osobników typu dzikiego.. a konsekwencją tego jest ograniczenie rozdziału melanosomów i rozjaśniony kolor włosów. przez działanie na mechanizmy włączone w funkcję melanocytu. REGULACJA NA POZIOMIE SUBKOMÓRKOWYM Melanogeneza jest regulowana także na poziomie subkomórkowym (enzymatycznym). Locus E (Extension) koduje przede wszystkim receptor MSH.

Mutacja umaszczenia himalajskiego (ch) polega na zmianie w glikozylacji. a konsekwencją tego jest synteza białka o zmienionej sekwencji aminokwasowej. a białko kodowane przez ten gen ma wszystkie cechy charakterystyczne dla tyrozynazy. która powoduje uwrażliwienie efektu fenotypowego na temperaturę. Fenotypowym efektem mutacji w genie Brown jest wytwarzanie brązowej mełaniny. Wiadomo jednak. wykazały. ch. natomiast inne geny regulują typ formowanego pigmentu. iż mutacja w genie tyrozynazy u myszy jest pojedynczą mutacją punktową. Badania poszczególnych mutacji w locus Albino u królików. w którym występuje dominacja w następującej kolejności: C. Jednym ze znanych efektów plejotropowego działania mutacji w tym locus jest zaburzenie czucia. prowadząca do osłabienia funkcji enzymu. Mutacje w locus C powodują brak pigmentu we włosach. warunkujących umaszczenie himalajskie i szynszylowate. ale są to mutacje typu nonsens. Locus B (Brown) — struktura i organizacja genu z tego locus jest podobna do genu Albino. Warunkiem ekspresji genów z tych loci jest 167 .Najważniejsze z loci działających na poziomie subkomórkowym to Albina (C) i Brown (B). gdyż białkiem kodowanym przez ten locus jest enzym tyrozynaza. Specyficzna funkcja tego białka nie jest jeszcze poznana. Mutacja ta zachodzi w bogatej w cysteinę pierwszej domenie białka. natomiast u ludzi stwierdzono ponad 30 mutacji powodujących albinizm. inhibitora) w melanocytach. ale dotychczas nie stwierdzono. U szynszyla (cch) natomiast zwiększona jest wrażliwość na inaktywację proteolityczną. czy pełnią one jakąś rolę (np. skórze i tęczówce oka. cch. jeszcze inne — sposób. B i E. Mechanizm dziedziczenia umaszczenia u zwierząt futerkowych na przykładzie lisa Istnieją dwa gatunki lisa — lis pospolity (Vulpex vulpex) i lis polarny (Alopex lagopus). Geny z locus C u królików tworzą szereg alleli wielokrotnych. Takie białka nie są kompetentne katalitycznie. Umaszczenie u obu gatunków determinowane jest głównie genami z podstawowych loci — A. ale mutacje te mają także wpływ plejotropowy jeszcze dokładnie nie poznany. iż kolor brązowy wynika z punktowej mutacji w obrębie genu Brown. Tyrozynaza przejawia swą ekspresję w melanocytach. w jaki pigment ma być formowany. Niekiedy mutacje w locus Albino powstają podczas składania mRNA (splicingu). która prowadzi do wymiany cysteiny na tyrozynę. czyli wycinania intronów. Locus C kontroluje liczbę i intensywność ziaren pigmentu. że melanocyty mutanty wytwarzają tyrozynazę z istotnie zmienioną aktywnością katalityczną. 6-9 wkładka kolorowa). Historycznie był on uważany za locus strukturalny dla tyrozynazy. zmiany sensu i mutacje zmiany fazy odczytu. c (ryć. której funkcja jest decydująca dla wytwarzania pigmentu. ale mechanizm działania tego genu dotąd nie jest znany. Interesujące jest to. Tyrozynaza jest najistotniejszym enzymem w wytwarzaniu melaniny.

jak G. W. Lis polarny o genotypie aa jest czarny. R. Allel E w układzie homozygotycznym nie ma wpływu na umaszczenie. u lisa polarnego jest rozcieńczona lub usunięta w ogóle. u obu gatunków są dwa allele — E i Ed. Allel ten odpowiedzialny jest za eliminację eumelaniny. Natomiast u lisa polarnego zamiast allelu A jest allel A".oczywiście obecność odpowiednich genów z locus C. warunkujących różne odmiany umaszczenia. Allel Ar warunkuje wstrzymanie wytwarzania eumelaniny. U lisa pospolitego w locus A są dwa allele: Ar — dominujący i a recesywny.pigment czekoladowobrązowy. w tym przypadku kolor jest determinowany allelami z locus A.genotyp gg. bez względu na to. We wszystkich tych loci. jakie są geny z innych loci. W locus B również są dwa allele — dominujący B (czarny pigment) i b. Genotypy umaszczenia różnych odmian lisa pospolitego i polarnego są przedstawione w tabeli 6-1. ale genotyp ten występuje bardzo rzadko (np. warunkującym wytwarzanie czarnej/czekoladowobrązowej eumelaniny. w populacji lisa polarnego w Islandii). Jedynie odmiana burgundzka lisa pospolitego jest homozygotyczna pod względem allelu b. W locus E. Jego alternatywny allela w podwójnej dawce warunkuje umaszczenie czarne lisa srebrzystego. S. która z reguły zajmuje miejsce eumelaniny. P. u lisa 168 . Feomelanina. W przypadku genotypu homozygoty recesywnej cc będzie fenotyp albinotyczny. U obu gatunków lisa allel Ed cechuje się niezupełną dominacją. w układzie homozygotycznym -. z wyjątkiem locus W. efekt fenotypowy dają tylko genotypy homozygotyczne recesywne: u lisa burgundzkiego -. Oprócz omawianych loci u lisa pospolitego występuje szereg innych loci.

przy czym genotyp ww występuje u lisa rudego i srebrzystego. natomiast u bydła ten sam fragment alłelu Erf koduje następującą kolejność aminokwasów: prolina-leucyna-leucyna. a drugie brązowe. Locus A koduje syntezę białka. s (trzy allele: S. Genetyczne podłoże umaszczenia u bydła Wyniki wielu badań sugerują. Letalny jest także genotyp WW. Fenotypy czarny dominujący (determinowany przez allel E'') i czarny recesywny są nieodróżnialne. będącego antagonistą białka MSH-R. Allel dominujący Ed. Allele z tego locus mogą wykazać ekspresję tylko wtedy. jest homologiczny do allelu ES0 u myszy. której skutkiem może być różny kolor oczu u tego samego osobnika. w układzie homozygotycznym mają efekt letalny. W3 (biały Georgian) i W M (gen marble). recesywny allel e. który w układzie homozygotycznym warunkuje umaszczenie czerwone. Mutacja w locus s (Shadow) charakteryzuje się heterochromią. są 3 allele: Ed warunkujący umaszczenie czarne dominujące. opisanych w rozdziale: Mutacje. U zwierząt z genotypem E+E+ lub E+e allel A+ koduje umaszczenie brązowe. SJ i SH) i t (T). natomiast w locus A tylko w przypadku allelu recesywnego a jest analogiczny allel u myszy. W locus tym są dwa allele: dominujący A+ (synteza pigmentu brązowego) i recesywny a. takie jak W i W. U lisa polarnego na wiele odmian umaszczenia wpływają allele recesywne (w homozygocie) z loci: D (dd — biały polarny. W łańcuchu polipeptydowym kodowanym przez allel ES0 nastąpiła zamiana trzech kolejnych cząsteczek leucyny na aminokwasy leucyna-prolina-leucyna. np. 169 . złożonego z około 350 aminokwasów. melanocyte stimulating hormon receptor). DD — niebieski). oraz allel E+ umożliwiający ekspresję alleli z locus A. natomiast gen marble daje inny efekt fenotypowy u tych odmian. Niestety dotychczas nie przeprowadzano badań molekularnych locus A.. umiejscowionym w chromosomie 18. F (ff — szafir) i G (gg — arktyczny niebieski) oraz u lisa niebieskiego allele dominujące z loci l (L — Laponia).srebrzystego: genotyp pp . kodujący czarny kolor. W locus W są następujące allele: w. W (białopyski). Z kolei allel A+ u bydła wydaje się wywoływać efekt różny od działania większości innych alleli z locus Agouti (A) opisanych dotychczas u ssaków. W locus tym. gdy w locus E jest genotyp E+_. W (platynowy). jedno oko niebieskie.perłowe umaszczenie oraz genotyp ss — umaszczenie perłowe Mansfield i rr — umaszczenie Radium. że u bydła umaszczenie czarne. Allele te powstały w wyniku mutacji punktowych. Mutacje dominujące. Wszystkie allele dotychczas zidentyfikowane w locus E u bydła mają odpowiadające im allele u myszy. natomiast allel a w układzie homozygotycznym — recesywne czarne. brązowe i czerwone jest determinowane przez allele z dwóch loci: Extension (E) i Agouti (A). Wyniki badań porównawczych wskazują na homologię działania alleli z locus Extension (E) u bydła i myszy. Locus E koduje syntezę białka MSH-R (ang.

poland-china i pietrain. W locus A zidentyfikowano dwa allele: A w (agouti biały brzuch) i allel a . Podobnie jak u myszy i bydła. Zróżnicowanie umaszczenia — czerwone lub czarne wynika z tego. locus I (biały dominujący) i locus Be (Belted opasany). ale recesywny w stosunku do białego (I). Wśród 170 . e umaszczenie jednolicie czerwone (rude) jak u tamworth i duroc-jersey. u których allel s jest utrwalony. W locus I są dwa główne allele: 7 (inhibicja koloru). i allel i — recesywny (kolorowy). że bydło belgijskie błękitne charakteryzuje duża frekwencja allelu dominującego E w locus Extension. Genetyczne podłoże umaszczenia u świń U świń znane są cztery główne loci determinujące umaszczenie: locus A (Agouti). W locus E stwierdzono dotychczas trzy allele: E — umaszczenie jednolite czarne jak w rasie wielkiej czarnej. recesywny s — łaciatość. belgijskie błękitne). mroziate). Wyniki badań porównawczego mapowania locus Extension u myszy (chromosom 8). U ras bydła (np. Badania.. ale jest recesywny w stosunku do allelu S. bydła (chromosom 18) i świń (chromosom 6) wskazują na homologię między tymi gatunkami. cornwall i hampshire. który dominuje nad s. Er — umaszczenie czarne nakrapiane (spotting) jak u berkshire. powodując różne zaburzenia. W tym samym locus u bydła tej rasy znajduje się allel Sc. odpowiedzialny za umaszczenie dominujące białe. U jałówek obu ras locus Roan wpływa istotnie na występowanie choroby białych jałowic. obserwowana jest zmienność w ekspresji cechy łaciatości. Większość ras świń udomowionych ma allel recesywny a — nieagouti. blisko telomerowego regionu ramienia p. Przykładem jest zmapowany w 5 chromosomie locus Roan — dereszowate (krasę. Allel A w jest obecny u dzikich świń i jest dominujący w stosunku do pozostałych kolorów oraz koloru mangalica. natomiast u shorthornów jest odwrotnie. wskazują. Choroba ta jest opisana w rozdziale: Determinacja i różnicowanie płci oraz interseksualizm.nieagouti. w których do analizy sprzężeń użyto ponad 230 markerów genetycznych. Na przykład.Wiele innych loci bierze udział w determinacji różnych odmian umaszczenia. także u świń receptor hormonu melanotropowego MSH-R jest determinowany przez geny z locus E. a mała allelu e (czerwone umaszczenie). warunkujący fenotyp nazwany colorsided — łaciaty. w którym są dwa allele: r+ czarny (u bydła błękitnego belgijskiego) lub czerwony (u bydła rasy shorthorn) i R biały. iż locus ten jest umiejscowiony w chromosomie 6. Kolejność dominowania tych alleli jest następująca: E-Ep-e. niektóre zwierzęta są niemal całkowicie pozbawione pigmentowanych łat. kora jest efektem plejotropowego oddziaływania allelu R na płodność. locus E (Extension). cecha jednolitego umaszczenia lub łaciatości znajduje się pod kontrola genów z locus S (Self): dominujący S — jednolite umaszczenie. U niektórych ras bydła pewne geny wykazują niekorzystne działanie plejotropowe.

Genotyp tego knura jest następujący: aa U EE BewBew. Umaszczenie białe. 6-10 wkładka kolorowa). overo (O). Rozjaśnienie umaszczenia u koni powodowane jest przez allel C"'. Zmienna szerokość pasa zależy od działania genów modyfikujących (zmienność poligeniczna). We wszystkich wymienionych loci dotychczas zidentyfikowano po dwa allele. zatem wystarczy jeden allel W. cremello). w przypadku jego braku (genotyp ee) syntetyzowana jest feomelanina. natomiast inne rasy są homozygotami recesywnymi (ii). Natomiast obecność w genotypie alleli dominujących z obu loci (E i A) warunkuje umaszczenie gniade. dominujący w stosunku do jednolitego umaszczenia. Umaszczenie białe u koni jest warunkowane przez dominujący allel W (jest to dominacja całkowita. Na przykład u świń rasy hampshire stwierdzono obecność genów recesywnych z loci Red-eye (czerwonych oczu) i Dilution (rozjaśniony). występuje on w homozygocie (II) w rasie wielka biała i wszystkich odmianach landrace. G (Gray — siwy) i RN (Roan — deresz). takie jak tobiano (TO). Rozjaśnienie barwy jest warunkowane działaniem genów z co najmniej trzech loci: C (Albina). wessex saddleback. hampshire (ryć. allel dominujący E determinuje syntezę eumelaniny. jak np. Również geny z innych loci u różnych ras świń kodują specyficzne wzory umaszczenia. hannover-braunschweig. Dziedziczenie umaszczenia u mieszańców niektórych ras sugeruje istnienie dalszych trzech alleli w tym locus. Locus I został zlokalizowany w chromosomie 8. jest kodowany przez allel Be w z locus Be. siwe i dereszowate jest kontrolowane odpowiednio przez allele z loci W (White — dominujący biały). Allele z tego locus wpływają na ekspresję genów z locus A. Genetyczne podłoże umaszczenia u koni Umaszczenie u koni determinowane jest głównie przez geny znajdujące się w locus E (Extension) i A (Agouti). sabino (SB) czy tarantowate (LP). Na przykład u świń rasy mangalica umaszczenie brudnobiałe jest prawdopodobnie determinowane przez allel c e z locus C. charakterystyczny dla niektórych ras. by było 171 . Locus E warunkuje wytwarzanie określonego rodzaju melaniny. wykazujący niepełną dominację. ale prowadzone są badania w celu potwierdzenia hipotez o istnieniu innych alleli (np. który w układzie homozygotycznym u innych gatunków zwierząt warunkuje albinizm. Allel recesywny e w podwójnej dawce (ee) tłumi działanie allelu A. trzeciego allelu w locus Extension — ED). W locus C u koni nie występuje allel recesywny c.świń domowych dominujący biały jest przeważający. D (Dun — bułany) i Z (Siher dapple — siwy jabłkowity). oznaczonych symbolem Id (deresz). W układzie homozygotycznym (CcrCcr) allel ten warunkuje umaszczenie kremowe (ang. Biały pas. Na umaszczenie świń oprócz wymienionych czterech loci wpływają także allele z locus C. Wzory umaszczenia. są determinowane przez geny z innych loci. I p (czarne łaty) oraz im (brudny szary).

Allel D z locus Dun wykazuje zupełną dominację. Locus D kontroluje intensywność wytwarzania eumelaniny i feomelaniny. z wyjątkiem białego. Natomiast umaszczenie siwe kontroluje allel dominujący z locus G. polegającym na niemożności wydalenia smółki z powodu braku komórek nerwowych (zwojów autonomicznych) kontrolujących ruchy perystaltyczne jelita lub. z wyjątkiem allelu W. znacznie rzadziej. Allel G (w homo. w locus W mają genotyp homozygoty recesywnej (ww). który wykazuje działanie epistatyczne w stosunku do poznanych dotychczas genów kontrolujących umaszczenie. Jego wpływ na rozjaśnienie barwy jest jednak mniejszy niż allelu C cr z locus Albina. osobniki homozygotyczne (DD) są nie do odróżnienia na podstawie fenotypu od heterozygot (Dd). wobec którego jest hipostatyczny. Z kolei większość źrebiąt homozygotycznych pod względem allelu O jest obarczona zespołem „białych źrebiąt" .i heterozygocie) powoduje redukcję wytwarzania pigmentu postępującą wraz z wiekiem zwierzęcia. Należą do nich allele dominujące z loci W.umaszczenie białe). determinujące wybrane rodzaje umaszczenia koni. Natomiast układ homozygotyczny w locus RN (RNRN) jest uważany za letalny. Wszystkie rodzaje umaszczenia. Genotypy w 7 loci.LWFS (ang. na skutek braku części jelita. 172 . O i RN. który jest epistatyczny w stosunku do wszystkich alleli z innych loci. zestawiono w tabeli 6-II. Allel W w podwójnej dawce (genotyp homozygoty dominującej) powoduje zamieranie zarodków we wczesnym okresie ciąży. Konie umaszczone biało są heterozygotyczne pod względem genów tego locus (Ww). lethal white foal syndrome). Niektóre spośród wymienionych genów umaszczenia działają plejotropowo. Na przykład obecność allelu D w genotypie osobnika karego powoduje umaszczenie myszate (aaE_CCD_).

wzór koloru i obecność lub brak białych znaków. podczas gdy feomelanina może być syntetyzowana. Następne geny w szeregu alleli z locus Agouti częściowo hamują syntezę eumelaniny. np. ale mogą mieć pigment tan. W locus tym stwierdzono ogółem 16 alleli kontrolujących zmianę syntezy eumelaniny na syntezę feomelaniny. Locus Brown determinuje syntezę czarnego i czekoladowobrązowego (moorit) pigmentu. Niektóre allele z tego locus mają efekt plejotropowy. natomiast recesywny allel. bądź też oba efekty występują łącznie. w których genotypach jest allel Awh. natomiast allel recesywny Ae w układzie homozygotycznym umożliwia pełną syntezę eumelaniny. Najczęściej występujące umaszczenia u owiec są klasyfikowane zgodnie z trzema kryteriami: typ pigmentu. Niektóre z nich warunkują wytwarzanie pigmentu tylko w poszczególnych partiach ciała. Głównym efektem allelu Awh jest całkowite zahamowanie wytwarzania eumelaniny. bądź mieszaniny jasnych i ciemnych włókien wełny. Badania specjalistyczne wykazały.15 jagnięcia w miocie i hamuje aktywność seksualną maciorek islandzkich poza normalnym sezonem rozpłodowym. Allel A wh .Genetyczne podłoże umaszczenia u owiec U owiec stwierdzono trzy typy pigmentu: czarna eumelanina. Konsekwencją tego może być umaszczenie brązowoczerwone (tan) owiec. że umaszczenie tan jest warunkowane wytwarzaniem pigmentu feomelaniny. Białe umaszczenie owiec ras wełnistych jest wynikiem selekcji prowadzonej przeciwko umaszczeniu brązowoczerwonemu (tan) u owiec nosicieli allelu Awh. inne wpływają na typ włókien. Brw — czekoladowobrązowej eumelaniny. warunkuje wytwarzanie czarnej eumelaniny. 6-III). Bw. który w fenotypie ujawnia się ze zmienną intensywnością. od umaszczenia jasnobrązowego do intensywnego czerwonawobrązowego. Umaszczenie owiec jest kontrolowane prawdopodobnie przez geny z 11 loci (tab. będący pierwszym w kolejności dominowania z szeregu alleli z tego locus. natomiast o wiele jaśniejsze umaszczenie brązowoczerwone (tan) występuje u owiec islandzkich i welsh mountain. Ten typ umaszczenia występuje u owiec rasy french solognot i brązowych (dominujących) karakułów. Przykładem tego jest brązowoczerwony kolor wełny karakułów. Wzory koloru składają się bądź z regularnej mieszaniny jasno i ciemno ubarwionych powierzchni ciała. czekoladowobrązowa (moorit) eumelanina i brązowoczerwona (tan) feomelanina. Owce biało umaszczone są zwykle prawie pozbawione pigmentu. 173 . Allel typu dzikiego. allel Awh zmniejsza płodność owiec o około 0. warunkuje białe umaszczenie owiec. Loews Agonii odpowiada za białe lub brązowe (tan) umaszczenie i wzory umaszczenia.

natomiast homozygoty SSSS są całkowicie białe. z biało umaszczoną głową są zwykle homozygotyczne pod względem genu białych plam (SSSS). AwhAwh. Ew umożliwia normalną ekspresję alleli z locus Agouti. Allel ten jest epistatyczny 174 . U umaszczonych kolorowo owiec kożuchowych białe lub złote końce włosów są warunkowane allelem Gs z locus Sur. łaciate afgańskie) jest kontrolowane przez allel W a z locus White. Umaszczenie czarne dominujące jest kontrolowane przez allel dominujący Edb z locus Extension. a także homozygotyczne białe. Owce ras wełnistych. recesywny. Allel ten inaktywuje działanie alleli z locus Agouti poprzez zahamowanie syntezy feomelaniny. Allel typu dzikiego. ale epistatyczny do dominującej brązowej (tan). Umaszczenie białe dominujące (białe perskie.Na umaszczenie u owiec wpływają także allele z innych loci: Allel recesywny Ca z locus Albino warunkuje w układzie homozygotycznym całkowity albinizm. Allel recesywny Ss z locus Spotting w podwójnej dawce (SSSs) determinuje białe znaki u owiec umaszczonych kolorowo. Allel ten jest recesywny lub hipostatyczny w stosunku do barwy czarnej dominującej. U owiec heterozygotycznych pod względem allelu A1"1' allel Ss redukuje pigment tan (brązowy).

zamiast 25% oczekiwanych zgodnie z klasycznym stosunkiem mendlowskiej segregacji genów. że jego penetracja wynosi 80%. ten sam genotyp u różnych osobników może spowodować różne nasilenie cechy w fenotypie. a nawet. Natomiast jeśli nie wszystkie osobniki. ograniczona do jednej płci (patrz podrozdział: Cechy sprzężone z płcią). Przykładem penetracji niezupełnej u zwierząt gospodarskich może być wada pojawiająca się u nowo wylężonych kurcząt — wrodzone drżenie. Na przykład. kiedy wśród osobników o jednakowych genotypach niektóre wykazują fenotypową obecność cechy. gdy u wszystkich osobników o danym genotypie występuje taki sam fenotyp. Penetracja. mówimy o penetracji niezupełnej. Penetracja może być całkowita lub niezupełna. Oba pojęcia — penetracja genu i ekspresywność genu zostały wprowadzone w 1926 roku przez neuropatologa Oskara Yogta. jeżeli gen dominujący ujawnia swą obecność w fenotypie tylko u 80% osobników. Omówione przykłady współdziałania allelicznego i nieallelicznego świadczą o tym. rozumiana także jako stopień ekspresji (przejawiania się) genu lub wyrazistość.4. Stwierdzono to na podstawie wyników doświadczenia. Natężenie drgań jest bardzo zróżnicowane. iż działanie genów może wywoływać różnorodne efekty. również w połączeniu z allelem dominującej białości allel Wrn wywołuje w większości przypadków efekt śmiertelny. inne zaś jej nie mają. Inny allel z tego locus. współdziałania tych genów między sobą oraz współdziałania ze środowiskiem. Pierwsze z tych zjawisk określane jest jako penetracja genu. wykazują charakterystyczny dla niego fenotyp. mające taki sam genotyp. w którym po 4 latach prowadzenia kojarzeń ptaków heterozygotycznych pod względem genu drżenia uzyskano jedynie 10% kurcząt dotkniętych tą wadą. Penetracja i stopień ekspresji (ekspresywność) genów Fenotyp rozpatrywany jako całokształt cech jest wynikiem działania wszystkich genów danego osobnika. warunkuje dominującą szarość u karakułów. O penetracji całkowitej mówimy wówczas. jest to częstość. Penetracja określonego genu może być różna zależnie od płci. która w formie homozygotycznej jest letalna. w przypadkach krańcowych. to mówimy. Z drugiej strony.w stosunku do wszystkich innych genów umaszczenia. inaczej określana jako przenikliwość. z jaką dominujący lub recesywny gen (w homozygocie) albo układ heterozygotyczny ujawnia się w fenotypie nosiciela. Wrn. Często zdarzają się przypadki. 175 . 6. natomiast drugie jako ekspresywność genu.

Zmienność ekspresywności genu często jest obserwowana w przypadku chorób genetycznych i wad dziedzicznych.Pojęcie stopień ekspresji (ekspresywność. że nie zawsze zmienność fenotypowa jakiegoś genotypu jest wynikiem różnego stopnia przejawiania się genu. możemy mieć wtedy. Wiele genów o małym stopniu penetracji wykazuje jednocześnie słabą ekspresywność. Także allele tego samego genu mogą charakteryzować się podobną ekspresywnością. sole mineralne oraz inne związki krążące we krwi. Nie bez znaczenia jest stan zdrowotny matki. w którym pojawiają się pierwsze objawy. a także położenie zarodka w macicy i nawet obecność innych płodów. jak: wiek. W przypadku chorób genetycznych czy wad dziedzicznych ocenę ekspresywności genu mogą utrudniać takie czynniki. Zmienność stopnia ekspresji jest dość rozpowszechnioną właściwością genów. Zarówno stopień penetracji. iż mamy do czynienia ze zmiennością przejawiania się tego samego genu. czy występowanie fenokopii (patrz podrozdział: Mutacje genowe wywołujące choroby genetyczne). geny charakteryzujące się dużą ekspresywnością wykazują wysoki stopień penetracji. Z kolei. Już na początku naszego stulecia zauważono. Spośród czynników niegenetycznych wpływających na ekspresję genu ważną rolę odgrywają wpływy matczyne na rozwijający się płód (w szczególności należy do nich zaliczyć hormony. 6. Należy jednak pamiętać o tym. Obserwowana zmienność stopnia ekspresji genu może być wywołana działaniem różnych u tych ras genów modyfikujących. które nie są dziedziczne. Dziedziczenie pozajądrowe Wszystkie omawiane dotychczas cechy są uwarunkowane genami zawartymi w DNA jądrowym. ujawniające się w różnym stopniu. docierające przez łożysko do rozwijającego się płodu). jak i fenotypowego przejawiania się genu zależą od współdziałania tego genu z innymi genami oraz od jego współdziałania ze środowiskiem. dziedziczą się różnie. a ich sposób dziedziczenia określany jest ogólnym terminem — dziedziczenie mendlowskie. gdy jest ona obserwowana u osobników spokrewnionych ze sobą. że niektóre cechy nie podporządkowują się temu terminowi. Geny z różnych loci mogą dawać podobne fenotypy. Przykładem wady dziedzicznej 0 różnym stopniu przejawiania się genu jest miejscowy brak nabłonka u bydła rasy ayrshire (łagodna forma) i Jersey (forma bardzo ostra) (patrz rozdział: Mutacje). a także chloroplas176 . stopień przejawiania się) genu oznacza poziom zmienności fenotypowej określonej cechy wśród osobników o tym samym genotypie. Pojęcia penetracja i ekspresywność genu są czasem trudne do rozdzielenia. Pewność. Wykrycie obecności DNA poza jądrem komórkowym — w mitochondriach.5. zależnie od kierunku krzyżowania.

że warunkuje on od 2 do 10% zmienności tych cech. średnią i niską wydajnością mleka. inaczej pozajądrowe lub cytoplazmatyczne. jest przekazywany następnemu pokoleniu wyłącznie przez matki. Jak dotąd. Taki sposób dziedziczenia może być przyczyną powstawania heteroplazmii (równoczesne występowanie zmutowanego i prawidłowego mtDNA u danego osobnika). Powstał nowy termin dziedziczenie pozachromosomowe. O mutacjach zachodzących w obrębie mitochondrialnego DNA i ich skutkach jest mowa w rozdziale: Mutacje. Po zapłodnieniu komórka jajowa może rozpoznawać tak napiętnowane organelle i niszczyć je. -879 ±114 kg mleka.tach roślin wyjaśniło podłoże tego zjawiska.1) rozkładały się nielosowo w grupach wydajności mleka i pochodzeniowych po matce. Przyczyną tego. Natomiast allele charakteryzujące się niską frekwencją (^ 0. W miarę rozwoju zarodka liczba mitochondriów ojcowskich maleje. iż największa frekwencja alleli występujących we wszystkich grupach wynosiła ^ 0.3 do 0.9. w przeciwieństwie do DNA jądrowego. +26 ±99 kg. U zwierząt gospodarskich badania wpływu genów w mitochondrialnym DNA na cechy produkcyjne najczęściej prowadzone są na bydle mlecznym. Analiza polimorfizmu fragmentów restrykcyjnych mitochondrialnego DNA wykazała. której wartość zawiera się w granicach od 0. Plemnik zawiera od 50 do 100 mitochondriów. Ponad 90% energii potrzebnej komórkom sekrecyjnym gruczołu mlecznego jest dostarczane przez ATP (adenozynotrifosforan) wytwarzany w mitochondriach. w świetle wyników najnowszych badań. analizowanego metodą RFLP. U bydła rasy holsztyńskiej stwierdzono dodatnią korelację. W celu oszacowania wpływu loci mitochondrialnego DNA na cechy użytkowości mlecznej porównywano średnie wartości tych cech w rodzinach (po określonej matce) z polimorfizmem alleli mtDNA. u żadnego innego gatunku nie potwierdzono przekazywania potomstwu mtDNA przez ojca. natomiast komórka jajowa ma ich około 100 tysięcy.4. Mitochondrialny DNA. tli . ale częstość ich występowania była minimalna i wynosiła 10-4 częstości matczynego mtDNA. między syntezą ATP w mitochondriach a wartością genetyczną w zakresie produkcji mleka. Badania wpływu genotypu w mtDNA krowy na wydajność mleka i tłuszczu wykazały. Geny mitochondrialne kodują przede wszystkim enzymy niezbędne do przebiegu procesów zachodzących w łańcuchu oddechowym. Wprawdzie w 1991 roku w doświadczeniu na myszach wykryto u potomstwa cząsteczki mtDNA pochodzące od ojca. może być znakowanie (piętnowanie) cząsteczkami białka (zwanego ubikwityną) mitochondriów w dojrzewających plemnikach podczas procesu spermiogenezy. Oszacowany dla tych rodzin efekt matki wynosił odpowiednio: + 991 ±108 kg. co może wskazywać na związek między polimorfizmem mtDNA a wydajnością mleka. W pewnym doświadczeniu spośród 2713 krów z 131 stad wybrano rodziny charakteryzujące się wysoką.

.rodzaj mutacji punktowej opisany w rozdziale: Mutacje) adeniny na guaninę w 169 nukleotydzie regionu D-loop (jest to szczególnie ważny region) mitochondrialnego DNA na zawartość tłuszczu w mleku i wartość energetyczną mleka. Stwierdzono bowiem istotny wpływ zamiany (tranzycji . Można zatem wykorzystywać do tego celu oocyty pochodzące od krów mających szczególnie korzystne allele w mitochondrialnym DNA. wykazały istotną współzależność między polimorfizmem fragmentów restrykcyjnych mtDNA a masą jagniąt przy urodzeniu. Wpływ matczynego mtDNA na cechy użytkowości mlecznej potomstwa może być wykorzystany w doskonaleniu bydła. prowadzone za pomocą technik molekularnych (RFLP). . Organizacja molekularna mtDNA jest omówiona w rozdziale: Mapy genomowe. U owiec badania mitochondrialnego DNA. Potencjalne możliwości stwarzają techniki klonowania oparte głównie na umieszczaniu w enukleowanym (pozbawionym jądra) oocycie jądra komórki somatycznej.Wyniki badań prowadzonych na bydle holsztyńsko-fryzyjskim przez innych badaczy potwiedzają istnienie tej współzależności.

lub S2 w przypadku próby losowej pochodzącej z tej populacji. Wszelkie różnice uzewnętrzniające się (widoczne lub dające się określić bądź zmierzyć) między zwierzętami określamy mianem zmienności fenotypowej. Zmienność ta powstaje w wyniku różnic genetycznych między zwierzętami (zmienność genetyczna) oraz oddziaływania zróżnicowanych warunków środowiskowych (zmienność środowiskowa). Istnieje także zmienność grupowa. wydajność mleczna w kolejnych laktacjach). zwaną także ogólną. występująca między osobnikami należącymi do różnych ras (zmienność rasowa) lub gatunków (zmienność gatunkowa). W przypadku cech. mamy do czynienia ze zmiennością wewnątrzosobniczą. jeśli rozpatrujemy populację zwierząt. tzw. interakcja genotyp-środowisko.1. 179 . Na zmienność fenotypową. Rodzaje zmienności i czynniki ją wywołujące Zmienność jest to różnorodność wartości lub jakości cech obserwowana wśród osobników.Rozdział 7. Zmienność danej cechy może być obserwowana między osobnikami i jest to zmienność osobnicza. może również wpływać zmienność wynikająca z wzajemnego współdziałania genotypów z warunkami środowiskowymi. czyli indywidualna. które ujawniają się periodycznie u tego samego osobnika w kolejnych sezonach (np. Zmienność oznaczamy symbolem S2.

które kontrolują występowanie danej cechy. są przyczyną powstawania różnych genotypów. Jej źródłem są przede wszystkim mutacje i rekombinacje genetyczne oraz w mniejszym stopniu współdziałanie między genami. Głównymi składnikami zmienności genetycznej są: zmienność addytywna. będące wynikiem segregacji chromosomów i crossing over w czasie mejozy oraz losowego łączenia się gamet zróżnicowanych genetycznie. Osobniki fenotypowo identyczne (bezrogie). Mutacje prowadzą do powstawania nowych genów. Zmienność epistatyczna jest składową zmienności genetycznej powodowaną nieallelicznym współdziałaniem genów — epistazą. w którego genotypie funkcjonuje jeden gen dominujący. ale także fenotypu (bezrogie i rogate). Efekt dominacji przejawia się nieaddytywnym zróżnicowaniem wartości między osobnikiem heterozygotycznym. innych układów w obrębie chromosomu lub między chromosomami. która jest powodowana dominacyjnym współdziałaniem genów warunkujących cechę. i osobnikami homozygotycznymi — dominującym i recesywnym.i heterozygotyczne) dadzą potomstwo różniące się nie tylko pod względem genotypu. ale różniące się pod względem założeń genetycznych (homo. Przykładem epistatycznego działania genów jednej pary alleli na geny innej pary jest 180 .Podstawą genetycznego doskonalenia zwierząt jest zmienność genetyczna. odchylenie dominacyjne i odchylenie epistatyczne. Poniższy schemat krzyżowania bydła obrazuje to odchylenie. Ten rodzaj zmienności zostanie omówiony szerzej w podrozdziale: Zmienność cech ilościowych. Zmienność dominacyjna jest to część zmienności genetycznej. Natomiast rekombinacje. Zmienność addytywna spowodowana jest niejednakowym sumującym efektem działania alleli z loci poligenów.

dlatego gen ten ujawnia się mimo ewentualnego modyfikującego działania środowiska czy wpływu na daną cechę innych genów zwanych modyfikatorami. Zmiennością ciągłą charakteryzuje się większość cech ilościowych. Do szacowania tego udziału stosowane są parametry genetyczne. Zmienność skokowa występuje również w przypadku pewnych cech ilościowych. upierzenie biafe). Zmienność skokowa odnosi się przede wszystkim do cech jakościowych. należących do tych ras. Do czynników środowiskowych. liczba prosiąt w miocie. W pracy hodowlanej szczególnie ważna jest znajomość udziału zmienności genetycznej. Nasilenie tych cech wyrażane jest za pomocą liczb rzeczywistych z przedziału 181 . Zagadnienie to jest szerzej omówione w rozdziale: Podstawy genetyki populacji. Z krzyżowania osobników 0 białym upierzeniu.białe upierzenie kur rasy leghorn i whiterock. których wartość wyrażana jest za pomocą liczb naturalnych. Barwa upierzenia u tych ras jest warunkowana dwiema parami alleli: C-c (wystąpienie barwy) oraz I-i (blokada wytwarzania me/aniny. w zmienności fenotypowej danej cechy ilościowej. np. Zmienność środowiskowa wynika z różnorodnych warunków środowiskowych oddziałujących na zwierzęta stale (np. czynniki klimatyczne) lub okresowo (żywienie. uzyskuje się mieszańce biało upierzone. Zmienność cechy może mieć charakter skokowy lub ciągły w zależności od jej genetycznego uwarunkowania. do których należy odziedziczalność. mających istotne znaczenie. Charakterystyka zmienności cechy jakościowej polega na określeniu częstości występowania (frekwencji) genów. sposób utrzymania itp. Wpływ środowiska matki zostanie omówiony w dalszej części tego rozdziału. a zwłaszcza jej składnika — zmienności addytywnej. należy także efekt matki pre-i postnatalny. W pokoleniu F2 wystąpią natomiast osobniki zarówno biało. Szczegółowe informacje dotyczące odziedziczalności i pozostałych parametrów genetycznych oraz ich wykorzystania w doskonaleniu zwierząt znajdują się w podręcznikach z zakresu metod hodowlanych.). genotypów i fenotypów w danej populacji (stadzie). Udział pojedynczego genu w wykształceniu cechy jakościowej jest duży. warunkowanych zwykle jedną parą alleli. jak 1barwnie upierzone.

zmierzyć) u wszystkich osobników stanowiących próbę. którego elementami są poszczególne osobniki. wydajność mleka w kilogramach. procentowa zawartość tłuszczu w mleku itp. Z punktu widzenia statystycznego populacją nazywamy zbiór zwierząt. dane zestawia się w tzw. wysokość w kłębie w centymetrach. 7. 7.2. Jeśli liczba obserwacji jest duża. ważona. szereg rozdzielczy. harmoniczna i geometryczna) oraz przeciętne pozycyjne (wartość środkowa — mediana i wartość modalna — dominanta).charakterystycznego dla danej cechy. W celu określenia zmienności cechy musimy ją oznaczyć (np. w którym na podstawie przyjętych przedziałów klasowych można wyodrębnić poszczególne klasy. według wartości rosnących lub malejących (szereg statystyczny uporządkowany). Miary zmienności Określanie zmienności fenotypowej cechy przeprowadzane jest na wybranej losowo z populacji odpowiednio licznej grupie osobników. Charakterystyka zmienności tych cech przedstawiana jest za pomocą miar zmienności opisanych poniżej. Szczegółową charakterystykę populacji można przeprowadzić po oszacowaniu odpowiednich parametrów statystycznych. Uzyskany w ten sposób nie uporządkowany materiał wymaga zestawienia (uporządkowania) np. a niektóre wartości powtarzają się.2. np. które można podzielić na dwie grupy: 1) miary skupienia 2) miary rozproszenia (dyspersji). Miary skupienia Do miar skupienia należą przeciętne klasyczne (średnia arytmetyczna. ale informuje o poziomie cechy w danej populacji i obliczana jest ze wzoru: . Średnia arytmetyczna nie odzwierciedla zmienności. zwanej próbą.1. Takie uporządkowanie danych liczbowych (obserwacji) ułatwia statystyczną i graficzną analizę zmienności cechy.

W pierwszej minucie uzyskano 4 kg mleka. jaka była średnia szybkość oddawania mleka: 183 . a w trzeciej l kg. do obliczania średniej prędkości. Wzór na jej obliczanie jest następujący: Średnia harmoniczna jest stosowana najczęściej do obliczania średnich wartości otrzymywanych ze wskaźników czasu. gdy danej wartości cechy odpowiada kilka obserwacji (tworzy się wówczas przedziały wartości cechy) lub gdy obliczamy średnią dla populacji na podstawie średnich dla prób. np. Stosując wzór na obliczanie średniej harmonicznej uzyskujemy wynik mówiący. w drugiej 2 kg.Średnia arytmetyczna charakteryzuje się następującymi właściwościami: Przykład (dane z tab. 7-1): Średnią ważoną obliczamy wówczas. Wzór na obliczanie średniej harmonicznej jest następujący: Przykład: Ważono mleko oddawane przez krowę w kolejnych minutach doju.

tzn. odbiega od rozkładu normalnego. W celu uproszczenia obliczeń można się posłużyć formą logarytmiczną: . Jest ona szczególnie przydatna do obliczania średniego tempa przyrostu (lub zmniejszania się) jakiegoś wskaźnika w jednostce czasu. Średnia geometryczna jest pierwiastkiem n stopnia z iloczynu n wartości cechy. gdy rozkład zmienności cechy jest asymetryczny.Średnią geometryczną stosuje się wtedy.

Wariancja jest to średni kwadrat odchyleń obserwacji (xi) od średniej arytmetycznej Biorąc pod uwagę. Wartość środkowa (mediana) jest to wartość cechy. 0.28. 185 . 7. natomiast ich suma = 0.0864. standardowe odchylenie i współczynnik zmienności. w celu uniknięcia błędu zalecane jest dzielenie nie przez N obserwacji. która najczęściej powtarza się w szeregu liczbowym. Miary rozproszenia Podstawowe miary rozproszenia to wariancja.3010. 0. ale przez N—1.6518.Przykład: Określano masę ciała cieląt od urodzenia do 6 miesięcy w odstępach miesięcznych.0697. Wartości zlogarytmowane tego współczynnika wyniosły: 0.2.. że najczęściej średnia arytmetyczna nie jest liczbą całkowitą. Ma ona miano takie jak analizowana cecha. 0. a następnie obliczono wskaźnik wzrostu dla kolejnych miesięcy (wskaźnik wzrostu jest to przyrost masy ciała wyrażony w procentach średniej masy ciała w danym okresie). w celu ułatwienia obliczeń stosuje się wzór roboczy. która dzieli szereg uporządkowany malejąco lub rosnąco na połowę. Chcąc określić tempo wzrostu cieląt w okresie 6 miesięcy należy obliczyć średnią geometryczną: Średni wskaźnik tempa wzrostu cieląt w okresie 6 miesięcy wyniósł 1. Wartość modalna (średnia modalna) jest to wartość cechy. w którym licznik jest sumą kwadratów odchyleń: Jeśli próbę stanowi mała liczba obserwacji.0414.1239. 0. 0. Za mało liczną próbę przyjmuje się poniżej 100 obserwacji.0294. czyli 128%.2. ale podniesione do kwadratu. Wariancja nie może mieć wartości ujemnej.

Charakteryzując zmienność cechy podaje się wartość średniej arytmetycznej i standardowego odchylenia Współczynnik zmienności obliczany jest ze wzoru: gdzie: Współczynnik zmienności wyraża zmienność w procentach. tak więc zmienność badanej cechy we wszystkich grupach musi być zbliżona. wykorzystując dane liczbowe zawarte w tabeli 7-1. Sposób obliczania miar rozproszenia przedstawiono niżej. np. Wariancja: . Dobór zwierząt do grup doświadczalnych powinien być losowy.Standardowe odchylenie jest pierwiastkiem kwadratowym z wariancji. dotyczące masy ciała owiec w wieku 10 miesięcy. dzięki czemu znajduje zastosowanie do porównywania zmienności różnych cech (mierzonych w różnych jednostkach. wydajność mleczna w stadzie krów rasy nizinnej czarno-białej i czerwonej polskiej). wydajność mleczna [kg] i zawartość tłuszczu w mleku [%]) w tej samej populacji. Jego wartość informuje o średnim odchyleniu in plus i in minus od średniej arytmetycznej i jest liczbą mianowaną w jednostkach badanej cechy. Różnica wartości współczynnika zmienności w granicach 5-10% oznacza możliwą do przyjęcia precyzję doświadczenia. a także zmienności tej samej cechy w różnych populacjach (np. Współczynnik zmienności może być również miarą precyzji w doświadczeniu przeprowadzanym na kilku grupach zwierząt.

zwiększające wartość cechy). Założono również. czyli obojętne dla wartości cechy. Zmienność cech ilościowych 7.7. Zagadnienie to obrazuje przykład. Najczęściej występują genotypy warunkujące wartości fenotypowe cechy. warunkujące 7 poziomów nieśności (fenotypów tej cechy). które skupiają się wokół wartości średniej. że efekty alleli pozytywnych z różnych loci poligenów są sobie równe i wreszcie — efekty te sumują się przy kształtowaniu fenotypu. Dziedziczenie cech ilościowych Cechy o znaczeniu gospodarczym w zdecydowanej większości należą do kategorii cech ilościowych. specyficznie ze sobą współdziałają. czyli miało założenia genetyczne warunkujące nieśność 180 jaj rocznie. uzyskujemy przedstawiony niżej obraz graficzny: 187 . uzyskano 64 genotypy. nazywane inaczej genami polimerycznymi. skrzyżowano z kurami o genotypach aabbcc. że każdy poligen ma dwa allele. Kury o genotypach „pozytywnych" AABBCC są zdolne do produkcji 240 jaj rocznie. U potomstwa w pokoleniu F2 nastąpiło rozszczepienie. a drugi neutralne. B i C są identyczne (A = B = C) i każdy z tych genów zwiększa nieśność kur o 20 jaj. natomiast zmniejsza się częstość występowania form skrajnych. natomiast o genotypach zawierających allele neutralne aabbcc — do produkcji 120 jaj rocznie. Koguty o genotypach AABBCC. Poligeny. Genetyczne tło cech ilościowych stwarza możliwość bardzo dużej liczby kombinacji układów alleli kontrolujących daną cechę. Kolejnym założeniem jest to. pomiędzy którymi zachodzi dziedziczenie pośrednie. niosącymi 120 jaj rocznie.1. że nieśność kur warunkowana jest trzema parami alleli z różnych loci. addytywnymi lub kumulatywnymi. AABBCC x aabbcc 240 120 Uzyskane w pokoleniu Fl potomstwo było heterozygotyczne (AaBbCc). Cechy ilościowe warunkowane są wieloma genami z różnych loci (poligeny). Przyjmuje się.3.3. że efekty poszczególnych poligenów sumują się i w ten sposób warunkują nasilenie cechy. W przeciwieństwie do cech jakościowych mechanizm ich dziedziczenia jest złożony i trudny do pełnego wyjaśnienia. w którym hipotetycznie przyjęto. Szeregując w pionie genotypy warunkujące takie same wartości cechy i łącząc linią krzywą genotypy znajdujące się najwyżej. przy czym jeden z nich ma działanie pozytywne (tzn. Liczba poligenów kontrolujących cechy ilościowe jest nieznana. mające założenia genetyczne warunkujące nieśność 240 jaj rocznie. Zakłada się. Ponadto zmienność tych cech zależy również od wpływu czynników środowiskowych. że efekty genów A.

w którym jest średnia wartość cechy. Czynniki te oraz ich wpływ na fenotypową ekspresję cech ilościowych będą omówione nieco później. gdyż zacierają one różnice między fenotypami. iż: • jest to rozkład. 188 . a najmniej skrajne wartości. w którym najwięcej osobników wykazuje wartość cechy zbliżoną do średniej.Po zestawieniu wartości fenotypowych cechy. a oś symetrii przechodzi przez punkt. że graficznym obrazem tej zmienności jest krzywa rozkładu normalnego. • rozkład ten jest symetryczny. zwana krzywą Gaussa. poniżej i powyżej średniej. Znaczenie tych czynników jest istotne. co w przypadku cech ilościowych o zmienności ciągłej powoduje. Rozkład normalny charakteryzuje się tym. determinowanych przez określone genotypy i obliczeniu średniej wartości cechy w pokoleniu F2 uzyskujemy: W podanym przykładzie celowo pominięto wpływ czynników środowiskowych.

95. • w przedziale x±S znajduje się ok. 99. są heterozygotyczne pod względem znacznej liczby loci. Efekt ten wynika bowiem z mleczności samicy i jej zachowania opiekuńczego (tzw.6% wszystkich obserwacji cechy. behawior matczyny). 7. Wielkość efektu matki prę. a więc wówczas gdy prosięta odżywiają się jedynie mlekiem matki. procent tłuszczu w mleku oraz wartość energetyczną mleka. stwierdzono. że wpływ efektu matki jest najistotniejszy dla wzrostu prosiąt do 21 dnia życia. Mogą one maskować oddziaływanie poligenów. a także wielu czynników środowiskowych. Spośród czynników środowiskowych na szczególną uwagę zasługuje efekt matki (ang. Na ten efekt składa się przede wszystkim wpływ: wielkości macicy. W wyniku krzyżowania takich osobników potomstwo może mieć założenia genetyczne warunkujące 189 . Niedawno u bydła mlecznego wykazano istotny wpływ genów mitochondriałnych na wydajność mleka.2% wszystkich obserwacji. rasy. wielkości matki oraz jej stanu fizjologicznego i zdrowotnego. nawet ras o ustalonym genotypie. co wartość średniej arytmetycznej. Mimo iż potomstwo otrzymuje od ojca i od matki taką samą liczbę chromosomów. Efekt prenatalny został wykryty przez wykorzystanie transferu zarodków zwierzęcych i analizę ich rozwoju. Zmienność transgresywna Zwierzęta gospodarskie. Wielkość prenatalnego efektu matki zależy również od założeń genetycznych przekazywanych potomstwu zarówno w jądrowym. Efekt postnatalny występuje przede wszystkim u ssaków i został określony za pomocą eksperymentów krzyżowego podsadzania noworodków innym matkom (np.3. maternal effect).2. omówione w rozdziale: Podstawowe mechanizmy dziedzicze nia cech). 68. na fenotypowe ujawnienie się każdej cechy ilościowej wyraźny wpływ wywierają czynniki środowiskowe. wpływ matki na potomstwo jest większy od wpływu ojcowskiego. • dwa następne źródła wynikają z oddziaływania środowiska matki w okresie życia płodowego (efekt prenatalny) i po urodzeniu (efekt postnatalny). ilości substancji odżywczych dostarczanych płodowi (lub płodom). U trzody chlewnej. z innych ras).4% wszystkich obserwacji. dziedziczenie pozajądrowe. Jak już wspomniano. Wpływ ten wynika z trzech źródeł: • pierwszym jest podłoże genetyczne — dodatkowe założenia dziedzicz ne przekazywane przez matkę poza chromosomami (tzw. na przykład. • w przedziale x±3 S znajduje się ok. • w przedziale x ±2 S znajduje się ok.• mediana i wartość modalna (opisane wcześniej) znajdują się w tym samym punkcie. jak i mitochondrialnym DNA.i postnatalnego zależy od gatunku.

W przypadku niektórych cech zaobserwowano zmienność. Cechy takie charakteryzują się rozkładem normalnym. Jednym z genów mających duży wpływ na różne cechy produkcyjne zwierząt gospodarskich jest gen hormonu wzrostu GH (ang. zwany inaczej genem głównym. bądź wartości wyższe lub niższe niż u rodziców. Jest to wynikiem dziedziczenia. growth hormone).3. gdy u przeciwstawnych homozygot różnice wartości fenotypowej cech wynoszą co najmniej jedno standardowe odchylenie. Zjawisko to nosi nazwę transgresji. W badaniach prowadzonych na simentalerach stwierdzono. genotyp DDEEFF. Zjawisko transgresji jest dość często obserwowane w hodowli zwierząt gospodarskich i jest źródłem zmienności transgresywnej. której graficzny obraz odbiega od krzywej Gaussa i może być dwumodalny lub przesunięty. Identyfikacja tych genów poprzez statystyczną analizę rozkładu zmienności cechy w populacji jest trudna.wartości cechy takie. natomiast heterozygotyczny DdEeFf— 3600 kg mleka. w którym obok poligenów działa gen o dużym efekcie. wykorzystywanej w pracy hodowlanej. Genotyp ddeeff warunkuje wydajność 2400 kg mleka. Geny o dużym efekcie W podanych wyżej przykładach determinacji cech ilościowych zakładano udział kilku lub kilkunastu par alleli z różnych loci o małym efekcie addytywnym (dziedziczenie poligeniczne). jakie obserwowano u rodziców. Efekty genów D. czyli wykazujące większą zmienność cechy. iż zwierzęta homozygotyczne pod względem allelu B hormonu 190 . Wykazano istotny wpływ polimorfizmu w tym locus na wydajność krów ras mlecznych. U bydła locus GH znajduje się w chromosomie l (w regionie 1q23-q25). Od niedawna dla genów o dużym efekcie fenotypowym w zakresie cech produkcyjnych używa się określenia locus cechy ilościowej — QTL (ang. Niektóre geny o dużym efekcie zostały wykryte przypadkowo. Przeważająca część potomstwa będzie się charakteryzować średnią wartością cechy. quantitative trait locus). Pojawią się jednak także inne wartości cechy — wyższe niż u rodziców (np.3. że wydajność mleczna krów jest kontrolowana przez geny z 3 loci — D. Gen o dużym efekcie jest identyfikowany wówczas. 7. W potomstwie rodziców heterozygotycznych pod względem genów kontrolujących produkcję mleka mogą wystąpić różne genotypy (typowe rozszczepienie przy krzyżowaniu heterozygot). Ilustruje je przykład: Załóżmy. DDEEFF — 4800 kg. warunkujące różną wydajność mleczną. równą wartości cechy u rodziców. spłaszczony albo nadmiernie uwypuklony. E i F. E i F są identyczne (D = E = F). a każdy z nich zwiększa produkcję mleka o 400 kg. warunkujący produkcję 4800 kg mleka) lub niższe (ddeeff 2400 kg mleka).

Przypadek takich zmian po raz pierwszy został opisany w 1957 roku przez Ludwigsena. Wpływ polimorfizmu genu hormonu wzrostu na cechy użytkowości mięsnej i tempo wzrostu jest przedmiotem badań prowadzonych także na drobiu. Zwierzęta takie są więc dobrym materiałem do tuczu. U bydła mięsnego gen hormonu wzrostu wpływa na cechy użytkowości mięsnej. 191 . Jednocześnie gen ten ma dodatni wpływ na niektóre cechy związane z użytkowością mięsną. a najnowsze osiągnięcia są omówione w rozdziale 12.5. powodowane transportem. bydła i szczura.wzrostu charakteryzowały się o 382 + 18. Badania cytogenetyczne wykazały. które allele mają związek z użytkowością mięsną. Stwierdzono także. będących nosicielami zmutowanego allelu. a także na poprawę wykorzystania paszy i przyrosty dzienne masy ciała. Dalsze badania zmierzają do ustalenia. Loews GH u świni znajduje się w chromosomie 12pl4 i wykazuje dużą homologię do genu GH u człowieka. z równoczesnym zmniejszeniem otłuszczenia. Wykazano wpływ hormonu wrostu na zwiększenie masy mięśni. iż polimorficzne warianty genu hormonu wzrostu (u kur znanych jest już 16 alleli) są odpowiedzialne za niektóre zaburzenia rozwojowe. Pozostałe ważniejsze geny o dużym efekcie zostaną przedstawione z podziałem na gatunki zwierząt. Gen receptora rianodyny (KYR1). prowadzące do pogorszenia jakości mięsa — odbarwienie i nieprzyjemny zapach. Paramety tych cech są najkorzystniejsze u zwierząt heterozygotycznych. porcine stress syndrome). warunkami termicznymi i niektórymi czynnikami chemicznymi. jak zawartość mięsa w tuszy i powierzchnia oka polędwicy. Badania prowadzone na mieszańcach piedmontese x chianina wskazują na istotną zależność między polimorfizmem tego genu a długością i obwodem klatki piersiowej.5 kg większą wydajnością mleka w porównaniu z osobnikami homozygotycznymi AA. iż jest on zlokalizowany w chromosomie 6 (lokalizacja ta przedstawiona jest w rozdziale: Mapy genomowe). W wyniku działania tego genu zwiększa się podatność świń na stresy (zespół PSS — ang. Hormon wzrostu reguluje rozwój mięśni. Wspólnie z genem czynnika wzrostu insulinopodobnego l (IGF-1) odgrywa on istotną rolę w kształtowaniu tempa wzrostu i składu tuszy. Świnie U trzody chlewnej zidentyfikowano kilka genów o dużym efekcie. jak karłowatość i akromegalia. iż gen hormonu wzrostu oddziałuje na proces starzenia się i reprodukcję oraz na odpowiedź immunologiczną organizmu.3. Dotychczas wykazano. Opisano dotychczas około 20 alleli hormonu wzrostu u tego gatunku. Autosomalny recesywny allel (gorączki złośliwej) genu RYR1 jest najlepiej poznanym genem o dużym efekcie u trzody chlewnej. a IGF-1 wspomaga jego działanie. Następstwem miopatii stresowych są niekorzystne zmiany fizykochemiczne w organizmie.

natomiast w zmutowanym 192 . powodująca zamianę argininy w cysteinę w pozycji 615 łańcucha polipeptydowego. początkowo oznaczono go symbolem Haln. że fenotypowo rozpoznany Haln jest mutacją genu receptora rianodyny (RYR1). W normalnym genie enzym HhaI rozpoznaje sekwencję GCGG i tnie DNA na dwa odcinki. U osobników HalnHaln (homozygoty recesywne) występuje nadmierny transport jonów Ca++ z retikulum endoplazmatycznego do cytoplazmy komórek. W obrębie genu RYR1 stwierdzono 18 mutacji punktowych. Procedurę tego testu przedstawiono na rycinie 7-1. co umożliwiło opracowanie molekularnych testów diagnostycznych. Dlatego obecnie gen hipertermii złośliwej jest oznaczany symbolem RYR1. Badania przeprowadzone przez naukowców kanadyjskich wykazały. Mutacja ta likwiduje miejsce trawienia niektórymi enzymami. Zamplifikowany fragment DNA długości 81 par zasad obejmuje rejon wystąpienia mutacji punktowej C→T.Ponieważ gen gorączki (hipertermii) złośliwej powoduje specyficzną wrażliwość na gaz używany w anestezji — halotan. jednej z podjednostek kanału wapniowego w mięśniach szkieletowych. z których najistotniejsza jest mutacja w 1843 nukleotydzie. W innym. fragment genu receptora rianodyny zawierający mutację trawiony jest enzymem Hhal. W jednym z nich stosowane są dwa enzymy restrykcyjne (HgiAI oraz HinPI). opatentowanym przez badaczy kanadyjskich.

warunkuje cechę kwaśnego mięsa.5-2. Badania molekularne (z zastosowaniem enzymów restrykcyjnych) genu receptora estrogenu. estrogen receptor gene) może mieć istotny wpływ na wielkość miotu. Lochy mające w swym genotypie dwie kopie tego genu dają mioty większe o l do 1.allelu zmiana tej sekwencji powoduje. Gorączka złośliwa występuje także u innych gatunków zwierząt oraz u ludzi. Niektóre chińskie rasy świń charakteryzują się niezwykłą plennością. Gen „kwaśnego mięsa" — gen podjednostki γ kinazy białkowej aktywowanej przez AMP (PRKAG3). 49 pz. wpływającego na wzrost zawartości glikogenu w tkance mięśniowej u świń rasy hampshire pojawiły się w 1986 roku. że enzym nie znajduje miejsca cięcia. że jeden z alleli tego genu. u bydła w 18. Badania prowadzone w USA miały na celu wykrycie genetycznego podłoża tej cechy. by wykorzystać wspomniane już wcześniej zalety genotypu heterozygotycznego. iż zlokalizowany w chromosomie l (1p2. pozwoliły na wykrycie dwóch mutacji punktowych (zamiana A→T w kodonie 1665 i A→G w kodonie 193 . U nosicieli zmutowanego allelu stwierdza się dwukrotnie większą zawartość glikogenu w mięśniach (zwłaszcza w szynce). Pierwsze sugestie co do istnienia genu o dużym efekcie. yorkshire. dla homozygotycznego (nn) .4) locus genu receptora steroidowego hormonu płciowego estrogenu — ESR (ang. występujący w chińskiej plennej rasie meishan.jeden prążek długości 81 pz. Obraz elektroforetycznego rozdziału zamplifikowanego odcinka genu dla osobnika homozygotycznego (NN) wykaże dwa prążki długości 49 pz i 32 pz. Stwierdzono. duroc).. a u koni w 10 chromosomie. wykazuje związek z wielkością miotu i może być uważany za gen główny kontrolujący tę cechę. 32 pz. Gen wpływający na wielkość miotu (ESR). Loews odpowiedzialny za cechę kwaśnego mięsa zlokalizowano w chromosomie 15 na podstawie analizy asocjacji przeprowadzonej dla rodzin referencyjnych z wykorzystaniem markerów genetycznych i oznaczono symbolem RN. natomiast dla heterozygoty trzy prążki: 81 pz. Diagnostyka wrażliwości świń na stres za pomocą testu molekularnego umożliwia eliminowanie z hodowli osobników podatnych. Test molekularny wykrywający mutację genu PRKAG3 został opatentowany. powodująca zamianę argininy na glicynę w łańcuchu polipeptydowym. prowadzone u świń innych ras (niemiecka landrace. W pracy hodowlanej należy prowadzić kojarzenia tak.4 prosięcia żywo urodzonego w porównaniu z lochami nie mającymi tego genu. W genie tym stwierdzono siedem mutacji. ale tylko tranzycja G-»A w kodonie 200. Dalsze badania z zastosowaniem precyzyjnych metod analizy genomu zostały uwieńczone w 2000 roku wykryciem mutacji w genie PRKAG3 (gen trzeciej izoformy podjednostki y kinazy białkowej aktywowanej przez AMP). Wyniki tych badań wskazują. Gen hipertermii u ludzi jest zlokalizowany w chromosomie 19. czego wynikiem jest uzyskanie nie strawionego fragmentu genu.

białka i tłuszczu). Podstawienia zasad w nukleotydach powodują powstanie miejsc cięcia dla enzymu HindIII. zawiera 7 eksonów. Gen β-laktoglobuliny ma długość około 7800 par zasad. wyprowadzanych z udziałem rasy meishan. W następstwie takiej mutacji w pozycji 136 łańcucha polipeptydowego κkazeiny wariantu A znajduje się aminokwas izoleucyna (kodon ATC). gdyż określony wariant tego białka. Polimorfizm tego genu może mieć szczególne znaczenie w pracach zmierzających do utworzenia syntetycznych linii świń. wpływa na wydajność mleka i jego składników. natomiast zniknięcie miejsca trawienia przez enzym Hm/L Dzięki różnicy w składzie nukleotydowym genu możliwe jest określanie genotypu kontrolującego wariant κ-kazeiny w mleku za pomocą testu PCR-RFLP (ryć.1754). ekonomicznie ważne cechy. wykorzystywanych jako dodatkowe kryterium selekcji buhajów. Białko wariantu A różni się od B dwoma aminokwasami. podobnie jak κ-kazeiny. wariant A alaninę (GCT). zlokalizowany w chromosomie 6. podczas gdy w wariancie B — treonina (w DNA kodon ACC). tłuszczu i kazein oraz lepszą przydatnością technologiczną. Mleko krów z genem κ-kazeiny typu B ma większą zawartość białka oraz lepszą przydatność do produkcji serów niż mleko z wariantem κ-kazeiny A. Do genów głównych o szczególnym znaczeniu dla wyników ekonomicznych hodowli bydła należą geny białek mleka: κ-kazeiny i β-laktoglobuliny. Natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy (kodon GAT). utrzymywanych w zakładach unasieniania. Bydło Geny białek mleka. Gen β-laktoglobuliny uważany jest za gen o dużym efekcie. ma długość około 13 tysięcy par zasad i zawiera 5 eksonów. Allele kontrolujące syntezę poszczególnych wariantów tego białka powstały w wyniku mutacji punktowej w genie κ-kazeiny wariantu A. Opracowana została metoda identyfikacji genotypów κ-kazeiny. W najdłuższym eksonie 4 znajduje się większość sekwencji kodujących dojrzałe białko κ-kazeiny. 7-2). przy czym genotypy homozygotyczne mogły być weryfikowane jako statystycznie bardziej lub mniej prawdopodobne. identyfikowanych w mleku córek. jak wzrost i grubość słoniny na grzbiecie. Gen ten nie wykazuje plejotropowego negatywnego działania na inne. Dotychczas genotyp ojca można było określić na podstawie segregacji polimorficznych wariantów κ-kazeiny. Wykazano związek między genami kazein a cechami użytkowości mlecznej (wydajność mleka. Te dwa warianty κ-kazeiny można rozróżnić za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych. Gen κ-kazeiny. Jest to konsekwencja różnic w sekwencji nukleo- 194 . Mleko zawierające β-laktoglobulinę B różni się od mleka z wariantem A większą zawartością suchej masy.

zmniejszona zdolność rozpłodowa — u buhajów mniejsze stężenie hormonów płciowych w osoczu krwi. Gen hipertrofii mięśniowej (MH — ang. l — trawienie enzymem restrykcyjnym Hinfi.AB AA BB Ryć. Wyniki oznaczeń są wykorzystywane jako dodatkowe kryterium selekcyjne w doskonaleniu cech użytkowości mlecznej. muscular hypertrophy). dlatego mutacja ta jest oznaczona jako nt821(del11). 2 — trawienie enzymem restrykcyjnym Hindlll tydowej obu alleli. jak i ich mieszańców. Rozwiązaniem 195 . Obecność zmutowanego allelu w genotypie ma jednak także niekorzystne następstwa. Stosowane są różne warianty molekularnej identyfikacji genotypów β-laktoglobuliny z zastosowaniem metod PCR-RFLP i SSCP. transforming growth factor β). Dlatego cecha ta jest preferowana przez hodowców zarówno w hodowli czystych ras. 7-2. mniejszy obwód i masa jąder. natomiast u krów dłuższa ciąża. b — produkt nie strawiony. a — marker. Zmutowany allel różni się od normalnego delecją 11 nukleotydów między 821 a 831 nukleotydem. Identyfikacja genotypu κ-kazeiny (wariant A i B) metodą PCR-RFLP. należą do nich: opóźnienie okresu dojrzałości płciowej u osobników obu płci. jego lokalizacja jest przedstawiona w rozdziale: Mapy genomowe). Bezpośrednim następstwem ekspresji tego allelu jest zwiększona zawartość chudego mięsa w tuszy oraz jego lepsze właściwości dietetyczne. Hipertrofia mięśniowa występująca u niektórych ras bydła mięsnego (belgijskiego błękitnego i asturiana) determinowana jest zmutowanym allelem genu miostatyny (locus miostatyny zmapowano w chromosomie 2. Gen miostatyny należy do rodziny TGFβ (ang. spowodowane zmniejszoną ilością tłuszczu i tkanki łącznej. Duża masa płodu stwarza wyraźne trudności naturalnego porodu.

Prowadzone są badania w celu jego izolacji. która jest odpowiedzialna za substytucję cysteiny przez tyrozynę. warunkujące zwiększony stopień owulacji. Owce Gen hipertrofii mięśniowej (CLPG). mutacje te są charakterystyczne dla określonych ras bydła mięsnego. począwszy od pozycji 419 nukleotydu. Analiza molekularna DNA przeprowadzona u rodzin referencyjnych z wykorzystaniem 21 markerów genetycznych bydła umożliwiła zmapowanie genu hipertrofii mięśniowej w 18 chromosomie. który pełni nieznaną jeszcze funkcję regulacyjną. Są to: a) insercja 10 nukleotydów powiązana z delecją 7 nukleotydów. U owiec występuje mutacja powodująca hipertrofię mięśniową. że podłoże molekularne tej cechy związane jest z mutacją w niekodującym regionie DNA. Powoduje ono jednak wydłużenie okresu międzywycieleniowego o około 20 dni. Jest to substytucja nukleotydowa A→G w regionie niekodującym żadnego białka. cecha ta ze względów ekonomicznych (koszt cesarskiego cięcia jest równy tylko 1/10 wartości mięsa cielęcia) jest w niektórych krajach utrwalana w hodowli bydła typu mięsnego (ryć. Przypuszcza się. Czwarta mutacja d) polega na tranzycji G →A w nukleotydzie 938. pyge -. gdy dziedziczy on gen CLPG od ojca (piętno gametyczne). c) transwersja G → T w nukleotydzie 676. że locus ten podlega transkrypcji. że istnieją dwa allele — CLPG i clpg. noncoding RNA). czy od matki. natomiast osobniki z genotypem clpg/clpg i CLPG/CLPG mają normalny fenotyp. Gen CLPG pochodzący od matki jest nieaktywny. Gen wysokiej plenności (BMPR-IB) u owiec rasy merynos booroola. 7-3 wkładka kolorowa). takie jak gen Inverdale (FecXI. Przypuszcza się. U owiec wykryto geny główne. w przypadku genotypu heterozygotycznego wystąpienie hipertrofii zależy od tego. Pomimo ujemnych następstw związanych z hipertrofią mięśni. zlokalizowany w chromosomie płci X) 196 . Co ciekawe.pośladki) -. przy czym zwierzęta o genotypie CLPG/clpg cechuje hipertrofia. a jego produkt to niekodujący RNA (ncRNA ang. b) u charolaise (Francja) i d) u gasconne (Francja) i piedmontese (Włochy). które uszkadzają funkcję kodowanego białka. Najnowsze badania struktury molekularnej genu miostatyny w różnych rasach mięsnych wykazały obecność kolejnych czterech mutacji. nazwany callipyge (z greckiego calli — piękne. Ostatnio ustalono. Trzy z nich powodują przedwczesne pojawienie się kodonu „stop" i w efekcie skrócenie łańcucha polipeptydowego miostatyny. Mutacje a) i c) występują u bydła francuskiego maine-anjou. Jak wykazały ostatnie badania.symbol CLPG. b) tranzycja C→T w 610 nukleotydzie. Hipertrofia ujawnia się u potomka wówczas.ograniczającym śmiertelność okołoporodową cieląt jest poród przez cesarskie cięcie. Jest to pojedynczy autosomalny gen. czy gen CLPG pochodzi od ojca. która jest związana ze wzrostem masy mięśni o około 32% i zmniejszeniem zawartości tłuszczu o około 8% oraz lepszym wykorzystaniem paszy.

„Thoka" u owiec islandskich. że mutacja powoduje powstanie sekwencji rozpoznawanej przez ten enzym. 30 pz i 140 pz) dla heterozygotycznego i jeden prążek (140 pz. w niektórych krajach czynione są próby wprowadzenia tego genu do ras miejscowych i wykorzystania go w programach intensyfikacji produkcji żywca jagnięcego. będzie następujący: 2 prążki (110 pz i 30 pz) dla osobników homozygotycznych pod względem allelu zmutowanego. wysoki stopień owulacji u maciorek rasy merynos booroola jest wynikiem wpływu genu FecB na rozwój pęcherzyków Graafa i ciałek żółtych. uwarunkowaną genami o addytywnym efekcie. Jednak najbardziej znany jest gen wysokiej plenności zidentyfikowany na początku lat 80. . Ponieważ obecność nawet jednej jego kopii w genotypie maciorki powoduje znaczny wzrost stopnia owulacji (w konsekwencji zwiększa jej plenność o około l jagnię w miocie). połączone z badaniami polimorfizmu w loci markerowych (markery klasy I i II).u owiec rasy romney. u których zwiększona plenność jest cechą poligeniczną. W przeciwieństwie do owiec ras wysokopiennych (owca romanowska. ubiegłego wieku u owiec rasy merynos booroola w Australii i określony wówczas symbolem FecB (ang. Obraz rozdziału elektroforetycznego zamplifikowanego i strawionego enzymem fragmentu genu BMPR-IB. owca fińska). polegającą na tranzycji adeniny na guaninę. W locus BMPR-IB wykryto mutację w 830 nukleotydzie. Opracowany test molekularny (PCR-RFLP) identyfikacji genotypu w locus BMPR-IB z zastosowaniem restryktazy AvaII wykorzystuje to. gen wysokiej plenności u owiec rasy olkuskiej w Polsce czy u syntetycznej rasy owiec Cambridge. wskazały lokalizację tego genu w chromosomie 6 (6q23-q21). Ponadto maciorki mające ten gen w swym genotypie wydzielają mniej hormonów inhibitorów działających na hormony gonadotropowe. produkt PCR nie strawiony) dla homozygoty typu dzikiego. trzy prążki (110 pz. zawierającego miejsce mutacyjne. Prowadzone przez badaczy nowozelandzkich badania segregacji cechy dużej plenności w rodzinach referencyjnych. odpowiedzialnej za dużą plenność owiec rasy merynos booroola. Dalsze wieloletnie badania z zastosowaniem metod genetyki molekularnej zaowocowały wykryciem w 2001 roku mutacji w genie receptora białka oznaczonego symbolem BMP-IB. której konsekwencją jest zamiana glutaminy na argininę w pozycji 249 łańcucha polipeptydowego. fecundity gene of booroola).

Hodowla jest działalnością genetyczno-populacyjną.H. jest prawo równowagi genetycznej sformułowane w 1908 roku przez angielskiego matematyka G. Hardy'ego i niemieckego lekarza W. tak więc w populacji występuje określona liczba fenotypów. 8. Prawo równowagi genetycznej Struktura genetyczna populacji Populację tworzy określona. Podstawowym prawem genetyki populacji. mogące się rozmnażać i występować na danym obszarze. W rozdziale tym przedstawiono jedynie zagadnienie struktury genetycznej populacji oraz wykorzystanie frekwencji alleli w szacowaniu zmienności genetycznej. Suma wszystkich genów występujących w genotypach zwierząt tworzących populację nazywa się pulą genową. Wiele zjawisk i procesów nie dotyczy jednak pojedynczych osobników. Weinberga. lecz zbiorowości określonej jako populacja. że każdy osobnik ma określony fenotyp. Szczegółowe omówienie wszystkich zagadnień z zakresu genetyki populacji zainteresowani znajdą w innych podręcznikach. w istocie odnoszone były do genotypu czy zwierzęcia jako jednostki. 198 . Ponieważ badacze ci działali niezależnie od siebie. Rozpatrując daną cechę można powiedzieć. prawo to nosi nazwę Hardy' ego-Weinberga. Populację stanowią zwierzęta należące do jednego gatunku. mimo iż dotyczyły nieraz grupy zwierząt.1. opisującym częstość występowania (frekwencję) poszczególnych alleli i genotypów. teoretycznie nieskończona liczba osobników.Rozdział Podstawy genetyki populacji Przedstawione w poprzednich rozdziałach genetyczne uwarunkowania zmienności cech i mechanizmy ich dziedziczenia.

każdy ma dwa allele). a allelu recesywnego symbolem q. Zatem w stadzie tym jest 1000 alleli A i 1000 a. które ten allel mógłby zająć w badanej populacji. to: 199 . Fenotyp osobnika jest bowiem odzwierciedleniem jego genotypu.5 (50%). oznacza stosunek tego fenotypu do całkowitej liczby fenotypów. Frekwencja poszczególnych fenotypów i jednocześnie genotypów jest następująca: Łączna liczba alleli warunkujących omawianą cechę wynosi 2000 (1000 ptaków. 250 ptaków czarnych ma w swych genotypach 500 genów A. inaczej frekwencja danego fenotypu. podobnie frekwencja allelu a = 1000/2000 = 0. Suma frekwencji wszystkich fenotypów równa się l lub 100%. ptaki niebieskie mają 500 genów A i 500 genów a.z których każdy reprezentowany jest przez pewną liczbę osobników. W genotypach 250 ptaków białych jest 500 alleli a. Częstość występowania (frekwencja) allelu A = 1000/2000 = 0. Częstość występowania. Z kolei stosunek liczby osobników o danym genotypie do ogólnej liczby osobników występujących w populacji określamy mianem frekwencji genotypów. Obliczenie frekwencji genów na podstawie fenotypów jest najprostsze w przypadku cech dziedziczących się pośrednio (z niezupełną dominacją). Sposób postępowania obrazuje poniższy przykład. natomiast frekwencja genotypów w pokoleniu następnym zależy od frekwencji genów w gametach pokolenia poprzedniego (rodzicielskiego). W stadzie kur andaluzyjskich (barwa upierzenia dziedzicząca się z niezupełną dominacją) liczącym 1000 ptaków jest 250 ptaków czarnych. Natomiast frekwencja genów jest to udział liczby loci zajętych przez dany allel względem ogólnej liczby loci. 250 białych i 500 o upierzeniu niebieskim (andaluzyjskim). Jeśli frekwencję allelu dominującego oznaczymy symbolem p.5 (50%). Frekwencja genotypów i frekwencja genów są elementami składowymi ogólniejszego pojęcia — struktury genetycznej populacji. Suma frekwencji obu alleli wynosi l (100%). Frekwencja genów w danym pokoleniu zależy od frekwencji poszczególnych genotypów. Oba te elementy są od siebie zależne. Frekwencję wyrażamy w procentach lub w postaci ułamka dziesiętnego.

wówczas struktura genetyczna w pokoleniu potomnym będzie następująca: czyli: Zatem struktura genetyczna populacji w pokoleniu potomnym jest taka sama jak w pokoleniu rodzicielskim. zatem rozkład fenotypów i genotypów w tej populacji wynosi: Suma frekwencji genotypów jest rozwinięciem kwadratu dwumianu (p + q)2 i wynosi l (100%). że: w dużej. 200 . Prawidłowość ta zawarta jest w prawie Hardy 'ego-Weinberga. jeśli nie działają czynniki naruszające równowagę. Prawo to rzadko jest spełnione w odniesieniu do wszystkich loci. bowiem nawet w naturalnych populacjach następuje dobór naturalny i selekcja naturalna. losowo kojarzącej się populacji. które mówi o tym. a osobniki charakteryzują się równą płodnością i żywotnością. frekwencje genów i genotypów nie zmieniają się z pokolenia na pokolenie. a' zdarzają się również migracje i mutacje.Rozpatrywana cecha dziedziczy się z niezupełną dominacją. w której frekwencje genów u obu płci są jednakowe. Jeśli w populacji będą kojarzenia losowe oraz będzie jednakowa frekwencja genów u obu płci. które wpływają na zmianę struktury genetycznej populacji. O czynnikach naruszających równowagę genetyczną będzie mowa nieco dalej.

że zawierają jedynie allele recesywne.(EdEd) lub heterozygotyczne (Ede). jak i genów stwarza pewne trudności. która wynosi Stąd frekwencja genu d czarnego umaszczenia (E = p) wynosi l —0. że w przypadku losowych kojarzeń rozkład genotypów jest następujący: łatwo jest obliczyć frekwencję pozostałych genotypów: W stadzie tym na 910 krów czarno umaszczonych należy oczekiwać 490 osobników o genotypach homozygotycznych dominujących i 420 heterozygot. Znając frekwencję genotypu recesywnego (ee) można obliczyć frekwencję allelu czerwonego umaszczenia e —q. Pozostałe 910 krów ma genotypy homo. Frekwencja genów i genotypów w przypadku dominowania W przypadku cechy dziedziczącej się z dominacją zupełną fenotyp dominujący występuje u osobników będących homozygotą dominującą lub heterozygotą pod względem danego locus. Wiedząc.3. gdyż w ich przypadku wiadomo na pewno. łatwo jest wyliczyć frekwencję allelu recesywnego Z kolei frekwencja allelu dominującego wynosi p = l— q.8. Frekwencja genów i genotypów w przypadku cech uwarunkowanych szeregiem (serią) alleli wielokrotnych W przypadku cech warunkowanych szeregiem alleli wielokrotnych rozkład genotypów w populacji będzie następujący: 201 . a 90 czerwonych.3 = 0.09. Podany sposób obliczania częstości genów i genotypów stosuje się do populacji będących w stanie równowagi genetyczej. że frekwencja homozygot recesywnych wynosi q2. 8. W populacji rozmnażanej losowo źródłem informacji do obliczeń frekwencji genów jest częstość genotypów homozygotycznych recesywnych. W stadzie tym prowadzone są kojarzenia losowe. Frekwencja genotypów recesywnych (osobniki czerwone — ee) wynosi 0. Tok postępowania obrazuje poniższy przykład: W pewnym stadzie bydła na 1000 krów 910 jest czarno umaszczonych.7. Zatem obliczanie frekwencji zarówno tych genotypów. Wiedząc.2.

W populacji tej. W rozmnażającej się losowo populacji złożonej ze 150 królików stwierdzono 135 osobników dziko umaszczonych (pełna barwa). q dla genu dla genu c. 8-1): 202 . genotypy i ich frekwencja są następujące (tab. U królików podstawowe typy umaszczenia warunkowane są szeregiem alleli wielokrotnych Umaszczenie dzikie warunkuje gen C. 13 himalajskich i 2 albinosy.q.przy czym p. r lub inne litery symbolizują częstość występowania genów w szeregu alleli wielokrotnych. w której są kojarzenia losowe. Suma frekwencji wszystkich alleli tworzących szereg wynosi l (100%). Frekwencja poszczególnych fenotypów wynosi zatem: Frekwencję genów oznaczono symbolem p dla genu C. Sposób obliczania frekwencji poszczególnych genów i genotypów zostanie przedstawiony na przykładzie cechy warunkowanej szeregiem złożonym z trzech alleli. fenotypy. himalajskie — i albinotyczne — gen c w układzie homozygotycznym (cc).

znając frekwencję fenotypu (jednocześnie genotypu) królików albinotycznych (cc). Podstawiając dane liczbowe.114. (q + r) równa się: Frekwencję genu c = r można obliczyć. W danym przykładzie r2 = 0.Po dodaniu takich samych genotypów uzyska się rozkład: Z zestawienia tego wynika. Frekwencję genu można obliczyć następująco: W badanej populacji królików frekwencja genów umaszczenia jest więc następująca: 203 .013. stąd r = = 0. że suma częstości fenotypów umaszczenia himalajskiego i albinotycznego wynosi: Zatem suma częstości genów d1 i c wynosi q + r i równa się pierwiastkowi kwadratowemu z sumy częstości występowania fenotypów umaszczenia himalajskiego i albinotycznego.

natomiast a — jego recesywnym allelem. Natomiast u osobników homogametycznych frekwencja poszczególnych genotypów będzie taka jak w przypadku cech autosomalnych.000 8. jak i u mężczyzn. U osobników homogametycznych dodatkowo może wystąpić nosicielstwo genu recesywnego (osobniki heterozygotyczne). Osobniki płci heterogametycznej mogą mieć jedynie dwa rodzaje genotypów pod względem cechy sprzężonej z płcią (cecha występuje lub nie na skutek braku genu. U kobiet (płeć homogametyczna) frekwencja poszczególnych genotypów pod względem tej cechy wynosi: U mężczyzn (płeć heterogametyczna) frekwencja genotypów jest równa frekwencji genów rozróżniania barw lub daltonizmu: 204 . geny warunkujące cechy sprzężone z płcią mogą występować także w formie hemizygotycznej.08. Na tej podstawie można oszacować częstość występowania daltonizmu zarówno u kobiet. który ją warunkuje). U ludzi jedną z najczęściej występujących cech sprzężonych z płcią jest daltonizm. których liczba w genotypach jest jednakowa bez względu na płeć osobnika. lecz przyjmie postać: przy czym A jest genem dominującym. Frekwencja genu d warunkującego daltonizm w populacji ludzkiej wynosi średnio q = 0.4. Rozkład genotypów u osobników płci heterogametycznej nie będzie zatem rozkładem dwumianowym. czyli zgodna z rozkładem dwumianowym.ogółem = 1. Frekwencja genów i genotypów w przypadku cech sprzężonych z płcią W odróżnieniu od cech warunkowanych genami znajdującymi się w chromosomach autosomalnych.

dobór par do kojarzeń i dryf genetyczny.08 Zatem wśród 10000 kobiet daltonizm (dd) wystąpi u 64. o tyle pozostałe czynniki są związane z jego świadomą działalnością. Natomiast mutacja genu warunkującego cechę jakościową. O ile mutacje i dryf genetyczny nie zależą od hodowcy.92 d. Łączna zmiana frekwencji allelu recesywnego w przypadku dwukierunkowej mutacji wyniesie: 205 . pozostałe zaś 8464 nie mają w swych genotypach genu daltonizmu (DD). wpływają na zmianę frekwencji genów i genotypów.= q = 0. W następstwie tych mutacji nie tylko ulega zmianie frekwencja alleli istniejących w danym locus. Mutacje Mutacje genowe zmieniając frekwencję genów naruszają równowagę genetyczną populacji. może przyczynić się do wytworzenia odmiany z frekwencją genów umaszczenia inną niż w populacji. Dobór zmienia jedynie frekwencję genotypów (będzie o tym mowa dalej). z wyjątkiem doboru. W grupie mężczyzn o tej samej liczebności aż 800 mężczyzn będzie daltonistami (d — ). W rozdziale dotyczącym mutacji podano. Jeśli zmutuje allel dominujący. pozostali natomiast (9200) będą normalnie rozróżniać barwy (D — ).5. w której mutacja wystąpiła. Konsekwencją zmiany frekwencji genów jest zmiana frekwencji genotypów. mutacja allelu recesywnego spowoduje zmniejszenie jego frekwencji o vq. ale będą nosicielkami genu daltonizmu (Dd). iż częstość mutacji allelu dominującego w recesywny oznaczamy symbolem u. natomiast częstość mutacji odwrotnej symbolem v. migracje. kontrolujących cechę ilościową. powodująca pojawienie się nowej barwy okrywy włosowej. która może wpłynąć na zmianę struktury genetycznej populacji. mutacja ta może być fenotypowo niezauważalna i nie ma wówczas szans na utrwalenie jej w drodze selekcji. jego frekwencja zmaleje o wartość równą up. umaszczenie zwierząt futerkowych. ale także mogą się pojawić nowe allele.= p = 0. Wszystkie te czynniki. Czynniki naruszające równowagę genetyczną Do czynników naruszających równowagę genetyczną populacji należą: mutacje. selekcja. Ekspresja fenotypowa mutacji. Jeśli zmutuje jeden z genów addytywnych. zależy od genetycznego uwarunkowania danej cechy. np.D. Analogicznie. 8. 1472 kobiety będą rozróżniały barwy.

Migracje Migracje zwierząt polegają na wprowadzaniu nowych osobników do stada lub ich usuwaniu. wielkość zmian frekwencji genów i genotypów jest różna. ee = q2 = 0.14 alleli Ed zmutowało w kierunku allelu e. Może nawet. które polega na kilkakrotnym przekrzyżowaniu pogłowia prymitywnego z rasą szlachetną. Wpływ tego czynnika na strukturę genetyczną populacji zostanie omówiony na przykładzie imigracji (wprowadzania) osobników do populacji. W konsekwencji frekwencja allelu Ed zmieniła się o wartość: czyli wzrosła do 0. po pewnym czasie populacja wróci do równowagi. w przypadku wielokrotnego krzyżowania.49. ile razy dokonywane jest to krzyżowanie. po mutacji: EdEd = p2 = 0. natomiast częstość allelu e zmieniła się o: której częstość była taka sama dla allelu dominującego i recesywnego i wynosiła 0. W hodowli niektórych gatunków zwierząt stosowana jest sztuczna inseminacja. krzyżowanie wypierające).66. ee = q = 0. Zmianie uległa także frekwencja genotypów. Jeśli stosunek nowo wprowadzonych genotypów do całkowitej liczby genotypów w populacji po imigracji (jest to intensywność imigracji) 206 .7. może ona dotyczyć wprowadzania nasienia.1.1156. Ede = 2pq = 0.42. Sztuczna inseminacja może powodować bardzo szybkie rozpowszechnianie genów. Zgodnie z prawem Hardy'ego-Weinberga frekwencja genotypów w tym stadzie była następująca: przed mutacją: EdEd = p2 = 0. powoduje zdecydowaną zmianę frekwencji genów istniejących w populacji wyjściowej. Natomiast krzyżowanie uszlachetniające. czyli ustali się nowy układ genetyczny. i wyniosła 0.Frekwencja allelu dominującego zmieni się o wartość: Na przykład: w pewnym stadzie liczącym 100 krów frekwencja allelu czarnego umaszczenia (locus E) wynosiła Ed = p = 0. Pula alleli w tym locus składała się z 140 alleli czarnego i 60 alleli czerwonego umaszczenia.3. Rozpatrzmy przykład wprowadzenia do populacji (stada) jakiejś grupy zwierząt. W wyniku mutacji genowej. a 6 alleli e w kierunku allelu Ed.4488. allelu czerwonego umaszczenia e = q = 0.09. Jeśli jest to zabieg jednorazowy.34.4356. zatem migracja nie zawsze wiąże się z wprowadzaniem osobników. Ede = 2pq = 0. doprowadzić do całkowitego wyparcia genów rasy prymitywnej przez geny rasy szlachetnej (jest to tzw. Przy krzyżowaniu różnych ras w zależności od tego.

5476.0676 Po imigracji w stadzie wzrosła liczba zwierząt z genotypem homozygotycznym EdEd. E d e = 2pq = 0. z frekwencją allelu Ed wynoszącą 0.26. które hodowca zamierza pozostawić do hodowli.2) • 0. zmalała osobników heterozygotycznyh Ede i homozygotycznych ee. Ede = 2pq = 0.18.9. Frekwencja genotypów w stadzie wynosiła: EdEd = p2 = 0.09 natomiast w grupie zwierząt imigrantów: E d E d = p 2 = 0. Nowa frekwencja allelu e wynosi (1 — 0. ee = q = 0. a eliminuje z populacji zwierząt geny niepożądane. Hodowca preferuje geny korzystne.2 • 0. E'e = 2pq = 0. ee = q= 0. Można to sprawdzić za pomocą wzoru: Frekwencja poszczególnych genotypów w stadzie po imigracji przedstawia się następująco: EdEd = p2 = 0. Nowa frekwencja allelu Ed wynosi teraz: ΔP1 = 0.7 = 0.42.4. Selekcjonując zwierzęta najlepsze hodowca pozostawia w populacji określone genotypy. 207 . wprowadzono 20 krów.oznaczymy literą m. Zmiany te są trwałe i pozostają nawet po zaprzestaniu prowadzenia selekcji.81.3848. w którym frekwencja allelu Ed wynosiła 0.01. to część osobników rodzimych będzie równa (1 —m).74) = 0. jakie geny czy genotypy są preferowane.74 czyli wzrosła o 0. ee = q2 = 0. Z kolei frekwencję genu w stadzie wyjściowym oznaczamy literą p. zatem nowa frekwencja genu będzie równa: a zmiana frekwencji tego genu będzie wynosiła: Załóżmy. nazywany jest selekcją.9 + (l -0. Zmiany w strukturze genetycznej populacji zależą od tego. Wielkość zmiany frekwencji genotypów w przypadku imigracji zależy od intensywności imigracji (m) oraz różnicy we frekwencji genów między zwierzętami w danej populacji i osobnikami wprowadzonymi do niej. Selekcja Wybór zwierząt.49.7. stanu zdrowotnego. a frekwencję genu u osobników wprowadzonych do stada literą p'. obniżenia płodności i produkcyjności lub niepożądanego genotypu. że do omawianego wcześniej stada liczącego 100 krów. Równocześnie z selekcją prowadzone jest brakowanie (usuwanie) zwierząt w związku z ich nieprzydatnością wynikającą z wieku.

co oznacza. Jeśli selekcję przeprowadzimy tylko w jednym pokoleniu i nie będą działały inne czynniki naruszające równowagę genetyczną populacji. Dobór par do kojarzeń W hodowli zwierząt nie zawsze stosowane są kojarzenia losowe. gdy nie ma w ogóle selekcji. W pewnym stadzie. prowadzona jest selekcja przeciwko genotypowi recesywnemu pp. Jeśli celowo dobierane są zwierzęta w pary rodzicielskie. to oznacza. Jeśli współczynnik selekcji będzie wynosić 0. złożonym z 1000 ptaków. że wartość O jest wówczas.187. zmianę częstości genu recesywnego.8. zależy od rodzaju tej selekcji. Cecha ta dziedziczy się z dominacją zupełną. w którym frekwencja allelu bezrożności wynosi 0. gdy usuwane są wszystkie niepożądane genotypy. będąca konsekwencją selekcji. prowadzi to do naruszenia równowagi genetycznej populacji poprzez zmianę frekwencji genotypów. będącą jej konsekwencją.013 i wyniesie 0. Zmiana frekwencji genu. zastosowano kojarzenia w obrębie takich samych 208 .4. Wówczas korzystając ze wzoru możemy obliczyć wielkość zmiany częstości genu recesywnego: Frekwencja allelu recesywnego w stadzie w wyniku selekcji przeciwko genotypowi recesywnemu zmniejszy się o 0. wartość l współczynnik osiąga. że w omawianym już wcześniej stadzie kur andaluzyjskich. czyli osobniki bezrogie mają genotyp homozygoty dominującej lub heterozygotyczny pod względem locus P (polled). Współczynnik ten może przybierać wartość od O do l.Siłę oddziaływania selekcji określa się mianem współczynnika selekcji i oznacza symbolem s. Jeśli selekcja w zakresie cechy dziedziczącej się z dominacją zupełną prowadzona jest przeciwko genotypom recesywnym. wówczas frekwencja genu tworzącego ten genotyp wyniesie: wzoru: Od pewnego czasu w hodowli bydła cecha rogatości jest uważana za niekorzystną. wówczas w pokoleniu potomnym ustali się nowa frekwencja genów oraz genotypów i populacja wróci do równowagi. można obliczyć ze Jeśli natomiast selekcja preferuje genotyp recesywny. Załóżmy. że w każdym pokoleniu będzie usuwanych 40% osobników z genotypem homozygoty recesywnej. Efekt selekcji zostanie zachowany.

W hodowli zwierząt laboratoryjnych kojarzenia w bliskim pokrewieństwie (najczęściej 209 . pod warunkiem że hodowca nie prowadził selekcji i nie wprowadzono do stada nowych zwierząt. Aby się o tym przekonać. na przykład w celu wzmocnienia (utrwalenia danej cechy) w populacji. maleje natomiast częstość genotypów heterozygotycznych. W pokoleniu rodzicielskim frekwencja genotypów była następująca: 0. Niekiedy. gdyby kojarzono między sobą osobniki będące przeciwstawnymi homozygotami.25 aa = l Po zastosowaniu kojarzeń „podobnego z podobnym" frekwencja uległa zmianie Frekwencja genów pozostała nie zmieniona. stosowane są kojarzenia osobników spokrewnionych. Oznacza to.5 Aa + 0. stado powróci do stanu równowagi genetycznej. Odwrotna sytuacja zaistniałaby. można przeprowadzić obliczenia: Jeżeli hodowca znów zastosuje kojarzenia losowe w stadzie i nadal nie będzie prowadzić selekcji. ojca z córką czy matki z synem. Przy kojarzeniach osobników o genotypach identycznych wzrasta frekwencja genotypów homozygotycznych. koguty niebieskie (forma pośrednia cechy) z kurami niebieskimi i koguty białe z kurami białymi. W stadzie tym frekwencja genów jest jednakowa u osobników obu płci i wynosi p = 0. iż kojarzono koguty czarne z kurami czarnymi.genotypów.25 AA + 0.5 (allel A) i q = 0. Kojarzenia takie powodują wzrost częstości występowania homozygot w pokoleniu potomnym. np. Wówczas zwiększyłaby się częstość genotypów heterozygotycznych kosztem homozygotycznych.5 (allel a).

Przy losowej segregacji genów do gamet i losowym łączeniu gamet w zygoty należy oczekiwać. Może jednak się zdarzyć tak. Biorąc pod uwagę. zwłaszcza w małych populacjach. Dla zobrazowania tego zjawiska grupę 20 owiec heterozygotycznych pod względem locus A skrzyżowano z trykiem również heterozygotycznym w tym locus. Rozkład genotypów w pokoleniu potomnym zależy od frekwencji genów u rodziców. iż w potomstwie uzyskamy 5 osobników homozygot dominujących. Im większa jest pula genów w jakiejś populacji. zjawisko tak nazwane przez Wrighta w 1931 roku. którego skutkiem będzie zmniejszenie płodności. która jest wynikiem odchyleń w losowej segregacji genów do gamet i losowego łączenia się gamet. Dryf genetyczny jest zjawiskiem całkowicie niezależnym od woli hodowcy. szczególnie niebezpieczny może być wzrost homozygot recesywnych. Jeżeli zaburzenie kojarzeń losowych będzie się powtarzać. iż allele niekorzystne z reguły są recesywne. żywotności czy ujawnienie się wad dziedzicznych. w których działa on najsilniej. tym silniejsze są zdolności adaptacyjne tej populacji do zmiennych warunków środowisko210 . 10 heterozygot i 5 homozygot recesywnych pod względem rozpatrywanego locus. w których stopień homozygotyczności jest bliski 100%. Jeśli było to jednorazowe zaburzenie. to struktura genetyczna populacji będzie się zmieniać (dryfować) w różnych kierunkach.brat x siostra) prowadzą do wytworzenia tzw. Dryf genetyczny Dryf genetyczny. 8. Dryf przyczynia się do zwiększania się różnic między małymi populacjami w zakresie struktury genetycznej. Niekorzystnym następstwem dryfu jest także wzrost frekwencji genotypów homozygotycznych kosztem heterozygotycznych. Prawidłowość tego rozkładu wynika z prawdopodobieństwa losowego połączenia gamet w następstwie kojarzeń losowych. Wtedy w potomstwie będzie 10 osobników (50%) homozygot dominujących i 10 heterozygot. jednocześnie zmniejsza się zmienność genetyczna w obrębie poszczególnych populacji. Wszelkie odstępstwa od oczekiwanego rozkładu są konsekwencją dryfu genetycznego. że jedynie plemniki zawierające allel dominujący wnikną do komórek jajowych. to w następnym pokoleniu ustali się nowa równowaga genetyczna. Wykorzystanie frekwencji alleli do szacowania zmienności genetycznej wewnątrz i między populacjami Zmienność genetyczna ma ogromne znaczenie dla wszystkich gatunków zwierząt. Szczepy wsobne są wykorzystywane w badaniach biomedycznych. szczepów wsobnych.6. w której frekwencja genu dominującego wyraźnie wzrośnie. polega na zmianie frekwencji genów i genotypów w małych populacjach.

które zachodzą w wyniku pracy hodowlanej. na przykład warunkujących antygeny erytrocytarne. czego wynikiem będzie utrata zdolności adaptacyjnych. różne typy białek surowicy krwi czy enzymy erytrocytarne. należące do markerów genetycznych klasy I. esterazy. amylazy. czyli markery genetyczne klasy II). opisanych w rozdziale: Markery genetyczne. ceruloplazminy czy anhydrazy węglanowej. można także przedstawiać ją w procentach. Średnia heterozygotyczność (H) w danej populacji obliczana jest ze wzoru: 211 . Mogą to być loci kontrolujące syntezę transferyny. Wartość tego parametru zawiera się w granicach od O do l.i mikrosatelitarny. By temu niekorzystnemu zjawisku zapobiec. Parametrem charakteryzującym zmienność genetyczną w populacji jest współczynnik heterozygotyczności. Od pewnego czasu do tego celu wykorzystywane są niekodujące sekwencje DNA (polimorfizm mini. zalecane jest monitorowanie zmian w strukturze genetycznej populacji. Na skutek długotrwałej selekcji. W tym celu szacuje się zmienność genetyczną w populacji na podstawie frekwencji alleli w loci markerowych. zwłaszcza w małych populacjach. może dojść do znacznego ograniczenia puli genów.wych. albuminy.

O markerach genetycznych jest mowa w innym rozdziale. Jednak najczęściej parametr ten służy do określenia przydatności danego markera genetycznego do analizy sprzężeń z innymi loci. Sekwencje mikrosatelitarne charakteryzują się wyjątkowo wysokim stopniem polimorfizmu i dzięki temu są bardziej przydatne niż markery klasy I do szacowania dystansu genetycznego między gatunkami blisko ze sobą spokrewnionymi. najdalszego sąsiedztwa — CLM (ang. należy znać frekwencję wszystkich alleli w danym locus: Dystans genetyczny Zróżnicowanie genetyczne między populacjami można określić porównując częstość występowania określonych genów w tych populacjach i szacując tzw. a także między populacjami w obrębie gatunku. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. tak na podstawie polimorfizmu sekwencji mikrosatelitarnych. najczęściej stosowany jest wzór: Dystans genetyczny może być przedstawiany graficznie w postaci dendrogramów.Parametrem charakteryzującym stopień zmienności (polimorficzności) danego locus jest wskaźnik określany symbolem PIĆ (ang. polymorphic Information content). Do szacowania dystansu genetycznego (Dr). unweighted pair group method). jak i polimorfizmu białek i antygenów erytrocytarnych. które cechuje duża zmienność genetyczna. 212 . dystans genetyczny na podstawie polimorfizmu grup krwi i białek lub sekwencji mikrosatelitarnych. complete linkage method) lub skupienia parami — UPGM (ang. Szacowanie dystansu genetycznego i wybór ras. na przykład: najbliższego sąsiedztwa — SLM (ang. obliczonych różnymi metodami. single linkage method). By obliczyć wartość PIĆ.

37 (ryć. 146 z linii Partnera i 202 z linii Bandosa. Na podstawie frekwencji alleli w 14 loci obliczono dystans genetyczny między liniami męskimi koni czystej krwi arabskiej ze stadnin państwowych.32. 8-1).Sposób szacowania dystansu genetycznego obrazuje poniższy przykład (wg: Niemczewski i wsp. Największy dystans genetyczny stwierdzono między liniami El Paso i Celebesa. Na przykład. 146 z linii Celebesa. 369 z linii Probata. 50:111-120. wartość dystansu genetycznego między liniami Celebesa a Banata wyniosła 0.39 oraz Palasa a Partnera 0. najmniejszy między linią Celebesa a Probata. Prace i Materiały Zootechniczne. a także między linią Banata a Celebesa i Probata. Częstość występowania poszczególnych alleli zawarto w tabelach 8-II i 8-III. 219 z linii Palasa. 213 . Palasa a Partnera. Analizą objęto 141 koni z linii El Paso. 150 z linii Banata. Do sporządzenia dendrogramu dystansu genetycznego wykorzystano obliczenia wykonane metodą najbliższego sąsiedztwa — SLM. Partnera a Banata 0.. 1997).

.

W przypadku polimorfizmu mikrosatelitarnego postępowanie jest podobne do opisanego wyżej. Im mniejsza zmienność genetyczna w danej populacji. tym większa wartość tego współczynnika. określający prawdopodobieństwo. wykorzystując wzór: gdzie: Nab — liczba identycznych prążków w obu próbach DNA (a i b) NaiNh — całkowita liczba prążków odpowiednio w próbie a i próbie b Wartość tego prawdopodobieństwa zawiera się w granicach 0-1. W wyniku analizy polimorfizmu minisatelitarnego (tzw. że prążek występujący w jednej próbie będzie wykryty także w drugiej próbie DNA. opisaną w rozdziale: Metody analizy i modyfikacji genomu. band sharing). opisany w rozdziale: Markery genetyczne) i RAPD uzyskujemy obraz prążków DNA w danej próbie DNA (może to być DNA jednego osobnika bądź zbiorczy DNA dla grupy osobników losowo wybranych z populacji). Porównując wzory prążkowe dwóch prób DNA można obliczyć indeks podobieństwa BS . .Do szacowania zmienności genetycznej i dystansu genetycznego wykorzystuje się również markery genetyczne klasy II (sekwencje mikroi minisatelitarne). odcisk palca DNA. a także metodę RAPD.ang.

Wśród ryb spotyka się również gatunki.Rozdział 9 Determinacja i różnicowanie płci oraz interseksualizm Ewolucja kręgowców doprowadziła do powstania różnych mechanizmów determinujących płeć organizmów. behawioralna determinacji płci. które są hermafrodytami sekwencyjnymi. w tym u wszystkich krokodyli.1. Z kolei u niektórych gatunków ryb zachodzi tzw. a konkretnie od genotypu w loci odpowiedzialnych za kształtowanie cech płciowych. Ten typ determinacji płci obserwuje się u wielu gatunków gadów. mają gonady męskie i żeńskie. Determinacja płci ssaków Ukształtowanie się cech płciowych ssaków obejmuje trzy zasadnicze etapy: 1) powstanie w wyniku zapłodnienia układu chromosomów płci XX lub XY w zygocie — kształtuje się wówczas tzw. a w przypadku ptaków Z oraz W. czyli zmieniają one płeć w ciągu życia. płci gonadowej i 3) uformowanie się wewnętrznych 216 . w jakich rozwijają się zarodki. 2) rozwój niezróżnicowanych gonad zarodka w kierunku jądra lub jajnika — wykształcenie tzw. Płeć może zależeć od warunków środowiska zewnętrznego. a samice heterogametyczne (układ Z W). U ptaków sytuacja jest odwrotna — samce są homogametyczne (układ ZZ). U ptaków i ssaków płeć osobnika zależy od układu chromosomów płci. 9. płeć chromosomowa. a płcią homogametyczną są samice (układ XX). wielu gatunków żółwi i niektórych gatunków jaszczurek. tzn. Zależnie od środowiska społecznego osobnik przyjmuje rolę męską lub żeńską. W przypadku ssaków wyróżnia się chromosomy X oraz Y. Zwierzęta takie są zazwyczaj obojnakami. U ssaków płcią heterogametyczną są samce (układ XY). głównie temperatury. Przy takim mechanizmie determinacji zostaje ona ustalona raz w momencie różnicowania się gonad i nie zmienia się przez całe życie.

Następnie grzebień płciowy oddziela się od pranercza i przekształca się w niezróżnicowaną gonadę. Pojawiają się one w endodermie pęcherzyka żółtkowego. 217 . Pleć fenotypowa obejmuje również zmiany powstające w mózgu. Pierwotne komórki płciowe po zasiedleniu gonad podlegają intensywnym podziałom mitotycznym. 9-1). W rozwijającym się zarodku zawiązki gonad powstają z komórek śródnerczowych i w ich kierunku wędrują pierwotne komórki płciowe. pici fenotypowej (ryć. a następnie ruchem amebowatym migrują między komórkami do grzebienia płciowego przylegającego do pranerczy. które są odpowiedzialne za ukształtowanie się zachowania samczego bądź samiczego.i zewnętrznych cech płciowych — powstanie tzw.

W ukształtowanej gonadzie męskiej ekspresja genu SF1 nadal zachodzi. przełączenie rozwojowe. że różnicowanie się gonad w okresie rozwoju płodowego jest kontrolowane przez co najmniej 15 genów.Dotychczasowe badania wykazały. 218 . Trzecim genem oddziałującym na wzrost niezróżnicowanej gonady jest gen SOX9. którego produkt należy. Gen SRY zbudowany jest z pojedynczego eksonu i koduje informację o peptydzie składającym się z ponad 200 aminokwasów. podobnie jak białko SRY. palce cynkowe. czyli kontrolujące uruchomienie i przebieg transkrypcji innych genów. Produkt tego genu miał odpowiadać za tzw. W rozwijającym się jądrze istotną rolę dla procesu różnicowania płci męskiej odgrywają komórki podporowe (Sertolego) i śródmiąższowe (Leydiga). SOX9. że w istocie tylko niewielki fragment krótkiego ramienia chromosomu Y ma podstawowe znaczenie. high mobility group). że jest tam zlokalizowany gen TDF (ang. w przeciwieństwie do jajnika. a w tym: WT1. Gen WT2 (ang. Ekspresję tego genu stwierdzono również w grzebieniu płciowym rozwijającego się zarodka. Przyjęto. W jądrze płodowym produkt genu SF1 pojawia się w komórkach Sertolego i wpływa on na regulację ekspresji genu hormonu antymullerowskiego. regulującego ekspresję hydroksylaz steroidowych. 9-2). steroidogenic factor 1) koduje białko receptora jądrowego. polegające na wprowadzeniu niezróżnicowanej gonady płodowej na tory rozwoju zmierzające do powstania gonady męskiej. Gen ten podlega ekspresji. SF1. SRY. testis determining factor) — czynnik determinujący jądro. że funkcja tego genu jest tożsama z funkcją genu SRY (ang. Część rdzeniowa szczególnie intensywnie rozwija się w gonadzie różnicującej się w kierunku jądra. ZFX i FOXL2. Fgf9. Od końca lat 50. Białko kodowane przez ten gen składa się z trzech regionów (ryć. Badania cytogenetyczne prowadzone u ludzi dowiodły. także w niezróżnicowanej gonadzie. oprócz kory nadnerczy. do grupy białek określanych skrótem HMG (ang. Gen SF1 (ang. Produktem tego genu jest białko zawierające tzw. którego locus występuje w chromosomie Y. Badania molekularne pokazały. które pełni rolę czynnika transkrypcyjnego. wiadomo było. Wiadomo o nich. gdzie obserwuje się zanik jego ekspresji. sex determining region Y). że pełnią funkcję czynników transkrypcyjnych. a część korowa w jajniku. że zasadniczą rolę w procesie determinacji płci męskiej u ssaków odgrywa chromosom Y. Wilms' tumor l gene) został pierwotnie zidentyfikowany jako onkogen odpowiedzialny za rozwój raka nerki — nowotwór Wilmsa u dzieci. W rosnącej gonadzie wyróżnia się część korową i rdzeniową.

ma strukturę podobną do białek z grupy HMG. który podtrzymuje rozwój przewodów Wolffa. że jego ekspresja jest kontrolowana przez produkt genu WTL Z kolei produkt genu SRY zawiaduje ekspresją genu SOX9. Jego ekspresja zachodzi w grzebieniu płciowym (listwie płciowej). W rozwijającym się jajniku nie zachodzi ekspresja genu MIS oraz genu 219 . Miillerian inhibitor substance). wysepka CpG). Białko AMH wpływa na zatrzymanie rozwoju i zanik przewodów Miillera. które mają zdolność wiązania się z DNA i dlatego uważane są za czynniki transkrypcyjne. a z przewodów Miillera — jajowody i macica. w momencie kiedy rozpoczyna się proces formowania gonady męskiej. Gdy gen SRY jest nieobecny. anti-Mullerian hormone — AMH). Bardzo ciekawe jest również to. W przypadku rozwoju płci męskiej zanikowi podlegają przewody Miillera. Początkowo przypuszczano. Proces ten jest zależny przede wszystkim od ekspresji genu MIS (ang. określanego także jako hormon antymiillerowski (ang. że jego locus występuje w chromosomie X. Bardziej szczegółowe dane wskazują. a drugi rozwija się. niezróżnicowana gonada płodowa rozwija się spontanicznie w jajnik. Z przewodów Wolffa rozwinąć się mogą nasieniowody. Zależnie od przyjętego kierunku rozwoju jeden z tych przewodów zanika. gen palca cynkowego). omówiony wcześniej. Wiadomo. czyli białka wpływające na uruchomienie i przebieg procesu transkrypcji. Na podstawie przedstawionych informacji o sekwencji nukleotydów poprzedzających gen SRY można przypuszczać. Obecnie większą rolę przypisuje się genowi ZFX (tzw. po pojawieniu się produktu genu SRY. składający się z 79 aminokwasów. pełni funkcję czynnika transkrypcyjnego. że ekspresja genu SRY występuje w różnicujących się komórkach Sertolego. Wiedza na temat kontroli genetycznej różnicowania się jajnika jest dużo mniejsza. Ekspresja tego genu zachodzi w komórkach Sertolego. że w części poprzedzającej gen SRY znajduje się sekwencja CpG (tzw. Z testosteronu powstaje dihydrotestosteron. a pod kontrolą genu SOX9 znajdują się geny AMH i Fgf9 (czynnik wzrostu fibroblastów 9). Kaskadowe włączanie tych genów.Region środkowy. oraz autosomalnemu genowi FOXL2 (receptor hormonu stymulującego rozwój pęcherzyków jajnikowych). który pełni zasadniczą rolę w różnicowaniu się zewnętrznych narządów płciowych. a jego produktem jest jądrowy receptor dla hormonów. odpowiada za prawidłowe różnicowanie się gonady męskiej. że proces ten jest w znacznej mierze kontrolowany przez ekspresję genu DAX1. odpowiedzialnego za kontrolę ekspresji genów związanych z różnicowaniem się pierwotnej gonady w kierunku jądra. Ekspresja tego genu jest stwierdzana już w niezróżnicowanej gonadzie. Rozwojowi gonad towarzyszy powstanie zawiązków przewodów wyprowadzających komórki płciowe. również położonemu w chromosomie X. aniżeli w odniesieniu do jądra. Równolegle w komórkach Leydiga następuje ekspresja genu kodującego testosteron. Białko SRY. w której obrębie występuje sekwencja nukleotydów przyłączająca czynnik transkrypcyjny WT1. tak jak białka WT1 i SOX9.

Interesujące są wnioski płynące z obserwacji osobników z układem chromosomów XY.kodującego testosteron. występują także inne geny. Delecje w tym regionie prowadzą do zaburzeń procesu spermatogenezy. Jego nazwa pochodzi od słów angielskich azoospermia factor. takich jak całkowity brak spermatogoniów. Należy również zwrócić uwagę. np. Mutacje tego typu (duplikacja lub delecja) nie mają wpływu na rozwój cech płciowych samic. czy też klonowania. Jeśli w genotypie wystąpi delecja tego locus. U takich osobników następuje rozwój interseksualny wynikający z niepełnego zróżnicowania gonady w kierunku jądra. Szczególnie istotną częścią chromosomu Y jest region AZF. RNA binding motif) biorący prawdopodobnie udział w procesie składania (ang. Procesowi temu towarzyszy równoczesny zanik przewodów Wolffa. w których genotypie występuje duplikacja locus DSS (DAX1). Jeśli w genotypie osobnika męskiego występują dwie kopie locus DSS (DAX1). oznaczających czynnik odpowiedzialny za powstanie azoospermii. Wykrywanie obecności genu SRY oraz alleli genu amelogeniny prowadzone jest na podstawie amplifikacji techniką PCR (patrz rozdział: Metody analizy i modyfikacji genomu) wybranego fragmentu DNA oraz elektroforezy uzyskanych produktów. Zastosowanie znajduje też metoda polegająca na analizowaniu sekwencji molekularnych genu amelogeniny (AMEL). z tym jednak że gen położony w chromosomie Y obarczony jest delecja (jest krótszy o 63 pary nukleotydów) względem genu położonego w chromosomie X. samic biorczyń. czyli brak plemników w ejakulacie. Zakłada się. Poznanie molekularnych podstaw determinacji płci ma w hodowli duże znaczenie praktyczne. gen RBM (ang. to rozwój w kierunku męskim nie jest zakłócony. to wówczas dochodzi do zakłócenia procesu kontroli ekspresji genów przez białko SRY. Do tej pory udało się zidentyfikować tylko kilka genów z tego obszaru chromosomu Y. 220 . jeśli stosuje się nowoczesne biotechniki rozrodu powiązane z przenoszeniem zarodków do tzw. Wczesna ocena płci zarodków pozwala na uzyskiwanie potomstwa o pożądanej płci. lub do zahamowania podziału mejotycznego. macicę i górną część pochwy. Znane są też geny położone w innych częściach chromosomu Y. splicing) mRNA. gen Ube1Y (ang. których ekspresja związana jest z przebiegiem spermatogenezy. Zarodki mogą być pozyskiwane od superowulowanych samic dawczyń lub powstawać podczas zapłodnienia pozaustrojowego (in vitro). W efekcie następuje spontaniczny rozwój przewodów Miillera w jajowody. W regionie tym występują geny. Bardzo przydatną metodą określania płci zarodków jest wykrywanie sekwencji genu SRY w DNA wyizolowanym z komórek zarodka męskiego. który pełni zasadniczą rolę w procesie różnicowania się gonady męskiej. że produkt locus DSS (DAX1) konkuruje z produktem genu SRY w wiązaniu się z promotorami innych genów odpowiedzialnych za kształtowanie się gonady męskiej. że w chromosomie Y poza genem SRY. Gen ten umiejscowiony jest w obu chromosomach płci. np.

że informacja genetyczna zawarta w chromosomie Y jest bogatsza. ze względu na bardzo duże zróżnicownie obserwowanych zmian. Podczas rozwoju ciąży mnogiej może dojść do powstania połączeń naczyniowych (anastomoz) między łożyskami rozwijających się płodów. Rozmiar zaburzeń w ukształtowaniu cech płciowych samicy frymartyna zależy od momentu. kiedy gonadom męskim towarzyszą zaburzenia w przekształcaniu się przewodów Wolffa i Miillera lub w powstawaniu zewnętrznych narządów płciowych. co w konsekwencji prowadzi prawie zawsze do niepłodności. Połączenie krwiobiegów bliźniąt różnopłciowych sprawia. które określa się terminem interseksualizmu lub obojnactwa. Interseksualizm Zaburzenie procesu determinacji i różnicowania płci prowadzi do powstania wrodzonych wad rozwojowych układu rozrodczego. 9. to wydzielany czynnik transkrypcyjny SRY może zakłócić proces kształtowania jajników u osobnika bliźniaczego płci 221 . Precyzyjna diagnoza przypadków interseksualizmu stwarza niejednokrotnie problemy. Z przedstawionych wyżej informacji można wyciągnąć wniosek. kiedy stwierdza się równoczesną obecność gonad męskich i żeńskich lub gdy występują struktury złożone typu jajnikojądro (ovotestis) i 2) pseudohermafrodytyzm męski. W rozwoju embrionalnym różnicowanie się jąder poprzedza okres. niż to wcześniej zakładano. Jeśli do połączeń tętniczo-żylnych łożysk doszło w okresie różnicownia się pierwotnej gonady w kierunku jądra u osobnika męskiego. to wówczas rozwój cech płciowych samicy (frymartyna) jest zaburzony. frymartynizm). który prawdopodobnie jest zaangażowany w ubikwitynację histonów w spermatydach. głównie przeżuwaczy. że związki hormonalne oraz inne czynniki aktywne wytwarzane przez jądra płodowe docierają do organizmu samicy i wpływają na proces różnicowania się żeńskich cech płciowych. w którym powstały połączenia naczyniowe. Zaburzenia tego typu wywoływane są przez mutacje chromosomów płci lub mutacje genów zaangażowanych w proces determinacji i różnicowania płci oraz mogą być skutkiem nieprawidłowego przebiegu ciąży (np. często takie przypadki klasyfikuje się na dwie kategorie: 1) hermafrodytyzm prawdziwy. w którym kształtują się jajniki.ubiąuitin activating enzyme-1).2. Kiedy niemożliwe jest jednoznaczne określenie podłoża obserwowanych zmian. Frymartynizm Frymartynizm jest najczęściej występującą postacią interseksualizmu u zwierząt domowych. Jeśli połączenie łożysk dotyczy płodów różnopłciowych. co może z kolei mieć związek z wymianą histonów na protaminy w chromatynie plemników.

że badania kliniczne samic są niewystarczające. powstający z wydzielanego przez komórki Leydiga testosteronu. Linie te różnią się układem chromosomów płci — w jednej występuje układ XX. które — jak wiadomo — pozbawione są u ssaków jąder komórkowych. dochodzi do zagnieżdżenia się komórek macierzystych szpiku kostnego samicy w szpiku kostnym samca i odwrotnie. niezależnie od stopnia zakłócenia procesu różnicowania cech płciowych. gdy zewnętrzne narządy płciowe są prawidłowo uformowane. obraz nasienia. Postęp genetyki molekularnej umożliwia wykrywanie chimeryzmu leukocytarnego nie tylko za pomocą metod cytogenetycznych. że rozwinie się nawet gonada męska. Wówczas dihydrotestosteron. a drugiej współbłiźniaka. a często u owiec (od 40 do blisko 100% ciąż. a także samców będących bliźniętami frymartynów. proces kształtowania się zewnętrznych narządów płciowych. to wówczas wydzielany przez jądra płodowe hormon antymiillerowski i testosteron spowodują zakłócenia w różnicowaniu się dróg wyprowadzających gamety oraz zewnętrznych narządów płciowych. przy jednoczesnym ich braku np. Ponieważ linie te pochodzą od dwóch różnych genotypów. w mniejszym lub większym zakresie. stwierdza się niepłodność samic frymartynów. a w ślad za tym drogi płciowe będą miały charakter męski. Powstawanie anastomoz jest bardzo często stwierdzane u bydła. Chimeryzm erytrocytarny można stwierdzić przez badanie grup krwi. Możliwe jest również powstanie połączeń. że ciąże mnogie występują bardzo rzadko u bydła (poniżej 2% ciąż).) są często obniżone. Istotną kwestią jest możliwość wykrywania frymartynizmu u samic hodowlanych. szczególnie wówczas. że badany osobnik jest frymartynem. Z tego powodu we krwi frymartynów. dlatego stan taki określany jest jako chimeryzm leukocytarny XX/XY. Ze względu na wspólną cyrkulację krwi u płodów. Bardzo pomocne okazało się badanie cytogenetyczne. że prawie we wszystkich przypadkach. że w przypadku ponad 90% ciąż bliźniaczych rozwijane są anastomozy.żeńskiej w takim stopniu. Trzeba podkreślić. zależnie od rasy). Znacznie rzadziej zdarza się to u owiec (od l do 10%. polegające na ustaleniu zestawu chromosomów płci w leukocytach. Identyfikacja sekwencji typowych dla chromosomu Y (np. zależnie od 222 . w komórkach błony śluzowej. Jednocześnie cechy płciowe męskiego bliźniaka są rozwinięte prawidłowo. wskaźnik niepowtarzalności rui itp. stwierdza się obecność dwóch linii komórkowych — jednej własnej. Buhaje takie mogą być wykorzystywane w rozrodzie. Jeśli anastomozy powstaną w chwili gdy jajnik jest już ukształtowany. ale także molekularnych (np. sekwencje mikrosatelitarne). Chimeryzm dotyczy również erytrocytów. Biorąc jednak pod uwagę. a w drugiej układ XY. sekwencja SRY) w DNA wyizolowanym z komórek krwi samicy. Okazuje się. w okresie gdy przewody Miillera będą już przekształcone w jajowody i macicę. może zakłócić. których łożyska są połączone anastomozami. chociaż parametry określające ich przydatność rozpłodową (np. a także wskazywanie samców pochodzących z ciąż bliźniaczych różnopłciowych. może być wskazówką. Szacuje się.

Z jednej strony mogą to być aneuploidie. U ludzi monosomia chromosomu X odpowiada za powstanie zespołu Turnera. a w nasieniu takich osobników zazwyczaj nie stwierdzano plemników. U nosicielek ruja nie występuje w ogóle lub występuje nieregularnie. XYY lub XXX). Zmiany te prowadzą do trwałej bezpłodności samic z monosomia chromosomu X. Wniosek taki wyciągnięto na podstawie pojawiania się chimeryzmu leukocytarnego XX/XY u zwierząt spokrewnionych.rasy). miały niedorozwinięte jądra. Konsekwencją występowania 223 . merynos booroola). w które są zaangażowane chromosomy płci. niedorozwinięte wewnętrzne narządy płciowe żeńskie oraz jądra. Aneuploidie chromosomów płci prowadzą przede wszystkim do upośledzenia funkcji gonad. Z kolei trisomie XXX oraz XYY zazwyczaj nie prowadzą do bezpłodności oraz nie wywołują zmian fenotypowych. Nieznane jest do tej pory molekularne podłoże powstawania anastomoz. Zwierzęta obarczone tym zespołem chorobowym mają w swoich komórkach układ chromosomów płci XY i prawidłowo rozwinięte zewnętrzne narządy płciowe żeńskie. np. Mutacje chromosomów płci Przyczyną rozwoju interseksualnego często są mutacje związane z chromosomami płci. że skłonność do tworzenia anastomoz może być uwarunkowana genetycznie. Zazwyczaj nie towarzyszą im zaburzenia polegające na równoczesnym rozwoju struktur typowych dla dwóch płci. Z drugiej strony ważną rolę odgrywają mutacje strukturalne. Charakteryzowały się one gorszym tempem wzrostu. Z badań przeprowadzonych na owcach wynika. Przykładem może być zespół niewrażliwości na androgeny (zespół feminizujących jąder). Przyczyną tych zaburzeń jest mutacja zlokalizowanego w chromosomie X genu kodującego receptor dla androgenów. a trisomia XXY jest przyczyną rozwoju zespołu Klinefeltera. Monosomia chromosomu X najczęściej jest diagnozowana u klaczy. wśród których najczęściej obserwuje się przypadki monosomii chromosomu X (zespół chorobowy X0) oraz trisomii chromosomów płci (zespoły chorobowe XXY. co oczywiście prowadziło do bezpłodności.5% (bydło) do kilku procent (niektóre rasy owiec. Gonady są niedorozwinięte i brak w nich rozwijających się pęcherzyków jajnikowych. Kilkanaście takich przypadków opisano u buhajów. w zakresie od 0. Zespół niewrażliwości na androgeny Mutacje genów zaangażowanych w proces determinacji i różnicowania płci są przyczyną wielu przypadków interseksualizmu. Przyczyny powstawania tych mutacji zostały omówione w rozdziale: Mutacje. w konsekwencji częstość frymartynizmu u tych gatunków kształtuje się na zbliżonym poziomie. W grupie trisomii chromosomów płci najwięcej przypadków dotyczy trisomii XXY. które są fenotypowo prawidłowo rozwinięte.

Wewnętrzne narządy płciowe wywodzą się z przewodów Miillera i są prawidłowo wykształcone lub przejawiają oznaki niedorozwoju. ale z powiększoną łechtaczką. a w nielicznych przypadkach opisano obecność niedorozwiniętych jąder lub jajnikojąder. Zazwyczaj stwierdza się obecność niefunkcjonalnych jąder. Zespół odwróconej płci u koni W hodowli koni częstym typem interseksualizmu jest tzw. W zdecydowanej większości przypadków stwierdza się niedorozwinięte gonady żeńskie. a występowanie rogów związane jest wyłącznie z genotypem homozygoty recesywnej pp. z wykorzystaniem techniki PCR. zespół odwróconej płci (ang. który uznawany jest za niezbędny do rozwoju gonady męskiej. Zewnętrzne narządy płciowe takich zwierząt mogą być bardzo zróżnicowane. W genotypie tych zwierząt nie ma genu SRY. tymczasem w procesie różnicowania płci występują zaburzenia dotyczące zarówno zewnętrznych. U koni występują również przypadki odwrócenia płci u osobników z układem chromosomów XX. chociaż zdarzają się zwierzęta z powiększoną łechtaczką. a w ich genotypie nie stwierdza się genu SRY. częściowa lub całkowita delecja). Osobniki takie powinny być samicami. co prowadzi do różnicowania się wewnętrznych i zewnętrznych narządów płciowych w kierunku żeńskim. sex reversal). Najczęściej zespół ten diagnozowany jest u fenotypowych samic. STS). przeniesienie genu SRY podczas nierównoważonego crossing over do chromosomu X lub translokację chromosomową między chromosomem Y i autosomem. w których kanaliki plemnikotwórcze są wyścielone jedynie komórkami Sertolego. że wśród osobników bezrogich często zdarzają się zwierzęta obojnacze. jak i wewnętrznych cech płciowych. Okazało się. które mają układ chromosomów płci XX. Badania molekularne genów położonych w chromosomie Y. które mają układ chromosomów XY. Zewnętrzne narządy płciowe są zazwyczaj prawidłowo rozwinięte. przy jednoczesnym braku kluczowego genu SRY. a wśród nich należy wymienić: mutację w locus SRY (np.nieprawidłowego receptora dla androgenów jest nieodbieranie przez komórki docelowe sygnału związanego z obecnością testosteronu i dihydrotestosteronu. od prawie typowo samczych do samiczych. ZFY. który polega na niezgodności między płcią fenotypową i chromosomową. Przyczyny takiego stanu mogą być różne. ujawniały u samic z zespołem odwróconej płci obecność genów charakterystycznych dla tego chromosomu (AMEL. Interseksualizm bezrogich kóz Ze szczególnym przypadkiem interseksualizmu można się spotkać w hodowli kóz. Taki typ odwrócenia płci spotykany jest również u kóz. świń i psów. Bezrożność kóz uwarunkowana jest przez dominujący allel P. a stopień 224 .

że za występowanie rogów odpowiedzialne są co najmniej dwa loci u tych gatunków. polledness and intersexuality syndrome). których celem była identyfikacja locus odpowiedzialnego za obojnactwo bezrożnych kóz (tzw. Z badań porównawczych wiadomo. Są one trudne do odróżnienia od samców o prawidłowej płci chromosomowej. U obu ras bydła stwierdzono. zlokalizowana w niekodującym fragmencie DNA.nasilenia tych zmian jest bardzo zróżnicowany. Zaburzenia te polegają na braku lub niedorozwoju pochwy. Gonady zazwyczaj mają strukturę jądra. że u bydła występowanie rogów nie wpływa na zakłócenie różnicowania się płci. Czasami stwierdza się zwiększoną odległość między odbytem i sromem lub znaczne powiększenie łechtaczki. Okazało się. Usytuowanie gonad może być pachwinowe lub mogą być położone w worku mosznowym. że odpowiedzialna za to jest delecja 11 700 par zasad. Ciekawe jest. również w zakresie układu loci w chromosomach. ukończono wieloletnie badania. że kariotypy obu gatunków są prawie identyczne. W 2001 r. Wreszcie mogą występować również osobniki. allel r+ za umaszczenie czarne (u bydła belgijskiego błękitnego) lub czerwone (u shorthornów). że locus genu bezrożności bydła został umiejscowiony również w chromosomie l. że jest on położony w chromosomie l — w części dystalnej. Allel R odpowiada za powstanie białego umaszczenia. W przypadku takich osobników stosunkowo łatwo udaje się zdiagnozować interseksualizm. że allel R zakłóca różnicowanie się przewodów Miillera w kierunku żeńskich wewnętrznych narządów płciowych u jałówek. co zakłóca ekspresję dwóch położonych w pobliżu genów: PISRT1 (zaangażowany w determinację płci poprzez oddziaływanie na produkt genu SOX9) oraz FOXL2 (uczestniczy prawdopodobnie w rozwoju jajników w okresie płodowym). a w ich genotypie występuje gen SRY. Jądra takich osobników nie wykazują jednak aktywności spermatogenetycznej. Allele te prezentują typ dziedziczenia pośredniego. Co więcej należy podkreślić. a rzadko jajnikojądra. który jest odpowiedzialny za rozwój interseksualny. tzn. czyli mających układ chromosomów płci XY. jest allel R genu Roan (umaszczenie dereszowate) u bydła. szyjki macicy i macicy. z tym jednak że genotyp Rr+ wykazuje niepełną penetrację. Można z tego wyciągnąć wniosek. które mają zdecydowanie samczy fenotyp. ale w części proksymalnej (w pobliżu centromeru). Choroba białych jałowic Innym przykładem genu o działaniu plejotropowym. natomiast jajniki są rozwinięte prawidłowo. Zewnętrzne cechy płciowe mogą mieć nieomal prawidłowy charakter żeński i wówczas odróżnienie takiego obojnaka od prawidłowej samicy jest praktycznie niemożliwe. około 9% białych zwierząt ma genotyp heterozygotyczny i podobna proporcja heterozygot ma umaszczenie barwne. gen PIS — ang. Zespół tych zmian jest określany jako choroba białych jałowic 225 . W wyniku przeprowadzonych badań nad zmapowaniem locus genu bezrożności ustalono.

W potomstwie jednego knura pojawiło się kilkanaście obojnaków. 9-3 wkładka kolorowa). w którym oprócz czynników genetycznych (allel R) istotną rolę odgrywają również nie rozpoznane jeszcze wpływy środowiskowe. a wśród pozostałych 10% przeważają jałówki umaszczone niebiesko (belgijskie błękitne) lub mroziato (shorthorny).XX. Wśród nich niejednokrotnie zdarzają się przypadki.XX/38. że zdecydowana większość zwierząt obarczonych interseksualizmem ma kariotyp żeński — 38. że produkt tego zmutowanego genu nie hamuje rozwoju cech męskich. Locus tego genu został wcześniej zmapowany w regionie. Dotychczasowe obserwacje dowodzą. Interseksualizm u świń Przypadki interseksualizmu u świń obserwuje się z częstością około 0. gdzie gonady mają strukturę jądra lub jajnikojądra.(ang. że genem roan może być gen kodujący czynnik wzrostu komórek tucznych. W Polsce opisano powtarzające się przypadki takiego właśnie interseksualizmu na fermie tuczu trzody chlewnej. Locus genu Roan umiejscowiono w chromosomie 5 w kariotypie bydła. który koduje polipeptyd wpływający na zahamowanie ekspresji innych genów uczestniczących w różnicowaniu płci męskiej. z tym jednak że łechtaczka była bardzo powiększona. macicy i nasieniowodów oraz zewnętrznych narządów płciowych żeńskich. bowiem ponad 90% chorych jałówek ma umaszczenie białe. że choroba białych jałowic ma złożone podłoże. Badania cytogenetyczne nie dają oczywiście wiążącej odpowiedzi na pytanie o podłoże genetyczne różnych form interseksualizmu. Tło genetyczne tych przypadków jest słabo poznane. pomimo nieobecności genu SRY. Zatem rozwój w kierunku męskim osobników z chromosomami XX byłby spowodowany tym. Zakłada się. Można natomiast przypuszczać. U zwierząt tych stwierdzano obecność jąder. white heifer disease). a zewnętrzne i wewnętrzne narządy płciowe są nieprawidłowo rozwinięte. że produkt genu SRY wstrzymuje ekspresję nieznanego genu autosomałnego. Przypuszcza się. pomimo braku genu SRY w ich genotypie. w którym ostatnio umiejscowiono locus genu Roan. a układ chromosomów XY i zewnętrzne narządy żeńskie są oznakami zespołu niewrażliwości na androgeny. Badania chromosomowe wykazują. Sytuacja taka wskazuje. że powstanie gonady męskiej może nastąpić pomimo braku genu SRY. Rozwój interseksualizmu u świń stwierdzano także u osobników z układem chromosomów XY lub chimeryzmem leukocytarnym 38. a srom tworzył z odbytem wspólny otwór (ryć.3%. w których kariotypie występowały dwa chromosomy X. . że chimeryzm leukocytarny XX/XY wskazuje na frymartynizm.XY.

ale także z posiadania przez organizmy wyższe unikatowego układu genetycznego.delta. połączonych z dwoma łańcuchami lekkimi (ang. Są one elementem odporności swoistej (nabytej. czyli przeciwciała. są grupą złożonych białek obecnych w surowicy krwi i płynach tkankowych wszystkich ssaków. Jest pięć typów łańcuchów ciężkich (gr. której celem jest zwalczenie. reagowania na różne bodźce i umiejętność oceny tych bodźców pod kątem ich oddziaływania na organizm. usunięcie tych obcych białek.Rozdział 10 Genetyczne podstawy odporności i oporności Układ odpornościowy jest pod względem „inteligencji" drugim po układzie nerwowym układem komórkowym organizmu. δ . ich zadaniem jest rozpoznanie i neutralizacja obcych antygenów (np. jakim jest główny układ zgodności tkankowej. podobnie jak układ nerwowy. mimo że ma tylko pięć klas przeciwciał.. adaptatywnej). 10. α . o masie po 25 kDa. Ich wytwarzanie przez limfocyty B jest stymulowane przez kontakt układu odpornościowego organizmu z obcą immunogenetycznie cząsteczką (antygenem). light — L).epsilon.alfa..1.. iż układ może rozróżnić ogromną liczbę antygenów i odpowiedzieć na infekcje. po 50 kDa każdy. ε . zdolność uczenia się. Genetyczne podłoże różnorodności przeciwciał Immunoglobuliny. zapamiętywania. wykryte w 1890 roku przez von Behringa i Shibasaburo Kitasato. γ . heavy — H). Cząsteczka przeciwciała ma masę 150 kDa i składa się z dwóch łańcuchów ciężkich (ang. Ma on.gamma 227 . Zastanawiające jest. Główną rolą tego układu jest rozróżnianie obcych białek (antygenów) i reakcja immunologiczna. bakterii czy wirusów).. Zdolność ta wynika przede wszystkim ze specyficznego sposobu genetycznej kontroli syntezy przeciwciał.

u ludzi wynosi on 70:30. Przeciwciało ma kształt litery Y (ryć. Immunoglobuliny dzieli się na podstawie różnic w budowie łańcuchów ciężkich na 5 klas : IgA. W części zmiennej znajdują się trzy regiony hiperzmienne (ang. hinge region). variable — V) oraz części stałe (ang. między domeną CH1 i CH2. HV2 i HV3. W części stałej łańcucha ciężkiego. utworzonej przez łańcuchy ciężkie. w którym są wiązania dwusiarczkowe łączące oba łańcuchy ciężkie. IgD. natomiast A. G i M od symboli łańcuchów ciężkich. jak i lekkie mają części zmienne (ang.i μ . 10-1). Stosunek przeciwciał.mi) i dwa typy lekkich (κ— kappa i λ. iż informacja genetyczna 228 . IgE. E. Ponieważ regiony te determinują swoistość przeciwciał. hypervariable). region zawiasowy (ang. znajduje się tzw. Badacz ten odkrył. constant — C). Łańcuchy ciężkie połączone są ze sobą wiązaniami dwusiarczkowymi. — lambda). nazywane są także regionami determinującymi dopasowanie (ang. IgG i IgM. których liczba i miejsce zależą od klasy i podklasy immunoglobuliny. do łańcucha λ zależy od gatunku (np. Zarówno łańcuchy ciężkie. Nazewnictwo to pochodzi od: Ig — skrót od angielskiego słowa immunoglobulin. u koni l: 25). a wzdłuż jej ramion znajdują się łańcuchy lekkie. które mają łańcuch lekki typu κ. u myszy l: 20. oznaczone HV1. D. complementarity determining regions CDR). Genetyczne podłoże powstawania przeciwciał zostało wyjaśnione przez Susumu Tonegawa w 1976 roku..

Za to odkrycie Tonegawa otrzymał w 1987 roku Nagrodę Nobla. Geny kodujące łańcuch ciężki znajdują się u człowieka w 14 chromosomie. dla lekkiego — kilka.immunoglobulin zawarta jest w znajdujących się w różnych chromosomach czterech grupach „minigenów". ] i C. Część stała obu rodzajów łańcuchów jest kodowana przez gen C. ich swoistość wynikają z tego. przede wszystkim z: • rearanżacji genów części zmiennych (V) i stałych (C) łańcuchów immunoglobulin • rekombinacji między wieloma genami V • insercji minieksonów • mutacji somatycznych Różnorodność ciężkich łańcuchów immunoglobulinowych wynika z rekombinacji (rearanżacji) genów V. ale ich segmenty. 6 i 16. Jednak rzeczywista liczba powstałych wariantów przeciwciał wynosi 107-108. których kolejność łączenia się jest następująca: gen D z genem J. następnie z genem V. natomiast łańcucha ciężkiego przez trzy geny: V. natomiast dla regionu C > 30 genów u ludzi i > 300 u myszy dla łańcucha lekkiego typu K oraz 6 u ludzi i 4 u myszy dla łańcucha typu A. a łańcuchów lekkich z rekombinacji regionów V. że wpływają na funkcję przeciwciała. zachodzące dzięki aktywności enzymu — rekombinazy. może kilkaset). Różnorodność przeciwciał wynika z wielu przyczyn. typu λ w 22 chromosomie. Proces ten zachodzi w poszczególnych limfocytach B podczas ich dojrzewania. powstały kompleks DJV łączy się z genem kodującym część stałą łańcucha ciężkiego. Przypuszczalnie jest wiele genów kodujących region V. Kompletne funkcjonalne geny kodujące cząsteczki przeciwciał powstają z omówionych wyżej genów. kilkadziesiąt genów D i kilka genów J. Część zmienna łańcucha lekkiego jest determinowana przez dwa geny V (ang. u myszy natomiast odpowiednio w chromosomach 2. diversity) i J. 6 genów funkcjonalnych i 3 pseudogeny regionu J. Teoretycznie jest możliwość powstania do 10n różnych immunoglobulinowych sekwencji domen. variable) i J (ang. D. Dopiero po połączeniu w całość segmenty te tworzą kompletny funkcjonalny gen. J i C. Geny determinujące region C różnią się od pozostałych tym. Proces syntezy przeciwciała następuje po skompletowaniu genów. Ogólnie liczbę genów determinujących poszczególne regiony łańcuchów immunoglobulin można określić jako kilkaset genów V. czyli połączeniu się segmentów po jednym z każdej grupy minigenów. a nie na jego powinowactwo do antygenu. jest głównym źródłem różnorodności przeciwciał. W funkcjonalnym genie łańcucha lekkiego nie ma genu D (ryć. joining). Rekombinacyjne łączenie się genów. które nazwał segmentami. D (ang. 229 . 10-2). Dla łańcucha ciężkiego ich liczba nie jest dokładnie znana (kilkadziesiąt. Istnieją co najmniej 3 rodziny genów (liczące 1-9 genów każda) dla regionu D.. Różnorodność przeciwciał. iż dziedziczone są nie całe geny immunogłobulinowe. natomiast geny łańcucha lekkiego typu κ w 2.

Dodatkowo na różnorodność sekwencji przeciwciał mają wpływ mutacje somatyczne zachodzące w rekombinowanym genie VJ (dla łańcucha lekkiego) i VDJ (dla łańcucha ciężkiego). prowadzi to do zmienności na złączach i utworzenia nowego genu. insercje lub konwersje. V-D i D-J) mogą być wstawiane nukleotydy (od l do 15). bądź też usuwane (do około 20 nukleotydów). Każdy limfocyt B wytwarza tylko jeden rodzaj łańcucha ciężkiego i jeden lekkiego. Ponieważ są to nowo powstałe odcinki DNA. powodujące zmianę pojedynczego aminokwasu.2. przy czym limfocyty T uczestniczą w odpowiedzi typu komórkowego. 10. Pojedyncza nawet zmiana aminokwasu w części zmiennej łańcucha ciężkiego może doprowadzić do całkowitej utraty przez przeciwciało zdolności wiązania antygenu lub też do zwiększenia jego powinowactwa do antygenu. atakując i niszcząc komórki zakażone (Tc — cytotoksyczne limfocyty T). Najczęściej są to mutacje punktowe. Genetyczne podłoże różnorodności receptorów limfocytów J W odpowiedzi immunologicznej organizmu biorą udział dwie populacje limfocytów: limfocyty T i limfocyty B. rzadziej natomiast delecje. Geny kodujące łańcuchy mają zdolność niezwykle szybkiego mutowania w odpowiedzi na pobudzenie limfocytu B poprzez związanie obcego białka (antygenu).Podczas procesu powstawania genu kompletnego do połączeń między genami — segmentami (V-J. natomiast genu VDJ następne 10 razy. tym samym liczba wariantów genu D] może być zwiększona około 10 razy. będące specyficznym receptorem tego limfocytu. które razem stanowią przeciwciało. oraz odpowiedzi typu humoralnego 230 .

Znane są dwa rodzaje receptorów limfocytów T — receptory składające się z łańcuchów α i β oraz receptory składające się z łańcuchów γ i δ. 10. które odpowiadają za syntezę przeciwciał. Części zmienne łańcuchów kodowane są przez geny V i J (łańcuchy a i y) i przez geny V. Główny układ zgodności tkankowej — MHC Główny układ zgodności tkankowej został odkryty w wyniku badań nad genetycznym tłem przyjmowania lub odrzucania przeszczepu u myszy. Proces rearanżacji elementów genów receptorowych. Przełomowe znaczenie dla poznania i wyjaśnienia roli tych antygenów miało wytworzenie przez Georga Snella linii kongenicznych myszy różniących się tylko locus zgodności tkankowej. Podobnie. doprowadziły do wykrycia grup (klas) antygenów oznaczonych I. Reaktywność tych receptorów znajdujących się na limfocytach pomocniczych i cytotoksycznych jest skierowana odpowiednio na antygeny MHC klasy II i klasy I. Na przykład u myszy 100 regionów łańcucha α-V i 50 regionów łańcucha α-J może tworzyć do 5000 różnych genów dla łańcucha α. Gdyby zostały wzięte pod uwagę wszystkie mechanizmy biorące udział w tworzeniu różnorodności struktury receptorów limfocytów T. liczba różnych receptorów wyniosłaby do 1015 receptorów α-β i 1018 γ-δ. II i III. który kontroluje ich syntezę. zachodzi podobnie jak rekombinacja genów przeciwciał. ale teoretycznie losowe kombinacje łańcuchów α i β mogą dać do 2. jeden do czterech elementów zostaje włączonych do genów kodujących pierwotną strukturę białek receptora komórki T. że wszystkie elementy genów są włączone w rearanżacje. Badania polegające na przeszczepach skórnych 231 . przez Petera Gorera poszukiwania innych antygenów grupowych krwi. który następuje podczas dojrzewania komórek T w grasicy. 2 regionów D i 12 genów dla łańcucha β-J. Dwie subpopulacje limfocytów T (Tc i Th) różnią się receptorami błonowymi. Poprzez proces rearanżacji genów. Bodźcem do podjęcia tych badań było odkrycie przez Landsteinera grup krwi systemu ABO i wyjaśnienie zjawiska aglutynacji krwinek czerwonych biorcy pod wpływem surowicy krwi dawcy. Potencjał dla różnorodności receptorów komórek T jest istotnie wyższy niż wynosi liczba komórek T obecnych w organizmie.3. U człowieka geny kodujące łańcuchy receptorów znajdują się w chromosomie 7 (dla łańcuchów β i γ) i 14 (dla łańcuchów α i δ). cytotoksyczne CD8.5 x 106 α-β heterodimerów. Oczywiście jest mało prawdopodobne. Prowadzone w latach 30. około 500 różnych genów kodujących łańcuch β może być utworzonych z 20 genów β-V. D i J (łańcuchy p i §). podobnie jak limfocyty B. Limfocyty pomocnicze mają receptory CD4. odpowiedzialnych za przyjęcie przeszczepu.(Th — pomocnicze limfocyty T).

jak i ilościowej. wykonywanych dla kilkunastu kolejnych pokoleń. pochodzi tylko od matki. ponieważ jest on kontrolowany przez gen mitochondrialny (zjawisko to jest omówione w rozdziale: Podstawowe mechanizmy dziedziczenia cech). Za badania nad MHC Snęli wraz z Francuzem Daussetem i Amerykaninem Benacerrafem otrzymali w 1980 roku Nagrodę Nobla. H-l. Do słabych antygenów transplantacyjnych myszy należą między innymi: H-Y (tylko u samców). major histocompatibility complex — MHC). nazwanych słabymi antygenami zgodności tkankowej (ang. natomiast mogą być rozpoznawane przez limfocyty T w połączeniu z antygenami MHC. U myszy loci słabych antygenów zgodności tkankowej (minor H loci) są najlepiej poznane i wiadomo. maternally transmitted antigen). zwłaszcza transplantacji szpiku kostnego. Antygeny te są istotną barierą podczas transplantacji tkanek. że większość z nich znajduje się w chromosomie 2. słabe antygeny transplantacyjne mogą spowodować odrzucenie przeszczepu. Natomiast inny antygen. Antygen H-Y występuje tylko u samców. Tabela 10-1 Lokalizacja MHC i nazwa u poszczególnych gatunków 232 . a tylko w niewielkim stopniu od innych loci. podobnie jak to występuje przy rozpoznawaniu antygenów wirusowych. nazwany Mta (ang. minor histocompatibility loci). często ich efekt jest niedoceniany.między tymi liniami. H-3. być może dlatego. Tymczasem niektóre z tych antygenów stymulują silniejszą odpowiedź transplantacyjną niż antygeny MHC. gdyż gen kodujący go jest zlokalizowany w chromosomie Y. gdy biorca i dawca są zgodni pod względem haplotypów MHC. Geny słabych antygenów zgodności tkankowej nie są jeszcze dobrze poznane i. H-5 i inne. iż reakcja na ten zabieg zależy przede wszystkim od locus głównego układu zgodności tkankowej (ang. Zatem jest on przekazywany przez ojca męskim potomkom. Różnice między słabymi antygenami zgodności tkankowej a MHC są zarówno natury jakościowej. W dziedziczeniu słabych antygenów zgodności tkankowej obserwuje się pewne charakterystyczne zjawiska. wykazały. Nawet wówczas. W zasadzie antygeny minor H loci nie biorą udziału w reakcji immunologicznej prowadzącej do syntezy przeciwciał.

powodujących podstawienia aminokwasów w cząsteczce MHC (> 20 dla loci klasy II i > 30 dla loci klasy I). regionu K.3. Ponieważ wiele białek MHC zostało zidentyfikowanych metodą serologiczną. w większości innych systemów genetycznych allele różnią się nielicznymi podstawieniami nukleotydów 233 . leukocyte antigens — LA). Główny układ zgodności tkankowej jest ogromnie konserwatywnym regionem DNA. będących glikoproteinami. układ ten cechuje ogromny polimorfizm. Z powodu powiązań tego układu z układem grupowym krwi B. jego struktura i funkcje są podobne u ludzi i wszystkich gatunków zwierząt. W obrębie MHC znajdują się regiony szczególnie często uczestniczące w rekombinacjach genetycznych. nazewnictwo tego układu u poszczególnych gatunków stanowi symbol zawierający w pierwszym członie nazwę gatunku. w populacji istnieje bardzo duża liczba różnych haplotypów. MHC u drobiu nazwano kompleksem B. W wielu przypadkach polimorfizm ten jest wynikiem konwersji genów. a drugim podstawową funkcję — LA (tab. Mechanizm dziedziczenia układu zgodności tkankowej jest taki jak w przypadku jednej pary alleli. II i III. iż: • liczba alleli w większości loci jest bardzo duża (> 50) • allele często różnią się dużą liczbą mutacji punktowych typu zmiany sensu. rzadziej mutacji punktowych. C i A u ludzi). Wykryto natomiast specyficzny region klasy IV. są wysoce polimorficzne. Polimorfizm alleliczny obserwowany w loci MHC charakteryzuje się tym. Zwłaszcza niektóre geny MHC. Ponieważ MHC zawiera wiele genów oraz. crossing over czy rekombinacji wewnątrzgenowych. Umożliwia to prowadzenie badań molekularnych MHC u jednego gatunku z zastosowaniem sond molekularnych uzyskanych z DNA innego gatunku. U drobiu nie stwierdzono regionu klasy III. Struktura i funkcje głównego układu zgodności tkankowej U ludzi i zwierząt MHC jest odcinkiem DNA składającym się ze specyficznych regionów genów kodujących trzy klasy białek — klasę I. jak i na poziomie genów zaliczane są do nadrodziny immunoglobulin. Białka (cząsteczki) MHC tak ze względu na podobieństwo na poziomie struktury białka. a wraz z nim — haploidalny genotyp MHC (haplotyp). należące do klasy I i II (np.Ponieważ główną funkcją genów MHC jest determinowanie antygenów leukocytarnych (ang. 10.1. często są one nazywane antygenami MHC. jak już wspomniano. D i L u myszy i B. Potomek otrzymuje od każdego rodzica po jednym chromosomie z każdej pary chromosomów homologicznych. 10-1). kodujący białka zlokalizowane na krwinkach czerwonych.

Cząsteczki MHC klasy I są obecne na powierzchni wszystkich komórek jądrzastych i warunkują zachowanie się cytotoksycznych limfocytów T. w tym także w interakcji różnych komórek limfoidalnych oraz limfocytów i komórek prezentujących antygen. a także w odrzucaniu przeszczepu. które kodują miejsce wiązania peptydów. Cząsteczki te składają się z dwóch łańcuchów polipeptydowych — lekkiego i ciężkiego (ryć. Domeny αl i α2 odznaczają się polimorfizmem. zjawisko polimorfizmu w innych systemach genetycznych częściej obserwowane jest w re gionach. Łańcuch ciężki jest kodowany przez geny MHC. a więc w tych.• polimorfizm występuje głównie w odcinkach istotnych funkcjonalnie. W domenach tych występują alloantygeniczne miejsca. Jest on kodowany przez geny MHC i ma trzy koliste domeny. Mimo iż początkowo uważano. Łańcuch ciężki składa się z trzech części: • Najdłuższy. każda złożona z około 90 aminokwasów. których znaczenie funkcjonalne jest mniej istotne • polimorfizm w obrębie MHC. oznaczone symbolami αl. który jest podstawą różnic między cząsteczkami MHC klasy I pochodzącymi od różnych osobników. Domena α3 jest ściśle sprzężona z β2-mikroglobuliną. że MHC pełni funkcję tylko w odrzucaniu przeszczepu. że białka kodowane przez ten region biorą udział w mechanizmach rozpoznania immunologicznego. N-końcowy fragment łańcucha ciężkiego. Ma ona wewnątrzłańcuchowe dwusiarczkowe wiązanie i podobną strukturę trzeciorzędową do domeny immunoglobuliny. co zostało już udowodnione. natomiast związany z nim niekowalencyjnie łańcuch lekki p2-mikroglobuliny (białko o masie 12 kDa) jest determinowany przez gen znajdujący się poza układem MHC. wpływa na możliwość immunologicznego rozpoznania obcych białek. 10-3). biorąc tym samym udział w reakcji przeciwko infekcji wirusowej. obecnie wiadomo. 234 . α2 i α3. stanowi około 80% jego długości i znajduje się na zewnątrz komórki.

Domeny α2 i α2 są strukturalnie podobne do domen części stałych łańcuchów ciężkich im-munoglobulin. W rowku tym wiązane są antygeny. oznaczonych symbolami α i β. Cząsteczki te są zbudowane z dwóch niekowalencyjnie połączonych łańcuchów o podobnej budowie.zawierające determinanty specyficzne dla osobników. Cząsteczki MHC klasy II mają zdolność wytwarzania dimerów złożonych z dwóch łańcuchów a i dwóch łańcuchów β. stwierdzane tylko na powierzchni wyspecjalizowanych komórek układu odpornościowego (makrofagi. 235 . składają się z trzech części: zewnątrzkomórkowej N-końcowej. przechodzący przez błonę komórkową. które następnie są prezentowane limfocytom T. regulują immunologiczne rozpoznanie antygenów za pomocą limfocytów B i T. Domeny αl i α2 tworzą rowek osadzony na β2-mikroglobulinie i domenie α3. Łańcuchy te. komórki den-drytyczne i limfocyty B). Polimorfizm cząsteczek MHC klasy II dotyczy przede wszystkim domen αl i βl. Oba łańcuchy mają w części N-końcowej po dwie koliste domeny. Cząsteczki MHC klasy II. kontrolowanych przez geny zlokalizowane w obrębie MHC (ryć. • Trzecią częścią jest liczący około 20-40 aminokwasów fragment hydrofilowy cząsteczki MHC klasy I (C-końcowy). śródbłonowej i wewnątrzkomórkowej. • Druga część łańcucha ciężkiego to zawierający około 20 aminokwasów fragment hydrofobowy. które są między nim a błoną komórkową. Domeny zewnętrzne (αl i βl) obu łańcuchów tworzą rowek podobny do tworzonego przez domeny αl i α2 łańcucha ciężkiego białek MHC klasy I. Fragment węglowodanowy (CHO) jest dołączony do domeny α2. który leży w cytoplazmie komórki. podobnie jak łańcuch ciężki cząsteczki klasy I. 10-4).

klasyczne cząsteczki klasy I. Zadaniem układu dopełniacza jest uzupełnianie (dopełnianie) roli przeciwciał w zakresie unieszkodliwiania antygenu. Badania sekwencji genu Qa-2. Późniejsze badania ujawniły. Białka te są oznaczane literą C (ang.1. które określono symbolem H-2 (ryć. Dotychczas wykryto co najmniej 15 genów klasy la.1. oznaczane symbolem la). jak i klasy II prezentują obcy peptyd (antygen) limfocytom T. od kilkunastu do ponad 20 aminokwasów. W jego skład wchodzą białka surowicy i płynów tkankowych. że także geny w regionach sprzężonych Qa i Tlą kodują cząsteczki MHC. a potem również zwierząt gospodarskich. Geny kodujące białka MHC klasy I znajdują się w regionach H-2K i H-2D (tzw. Natomiast produkty genów kompleksu Tlą i Qa wyka- 236 . a ich wyniki miały ogromne znaczenie dla późniejszych badań MHC człowieka. Natomiast białka MHC klasy II mogą wiązać peptydy różnej długości.3. Pierwotnie w MHC u myszy zidentyfikowano regiony K. Geny klasy I MHC mają po osiem eksonów kodujących funkcjonalne domeny białek MHC klasy I. Geny zlokalizowane w regionach Qa ł Tlą kodują cząsteczki zaliczane także do klasy I. C4 i czynnik B (BF) u ludzi są kontrolowane przez loci MHC klasy III. gdyż ich miejsce wiążące pozostaje otwarte z obu stron. u myszy natomiast przez loci regionu S w obrębie H-2. Jednak cząsteczki klasy I mogą wiązać jedynie krótki.Zarówno białka MHC klasy I. kontrolujących syntezę klasycznych białek MHC klasy I. których jest łącznie z czynnikami regulującymi około 30. 10. S i D. niektóre z nich też biorą udział w odpowiedzi immunologicznej. 10-5).3 wskazują na wysoką homologię (80%) tego genu z genami klasycznych antygenów transplantacyjnych. Cząsteczki MHC klasy III wchodzą w skład układu dopełniacza (komplementu). complement) i liczbą. Białka C2. I. Główny układ zgodności tkankowej myszy Badania głównego układu zgodności tkankowej były prowadzone początkowo u myszy. z tym jednak że określane są one jako cząsteczki nieklasyczne (Ib). złożony z kilku aminokwasów peptyd. ponieważ mają zamknięte miejsce wiążące.

Geny klasy II HLA znajdują się w pięciu podklasach: DQ. DP. -P.3 i Tla zmapowano dotychczas 31 genów. zajmuje łącznie około 4 mpz DNA (4 miliony par zasad). natomiast u myszy z trzech eksonów. w którym znajdują się geny kontrolujące odpowiedź immunologiczną (wytwarzanie przeciwciał przeciwko ponad 40 różnym antygenom). z wyjątkiem H2-P. u człowieka w 15 chromosomie.żują wiele różnic w porównaniu z antygenami transplantacyjnymi. Częstość rekombinacji między skrajnymi końcami tego kompleksu genów wynosi około 1%. immune response).2. -O/N oraz -M. DR. Wzór eksonów i intronów genów klasy II wskazuje na bliską współzależność między tymi genami i podobieństwa struktury z genami klasy I oraz genem β2-mikroglobuliny. czyli ponad 0.1. DOB/DNA i DM. -F i -G należą do nieklasycznych cząsteczek klasy I. Gen ten u ludzi składa się z ośmiu eksonów. Główny układ zgodności tkankowej człowieka • U ludzi MHC (HLA) znajduje się w krótkim ramieniu chromosomu 6. który ma pojedynczy pseudogen oznaczony symbolem H-2Pb. Gen kodujący łańcuch lekki (β2-mikroglobulinę) cząsteczek klasy I.3. natomiast cząsteczki kontrolowane przez loci HLA-E. 10-6).1% całego genomu. Sekwencja aminokwasowa β2-mikroglobuliny wykazuje wysoką homologię z domeną immunoglobulin i odpowiednimi domenami antygenów transplantacyjnych klasy I. Wśród regionów H-2 na szczególną uwagę zasługuje region I (między regionami K i S). w grupie sprzężeniowej z locus dehydrogenazy sorbitolu. przy czym trzy pierwsze . oznaczone symbolem Ir (ang. Klasyczne cząsteczki klasy I kodowane są przez 3 loci — HLA-A. znajduje się poza MHC. Białka klasy III są kontrolowane przez geny regionu S. Białka klasy II są determinowane przez geny zlokalizowane w subregionach H2-A i -E. u myszy w 2. W regionie Qa-2. bardzo istotny dla ekspresji produktów genów klasy I. 10. Każda podklasa ma co najmniej jeden gen łańcucha α i β. Struktura HLA przedstawiona jest na liniowym diagramie (ryć. -B i -C.

in. podczas gdy czwarta podklasa. 314 alleli klasy II i 40 alłeli klasy III. iż komórki nie wykazujące ekspresji tej cząsteczki mają upośledzoną zdolność prezentacji antygenów. mają tylko 2 allele. DOB/DNA. O szczególnej roli proteasomu świadczy określanie go jako „wewnątrzkomórkowego układu immunologicznego". -DRB i -DPB występują w postaci kilkudziesięciu alleli (tab. na przykład DRA. Odkryty niedawno locus DM jest nieco inny niż pozostałe. m. Dwa inne geny LMP2 i LMP7 kodują podjednostki kompleksu białek cytoplazmatycznych nazywanych proteasomami. region klasy II HLA zawiera także geny. przenoszące peptydy (pocięte białka) do siateczki śródpłazmatycznej w celu prezentacji ich przez cząsteczki klasy I MHC. Ta liczba alleli wynika z ogromnego polimorfizmu genów MHC. Jest pewnym paradoksem. białek transkrypcyjnych oraz białek nieprawidłowych. Dotychczas wykryto 267 allełi klasy I HLA.kodują klasyczne cząsteczki klasy II. Podobnie jak u myszy. Ponadto w obrębie HLA wykryto także kilkanaście pseudogenów. Stwierdzono na przykład. bowiem jego sekwencja jest w takim samym stopniu podobna do genów klasy I. białek szoku 238 .in. 10-11). nie podlegających transkrypcji (np. że geny HLA-A. Nieliczne z genów MHC. Cząsteczka MHC kodowana przez ten locus odgrywa szczególną rolę w prezentacji antygenów. Są to geny TAP1 i TAP2 kodujące peptydowe transportery. determinuje syntezę nieklasycznych cząsteczek klasy II. m. jak i do genów klasy II. iż cząsteczka DR jest kodowana przez wysoko polimorficzny gen DRB (determinujący syntezę łańcucha β) oraz dialleliczny gen DRĄ (kontrolujący syntezę łańcucha α). HLA klasy II — DPB2 i DPA2) oraz geny kodujące inne białka. Biorą one udział w proteolizie białek. co potwierdza fakt. które strukturalnie nie należą do genów klasy II. Najbardziej interesujące z immunologicznego punktu widzenia są geny włączone w przetwarzanie własnych białek komórkowych. geny dla 21-hydroksylazy (CYP21). -B.

3. główny układ zgodności tkankowej jest regionem względnie konserwatywnym i istnieje wiele homologii między MHC u ludzi i różnych gatunków zwierząt.3. Główny układ zgodności tkankowej zwierząt gospodarskich Główny układ zgodności tkankowej zwierząt gospodarskich jest mniej poznany. iż homologia między poszczególnymi gatunkami i człowiekiem jest duża. Geny klasy I należą do dwóch grup — A i B. Na przykład homologia genów klasy II u ludzi i myszy jest następująca: myszy: ludzie: Aa Aβ DQα DQβ Eα Eβ DKα DRβ P O/N DP DOB/DNA M DM 10. który koduje krótki fragment transbłonowy łańcucha cząsteczki 239 . Główny układ zgodności tkankowej bydła Główny układ zgodności tkankowej bydła zlokalizowano w 23 chromosomie. Jest to najlepiej poznany chromosom bydła. Struktura BoLA przedstawiona jest na rycinie 10-7. w którym znanych jest także ponad 30 genów strukturalnych i kilkanaście markerów mikrosatelitarnych. Jak wspomniano na początku tego podrozdziału. Liczba poznanych haplotypów BoLA jest już bardzo długa i stale się zwiększa. Produkty genów klasy I są to klasyczne cząsteczki MHC. Wiadomo jednak.1. Nie wykryto dotąd cząsteczek klasy I będących nieklasycznymi cząsteczkami.cieplnego 70 (HSP70) i dwa geny dla czynnika martwicy nowotworu (TNFA i TNFB). Porównanie genów znajdujących się w obrębie MHC u poszczególnych gatunków zwierząt zawarto w tabeli 10-111. różniących się delecją 6 par zasad w eksonie 5.

że jest ich około 7-10. Tylko kilka genów regionu klasy I wykazuje ekspresję. Homologia między genami BoLA i HLA jest stosunkowo duża. różniący się od genów tego locus kodonem „stop" w eksonie kodującym transbłonowy fragment łańcucha cząsteczki MHC.MHC. których homologia wynosi około 80-85%. spośród których przypuszczalnie tylko DR i DQ wykazują ekspresję na poziomie białka. Na przykład gen DRB3 wykazuje 85% homologii z genem HLA — DRB1. par zasad mniejsza niż w MHC u ludzi. natomiast DQA bydła i człowieka — 75% homologii. szacuje się. odległość między nimi wynosi 0. w granicach 75-87%. Są to PD1. DQA. Główny układ zgodności tkankowej świni Główny układ zgodności tkankowej świń został zmapowany w chromosomie 7 ponad ćwierć wieku temu. i bardziej różniące się od nich (podobieństwo około 50%) PD6 i PD15. PD7 i PD14. 26 DQB i 31 DQA. Region klasy II zawiera wiele genów. DQB. Wydaje się. W locus DRB wykryto pseudogen (DRB1).4 cM. że region klasy I SLA jest mniejszy od analogicznego regionu u ludzi i myszy. Podobnie jak u innych gatunków. Natomiast odległość między genami klasy I i III oraz III i II jest co najmniej o 100 tyś. z odpowiadającymi im genami HLA. DRĄ i DRB. W obrębie klasy II obserwowany jest duży polimorfizm genów. Regiony klasy I i II znajdują się blisko siebie. Za pomocą analizy molekularnej (RFLP) zidentyfikowano już 46 haplotypów DRB. Niektóre geny. mają dużą homologię. w SLA 240 . Nie jest znana dokładna liczba genów klasy I SLA.

powodujące. 10-8.6 cM. w którym stwierdzono delecję nukleotydu w kodonie 53. W regionie klasy III. Schemat głównego układu zgodności tkankowej świni (SLA) (wg: Schook i Lamont. 241 . iż nie jest on funkcjonalny. Główny układ zgodności tkankowej owcy Główny układ zgodności tkankowej owiec oznaczony jest skrótem OLA. Jest nim na przykład gen DRB2. W regionie klasy II. zmodyfikowano) znajdują się także pseudogeny. obok genów MHC znajdują się pseudogeny. przy czym geny z locus DQB cechuje większy polimorfizm niż z locus DQA i DRĄ. W regionie tym są także inne geny typowe dla tego układu (ryć. W wyniku mutacji.Ryć. Mapa sprzężeniowa owczego chromosomu 20. Najlepiej poznany jest pseudogen DRB2. ovine aries). 1996. Geny klasy II wykazują duży polimorfizm. ale informacje uzyskane za pomocą analizy sprzężeń wykazują podobieństwa OLA do MHC u ludzi i bydła. ma długość 5. a częstość rekombinacji między nimi wynosi 0. w przeciwieństwie do innych gatunków. w eksonach 3 i 4 znajdują się kodony „stop".6%. podobnie jak u bydła. w którym znajduje się główny układ zgodności tkankowej. C2 i C4. Dotąd nie sporządzono mapy fizycznej tego układu. znajdują się po jednym genie CYP22. ale można również spotkać określenie Ovar (ang. które wykryto w tym pseudogenie. W regionie OLA klasy I zidentyfikowano blisko sprzężone loci: OLA -A i -B. 10-8).

5%. Wyniki badań prowadzonych na dużych populacjach referencyjnych wskazują na możliwość sprzężenia przynajmniej kilku genów klasy III z MHC drobiu. 10-9). Dotychczas stwierdzono ponad 30 haplotypów tego kompleksu. O ile funkcje regionów B-F i B-L są znane. częstość rekombinacji między skrajnymi loci tego układu -. Badania MHC u drobiu koncentrują się na kompleksie B.około 0. U drobiu nie ma regionu klasy III. Region klasy I oznaczony jest symbolem B-F. przypuszcza się natomiast. klasy II — B-L. par zasad. częstość rekombinacji regionu Rfp-Y z regionem B wynosi 100%. o tyle funkcja regionu B-G wciąż nie jest wyjaśniona. Jak już wspomniano przy omawianiu budowy cząsteczki klasy I. Z kolei. Kompleks B znajduje się w 16 mikrochromosomie. że jest on zlokalizowany również w tym chromosomie (ryć. Za typowy MHC uważany jest kompleks B. gen łańcucha lekkiego (β2-mikroglobuliny) znajduje się poza głównym układem 242 .Struktura genetyczna regionu OLA klasy III wykazuje dużą homologię do HLA. Długość tego regionu u owiec wynosi około 150 tyś. Główny układ zgodności tkankowej kury U drobiu geny MHC są zlokalizowane w dwóch kompleksach: B i Rfp-Y. które są klasyfikowane niezależnie. Długość kompleksu B u drobiu wynosi prawdopodobnie 300-400 kpz. Cecha charakterystyczną klasy III OLA jest duplikacja loci dopełniacza C4 i 21-hydroksylazy (CYP21). że kompleks Rfp-Y jest włączony w proces rozpoznania przez komórki NK — naturalnych zabójców. chociaż niedawno zmapowano w obrębie MHC u drobiu gen G9a należący do klasy III HLA. Chromosom 16 jest jedynym chromosomem u drobiu mającym obszar jąderkotwórczy (NOR). a klasy IV — B-G. natomiast w odniesieniu do Rfp-Y większość badaczy uważa.

inwazję kleszczy i pasożytów oraz trypanosomatozę (tab.3. allele specific oligonucleotides — ASO). pozwalających na identyfikację określonej cząsteczki (białka. poprzedzona amplifikacją danego frag mentu DNA (PCR). 10-IV). Rola głównego układu zgodności tkankowej w odporności/podatności na wiele chorób u ludzi jest przedmiotem intensywnie prowadzonych badań. od pewnego czasu. Znane są już powiązania antygenów MHC z zapadalnością na różne choroby. ale ich wyniki świadczą o wpływie MHC na podatność/odporność na niektóre choroby. Na przykład. Natomiast bezpośrednia identyfikacja genów MHC jest możliwa dzięki takim technikom genetyki molekularnej.2.3.zgodności tkankowej. jak: • hybrydyzacja z sondą komplementarną do danego allelu (ang. 10. • metoda RFLP. Udoskonaleniem tej techniki jest test HTC. 2) poprzez analizę molekularną DNA. Związek MHC z odpornością na choroby Najważniejszą funkcją cząsteczek MHC jest udział w odpowiedzi immunologicznej organizmu na infekcje wewnątrzkomórkowe. tuberkulozę. przeciwciała monoklonalne. U drobiu zlokalizowano go metodą FISH (hybrydyzacja fluorescencyjna in situ) w dużym mikrochromosomie (numer 9 lub 10 pod względem wielkości). Do badań serologicznych wykorzystywane są surowice lub. Identyfikacja cząsteczek głównego układu zgodności tkankowej Określanie genotypu osobnika pod względem układu zgodności tkankowej (haplotypu) może być przeprowadzane dwoma podstawowymi sposobami: 1) za pomocą metod serologicznych. Mechanizm ten przedstawiony jest w podrozdziale: Zarys przebiegu reakcji odpornościowej. 243 . Zainteresowani tym zagadnieniem znajdą szczegółowe informacje w podręczniku immunologii.3. Znaczenie głównego układu zgodności tkankowej 10. 10.3.1. dzięki której możliwe jest wykrycie obecności danego allelu MHC. w którym używane są homozygotyczne komórki stymulujące. antygenu) MHC. białaczkę. badania układu zgodności tkankowej u bydła (BoLA) wykazały jego związek z odpornością na mastitis.3. U zwierząt gospodarskich analogiczne badania są znacznie mniej zaawansowane. Cząsteczki MHC klasy II można również identyfikować w mieszanej hodowli limfocytów (MLC).

2*8 — podatność 10. Główny układ zgodności tkankowej u koni (ELA) jest najmniej poznany. mięsaka Rousa i cholerę ptasią. Coraz częściej u zwierząt gospodarskich identyfikowane są haplotypy związane z określoną reakcją na infekcje. oprócz szczególnej roli w reakcji immunologicznej. oddziałuje także na inne cechy (produkcyjne i reprodukcyjne).3. U trzody chlewnej geny klasy I są przypuszczalnie głównymi genami włączonymi w regulację odpowiedzi immunologicznej na inwazję nicieni Trichinella spiralis.2*11 — odporność DQA*12-DQB*12-DRB2*3A-DRB3. U bydła mlecznego stwierdzono istotne oddziaływanie niektórych 244 . Związek MHC z cechami produkcyjnymi i reprodukcyjnymi Główny układ zgodności tkankowej. Podstawowym celem tych badań jest ustalenie antygenów MHC mogących być wskaźnikami selekcyjnymi odporności owiec na pasożyty wewnętrzne. ale stwierdzono już jego związek z odpornością na raka skóry.U owiec najbardziej zaawansowane są badania nad zależnością między podatnością/odpornością na inwazje pasożytnicze a głównym układem zgodności tkankowej.3. kokcydiozę.2. Na przykład. U kur główny układ zgodności tkankowej jest związany z odpornością na chorobę Mareka. haplotypy klasy II bydła uznane za skorelowane z odpornością/podatnością na białaczkę są następujące: DQA*3A-DQB*3A-DRB2*2A-DRB3.

10. bakterie i pasożyty) do organizmu układ immunologiczny reaguje w różny sposób. nie do końca został poznany. bez względu na to. natomiast u bydła ras mięsnych zauważono korelację między przyrostami masy ciała i przekrojem mięśnia najdłuższego grzbietu a obecnością określonych antygenów MHC. W zakażonej komórce białka wirusowe ulegają proteolizie (w cytosolu). Zarys przebiegu reakcji odpornościowej W odpowiedzi na wniknięcie patogenów (wirusy. zwłaszcza w odniesieniu do zakażenia zewnątrzkomórkowego. przy czym stwierdzono różną współzależność danego haplotypu z cechami produkcyjnymi zależnie od rasy. Dotyczyły one wpływu MHC na stopień owulacji. Wykazano wyraźny wpływ haplotypu rodziców na te cechy. Zasadniczą rolę w ich rozpoznaniu. po czym powstały kompleks transportowany jest na powierzchnię komórki. czy są to antygeny zewnątrzkomórkowe czy wewnątrzkomórkowe. Tutaj też następuje związanie cząsteczki MHC z peptydem. U koni natomiast stwierdzono. Wykazano ponadto istotny związek niektórych antygenów klasy II z zatrzymaniem łożyska. zależnie od rodzaju patogenu i miejsca infekcji.4. jak dotychczas. odgrywają cząsteczki głównego układu zgodności tkankowej. Wyniki badań prowadzonych na trzodzie chlewnej świadczą o wpływie MHC na cechy tuczne i rzeźne świń. iż geny ELA mogą wpływać na zmniejszenie płodności przy kojarzeniach ogierów i klaczy o identycznych haplotypach. czyli są degradowane do peptydów. 245 . reprodukcją i produkcyjnością powinno w przyszłości umożliwić wykorzystanie cząsteczek (antygenów) MHC jako markerów genetycznych w doskonaleniu zwierząt pod względem tych cech. obniżać stopień przeżywalności i masę ciała cieląt.cząsteczek MHC klasy I na cechy związane z użytkowością mleczną. przeżywalność zarodków i płodów oraz liczebność miotu. Cząsteczki MHC klasy I biorą udział w odpowiedzi układu immunologicznego na wirusową infekcję wewnątrzkomórkową. Dokładne poznanie struktury i funkcji głównego układu zgodności tkankowej zwierząt gospodarskich oraz jego związku z odpornością. W siateczce śródplazmatycznej są syntetyzowane cząsteczki klasy I MHC. Obecna wiedza pozwala na przedstawienie jedynie w zarysie przebiegu reakcji. gdzie zostaje rozpoznany przez obecne w pobliżu limfocyty T cytotoksyczne. Przebieg reakcji immunologicznej jest niezmiernie skomplikowany i. Badania znaczenia głównego układu zgodności tkankowej w reprodukcji zwierząt gospodarskich prowadzone były przede wszystkim na świniach. Peptydy te są następnie przekazywane do siateczki śródplazmatycznej. Również u bydła antygeny MHC mogą wpływać na zamieralność zarodków.

Podczas infekcji bakteryjnej. 10-10. Cząsteczki MHC klasy II uczestniczą w reakcji przeciwko infekcji zewnątrzkomórkowej. prezentując przede wszystkim obce antygeny. makrofagi lub limfocyty B. (b) prezentacja antygenu przez cząsteczki MHC klasy II 246 . 10-10a). mające na powierzchni cząsteczkę CD8. jeśli bakterie zostaną pochłonięte przez makrofagi. które zabijają zakażoną komórkę (ryć. Powstały Ryc. przedostającymi się z siateczki śródplazmatycznej. Limfocyty te uwalniają cytokiny hamujące replikację wirusów i cytotoksyny. są rozkładane na peptydy w wakuolach (endosomach). które zostały pochłonięte przez wyspecjalizowane komórki układu immunologicznego — komórki dendrytyczne. Reakcja immunologiczna: (a) prezentacja antygenu przez cząsteczki MHC klasy I.nazywane inaczej zabijającymi. Peptydy te wiążą się z cząsteczkami MHC klasy II.

10. a raczej ich pojemność jest różna. Następnie peptydy te są wiązane przez cząsteczki klasy II. Dojrzały limfocyt B ma na swej powierzchni przeciwciała IgM lub IgM i IgD. Limfocyt ten daje sygnał limfocytom B do proliferacji (namnażania) i syntezy przeciwciał. Cząsteczki MHC biorą także udział w usuwaniu własnych białek pochodzących z komórek. Ostatnio coraz więcej uwagi poświęca się genetycznie uwarun247 . a jej fragmenty są trawione przez sąsiadujące komórki. nieśność itd.). Jedna cząsteczka MHC klasy I może w swym rowku związać około 1000 różnych peptydów. ale uwalniają limfokiny aktywujące komórkę do zwalczenia infekcji (ryć. gdy jest zbyt mała liczba limfocytów B zdolnych do rozpoznania antygenu (co może wystąpić przy pierwszym zetknięciu się organizmu z danym antygenem) bądź gdy fagocytowane cząsteczki lub bakterie są dużych rozmiarów. Zaktywowane limfocyty B rozpoczynają syntezę przeciwciał wtórnych (IgG. Makrofagi wchłaniają. czyli jej fizjologiczna śmierć. które służą jako receptory antygenów. wkrótce potem jądro. degradują i prezentują wszystkie antygeny (ryć. Limfocyty te nie mszczą komórek tak jak limfocyty T cytotoksyczne (CD8). Genetyczna oporność na choroby Zmienność obserwowana u zwierząt dotyczy nie tylko cech użytkowych (mleczność. ale także oporności/podatności na choroby zakaźne i inwazyjne. które różnią się od pierwotnych tylko strukturą łańcucha ciężkiego. w odpowiedzi immunologicznej biorą udział limfocyty T CD4 pomocnicze.kompleks jest transportowany na powierzchnię komórki i tutaj rozpoznawany przez limfocyty T CD4 typu zapalnego (Thl). po przedostaniu się na powierzchnię komórki. chromatyna ulega kondensacji na obrzeżach jądra. Tak więc wytwarzanie przeciwciał przez limfocyty B jest kontrolowane przez cząsteczki MHC i limfocyty T (ryć. makrofagi mogą pełnić rolę pośrednią. a następnie cała komórka pęka. IgE lub IgA). apoptosis opadanie) jest to programowana śmierć komórki. Zdolność cząsteczek MHC do wiązania peptydów. 10-10b). Utworzony kompleks. jest rozpoznawany przez limfocyt pomocniczy T. 10-10b).5. Jeśli bakterie zostaną pochłonięte przez limfocyty B. Obce białko rozpoznane przez limfocyt B jest przekazywane do wakuoli (endosomów) i tam trawione na krótkie peptydy. 10-10b). W określonych przypadkach. prezentując limfocytom B cząsteczki po fagocytozie i wstępnej fragmentacji. Apoptoza (gr. Podczas tego procesu komórka początkowo kurczy się i oddziela od sąsiednich komórek. które uległy apoptozie. które dotarły tu z siateczki śródplazmatycznej. natomiast cząsteczka klasy II może ich związać dwa razy więcej. określane jako Th2.

Oporność na choroby jest definiowana jako właściwość organizmu uniemożliwiająca rozwój choroby pomimo wniknięcia patogenu. celowe jest zmapowanie tego genu. należy oszacować jej zmienność genetyczną. Podstawowe założenia poszukiwania genów odpowiedzialnych za oporność zwierząt na choroby obrazuje schemat (ryć.kowanej oporności na choroby. Jeśli okaże się. których celem jest znalezienie takich genów. Informacje te mogą być przydatne w opracowaniu strategii doskonalenia oporności. mutacja w genie FUT1 odpowiadająca za oporność prosiąt na chorobę obrzękową. Mechanizm dziedziczenia genetycznej oporności na różne choroby nie został jeszcze w pełni poznany. W ośrodkach naukowych wielu krajów prowadzone są intensywne badania. Wybór cechy będącej wskaźnikiem oporności powinien być przeprowadzony z uwzględnieniem pewnych kryteriów. Cecha ta powinna: • charakteryzować się dużą genetyczną zmiennością i odziedziczalnością • mieć istotną wartość ekonomiczną. iż oporność na nie zależy od pojedynczego genu o dużym efekcie. np. Genetyczna oporność nie obejmuje typowej odpowiedzi immunologicznej. Umożliwi to poznanie sposobu jej dziedziczenia. 248 . czyli określenie jego położenia w chromosomie. następnie sklonowanie go i poznanie sekwencji nukleotydów. 10-11). Gdy cecha — wskaźnik oporności jest już wybrana. iż cecha oporności jest warunkowana pojedynczym genem. następnym krokiem jest oszacowanie parametrów genetycznych: odziedziczalności tej cechy i jej korelacji genetycznej z innymi cechami istotnymi ekonomicznie. chociaż w przypadku niektórych schorzeń stwierdzono. może nią być produkt nadający się do sprzedaży bądź zmniejszający koszty produkcji • być łatwa do mierzenia bez ponoszenia wysokich kosztów. Na ogół jest to cecha poligeniczna. W przypadku gdy oporność na chorobę jest cechą poligeniczna.

W Kenii zarażenie bydła motylicą wątrobową jest o wiele częstsze u ras importowanych z Europy niż u ras miejscowych. które są określane za pomocą testów serologicznych lub elektroforezy. wskazujące na większą niż u osobników białych oporność na choroby wirusowe. jak: • cechy eksterierowe (widoczne gołym okiem). warunkowaną wieloma lub jednym genem. Sprzężenia takie są szczególnie korzystne w selekcji. Na przykład. co ma zasadnicze znaczenie w hodowli bydła wobec coraz szerzej stosowanego ich transferu. i barwne upierzenie drobiu. W opracowaniu strategii doskonalenia oporności genetycznej wykorzystuje się zarówno metody tradycyjne. Choroba ta dziesiątkuje populacje bydła 249 . umożliwiałaby prowadzenie selekcji wśród zwierząt młodych. • cechy ustalane za pomocą badań molekularnych DNA. Klasycznymi przykładami cech eksterierowych są: ciemna obwódka wokół oczu u bydła rasy hereford (bydło z biało umaszczoną głową). rodzime rasy bydła w Indii są bardziej wrażliwe na brucelozę niż ich mieszańce z rasami europejskimi. Ustalenie na tej podstawie oporności (lub podatności) na choroby jest możliwe już u zarodka. takimi jak antygeny erytrocytarne czy białka polimorficzne (markery klasy I) lub niekodujące sekwencje DNA (markery klasy II). Na przykład. Zwierzęta z hemoglobiną AA są bardziej oporne niż osobniki z hemoglobiną AB i BB. która prowadzi do śpiączki afrykańskiej (trypanosomatoza). jak i techniki inżynierii genetycznej. Największe możliwości ograniczania występowania chorób u zwierząt na drodze hodowlanej stwarzają wyniki badań molekularnych określających sekwencje nukleotydowe genów. związana z opornością na raka oczu.Zasadniczym krokiem w badaniach genetycznej oporności jest poszukiwanie sprzężeń między genetyczną opornością. gdyż umożliwiają określanie oporności/podatności zwierzęcia bez konieczności zarażania go patogenami. jak i rasowe. które mogą być wskaźnikami oporności na choroby. u bydła opornego na białaczkę częściej występują antygeny erytrocytarne B. a markerami genetycznymi. jak również badania genetycznej struktury głównego układu zgodności tkankowej (MHC). Tradycyjna praca hodowlana w kierunku zwiększenia oporności zwierząt może być prowadzona w drodze selekcji pośredniej na podstawie takich cech. Wyniki badań prowadzonych na owcach w Australii i Nowej Zelandii wskazują na zależność między genotypem hemoglobiny a częstością zarażenia pasożytem Haemonchus contortus. Znajomość cech określanych metodami serologicznymi. Innym markerem biochemicznym mogą być antygeny erytrocytarne grup krwi. Powszechnie znana jest oporność rodzimego bydła afrykańskiego N'Dama na infekcję świdrowca Trypanosoma brucei brucei. Na zmienność w podatności na choroby infekcyjne i pasożytniczne składają się zarówno różnice osobnicze. Y2/ D' i P'. • cechy.

simentalery czy szwyce. Jedną z dróg ograniczania występowania mastitis u bydła jest wykorzystanie w pracy hodowlanej różnic w genetycznych skłonnościach do tego schorzenia. Na przykład. Należą do nich stany zapalne gruczołu mlecznego (mastitis). S. z zachowaniem ich wysokiej produkcyjności. Mechanizm oporności na chorobę Mareka przypuszczalnie polega na ograniczaniu rozwoju guzów u zainfekowanych ptaków. iż oporność na salmonellozę jest dominująca i może być warunkowana pojedynczym genem. śmiertelność. a także.afrykańskiego. zmniejszone wykorzystanie paszy. Zjawisko oporności u kur obserwowane jest także w odniesieniu do kokcydiozy i salmonellozy. Ze względu na stosowaną sztuczną inseminację problem przekazywania przez ojca oporności na mastitis jest bardzo istotny. pullorum. Wykorzystanie zjawiska genetycznej oporności w celu poprawy zdrowotności zwierząt gospodarskich ma szczególne znaczenie w przypadku chorób trudnych do zwalczania metodami weterynaryjnymi. Za wskaźnik oporności na kokcydiozę przyjęto liczbę produkowanych oocyst. krowy rasy nizinnej czarno-białej i czerwonej duńskiej częściej zapadają na zapalenia gruczołu mlecznego niż holsztyńsko-fryzyjskiej. jak i indywidualne. typhimurium. Ponadto świadczą one. że oporność na nie zależy od funkcji fagocytarnych komórek przede wszystkim śledziony i wątroby. Wyniki badań wrażliwości kur na bakterie Salmonella (S. które są przyczyną poważnych strat ekonomicznych w hodowli bydła mlecznego. S. Kokcydioza jest równocześnie przykładem choroby. Prowadzone są badania nad możliwością wprowadzenia do oceny wartości hodowlanej buhajów cechy „choroba" (mastitis). w tym przypadku jest to temperatura otoczenia. nie zabezpieczając ich przed infekcją. Dzięki wysokiej plenności i szybkiej rotacji pokoleń prowadzona u tego gatunku intensywna selekcja w kierunku oporności na chorobę Mareka umożliwiła wytworzenie rodów kur całkowicie niewrażliwych na to schorzenie. S. Zależność ta jest następstwem zróżnicowanej zdolności termoregulacji u młodych ptaków. Oprócz różnic rasowych w podatności krów na mastitis stwierdzono także wyraźne różnice w częstości występowania tego schorzenia między rodzinami (po matkach) i liniami (po ojcach). enteritidis) sugerują. Różnice rasowe w oporności/podatności na choroby mogą być wykorzystywane do krzyżowania w celu uzyskania mieszańców opornych na daną chorobę. której częstość występowania jest w dużej mierze stymulowana działaniem czynników środowiskowych. gallinarum. zwłaszcza u młodych kurcząt. Zmienność podatności zwierząt na choroby najlepiej poznano u kur. Obserwowane są zarówno różnice rasowe. Badania genetycznych uwarunkowań oporności na kokcydiozę wskazują na rolę genów głównego układu zgodności tkankowej (MHC) i genów zlokalizowanych poza tym układem. W Norwegii od 1978 roku mastitis jest już włączone jako cecha 250 . Kokcydioza powoduje obniżony stopień wzrostu.

ustawienie strzyków. Inną drogą zwalczania mastitis jest selekcja buhajów w kierunku zmniejszenia zawartości komórek somatycznych w mleku ich córek. iż wirus białaczki limfatycznej nie jest przenoszony podczas sztucznej inseminacji przez nasienie. że skłonność do białaczki jest przekazywana przez rodziców. Można zatem przypuszczać. siarę i mleko oraz. wysokość zawieszenia wymienia i szybkość oddawania mleka. niedobór niektórych pierwiastków. Jednakże badania niektórych autorów wykazały istotną rolę poszczególnych rodzajów komórek somatycznych w zabezpieczaniu wymienia przed drobnoustrojami chorobotwórczymi. Ponieważ wszelkie metody zwalczania białaczki (poza eliminacją zwierząt zarażonych) stosowane przez lekarzy weterynarii nie przynoszą oczekiwanych wyników. Wpływ buhajów na skłonność ich córek do białaczki nie jest tak silny jak wpływ matek. Obecnie w programach hodowlanych kładzie się wyraźny nacisk na cechy morfologiczne wymion i zdolność wydojową krów. Podstawowymi kryteriami tej selekcji są. kształt i wielkość wymienia oraz strzyków.selekcyjna w programach hodowlanych. kobalt i mangan). coraz więcej uwagi poświęca się zagadnieniom wpływu założeń genetycznych na skłonność do tego schorzenia. zbyt duża wielkość i niskie zawieszenie. Wydaje się. Ta metoda selekcji jest zalecana na przykład w Szwecji. iż byłoby celowe prowadzenie selekcji pośredniej. Stwierdzono na przykład. opartej na wskaźnikach fenotypowych oporności. przez uprzednio zarażoną wirusem białaczki komórkę jajową. ale także zakażenia przez łożysko. charakteryzujących się wysoką produkcją mleka i zwiększoną opornością na mastitis. jest białaczka limfatyczna. a zwłaszcza przez chore matki. wapń. których wymiona wykazują morfologiczne i fizjologiczne odchylenia od normy. Ocena rozpłodników jest dokonywana na podstawie zdrowotności gruczołu mlecznego ich potomstwa żeńskiego. iż selekcja w kierunku zmniejszenia zawartości komórek somatycznych w mleku może zmniejszyć zdolność krów do reakcji na infekcje gruczołu mlecznego. Z drugiej 251 . za duże lub za małe strzyki. Innym schorzeniem u bydła. w celu ograniczania występowania mastitis poprzez selekcję. Na podstawie licznych badań można sądzić. że mastitis najczęściej występuje u krów. co zostało udowodnione. ale najczęściej atakuje ona bydło w krajach strefy umiarkowanej. którego leczenie jest bezskuteczne. Wydaje się. Wybór tych cech jest uzasadniony ich uwarunkowaniem genetycznym i powiązaniem ze stanem zdrowotnym wymienia. Celem tych działań jest wyselekcjonowanie krów o prawidłowej budowie wymienia. Wielu badaczy wiąże skłonność krów do stanów zapalnych (mastitis) z budową i wielkością wymienia oraz strzyków. że większa zapadalność na białaczki krów od matek chorych jest następstwem nie tylko dziedziczenia skłonności do tej choroby. Jej występowanie stwierdzono na wszystkich kontynentach. jak: magnez. jak również niekorzystnym warunkom środowiska (np. która w znacznym stopniu jest uwarunkowana genetycznie. oprócz wydajności. takie jak: nieproporcjonalny rozwój przednich i tylnych ćwiartek. Wiadomo.

przede wszystkim z powodu trudności w znalezieniu odpowiedniego wskaźnika tego stanu. Badania nad genetyczną opornością świń na choroby dotyczą przede wszystkim biegunek u prosiąt. coli i F18 E. W tym miejscu należy podkreślić. Oporność owiec na pasożyty żołądkowo-jelitowe może przejawiać się jako zdolność żywiciela do kontrolowania występowania pasożyta.jednak strony wielu badaczy stwierdzało. że krowy po niektórych buhajach znacznie częściej zapadają na tę chorobę. w odróżnieniu od genetycznej zmienności oporności.5-0. Genetyczna zmienność zdolności do współżycia żywiciela z pasożytem. cieszy się mniejszym zainteresowniem wśród badaczy. resilience) poprzez utrzymywanie produkcyjności na nie zmienionym poziomie nawet podczas inwazji. przez zmniejszanie jego ilości 1 ograniczanie przeżywalności (ang. iż między opornością owiec na zarażenie nicieniami żołądkowo-jelitowymi (np. Stwierdzono. coli jest opisane w podrozdziale: Mutacje genowe. Genetyczne uwarunkowanie oporności prosiąt na biegunki okresu noworodkowego i poodsadzeniowego wywoływane szczepami K88 E. że praktycznie nie jest możliwe uzyskanie zwierząt opornych na kilka chorób jednocześnie. ale także innych schorzeń. której wartość waha się w granicach 0. co może być dowodem na dziedziczenie podatności na białaczkę. lub też jako zdolność do współżycia z pasożytem (ang. Haemonchus contortus) a „resilience" istnieje dodatnia korelacja genetyczna. . Prowadząc selekcję w kierunku oporności na pasożyty można oczekiwać poprawy skorelowanej z nią cechy zdolności współżycia z pasożytem. U owiec stwierdzono zróżnicowaną oporność na pasożyty wewnętrzne. na przykład schorzeń kończyn. Stwarza to możliwość wykorzystywania tej właściwości w ograniczaniu stopnia inwazji pasożytniczych u tego gatunku zwierząt. resistance). Można jedynie mówić 0 doskonaleniu cechy oporności na określone schorzenie.6.

temperatura. W przypadku DNA rozdział może być poprzedzony trawieniem wyizolowanego (lub zamplifikowanego metodą PCR) DNA z użyciem enzymów restrykcyjnych. uwarunkowana w sposób prosty — tzn. pozwala na analizę polimorficznych loci zawierających sekwencje mikrosatełitarne lub też ujawnienie zróżnicowanej konformacji pojedynczych łańcuchów zamplifikowanego frag253 . Polimorfizm markerów bada się zazwyczaj za pomocą metod analitycznych. a z drugiej strony od parametrów fizycznych rozdziału (napięcie. Technikę elektroforezy wykorzystuje się do rozdziału w polu elektrycznym białek oraz fragmentów DNA. zawierających przeciwciała skierowane przeciw ściśle określonej postaci białka. co zachodzi wówczas. Metody serologiczne wymagają stosowania surowic testowych. Przydatność markera zależy od tego. umiejscowione na niektórych frakcjach leukocytów (antygeny klasy II) lub innych komórkach mających jądro (antygeny klasy I). wśród których dominują metody serologiczne oraz biochemiczne — oparte na elektroforezie. uzyskanych metodą PCR. które nie kodują informacji genetycznej.Rozdział W klasycznym ujęciu marker genetyczny to cecha jakościowa. Natomiast bezpośrednia elektroforeza wybranych fragmentów DNA. gdy w populacji występują przynajmniej dwa allele w locus tego markera. antygeny głównego układu zgodności tkankowej. przydatna do celów analizy genetycznej. Rozdział elektroforetyczny ujawnia formy różniące się ruchliwością. czy jest on polimorficzny. która zależy od wielkości i ładunku elektrycznego cząsteczki białka (lub fragmentu DNA) oraz jej konformacji przestrzennej.). a dokładniej — rozpoznające konkretną determinantę antygenową. Zastosowanie enzymów restrykcyjnych pozwala na ujawnienie polimorfizmu długości fragmentów restrykcyjnych (RFLP) w obrębie genów lub polimorfizmu powtarzalnych sekwencji minisatelitarnych. antygenowe determinanty białek surowicy krwi (allotypy). W ten sposób badane są antygeny erytrocytarne (grupy krwi). przez jedną parę alleli. stężenie nośnika — żelu itp.

geny. 11. Do pionierów tych badań należy zaliczyć m. Objęcie badaniami niekodujących sekwencji DNA spowodowało. o właściwościach antygenowych. że są związane z błoną plazmatyczną erytrocytów. Jeśli białko ma tylko jedną determinantę antygenową. Antygeny erytrocytarne (grupy krwi) Grupy krwi były najwcześniej wykorzystane w analizie genetycznej. Białka kodowane przez te geny pełnią różnorodne funkcje biologiczne. W wyniku reakcji antygen-przeciwciało dochodzi do aglutynacji lub hemolizy krwinek czerwonych. wśród nich najważniejsze miejsce zajmują tandemowo powtarzające się sekwencje mikrosatelitarne. i 60. cechujący się obecnością charakterystycznych białek. Identyfikacja antygenów erytrocytarnych wymaga zastosowania surowic testowych. Oprócz wymienionych wyżej dwóch klas markerów genetycznych można wyróżnić jeszcze grupę markerów związanych z polimorfizmem chromosomowym. Polimorfizm tych markerów wykrywany jest poprzez analizę produktów genów (metody serologiczne i technika elektroforezy białek) lub badanie DNA tych genów (metody RFLP. na powierzchni erytrocytów. Z badań prowadzonych u człowieka wynika. np. single stranded conformation polymorphism). cząsteczkami adhezyjnymi czy białkami strukturalnymi. Przez grupę krwi należy rozumieć typ krwi. Polimorfizm chromosomowy dotyczy przede wszystkim wielkości bloków heterochromatyny konstytutywnej (barwienia techniką CBG) oraz obszarów jąderkotwórczych (technika Ag-I. Klasa I obejmuje klasyczne markery. czyli sekwencje kodujące -. wówczas jest rozpoznawane 254 . który jest wykrywany za pomocą technik prążkowego barwienia chromosomów. Intensywne badania nad polimorfizmem antygenów erytrocytarnych u zwierząt domowych podjęto na przełomie lat 50. a w mniejszym stopniu sekwencje minisatelitarne.in. Ich efektem było wykrycie wielu układów grupowych. W tym przypadku mają zastosowanie tylko badania oparte na elektroforezie DNA. Po dodaniu do surowicy testowej zawiesiny erytrocytów dochodzi do reakcji anty-genprzeciwciało. polskiego badacza Ludwika Hirszfelda. Klasa II markerów to sekwencje niekodujące. Przeciwciała obecne w surowicy testowej wiążą się z determinantami antygenowymi.mentu DNA genu (metoda SSCP — ang. czyli Ag-NOR). Wspólną ich właściwością jest to. SSCP).1. a ich obecność można wykryć metodami serologicznymi. które zawierają swoiste przeciwciała skierowane przeciw konkretnemu antygenowi. receptorami. dotyczącej kontroli pochodzenia. W ich obrębie zidentyfikowano liczne antygeny i allele je warunkujące. że markery zostały podzielone na dwie klasy. że mogą one być enzymami. który w populacji jest reprezentowany zazwyczaj przez wiele alleli (seria alleli wielokrotnych). Konkretny układ grupowy krwi jest warunkowany przez pojedynczy gen (locus).

Jeśli takie geny mają wiele alleli. a przez to do utworzenia (lub zlikwidowania) 255 . Struktura białka zależy również od modyfikacji potranslacyjnej polipeptydu przeprowadzonej przez enzymy kodowane przez inne geny. a w tym jego determinanty antygenowej. Występowanie różnych form determinanty antygenowej w danym białku jest skutkiem mutacji punktowych. Mutacja taka może doprowadzić do zmiany sekwencji aminokwasów. to wówczas ta forma białka jest wykrywana po zastosowaniu odpowiedniej liczby surowic testowych. może to prowadzić do zróżnicowanej modyfikacji potranslacyjnej. Wreszcie może być taka sytuacja. Jeśli białko ma kilka determinant antygenowych. że białko jest pozbawione determinant wykrywalnych dostępnymi surowicami testowymi.za pomocą jednej surowicy testowej. a to z kolei może wpłynąć na zmianę struktury białka.

prowadząca do zmiany budowy białka — rozpoznawanej przez surowice testowe — będzie skutkowała powstaniem nowego allelu (ryć.nowej determinanty w antygenie erytrocytarnym. które dziedziczą się jak jednostka. to wówczas każda mutacja genu. że nowe determinanty antygenowe są skutkiem mutacji genu kodującego łańcuch polipeptydowy antygenu erytrocytarnego 256 . Gdyby dla uproszczenia przyjąć. 11-2. Mechanizm powstawania zróżnicowania antygenów erytrocytarnych. W takiej sytuacji mutacja genu zmienia jedną Ryć. 11-1). Schemat opiera się na założeniu. gdy białko ma więcej determinant antygenowych. Mówi się wówczas o fenogrupach. Sytuacja staje się bardziej złożona. czyli zespole antygenów. że białko ma tylko jedną determinantę antygenową. które pojawiają się w trzech fenogrupach: abc. przykład dla białka mającego kilka determinant antygenowych. Wówczas pojedynczy allel jest opisywany za pomocą kilku surowic testowych. a więc są uwarunkowane przez jeden allel. ab oraz a’bc).

Przy takim uwarunkowaniu genetycznym może dochodzić do powstawania rekombinantów. że występują obie sytuacje. a w konsekwencji do nietypowego dziedzi- 257 . Należy jednak zaznaczyć. Badania prowadzone u zwierząt wykazały. Wówczas zespół antygenów dziedziczący się jako jednostka genetyczna byłby uwarunkowany przez grupę genów bardzo silnie ze sobą sprzężonych. ale nie narusza struktury pozostałych (ryć. że istnieje także druga teoria tłumacząca fenomen fenogrup.z determinant. że każdy antygen warunkowany jest przez jeden gen. 11-2). Przyjmuje ona.

w którym występuje allel „ — " określany jest jako otwarty. C. Liczba znanych układów grupowych (loci) u zwierząt gospodarskich wynosi: 7 w genomie konia (układy: A. I. D. 11-1). M. R. D. a drugi allel (allel „ —") koduje białko. C. O. że istnieją białka zbudowane z podjednostek kodowanych przez różne geny. Przykłady takie opisano u bydła. R'). D. że cząsteczka białka kodowana przez ten gen ma bardzo zróżnicowaną strukturę i przez to ma wiele determinant antygenowych. Q. 11 w genomie bydła (układy: A. C. L. O). przy czym jeden z nich jest odpowiedzialny za występowanie białka mającego determinantę antygenową wykrywaną przez surowicę testową. J. że w niektórych przypadkach obie teorie będą miały zastosowanie do wyjaśnienia połimorfizmu antygenów erytrocytarnych. M. K. 13 w genomie kury (układy: A. P. Ponadto determinanty mogą 258 . B. W przypadku wielu układów grupowych znane jest umiejscowienie chromosomowe loci. głównie w odniesieniu do układu grupowego B. E. Biologiczna funkcja powyższych białek nie została jeszcze poznana. C. F. H. w którym wykryto 40 antygenów i opisano około 1000 alleli (fenogrup). G. L. jak np. U) oraz owcy (układy: A. X). Wśród poznanych układów są takie. B. Należy pamiętać. Na drugim biegunie są układy o olbrzymim polimorfizmie. E. Natomiast bardzo bogata jest wiedza na temat połimorfizmu występującego w obrębie poszczególnych układów (tab. Układ grupowy. N. B. Zatem możliwe jest. układ grupowy B bydła. T'. D. K. M. F. które w reakcji z dostępną surowicą testową nie daje reakcji serologicznej. C. F. w których wykryto dotąd tylko dwa allele (np. układ L bydła czy układ C świni). J. S. M. J. Można przypuszczać. P) oraz 15 w genomie świni (układy: A.czenia antygenów krwinkowych. Z. H. B. K. G.

W układzie grupowym A występują dwa antygeny A oraz O. Gen S ma dwa allele: S oraz s. pod auspicjami Międzynarodowego Towarzystwa Genetyki Zwierząt (ang. konie) oraz Zakład Hodowli Koni AR w Poznaniu (konie). pozyskaniu od nich surowicy odpornościowej (na ogół poliwalentnej. erytrocytów i leukocytów Białka surowicy krwi. Pojawienie się antygenu A lub O uzależnione jest od genotypu w locus S. Jak to już wcześniej wspomniano. które warunkują pojawienie się tylko jednej determinanty (rozpoznawanej przez jedną surowicę). Niezmiernie istotne jest. W Polsce produkcją surowic testowych zajmuje się Instytut Zootechniki (bydło. Surowice takie są produkowane przez laboratoria. przy czym działanie epistatyczne pojawia się przy genotypie homozygoty recesywnej ss. erytrocytów i leukocytów są drugą. comparison test). Za pomocą dostępnych surowic testowych należy ustalić. czyli zawierającej wiele różnych przeciwciał). Poszczególne warianty tych białek są określane za pomocą technik elektroforetycznych (np. Na uwagę zasługuje układ grupowy A świni.2. w których zidentyfikowano kilka czy kilkanaście alleli. wyprodukowane w różnych laboratoriach. które zajmują się badaniami antygenów erytrocytarnych na potrzeby kontroli pochodzenia zwierząt. które powinny spełniać warunek swoistości. Polegają one na tym. Białka surowicy krwi. międzynarodowych testów porównawczych (ang. to znaczy zawierającej przeciwciała skierowane przeciw konkretnemu antygenowi erytrocytarnemu. Zbiorcze wyniki testu są udostępniane zainteresowanym laboratoriom. po grupach krwi. Cel ten osiąga się poprzez cykliczne przeprowadzanie. 11. International Society for Animal Genetics — ISAG). charakteryzowały się identyczną swoistością. że do laboratoriów uczestniczących w teście przesyłane są zestawy zakodowanych próbek krwi zwierząt. Procedura produkcji oparta jest na immunizacji zwierząt. aby surowice testowe.mieć wiele wariantów. a każdy z nich jest rozpoznawany przez odrębną surowicę testową. W tabeli 11-11 przedstawione są rozpoznane dotychczas antygeny i allele u koni. a następnie jej „oczyszczaniu" (absorpcji niespecyficznych przeciwciał) do momentu otrzymania surowicy testowej (monowalentnej). jakie antygeny występują na erytrocytach w poszczególnych próbkach. które odpowiadają za występowanie kilku determinant (rozpoznawanych przez analogiczną liczbę surowic). Jego ekspresja zależna jest od dodatkowego locus S. Pomiędzy tymi skrajnymi przykładami są liczne układy grupowe. elektroforeza w żelu poliakryloamidowym lub elektroforeza 259 . pod względem liczebności grupą markerów genetycznych klasy I. W efekcie wśród alleli będą takie. oraz takie. który ma działanie epistatyczne w stosunku do locus układu A. świnie. badanie grup krwi wymaga stosowania surowic testowych.

będących skutkiem mutacji punktowych w genie kontrolującym syntezę danego białka lub genach kodujących enzymy odpowiedzialne za modyfikację potranslacyjną. i ich znaczenie są omówione szczegółowo w rozdziale: Genetyczne podstawy odporności i oporności. Spośród ponad 25 białek najbardziej polimorficzne 260 . Na przykład u koni testy takie wykonywane są dla 16 systemów białek. elektrofokusing).dwuwymiarowa czy rozdział białek w gradiencie pH — tzw. Polimorfizm białek surowicy krwi wynika ze zmienności ich form strukturalnych. Polimorfizm białek leukocytów. Niektóre białka i enzymy surowicy krwi zestawiono w tabeli ll-III. nazywanych także cząsteczkami lub antygenami głównego układu zgodności tkankowej (MHC). Identyfikacja wariantów tych białek musi być potwierdzona w teście porównawczym (pod kontrolą Międzynarodowego Towarzystwa Genetyki Zwierząt).

Ze względu na to. Inhibitory α-proteaz cechuje największy polimorfizm u takich gatunków. PO1AB i PO1BY dla wielkiej białej polskiej. Liczba rozpoznanych wariantów elektroforetycznych białek jest jednak specyficzną cechą gatunkową. niektóre allele są charakterystyczne dla danych ras. inhibitor α-proteaz i transferyna. mającą dwa aktywne centra wiązania żelaza. 11-IV) szczególnie interesujące są deaminaza adenozyny i hemoglobina. jak świnia. Allel ten. występuje szczególnie często u zwierząt podatnych na stres. U osobników o genotypie ADA°ADA° brak jest deaminazy adenozyny w erytrocytach. jak np. u bydła w chromosomie l. charakteryzujące się podobnym stopniem polimorfizmu (3-5 alleli). określany jako zerowy. przy czym jedynie allele Tf-D i Tf-F2 występują prawie u wszystkich ras koni. Albuminy współdziałają z globulinami w regulacji równowagi płynów ustrojowych. koń i koza. owiec (chromosom 15). Najrzadsze allele to TfE (tylko u świń rasy hampshire) oraz Tf1 (u dzika europejskiego). Deaminaza adenozyny została dotychczas wykryta u trzody chlewnej. PO1A. kur i bydła. PIZ. U koni jest ono determinowane przez 13 alleli. które mają skłonność do wytwarzania mięsa typu DFD (ciemne. PO1B. Jej podstawową funkcją jest transport żelaza z miejsc absorpcji w przewodzie pokarmowym do różnych komórek organizmu. Transferyna jest β-globuliną. hampshire i duroc. w rasie szwedzkiej yorkshire oraz landrace zidentyfikowano po około 40 różnych haplotypów. Jest to najbardziej polimorficzne białko zidentyfikowane dotychczas u podstawowych gatunków zwierząt gospodarskich. U koni w jednym poznanym dotychczas locus inhibitora α-proteaz wykryto 20 alleli. są one cennymi markerami genetycznymi. przy czym u bydła jest to enzym leukocytarny. 261 . natomiast jest ona aktywna w leukocytach i innych tkankach. U owiec synteza albumin jest kontrolowana przez locus ALB umiejscowiony w chromosomie 6 i będący w sprzężeniu z locus białka wiążącego witaminę D. twarde i suche). Z drugiej strony. Spośród białek i enzymów erytrocytarnych (tab. PJ4) zajmujące łącznie region długości około 2 centymorganów (chromosom 7q24-q26). Locus transferyny u świń znajduje się w chromosomie 13 (13q31). podczas gdy allel TfA występuje przede wszystkim u yorkshire. przy czym jeden z alleli (ALBS) występuje u większości ras.są albumina. P/3. Polimorficzne warianty są związane z różną aktywnością tego enzymu. że różne rasy świń mają całkowicie odmienne haplotypy (czyli układy sprzężonych alleli z loci genów dla inhibitorów α-proteaz). U świń są one determinowane przez ściśle sprzężone loci (Pi1. U świń w locus ADA znanych jest sześć alleli. U świń locus albuminy jest umiejscowiony w chromosomie 8ql2. z kolei u kóz inhibitory α-proteaz są kontrolowane przez 4 loci. u owiec także w chromosomie l (Iq42q45). Tak więc. Natomiast u świń allel TfB jest głównym allelem u ras europejskich i azjatyckich. Najwięcej wariantów tego białka zidentyfikowano u bydła.

U owiec warianty hemoglobiny kontrolowane są przez loci: HBA (24 chromosom) i HBB (15 262 . bydła i kóz.Hemoglobina wykazuje największy polimorfizm u owiec. Warianty tego białka różnią się tylko budową łańcucha β. kontrolowanego przez locus znajdujący się w chromosomie 15q22-q27. u rasy Jersey i niektórych ras mięsnych. Większość ras bydła. Polimorfizm genu kontrolującego hemoglobinę występuje u niektórych ras bydła. jest monomorficzna. Na przykład u bydła w trzech pozycjach tego łańcucha. jak np. wśród nich bydło czarno-białe i czerwono-białe. są różne aminokwasy.

dotychczas zidentyfikowano 3 allotypy. Ciekawe jest. 14 allotypów dla γ-globulin i 3 dla α-globulin. u owiec 1. Największe zróżnicowanie allotypów lipoprotein. układ sprzężonych alleli nazywany jest haplotypem. określane terminem allotypy. wykazują właściwości antygenowe. bo liczący ponad 21 allotypów. 11. a wielkość tego wytwarzania zależy od nasilenia anemii. kontrolowane przez allele bval. 11. β i κ oraz białko serwatkowe — P-laktoglobulina. Określenie genotypu na podstawie 263 . iż łańcuch β hemoglobiny C (HBB C) jest wytwarzany tylko w przypadku anemii i tylko u osobników mających allel HBA. Ponadto wariant A hemoglobiny β (HBB A) wykazuje większe powinowactwo do tlenu niż wariant B (HBB B) i związany jest z większą wartością hematokrytu. U bydła loci kazein znajdują się obok siebie w 6 chromosomie (6q26-q33) i zajmują razem odcinek DNA długości około 200 kpz (tysięcy par zasad). a w piątym układzie (Lps) tylko jeden allel. jak i analizy na poziomie DNA (żel agarozowy lub poliakryloamidowy). oznaczonych symbolem Lp. Genotyp zwierzęcia w loci kontrolujących białka mleka można określać za pomocą metody elektroforezy stosowanej zarówno w przypadku rozdziału białek (żel skrobiowy lub poliakryloamidowy).3. W zależności od właściwości fizycznych wyróżnia się pięć klas tych białek. U świń zidentyfikowano dotychczas 16 allotypów we frakcji β-globulin. biorące udział w transporcie cholesterolu. Stopień polimorfizmu allotypowego jest różny zależnie od gatunku. bva2 oraz bvb. Większość tych allotypów jest determinowana przez kodominujące allele. są to ugrupowania chemiczne (najczęściej jeden lub kilka aminokwasów) występujące na cząsteczkach białek i różnicujące osobniki tego samego gatunku. U większości gatunków zwierząt gospodarskich poznane allotypy zlokalizowane są przede wszystkim na α-. U bydła zidentyfikowano 3 allotypy. U pozostałych gatunków zwierząt polimorfizm allotypowy lipoprotein jest niewielki. Białka mleka Głównymi białkami mleka są kazeiny αs1. Allotypy immunoglobulin i lipoprotein Antygenowe właściwości surowicy krwi. 10 determinant antygenowych we frakcji β-globulin oraz 7 we frakcji γ-globulin. αs2. Natomiast u owiec wykryto 11 antygenowych markerów cząsteczek α-globulin. od lipoprotein o bardzo małej gęstości (VLDL) do lipoprotein o bardzo dużej gęstości (VHDL). W przypadku antygenów immunoglobulin u bydła. Również lipoproteiny. u których najbardziej polimorficzny.i γ-globulinach. jest układ Lpb. Ze względu na ścisłe sprzężenie loci kazein. Lpt i Lpu) znane są po dwa allele.4. W następnych układach (Lpr. β. stwierdzono dotychczas u świń.chromosom).

Białko serwatkowe mleka bydła. Poszczególne warianty aS2-kazeiny są kontrolowane przez 4 allele: A. Allel E κ-kazeiny różni się od A i B podstawieniem A→G (seryna->glicyna w pozycji 155 łańcucha polipeptydowego). albowiem w locus kontrolującym syntezę tego białka stwierdzono 7 alleli. przy czym największą frekwencją u bydła europejskiego charakteryzuje się allel B. C. Mleko zawierające β-laktoglobulinę B różni się od mleka z β-laktoglobulina A większą zawartością suchej masy. tłuszczu i kazein oraz lepszą przydatnością technologiczną do produkcji serów. opisanej w rozdziale: Metody analizy i modyfikacji genomu) może być przeprowadzana u osobników obu płci i w każdym wieku. D i E. której skutkiem jest zmiana w pozycji 10 łańcucha polipeptydowego aminokwasu argininy na histydynę. C. W pozycji 136 łańcucha polipeptydowego B jest treonina. znane są różnice w sekwencji aminokwasowej obu wariantów βlaktoglobuliny. Dotychczas u bydła wykryto 6 typów κ-kazeiny. co stwarza możliwość molekularnej identyfikacji poszczególnych alleli za pomocą metody PCR-RFLP. Molekularna identyfikacja alleli A i B metodą PCR-RFLP jest przedstawiona w rozdziale: Zmienność cech. Białko αs2-kazeiny różni się długością łańcucha od białka αs1-kazeiny. Różnica między 264 . U bydła w locus kazeiny αsl wykryto pięć alleli: A. Różnice między poszczególnymi wariantami polegają na zmianie aminokwasu. z których jedynie A i D są obecne w genotypie bydła ras europejskich. które powodują zmianę aminokwasu. determinowanych allelami: A. β-laktoglobulina. E. wynikające z polimorfizmu genu kodującego to białko. C i D. a u bydła indyjskiego — alleł C. Natomiast analiza polimorfizmu genów kodujących białka (z wykorzystaniem metody RFLP. Białko β-laktoglobuliny składa się z 162 aminokwasów. B. Allel F powstał w wyniku mutacji punktowej w allelu A. występuje w dwóch wariantach A i B. Mutacje te tworzą miejsca restrykcyjne dla enzymów HhaI i MaII. Podobnie allel G powstał wskutek tranzycji C→T w allelu A. bardzo rzadko wariant β-kazeiny B (prawie wyłącznie stwierdzane są genotypy heterozygotyczne AB). β-Laktoglobulina odgrywa rolę w odporności organizmu. a wariant A — alaninę. powodującej zamianę argininy na cysteinę w pozycji 97 sekwencji aminokwasowej białka. Tak więc allele A i B różnią się nukleotydami w dwóch miejscach łańcucha DNA. a w wariancie A — izoleucyna. składają się one bowiem odpowiednio z 207 i 199 aminokwasów. β-Kazeina wykazuje większy polimorfizm niż kazeiny αs1 i αS2.badania białka jest możliwe tylko u samic będących w okresie laktacji. natomiast w pozycji 148 wariant B κ-kazeiny ma kwas asparaginowy. pobierana bowiem przez oseski z mlekiem matki chroni je przed infekcjami. B. U bydła europejskiego najczęściej występuje wariant β-kazeiny A. F i G. Podobnie jak w przypadku κkazeiny. polegającej na tranzycji G→A. B. będącej konsekwencją mutacji punktowej (tranzycji jednej zasady na inną).

DNA fingerprint). Jeśli strawiony enzymem restrykcyjnym i rozdzielony elektroforętycznie DNA hybrydyzuje się z wyznakowaną radioaktywnie sondą zawierającą sekwencję minisatelitarną. natomiast wariant B — glicynę (GGT). wśród których dużą przydatność dla potrzeb analizy genetycznej mają sekwencje powtarzające się tandemowo. przedstawia wysoce charakterystyczny obraz osobniczego DNA. W mleku kóz i owiec. to na błonie radiograficznej pojawia się układ prążków. że długość podstawowego motywu powtarzającego się wynosi zazwyczaj kilkanaście nukleotydów. ale także sekwencje ją otaczające. to znaczy zawierających nie tylko sekwencję minisatelitarną. D. O ile allele A. Do najbardziej znanych sekwencji minisatelitarnych należą: 33. polegające na delecji odpowiednio 11 i 37 aminokwasów.5.6 (motyw podstawowy: AGGGCTGGAGG) i 33. C. do kontroli pochodzenia i identyfikacji śladów biologicznych. Obok równoczesnej analizy wielu loci możliwe jest także badanie polimorfizmu sekwencji minisatelitarnej w pojedynczym locus. Z kolei w pozycji 118 w wariancie A jest walina (GTC). są cztery frakcje białek. O). Zmiana zasady w kodonie 118 genu stwarza miejsce restrykcyjne dla enzymu HaeIII (GG/CC) w allelu β-laktoglobuliny B. podobnie jak bydła. jaka dzieliła sekwencję minisatelitarną od miejsca cięcia przez enzym restrykcyjny. zaś w B -. a ich długość zależy od liczby powtórzeń motywu podstawowego i także odległości. F. Fragmenty te pochodzą z wielu loci. Badanie takie wymaga zastosowania sond o dużej specyficzności. który reprezentuje fragmenty DNA o różnej długości. nazywany niekiedy „odciskiem palca" DNA (ang. 33. 11. Sekwencje te występują w wielu miejscach (loci) genomu. Ich cechą charakterystyczną jest to. który może być wykorzystany m. w którym są 3 allele. Najbardziej polimorficzny jest gen kazeiny αs1 u kóz (7 alleli — A. Uzyskany układ prążków.wariantem A i B polega na tym. W pozostałych loci wykryto po 2 allele. z wyjątkiem locus P-laktoglobuliny (chromosom 3p28). Zostało to wykorzystane w opracowanym teście PCR-RFLP. Podobnie u owiec.5 (motyw podstawowy: GGGAGGTGGGCAGGAGG). opisano po raz pierwszy sekwencje minisatelitarne. C i E różnią się między sobą kilkoma podstawieniami aminokwasów.alanina (GCC). a w konkretnym locus może być różna liczba powtórzeń motywu podstawowego. który także jest już rutynowo stosowany.in. o tyle allele D i F wykazują znacznie większe różnice. B. B. W połowie lat 80. Polimorfizm DNA W jądrowym DNA zdecydowanie przeważają sekwencje niekodujące. w loci kontrolującym główne białka mleka występują po 2 allele. oraz przeprowadzenia hybrydyzacji zgodnie z zaostrzoną proce265 . E.15 (motyw podstawowy: AGAGGTGGGCAGGTGG). że wariant A w pozycji 64 sekwencji aminokwasowej zawiera kwas asparaginowy (GAT).

a następnie określeniu ich długości za pomocą klasycznej elektroforezy (np. za pomocą sekwencji starterowej o losowej 266 . Sekwencje mikrosatelitarne mogą występować jako proste powtórzenia motywu podstawowego lub mogą mieć układ złożony. Z zebranych do tej pory informacji o występowaniu sekwencji minisatelitarnych w różnych genomach wynika. w przypadku homozygoty. polimorficznego fragmentu DNA. random amplified polymorphic DNA — RAPD). Do tej pory najczęściej opisywano dwu. pochodzących z DNA wyizolowanego od danego osobnika. Badanie polimorfizmu sekwencji mikrosatelitarnych w pojedynczym locus polega na amplifikacji techniką PCR specyficznych fragmentów. Z tego względu ich przydatność w budowaniu markerowych map genomo-wych jest ograniczona. że powtórzenia motywu podstawowego są przedzielone inną sekwencją — np. gdy za pomocą techniki PCR. Analiza tego typu polega na amplifikacji nieznanych fragmentów DNA. (GT)nGAT(AG)m. że ich loci są położone głównie w częściach telomerowych chromosomów. tzn. Zależnie od genotypu osobnika stwierdza się występowanie jednego fragmentu. Wykrywanie polimorfizmu mikrosatelitarnego może być prowadzone podobnie jak sekwencji minisatelitarnych. ani sekwencje starterowe umożliwiające amplifikację techniką PCR konkretnego. Sekwencje mikrosatelitarne stały się najpowszechniejszym źródłem markerów genetycznych. lub dwóch fragmentów — u heterozygoty (ryć. Wykrywanie polimorfizmu (markerów) DNA możliwe jest również wówczas. polegający na tym. high stringency). Jedną z częściej stosowanych procedur w takiej sytuacji jest losowa amplifikacja polimorficznego DNA (ang. że w genomie ssaków sekwencje takie występują co 6-10 tysięcy par nukleotydów. 11-3 wkładka kolorowa). po rozpoznaniu sekwencji otaczających sekwencję mikrosatelitarną. Szacuje się.durą (ang.(np. Szczególne jednak znaczenie zyskały sekwencje mikrosatelitarne w chwili. gdy nie są znane ani sondy molekularne. także powtarzających się tandemowo. możliwe stało się analizowanie pojedynczych loci. Wkrótce po odkryciu polimorfizmu sekwencji minisatelitarnych opisano polimorfizm krótkich sekwencji. Na podstawie wiedzy o sekwencjach otaczających mikrosatelitę syntetyzowane są oligonukleotydy pełniące funkcję starterów dla polimerazy DNA. że sekwencje mikrosatelitarne mogą występować w intronach (przykładem są geny apolipoproteiny A oraz B świni) lub nawet w eksonach (gen kodujący huntingtynę u człowieka). (CA)nAT(CA)m lub też sekwencja przedzielająca jest otoczona różnymi powtarzającymi się motywami podstawowymi — np. CA) lub czteronukleotydowe (np. Zostały one określone terminem sekwencji mikrosatelitarnych. żel poliakryloamidowy + barwienie azotanem srebra) lub w automatycznym sekwenatorze DNA. Warto zaznaczyć. CATA) motywy podstawowe. dzięki wysokiemu polimorfizmowi i równomiernemu rozproszeniu w genomie. hybrydyzacji z sondami i wówczas analiza dotyczy równocześnie wielu loci. bo zawierających motyw podstawowy długości kilku nukleotydów.

ale może od267 . Mutacja punktowa prowadzi do powstania miejsca polimorficznego typu SNP. a także polimorfizmu konformacji jednoniciowych łańcuchów DNA (SSCP). w tym sekwencjonowanie. seauence characterized amplified region). prace nad ustaleniem sekwencji DNA genomu człowieka ujawniło co najmniej 1. Istotą obu metod jest identyfikacja mutacji punktowych w obrębie genów. Należy zaznaczyć. Jeśli amplifikowany fragment jest wystarczająco duży. są poddawane elektroforezie. jeśli każdy z alleli występuje w populacji z częstością nie mniejszą niż 1%. że markery RAPD czy SCAR mogą zawierać sekwencje kodujące lub niekodujące i dlatego ich jednoznaczna klasyfikacja do kategorii markerów klasy I lub II jest trudna. czyli nie wpływa na budowę polipetydu. Niewątpliwą zaletą polimorfizmu SNP jest jego powszechność w genomach różnych gatunków. co doprowadziło do identyfikacji markera specyficznego SCAR. spośród których większość występuje poza strukturą genów. został następnie molekularnie opisany. zaowocował identyfikacją nowej klasy markerów genetycznych. Analiza taka opiera się najczęściej na wykrywaniu polimorfizmu długości fragmentów restrykcyjnych (RFLP). Polimorficzny fragment. Wynika z tego. Po określeniu sekwencji tego fragmentu możliwe staje się ograniczenie analizy genetycznej do tego pojedynczego locus. Przykładem takiej procedury jest identyfikacja polimorficznego markera RAPD. amplifikowanego przez starter 5'-AGAATAGGC-3'. wykryty za pomocą techniki RAPD. Zidentyfikowanie takiego polimorficznego fragmentu pozwala na dalszą jego analizę. cichego podstawienia. w wyniku której uzyskuje się kilka prążków (fragmentów DNA różnej długości). które są wynikiem mutacji punktowych tworzących lub znoszących miejsce rozpoznawane przez losowy 10-nukleotydowy oligonukleotyd starterowy dla reakcji PCR. Dynamiczny rozwój badań. Zamplifikowane fragmenty. Polimorfizm SNP wiąże się zazwyczaj z obecnością w puli genowej populacji jedynie dwóch alleli. Na przykład. O metodach tych napisano w rozdziale: Metody analizy i modyfikacji genomu. Badając grupę osobników można stwierdzić różnice w układzie prążków. to możliwe jest jego zlokalizowanie w chromosomie (mapowanie fizyczne).4 mln miejsc SNP. reprezentujące zazwyczaj różne loci w genomie. np.AATCGGC oraz allel 2 — AATGGGC. określanych symbolem SNP (ang.kombinacji nukleotydów (zazwyczaj składa się z 10 nukleotydów). single nucleotide polymorphism). W ten sposób identyfikuje się markery określane skrótem SCAR (ang. których celem jest sekwencjonowanie genomów różnych gatunków. progressive rod-cone degeneration). allel l . który zlokalizowano w chromosomie 9 u psa. Polimorfizm ten związany jest z występowaniem pojedynczych zmian sekwencji nukleotydów w homologicznych sekwencjach. w której dominują nukleotydy C i G. charakterystycznego dla psów obciążonych chorobą genetyczną — postępującym zanikiem siatkówki (ang. Badanie polimorfizmu DNA jest powszechnie stosowane także dla markerów klasy I. że te proste podstawienie nukleotydów zazwyczaj ma charakter tzw.

następujące formy: allel l — TCGAATGAATT (insercja AAT) i allel 2 — TCGGAATT (delecja AAT). ocenie zmienności genetycznej wewnątrz i między populacjami (liniami) oraz szacowaniu dystansu genetycznego. P-ad i Q-b oraz typy białek TF-O. Ogromne nasycenie genomów markerami SNP sprawia coraz powszechniejsze ich wykorzystywanie w analizie genetycznej. w których występuje wiele antygenów.6. u bydła są to układy B (40 antygenów). PHI-I. tzw. Warunków tych nie spełnia ogier l. ES-I. D-cgm. natomiast u koni układy A (7 antygenów). D (17 antygenów). drugi od matki. u świń układy M (12 antygenów).działywać na ekspresję genu. Polimorfizm na poziomie sekwencji nukleotydów może być również związany z brakiem (delecja) lub wstawieniem (insercja) jednego lub kilku nukleotydów. Podstawą tej kontroli jest to. 268 . C (12 antygenów) oraz S (8 antygenów). że w fenotypie ojca musiały wystąpić antygeny erytrocytarne A-a. on zatem może być ojcem źrebięcia. Przykład kontroli pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych oraz białek surowicy krwi i erytrocytów przedstawiono w tabeli 11-V. Porównanie genotypów i fenotypów źrebaka i klaczy wskazuje na to. Jednakże niektóre z tych podstawień mogą wywoływać skutki fenotypowe. czyli markerów genetycznych klasy I. P (4 antygeny) i Q (3 antygeny). że potomek dziedziczy jeden allel z każdego locus od ojca. Do kontroli pochodzenia najlepsze są układy grupowe. MAS (ang. Jednak identyfikacja wielu miejsc SNP wymaga odwołania się do innych technik. E (17 antygenów) i L (12 antygenów). Zatem w przypadku grup krwi nie może on mieć antygenu erytrocytarnego. którego nie stwierdzono u jednego z rodziców. można wykluczyć jego ojcostwo. Spełnia je ogier 2. Do identyfikacji alleli SNP może być przydatna technika RFLP (jeśli mutacja zmienia sekwencję rozpoznawaną przez enzym restrykcyjny) lub SSCP. ocenie wartości genetycznej zwierząt pod kątem cech użytkowych i selekcji pośredniej. 11. marker assisted selection). ALB-A. Informacje o umiejscowieniu loci markerów genetycznych znajdują się w markerowych mapach genomu (rozdział: Mapy genomowe). Kontrola pochodzenia u zwierząt od wielu lat jest prowadzona na podstawie układów grupowych krwi i polimorficznych białek. w tym sekwencjonowania DNA. Ponieważ kontrola pochodzenia na podstawie polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorficznych białek surowicy krwi nie zawsze stwarza możliwość jednoznacznego wskazania pary rodzicielskiej. Wykorzystanie markerów genetycznych w hodowli zwierząt Markery genetyczne znajdują zastosowanie w pracy hodowlanej między innymi w kontroli pochodzenia. Tego typu markery opisywane są terminem InDel (Insertion Deletion polymorphism) i mogą mieć np.

W przypadku analizy polimorfizmu w jednym locus minisatelitarnym u potomka i jednego z rodziców (nie zawsze dysponujemy pełnymi danymi pochodzenia) prawdopodobieństwo wykluczenia obliczane jest ze wzoru: Gdy dostępne są informacje dotyczące polimorfizmu minisatelitarnego w DNA obojga rodziców i potomka. sekwencja minisatelitarna. jedna jest oparta na polimorfizmie minisatelitarnym. druga na polimorfizmie mikrosatelitarnym. prawdopodobieństwo wykluczenia obliczane jest ze wzoru: 269 . W celu określenia prawdopodobieństwa wykluczenia pochodzenia danego osobnika po danym rodzicu (-ach) stosowane są odpowiednie wzory.ostatnio coraz częściej są stosowane do tego celu markery genetyczne klasy II (niekodujące sekwencje DNA). Polimorfizm minisatelitarny jest podstawą metody „odcisku palca" DNA. Można wyróżnić dwie podstawowe metody stosowane do kontroli pochodzenia. którą jest np. 11-4). Dokładność kontroli pochodzenia można zwiększyć przez użycie w analizie kilku sond molekularnych. ale potomek otrzymuje od każdego z rodziców po jednym prążku („allelu") danej sekwencji (ryć. Daje to możliwość wykorzystania znacznie bardziej precyzyjnych kryteriów analizy genetycznej. W metodzie tej strawiony (pocięty) enzymem restrykcyjnym i rozdzielony elektroforetycznie DNA jest hybrydyzowany z sondą. Uzyskany obraz prążków jest charakterystyczny dla danego osobnika. Prawdopodobieństwo wystąpienia tego samego obrazu prążków u dwóch niespokrewnionych osobników jest minimalne.

Jak już wspomniano. analiza polimorfizmu w kilku loci minisatelitarnych równocześnie zwiększa dokładność kontroli pochodzenia. łączne prawdopodobieństwo wykluczenia dla wszystkich 270 . W takim przypadku określa się tzw.

natomiast trzeci — allel 263 pz. drugi od ojca. Ojciec jest homozygotą pod względem allelu długości 235 pz. w której stosuje się kilka markerów równocześnie. W ostatnich latach badacze coraz częściej zastanawiają się nad wykorzystaniem do kontroli pochodzenia polimorfizmu pojedynczych nukleotydów. szacowaniu zmienności genetycznej i dystansu genetycznego. jak i obojgu rodzicach: Druga metoda stosowana obecnie do kontroli pochodzenia wykorzystuje polimorfizm sekwencji mikrosatelitarnych. Wszystkie szczenięta są heterozygotami. Widoczny „pik" przy długości 270 pz jest to marker wielkości fragmentu DNA. Również to. ale także w poszukiwaniach genów ważnych z hodowlanego punktu widzenia. matka natomiast heterozygotą (jeden allel .243 pz. iż w niedalekiej przyszłości polimorfizm pojedynczych nukleotydów zastąpi sekwencje mikrosatelitarne nie tylko w kontroli pochodzenia. Długość alleli (produktu PCR — zamplifikowanych sekwencji mikrosatelitarnych) może być oznaczana za pomocą automatycznego sekwenatora. Krzywe 1-5 obrazują genotypy szczeniąt (3-5) oraz ich domniemanych rodziców — ojca (1) i matki (2). single nucleotide polymorphisms). Polimorfizm ten jest wynikiem mutacji punktowych (zamiana określonej zasady w danym nukleotydzie na inną). określanego symbolem SNPs (ang. sprawia. Zaletą SNPs jest bardzo duża gęstość ich rozmieszczenia w genomie (na przykład w genomie człowieka występują one co ok. przedstawiono na rycinie 11-5 (wkładka kolorowa). których częstość szacuje się na 10-2-10-5 na pokolenie. Wzór na obliczanie tego prawdopodobieństwa ma tę sama postać dla obu przypadków. że do identyfikacji genotypu w przypadku polimorfizmu pojedynczych nukleotydów można zastosować zdecydowanie więcej technik molekularnych niż do identyfikacji genotypu w loci mikrosatelitarnych. Przyczyną odchodzenia od wykorzystywania sekwencji mikrosatelitarnych w kontroli pochodzenia są głównie zachodzące w nich mutacje. W przypadku każdej sekwencji mikrosatelitarnej potomek otrzymuje jeden allel od matki. Przykład kontroli pochodzenia na podstawie sekwencji mikrosatelitarnej 2319 (powtórzenie 4-nukleotydowe) u lisów.badanych loci. dokładnie tak. dodawany do każdej próby DNA analizowanej za pomocą sekwenatora. jak to jest przy cechach monogenowych — jakościowych. drugi — 263 pz). 271 . przy czym allel długości 235 pz odziedziczyły po ojcu. 1300 par zasad). której długość określono metodą elektroforetycznego rozdziału w żelu poliakryloamidowym barwionym azotanem srebra oraz za pomocą automatycznego sekwenatora. Istnieje możliwość kontroli pochodzenia za pomocą PCR multipleks. dostępności informacji zarówno o jednym. Dwa z nich otrzymały od matki allel długości 243 pz.

czyli istotnych z hodowlanego punktu widzenia. U świń określono także regiony chromosomów sprzężone z cechami użytkowości mięsnej i rozpłodowej (tab. W przypadku tych cech jest już możliwa selekcja bezpośrednia. Większość cech użytkowych o znaczeniu ekonomicznym ujawnia się fenotypowo u zwierząt w określonym wieku (np. warunkujących cechy użytkowości mlecznej (tab. Identyfikacji genotypu w loci tych markerów daje 99. W metodzie tej kryterium wyboru zwierzęcia jest jego genotyp w locus markera genetycznego wykazującego asocjację z doskonaloną cechą użytkową. marker assisted selection). W takim przypadku selekcja pośrednia (MAS) jest znacznie bardziej intensywna i dokładna w porównaniu z selekcją tradycyjną. Cechy użytkowe (ilościowe) są determinowane przez wiele genów o małym efekcie każdego z nich. Wynika to z możliwości określenia genotypu u bardzo młodych zwierząt. Rozwój technik molekularnych przyczynił się do opracowania metody selekcji pośredniej nazwanej MAS (ang. Niektóre cechy użytkowe występują tylko u jednej płci lub nie można ich zmierzyć przyżyciowe. zwiększoną płodność owiec oraz geny białek mleka — κ-kazeiny i β-laktoglobuliny (jest o nich mowa w rozdziale: Zmienność cech). Cechy takie mogą być doskonalone jedynie poprzez selekcje pośrednią. Przykładem tego jest wykorzystanie markerów mikrosatelitarnych do identyfikacji obecności w genotypie heterozygotycznym recesywnego allelu rogatości u bydła.99% prawdopodobieństwa wykluczenia. o istotnym wpływie na cechy użytkowe. Markery genetyczne. że niektóre geny oddziałujące na wartość cechy ilościowej mają ogromne znaczenie. głównie klasy II. Należą do nich między innymi geny warunkujące hipertrofię mięśniową u bydła i owiec. dlatego identyfikacja ekspresji tych genów jest znacznie utrudniona. Znając sprzężenie między określonym markerem genetycznym a np.Badacze niemieccy wybrali na razie 60 SNPs do kontroli pochodzenia u bydła holsztyńsko-fryzyjskiego. Analiza asocjacji między markerami mikrosatelitarnymi a cechami ilościowymi jest pierwszym krokiem do identyfikacji genów „ważnych". Wykorzystując markery mikrosatelitarne wykryto u bydła kilka loci znajdujących się w różnych chromosomach. Geny takie nazwano głównymi lub genami o dużym efekcie. 11-VI). a postęp genetyczny jest uzyskiwany w krótszym czasie. wydajnością białka w mleku. której kryteriami są genotypy zwierząt w danych loci. są również pomocne w doskonaleniu niektórych cech jakościowych. Okazało się. Badania asocjacji markerów genetycznych z cechami ilościowymi zaowocowały już wykryciem u większości gatunków zwierząt gospodarskich sporej liczby loci genów ważnych. Sekwencje mikrosatelitarne są bardzo pomocne w analizie genetycznego tła cech ilościowych. 11-VII). jaka będzie wartość tej cechy w przyszłości. można dla młodej jałówki określić. Prowadzone są badania w celu znalezienia takich genów. Jest to cecha dziedzicząca 272 . cechy użytkowości mlecznej). zwiększoną plenność świń. które mają znaczący wpływ na kształtowanie się cech użytkowych. brunatnego szwajcarskiego i simentali.

której fenotyp jest taki sam u osobnika homozygotycznego i heterozygotycznego. w których coraz więcej uwagi poświęca się dobrostanowi zwierząt. Problem eliminacji z populacji genu rogatości jest dość istotny w krajach zachodnich. Posiadanie rogów jest cechą niekorzystną tak w aspekcie dobrostanu (gdyż może być przyczyną uszkodzeń ciała). jak również intensywnej hodowli (zasiniaczenia i ukryte 273 .się z dominacją całkowitą.

dzięki czemu nosiciele niekorzystnych alleli mogą być wykrywani. Znaczenie markerów genetycznych w hodowli zwierząt podkreśla to. 274 . Charakterystyka wybranych markerów genetycznych pozwala śledzić wpływ pracy selekcyjnej na strukturę genetyczną danej populacji. Znane są już dwie sekwencje mikrosatelitarne. które cechuje duża zmienność genetyczna. jak określone geny ulegają eliminacji równolegle z eliminacją cech niekorzystnych z hodowlanego punktu widzenia. Szczególne znaczenie mają badania związku między antygenami/genami głównego układu zgodności tkankowej (MHC) a występowaniem chorób. występuje w l chromosomie. Stosowany w stadach bydła mięsnego zabieg usuwania rogów powoduje cierpienie zwierząt oraz zmniejszenie ich dziennych przyrostów. Markery genetyczne są także niezwykle przydatne w szacowaniu stopnia zinbredowania (homozygotyczności) poszczególnych populacji (linii). że locus polled.uszkodzenia tusz są przyczyną istotnych strat ekonomicznych w produkcji żywca). Zmienność genetyczna w obrębie ras ginących lub uznanych za zagrożone jest określana na podstawie polimorfizmu markerów genetycznych. Dotychczas wiadomo jedynie. że są one wykorzystywane do analizy zmienności genetycznej w ramach programów Światowej Strategii Zachowania Zasobów Genetycznych Zwierząt Gospodarskich FAO (Global Strategy for the Farm Animal Genetic Resources). które mogą być wykorzystane do tego celu. a w krzyżowaniu towarowym uzyskanie maksymalnego efektu heterozji. Polimorfizm markerów genetycznych jest wykorzystywany w badaniach nad odpornością/podatnością zwierząt na różne choroby i zaburzenia genetyczne. Zagadnienie to jest opisane w rozdziale: Genetyczne podstawy odporności i oporności. służy zachowaniu biologicznej różnorodności zwierząt gospodarskich. Identyfikacja nosicieli genu p może być przeprowadzana za pomocą analizy polimorfizmu sprzężonych z tym genem markerów genetycznych. jak i klasy II. przede wszystkim polimorfizmu antygenów erytrocytarnych (grup krwi) i polimorfizmu DNA mikrosatelitarnego. W badaniach z zakresu genetyki populacji znajdują zastosowanie zarówno markery genetyczne klasy I. coraz więcej uwagi poświęca się genetycznemu uwarunkowaniu bezrożności i możliwości prowadzenia selekcji w tym kierunku. kontrolujący bezrożność/rogatość u bydła. w której są uwzględnione zasady międzynarodowego porozumienia — Konwencji o Biologicznej Różnorodności. w analizie podobieństw i różnic między populacjami i ustalaniu dystansu genetycznego między nimi. ujawniającego się głównie zwiększeniem wydajności cech użytkowych zwierząt. sprzężone z locus polled. Z kolei ocena zmienności genetycznej między populacjami (liniami) ułatwia wybór optymalnego wariantu krzyżowania. zwłaszcza infekcyjnych. ponadto jest zabiegiem kłopotliwym. zanim wystąpią objawy chorobowe. Szacowanie dystansu genetycznego i wybór ras. Zastosowanie frekwencji alleli markerów genetycznych klasy I do szacowania zmienności genetycznej wewnątrz i między populacjami omówione zostało w rozdziale: Podstawy genetyki populacji. Aby tego uniknąć.

czyli geny. Sekwencje powtarzalne 275 . Składa się na nią przede wszystkim DNA jądra komórkowego oraz DNA występujący w mitochondriach (mtDNA). Całkowita długość genomu u ssaków. która odzwierciedla częstość zachodzenia crossing over między loci sprzężonych genów. Miejsca te można wybarwić metodą barwienia prążkowego typu T. Odległości między sprzężonymi ze sobą genami można wyrazić za pomocą jednostki względnej — centymorgana (cM). Przyjmuje się. Organizacja DNA jądrowego W obrębie genomu występują zarówno sekwencje kodujące. Zdecydowanie przeważają sekwencje niekodujące. że w genomie ssaków występuje około 35 tysięcy genów. które stanowią około 97% całego DNA (ryć. wyrażona w cM. Wreszcie genom może być opisany za pomocą całkowitej liczby loci genów.1. dlatego pojęcie genomu odnoszone jest do DNA jądrowego. jak i sekwencje niekodujące. Genom może być opisany za pomocą kilku parametrów. jest to haploidalna liczba chromosomów charakterystyczna dla gatunku. Miejscami silnie nasyconymi genami są regiony występujące na końcach ramion chromosomowych. Ponieważ długość cząsteczki mtDNA jest niezmiernie mała w porównaniu z DNA haploidalnego zestawu chromosomów. Wielkość ta zawiera się u ssaków w przedziale między 2 a 3 miliardy par zasad.Rozdział 12 Mapy genomowe Genom jest pojęciem określającym zbiór informacji genetycznej zawartej w gamecie. Rozmieszczenie loci genów w genomie jest nierównomierne. Tam też znacznie częściej zachodzi crossing over. Po pierwsze. 12-1). U zwierząt gospodarskich wielkość ta oscyluje wokół 2500 cM. Drugim parametrem jest łączna długość DNA występującego w haploidalnym zestawie chromosomów. mieści się w przedziale od 1600 cM (mysz) do 3200 cM (człowiek). 12.

W genomie występują duże skupienia sekwencji niekodujących w obrębie heterochromatyny konstytutywnej. Szczególnie cenne. którą uwidocznia się metodą barwienia prążkami C. że w genomie ludzkim sekwencje te pojawiają się przeciętnie co kilka tysięcy par zasad. Szacuje się. Sekwencje mikrosatelitarne okazały się bardzo bogatym źródłem wysoce polimorficznych markerów genetycznych. Cechą charakterystyczną sekwencji powtarzających się tandemowo jest to.dzieli się na dwie podstawowe grupy: a) sekwencje powtarzające się tandemowo i b) elementy nukleotydowe. sekwencje powtarzalne są rozproszone również w obszarach euchromatynowych. ale w każdym z tych miejsc (loci) sekwencja ta powtarza się wielokrotnie w układzie tandemowym (jeden za drugim). że liczba powtórzeń danego układu podstawowego wykazuje w obrębie 276 . że dana sekwencja nukleotydów (układ podstawowy) występuje w wielu miejscach genomu. Niezależnie od tego. jest to. z punktu widzenia przydatności tych sekwencji do analizy genetycznej. Oznacza to. że genom jest bardzo silnie nimi nasycony. Zależnie od długości układu podstawowego sekwencje powtarzalne dzielone są na mikrosatelitarne (do 10 nukleotydów) i minisatelitarne (powyżej 10 nukleotydów).

Szczególnym przykładem sekwencji mikrosatelitarnych ze względu na funkcję biologiczną. Poszczególne chromosomy zajmują w jądrze wyodrębnione domeny.2. które różnią się między sobą liczbą powtórzeń podstawowego układu nukleotydów. Przy okazji badań molekularnych kompleksów synaptonemalnych okazało się. Zazwyczaj są one zlokalizowane w częściach dystalnych — tzn. która stanowi zakończenia ramion chromosomowych. Z kolei części chromosomów zbudowane z heterochromatyny konstytutywnej pozostają mocniej skondensowane i niejednokrotnie wykazują tendencje do tworzenia chromocentrów. że utrzymywana jest w nim nukleosomowa organizacja nici chromatynowej. przy czym domeny chromosomów homologicznych zazwyczaj nie kontaktują się ze sobą. Funkcją biologiczną tych sekwencji jest ochrona zakończeń chromosomów przed degradacją podczas kolejnych replikacji. jest do tej pory słabo rozpoznana. Inaczej mówiąc. Sekwencje te bardzo często są zlokalizowane w okolicach centromerów. że sekwencje te. ale w danym miejscu występuje tylko jedna kopia sekwencji. dla danego locus funkcjonują niejednokrotnie długie serie alleli wielokrotnych. leżą w pobliżu białkowych struktur kompleksów. Organizacja DNA mitochondrialnego Badania na zwierzętach i roślinach przyczyniły się do wykrycia obecności informacji DNA poza jądrem komórkowym — w mitochondriach (u roślin i zwierząt) i chloroplastach (u roślin). z wyjątkiem sekwencji telomerowych. których długość jest powyżej 500 pz i może dochodzić do kilku tysięcy pz. W przypadku sekwencji minisatelitarnych stopień równomierności rozproszenia w genomie jest mniejszy. w których asocjuje heterochromatyna z kilku chromosomów. podobnie jak elementy nukleotydowe. sekwencje te dzieli się na dwie grupy zależnie od ich długości: a) SINE (short interspersed nucleotide element). której nazwa pochodzi od enzymu restrykcyjnego mającego miejsce cięcia cząsteczki DNA w obrębie tej sekwencji. Elementy nukleotydowe to takie sekwencje. Przykładem elementu nukleotydowego z grupy SINE jest rodzina sekwencji Alu.populacji silne zróżnicowanie. Skróceniu ulegają właśnie sekwencje telomerowe. jest sekwencja telomerowa (TTAGGG/AATCCC). Funkcja sekwencji powtarzalnych. których długość mieści się poniżej 500 pz oraz b) LINE (long interspersed nucleotide element). które również są rozproszone w wielu miejscach genomu. Podobnie jak poprzednio. Może to świadczyć o roli tych sekwencji w kotwiczeniu domen pędowych DNA w strukturze białkowej kompleksu synaptonemalnego. 277 . 12. Organizacja chromatyny w jądrze interfazowym charakteryzuje się pewnymi szczególnymi cechami. w pobliżu końców ramion chromosomów. Na chromosomach ludzkich każdy telomer zawiera od 250 do 1500 powtórzeń tej sekwencji. Wiadomo.

Mitochondria należą do organelli komórkowych przekształcających energię. Zwielokrotnienie liczby kopii w oocycie jest częścią przygotowań tej komórki do podołania przez zygotę wymaganiom energetycznym związanym z wczesnym rozwojem zarodka lub zapewnieniem wystarczającej liczby kopii mtDNA dla pierwszych blastomerów zarodka. Informacja o składzie aminokwasowym tych białek jest zapisana w mitochondrialnym DNA. Większość komórek zawiera od tysiąca do 10 tyś. zatem muszą być syntetyzowane wewnątrz mitochondriów. Większość białek wchodzących w skład tych kompleksów jest kodowana przez DNA jądrowy. Białka będące podjednostkami enzymów łańcucha oddechowego (np. Porównanie liczby podjednostek białkowych kodowanych przez DNA mitochondrialny i jądrowy zawiera poniższe zestawienie. poza tym 2 rodzaje rRNA i 22 rodzaje tRNA. Wiadomo już. Całkowita liczba genów w ludzkim mtDNA wynosi 37. Geny kodujące białka i rRNA są od siebie oddzielone genami kodującymi tRNA. Jego długość wynosi około 16 tysięcy par zasad. ubichinon/koenzym Q. oxidative phosphorylation — OXPHOS). Struktura mtDNA jest inna niż DNA jądrowego. W nich odbywa się większość reakcji oddychania komórkowego. kopii mtDNA. mtDNA jest bowiem kolisty. przy czym kompleks V jest to syntaza ATP. cytochrom c czy oksydoreduktaza) należą do pięciu kompleksów oznaczonych cyframi rzymskimi I-V. Jedynie w oocytach II rzędu liczba kopii jest wyraźnie większa i sięga około 100 tyś. w których być może replikacja mtDNA nie zachodzi. 278 . Niektóre białka uczestniczące w oddychaniu nie mogą przechodzić przez błony organelli. że mitochondrialny DNA (mtDNA) koduje białka będące składnikami mitochondrialnego łańcucha oddechowego i systemu fosforylacji oksydacyjnej (ang. a tylko część przez mtDNA.

c) odległościach genetycznych. czyli tandemowo powtarzających się sekwencji anonimo wych (markery klasy II) w chromosomach. która wskazuje położenia loci w chromosomach. nazywa się cytogenetyczną lub fizyczną mapą genomu. dlatego niejednokrotnie mówi się o markerowej mapie genomu. transkrypcji podlegają obie nici kolistego DNA. Mapa. genów (markery klasy I). Markerowa mapa genomu Wiedza o lokalizacji genów oraz sekwencji niekodujących w DNA jądrowym jest bardzo słabo rozwinięta w porównaniu z wiedzą o mapie mtDNA. różnią się udziałem nukleotydów i dlatego wyodrębnia się łańcuch ciężki (H). Rola i zachowanie się mtDNA w dziedziczeniu pozajądrowym opisane są w rozdziale: Podstawowe mechanizmy dziedziczenia cech. w której obrębie występuje potrójna struktura DNA. a niektóre geny nawet nakładają się na siebie. co więcej. Z kolei mapa opisująca sprzężenia. Ponieważ mapy genomowe budowane są przede wszystkim na bazie polimorficznych markerów genetycznych. która przebiega równocześnie. że geny mitochondrialne nie zawierają intronów. wchodzące w skład cząsteczki mtDNA.3. Dlatego w dalszej części tego rozdziału będą omówione zagadnienia związane z poznawaniem (mapowaniem) DNA jądrowego. ale w przeciwnych kierunkach. Markerowa mapa genomu jest zbiorem informacji o: a) położeniu loci sekwencji kodujących. W mtDNA występuje jedno miejsce inicjujące transkrypcję. 12. który ma większy udział nukleotydów guanylowych — G i tymidylowych . wyrażonych w cM. a na łańcuchu lekkim umiejscowiony jest tylko jeden gen kodujący białko i 8 genów kodujących cząsteczki tRNA.T niż łańcuch lekki (L). który stanowi dominującą część genomu. Na łańcuchu ciężkim występuje 12 genów kodujących białka oraz 14 genów kodujących cząsteczki tRNA i 2 geny kodujące rRNA. pomiędzy sprzężo nymi loci oraz ich uszeregowaniu. b) stopniu polimorfizmu w obrębie znanych loci (wykaz alleli).DNA występujący w mitochondriach nie jest powiązany z białkami. uszeregowanie i odległości genetyczne pomiędzy takimi loci określana jest terminem genetycznej lub sprzężeniowej mapy genomu. a sekwencje powtarzające się tandemowo są reprezentowane bardzo nielicznie. w odróżnieniu od DNA jądrowego. Łańcuchy komplementarne. Kolejną cechą charakterystyczną mtDNA jest to. tzn. i niekodujących. pozostający w asocjacji z cząsteczką macierzystą. W strukturze łańcucha ciężkiego wyróżnia się również pętlę D. uformowana przez krótki fragment nowego łańcucha H. Prawie cały mtDNA zawiera sekwencje kodujące. na obu łańcuchach. 279 .

Różnica między DNA genu a jego cDNA polega na tym.3. 280 .12. na bazie którego syntetyzowano cDNA. na przykład mikrosatelitę — marker klasy II. że w cDNA nie występują introny. Sonda jest to sklonowana molekularnie sekwencja nukleotydowa. Fizyczna mapa genomu Podstawową. która powstała na drodze syntezy DNA z udziałem enzymu odwrotnej transkryptazy na bazie wyizolowanego mRNA. Często sondę stanowi tzw. ale nie jedyną. metodą mapowania fizycznego jest hybrydyzacja in situ pomiędzy zdenaturowaną i wyznakowaną sondą DNA a zdenaturowanymi chromosomami metafazowymi utrwalonymi na preparacie mikroskopowym. cDNA (komplementarny DNA) genu. sekwencje intronowe zostały już wcześniej wycięte podczas obróbki potranskrypcyjnej (ang.1. ponieważ w mRNA. Tak utworzony cDNA jest wbudowywany do wektorów i klonowany. reprezentująca gen (lub jego część) bądź fragment DNA obejmujący niekodującą sekwencję. Jest to taka sekwencja nukleotydowa.

Analizę taką określa się terminem porównawczego malowania chromosomów (ang. Lokalizacja markera mikrosatelitarnego ZuBeCa4 metodą fluorescencyjnej hybrydyzacji in situ (ang. Ponadto. że do identyfikacji chromosomu. świecenie barwnika flurescencyjnego związanego z sondą) na obszarze całego chromosomu (ryć. Warto wspomnieć o dwóch: tzw. Malowanie chromosomów polega na zastosowaniu sondy. (b) ta sama metafaza po hybrydyzacji. comparative chromosome 281 . chromosome painting) i mapowaniu na chromatynie jąder interfazowych. Podejście takie jest alternatywne w stosunku do klasycznej procedury opartej na identyfikacji chromosomów za pomocą barwień prążkowych. w którym sonda połączy się z DNA chromosomu. gdzie sonda hybrydyzowała z DNA chromosomu splicing). (a) chromosomy barwione metodą prążków Q. FISH) na chromosomie 3 psa. które w ostatnim czasie są szeroko wykorzystywane do opisu genomu zwierząt. 12-3. jasne punkty wskazują miejsce. Schemat mapowania genów metodą hybrydyzacji in situ jest przedstawiony na rycinie 12-2. Trzeba podkreślić. które stosuje się albo przed hybrydyzacją. dzięki wyznakowaniu sondy pierwiastkiem promieniotwórczym lub analogiem jednego z nukleotydów. wykorzystuje się techniki prążkowego barwienia (G. jest rozpoznawane przez obserwację mikroskopową. Miejsce. która zawiera unikatowe sekwencje DNA wybranego chromosomu. 12-3). albo po hybrydyzacji. Hybrydyzacją in situ ma wiele odmian. Kolejnym etapem jest amplifikacja (metoda PCR) lub klonowanie molekularne fragmentów DNA tego chromosomu. W trakcie amplifikacji blokowane są sekwencje powtarzalne i dzięki temu następuje zwielokrotnienie unikatowych sekwencji nukleotydowych danego chromosomu. Pierwszym etapem prowadzącym do uzyskania takiej sondy jest pozyskanie jednorodnej frakcji wybranego chromosomu na drodze ich sortowania w cytometrze przepływowym lub mikrodysekcji przeprowadzonej za pomocą mikromanipulatora na preparacie mikroskopowym. 12-4 wkładka kolorowa). związanego z barwnikiem fluorescencyjnym (ryć. technika ta wykorzystywana jest do identyfikacji homologii między chromosomami różnych gatunków. Przeprowadzenie hybrydyzacji in situ z użyciem takiej sondy daje efekt w postaci sygnału (np. malowaniu chromosomów (ang.Ryć. zgodnie z przyjętym wzorcem kariotypu. Q lub R). Stosowanie techniki malowania chromosomów umożliwia detekcję mutacji genomowych (głównie aneuploidii) i chromosomowych.

stosuje się do hybrydyzacji na preparatach chromosomowych pochodzących od innego gatunku (np. konia czy świni można zidentyfikować ponad czterdzieści fragmentów chromosomowych. które są „malowane" sondami reprezentującymi wszystkie chromosomy człowieka (tab. że sondę chromosomowo specyficzną. że zmiany na poziomie chromosomowym. bydła). Przeprowadzone eksperymenty ujawniły. W ten sposób można wskazać. jakie zaszły podczas ewolucji. są bardzo złożone. które chromosomy bydła zawierają fragmenty homologiczne względem konkretnego chromosomu ludzkiego. Dowodzi to. Należy jednak 282 . że w genomach bydła.painting) i polega ona na tym. 12-1). utworzoną dla jednego gatunku (np. człowieka).

że są położone w jednym chromosomie. że sonda chromosomowo specyficzna da widoczny sygnał. Okazuje się jednak. które zawsze pojawiają się razem. czyli 40 (mysz) plus 60 (bydło) daje 100 chromosomów. komórki nowotworowe myszy). że w warunkach in vitro doprowadza się do połączenia komórek pochodzących od dwóch różnych gatunków. Liczba zachowanych chromosomów zazwyczaj jest rzędu kilku. której celem jest identyfikacja białek lub markerów DNA typowych dla komórek gatunku. a zatem fragmentacja chromosomów. Dużą rolę w postępie mapowania genomów odegrała metoda hybrydyzacji komórek somatycznych. 0 ich umiejscowieniu wiadomo jedynie tyle. to stopniowo „gubione" są chromosomy. jeżeli obejmuje segment długości co najmniej kilku milionów par zasad. ale czasami może się zdarzyć tak. że metoda malowania chromosomów ma ograniczoną dokładność. Efektem naświetlania jest powstanie licznych pęknięć cząsteczek DNA. nieznana pozostaje również wzajemna odległość między nimi. W ten sposób w komórkach hybrydowych zachowane są fragmenty chromosomów gatunku mapowanego. Polega ona na poddawaniu komórek gatunku mapowanego. np. Tak wyprowadzone klony poddawane są analizie elektroforetycznej. naświetlaniu promieniami jonizującymi. naświetlanie fibroblastów psa promieniowaniem o dawce 5000 radów dało fragmenty o średniej wielkości około 16. Loci takie nazywa się syntenicznymi. że tylko pojedyncze chromosomy bydła zostaną zachowane w danym klonie komórkowym. które będą się między sobą różniły liczbą zachowanych chromosomów bydła. Sytuacja taka świadczy o tym.zaznaczyć. Komórki z pofragmentowanymi chromosomami poddawane są hybrydyzacji. mysich komórek nowotworowych. że jeżeli takie komórki są hodowane w warunkach in vitro. Polega ona na tym. który jest to chromosom 1 w jakim regionie mieszczą się badane loci. utrzymywanych w hodowli. Lokalizacja chromosomowa grup syntenicznych wymaga przeprowadzenia badań cytogenetycznych. Na przykład. W tym przypadku są to chromosomy bydła.6 milionów par zasad. którego genom jest badany — w tym przykładzie są to komórki bydlęce. Objęcie badaniami dużej liczby klonów stwarza możliwość wykrycia w komórkach hybrydowych loci. które nie pochodzą z komórek nowotworowych. że grupa tych loci jest położona w tym samym chromosomie. W rezultacie można wyprowadzić klony (komórki będące potomstwem jednej wyjściowej komórki). których celem jest identyfikacja chromosomu (-ów) gatunku mapowanego w danym klonie hybrydowym. podczas której dochodzi do fuzji fragmentów chromosomowych z chromosomami komórek nośnikowych. z fibroblastami pochodzącymi z mięśni czy skóry bydła. Komórki takie po połączeniu powinny mieć liczbę chromosomów odpowiadającą sumie liczb diploidalnych u obu gatunków. a w każdej 283 . przyjmuje się bowiem. przed hybrydyzowaniem z komórkami nośnikowymi (np. Do techniki uzyskiwania hybrydowych linii komórek somatycznych została ostatnio wprowadzona istotna modyfikacja. Nie można natomiast wskazać.

Najpierw poszukuje się sprzężeń pomiędzy loci. ze względu na zbyt małe prawdopodobieństwo zajścia crossing over. Dalej. wykorzystywane w mapowaniu radiacyjnym. w czym pomocne może być przeanalizowanie rodzin z równoczesnym uwzględnieniem trzech loci (tzw. na podstawie liczby zidentyfikowanych rekombinantów szacuje się odległości genetyczne (cM) między sprzężonymi loci. w takim przypadku bowiem analiza segregacji alleli (mapowanie genetyczne) jest nieefektywna. Do wykrywania sprzężeń jest stosowana powszechnie funkcja zwana logarytmem ilorazu wiarogodności (ang. loci). lub 12 tyś. 12. że klasyczne mapowanie sprzężeniowe nie pozwala na określenie odległości genetycznej. 0. Wielkość uzyskiwanych fragmentów chromosomowych zależy od dawki promieniowania jonizującego — czym większa dawka. przez którą rozumie się najmniejszą odległość między loci sąsiednich markerów możliwą do wykrycia. Odległość taka oznacza.. wynoszą zazwyczaj 5 tyś.. Uzyskiwanie małych fragmentów chromosomowych zwiększa rozdzielczość mapowania. Zaletą tej techniki mapowania jest możliwość identyfikacji loci markerowych położonych bardzo blisko siebie. L .z uzyskanych linii hybrydowych zachowane fragmenty chromosomowe stanowiły około 20% genomu psa. Dawki promieniowania jonizującego.. Jednostką odległości genetycznej jest l cM. tym mniejsze fragmenty. względem hipotezy alternatywnej. przyjmującej niezależne dziedziczenie (r = 0. Kolejność postępowania jest następująca. Tak zmodyfikowaną technikę hybrydyzacji komórek somatycznych określa się terminem mapowania radiacyjnego. u potomstwa osobników o znanych genotypach. W tym celu korzysta się z wiedzy o genotypach osobników 284 . służy tworzeniu genetycznej mapy genomu.5) r . obliczana jako prawdopodobieństwo wystąpienia określonych genotypów. że crossing over między dwoma sprzężonymi loci zachodzi jeden raz na sto podziałów mejotycznych. Poznanie wzajemnych odległości między sprzężonymi loci stwarza warunki do poznania ich uszeregowania. zawierający się w przedziale (0.współczynnik rekombinacji. które odzwierciedlają częstość. Dotyczy to szczególnie loci o niskim stopniu polimorfizmu. Genetyczna mapa genomu Analiza segregacji alleli w loci markerowych.2. na tyle blisko. przy założonym współczynniku rekombinacji (r). krzyżówka trójpunktowa).funkcja wiarogodności. z jaką zachodziło crossing over między nimi podczas gametogenezy u rodziców. radów.5) Badanie sprzężenia dokonuje się poprzez analizę segregacji genów w dwóch loci.3. 7 tyś.

należących do rodzin co najmniej dwupokoleniowych. Jednak nie wszystkie kojarzenia są informatywne. Jeżeli oboje rodzice są homozygotami w obu loci, to oczywiście identyfikacja segregantów jest niemożliwa. Z kolei, jeżeli oboje rodzice są heterozygotami o identycznych allelach, to niemożliwe jest ustalenie fazy (cis lub trans), w jakiej allele analizowanych loci występują u rodziców. Tego typu kojarzenie też nie jest informatywne. Wynika z tego, że informatywne są kojarzenia typu podwójna heterozygota z podwójną homozygotą lub kojarzenie między heterozygotami, u których w badanych loci występują różne ałlele. Obliczenie wartości loci przeprowadza się dla z góry założonych wartości współczynnika rekombinacji (r), mniejszych niż 0,5. Jeżeli wartość loci, dla niektórych wielkości współczynnika rekombinacji, będzie większa niż 3,0, to oznacza, że analizowane loci są ze sobą sprzężone. Największą wartość loci przewyższającą 3,0 uznaje się za oszacowanie współczynnika r, czyli częstości, z jaką dochodzi do rekombinacji między analizowanymi loci. Wartość loci mniejsza niż —2 oznacza, że dla testowanej wartości współczynnika r nie stwierdza się sprzężenia między analizowanymi loci. Natomiast wartości z przedziału ( — 2; 3) nie pozwalają na wyciągnięcie jednoznacznego wniosku dotyczącego sprzężenia, czyli analizowany materiał rodzinowy był zbyt mały lub loci były ze sobą na tyle słabo sprzężone, że zachowują się tak jakby się dziedziczyły niezależnie. Badanie sprzężenia polega na wyliczaniu wartości loci dla kolejnych wielkości współczynnika r (np. 0,1; 0,2; 0,3; 0,4). Jeśli dla wszystkich testowanych wielkości współczynnika r wartość loci jest mniejsza niż —2,0, to można przyjąć, że badane geny nie są ze sobą sprzężone. Pojawienie się wartości loci powyżej 3,0 dowodzi, że geny są ze sobą sprzężone i równocześnie poznajemy współczynnik r. Jeśli wartość loci mieści się między —2,0 i 3,0, to należy zwiększyć liczbę badanych rodzin, tak aby dojść do wiążących wniosków. Po ustaleniu, że loci są ze sobą sprzężone, można przystąpić do oszacowania odległości genetycznej między nimi. W tym celu wykorzystywana jest tzw. funkcja Kosambiego (x), która wyraża odległości genetyczne między sprzężonymi loci w centymorganach (cM).

r - - oszacowana częstość rekombinacji między analizowanymi loci Funkcja ta uwzględnia dwie okoliczności wpływające na częstość identyfikowanych zjawisk crossing over. Po pierwsze, bierze pod uwagę to, że identyfikacja rekombinantów w potomstwie pozwala na wykrycie tylko nieparzystych przypadków crossing over, parzysta ich liczba bowiem nie zmienia układu alleli w chromatydzie i tym samym nie pojawiają się w potomstwie osobniki o zrekombinowanym układzie alleli. Po drugie, brane jest pod uwagę zjawisko interferencji, polegające na tym, że zajście crossing over w danym miejscu wpływa ograniczająco na możliwość
285

powtórnego wystąpienia crossing over w pobliżu. Należy podkreślić, że do obliczania funkcji loci oraz funkcji Kosambiego opracowano programy komputerowe. Wyniki badań nad częstością crossing over ujawniły ciekawą zależność polegającą na tym, że długość genetyczna chromosomu, szacowana na podstawie rekombinacji zachodzącej w gametogenezie żeńskiej, jest zazwyczaj większa, aniżeli w przypadku gdy podstawą takiego oszacowania były rekombinacje zachodzące podczas spermatogenezy (ryć. 12-5). Można zatem sądzić, że w oogenezie crossing over zachodzi częściej aniżeli w spermatogenezie. Brak jest jednoznacznej odpowiedzi na pytanie, dlaczego tak jest. Być może prawidłowość ta wynika ze specyfiki spermatogenezy, podczas której jest wytwarzanych nieporównanie więcej gamet niż podczas oogenezy i dlatego żeńska rekombinacja wewnątrzchromatydowa (crossing

286

over) zachodzi z większym nasileniem, aby dorównać ogromnej zmienności genetycznej wśród plemników. Trzeba też pamiętać, że chiazmy utrzymują strukturę biwalentu w oocycie przez znacznie dłuższy czas niż w sperma tocy cię. Należy również podkreślić, że odległości genetycznej (cM) między sprzężonymi loci nie można w bezpośredni sposób przeliczać na odległości fizyczne, mierzone np. liczbą par zasad, jaka je dzieli. Przyjmuje się z dużym przybliżeniem, że odległość 1 cM odpowiada długości cząsteczki DNA, liczącej około jednego miliona par zasad. Brak prostej zależności między odległością względną i bezwględną wynika z tego, że losowość zachodzenia crossing over jest ograniczona tym, iż w chromosomie są obszary, gdzie zachodzi ono znamiennie częściej (prążki T), oraz takie, gdzie zdarza się bardzo rzadko (heterochromatyna konstytutywna).

12.3.3. Strategia mapowania genomu
Markerowa mapa genomu powinna charakteryzować się kilkoma cechami, które wyznaczają jej wartość poznawczą i aplikacyjną. Po pierwsze, markery genetyczne powinny być możliwie wysoce polimorficzne, tzn. w puli genowej populacji powinna występować możliwie długa seria alleli wielokrotnych. Wykrycie w drugiej połowie lat 80. wysoce polimorficznych sekwencji anonimowych typu mini- i mikrosatelitarnego spowodowało, że markery zostały podzielone na dwie klasy. Do klasy I zostały zaliczone klasyczne markery genetyczne (sekwencje kodujące, czyli geny). Polimorfizm tych markerów identyfikowany jest na poziomie produktu, za pomocą metod serologicznych — układy grupowe krwi, antygeny głównego układu zgodności tkankowej itd. lub elektroforezy — polimorficzne białka surowicy krwi, mleka itd. Możliwe jest również wykrywanie polimorfizmu tych markerów poprzez badanie polimorfizmu DNA tych genów metodami opartymi na elektroforezie (RFLP i SSCP). W grupie markerów klasy II znalazły się wszystkie rodzaje polimorfizmu związane z niekodującymi sekwencjami nukleotydowymi, a wśród nich główną rolę odgrywają sekwencje mikrosatelitarne. Metody analizy ich polimorfizmu opisano w rozdziale: Markery genetyczne. Ważną cechą mapy genomu jest równomierność rozproszenia loci markerowych. Początkowo zakładano, że stopień równomierności powinien być taki, aby maksymalna odległość genetyczna między dwoma dowolnymi sąsiednimi loci nie przekraczała 20 cM. Spełnienie tego warunku stwarza sytuację, w której dowolny locus genu znajduje się w odległości nie większej niż 10 cM od jakiegoś markera. Odległość taka pozwala zidentyfikować położenie dowolnego genu, gdy w badaniach rodzinowych analizowane loci markerowe byłyby rozproszone równomiernie w całym genomie, a gen będący obiektem zainteresowania byłby reprezentowany w analizowanej
287

rodzinie przez więcej niż jeden allel. Obecnie stopień nasycenia map genomowych podstawowych gatunków zwierząt gospodarskich jest znacznie większy i w przypadku bydła oraz świń kształtuje się poniżej poziomu 3 cM. Kolejną istotną cechą mapy genomu jest informatywność jej mapy fizycznej. Zakłada się, że na każdym ramieniu chromosomu powinny być zlokalizowane co najmniej dwa markery, jeden w pobliżu centromeru (marker proksymalny), a drugi w końcowej części ramienia (marker dystalny). Spełnienie tego kryterium dowodzi, że na obszarze całego genomu zostały zlokalizowane markery genetyczne. Ostatecznym celem programów budowania map genomowych jest stworzenie zintegrowanej mapy, tzn. takiej, w której wszystkie grupy genów sprzężonych oraz syntenicznych mają znaną lokalizację chromosomową. Taka mapa może być przedmiotem porównania z najbardziej rozwiniętymi mapami, do których zalicza się mapę genomu człowieka i myszy. Porównanie to odnosi się przede wszystkim do lokalizacji tzw. loci zakotwiczonych (ang. anchor loci). Należą one do markerów klasy I, o których wiadomo, że są równomiernie rozproszone w genomie człowieka, myszy, kota i bydła. Z przeprowadzonych badań porównawczych wynika, że w genomach tych gatunków odległości między dwoma dowolnymi loci zakotwiczonymi mieszczą się w granicach od 5 do 10 cM. Przyjmuje się, że ich lokalizacja odzwierciedla obszary konserwatywne pod względem ewolucyjnym. Konserwatyzm genetyczny jest równie często wykorzystywany w mapowaniu fizycznym markerów klasy I. Polega to na tym, że sondy molekularne uzyskane na bazie genomu jednego gatunku są przydatne do mapowania tegoż genu w genomie innego gatunku. Spełnienie podstawowych warunków dotyczących nasycenia mapy fizycznej i genetycznej genomu oznacza, że w przypadku genomu gatunków ssaków, których wielkość wynosi około 2500 cM, minimalna liczba równomiernie rozproszonych (na poziomie 20 cM) polimorficznych markerów genetycznych wynosi około 120. Oczywiście jest to rozważanie czysto teoretyczne, ponieważ przystępując do mapowania kolejnych markerów nie można przewidzieć, w którym miejscu mogą one mieć swoje loci. Może się zdarzyć tak, że wiele takich markerów zostanie zlokalizowanych w niewielu tylko chromosomach, lub wręcz w niektórych ich regionach. Wynika z tego wniosek, że osiągnięcie stanu równomiernego nasycenia mapy markerami genetycznymi wymaga zmapowania o wiele większej liczby loci, niżby to wynikało z teoretycznego wyliczenia. Wysiłkom skierowanym na tworzenie mapy markerowej towarzyszą prace, których celem jest identyfikacja genów kontrolujących cechy użytkowe zwierząt lub istotnie na nie wpływających. Osiągnięcie tego celu wymaga skrupulatnych obserwacji zmienności fenotypowej interesującej cechy w tzw. rodzinach referencyjnych. Są to zazwyczaj trzypokoleniowe rodziny, w których rodzice wywodzą się z odległych genetycznie ras lub nawet blisko spokrewnionych gatunków (np. świnia domowa i świnia dzika lub bydło domowe i bydło zebu). Duży dystans genetyczny (patrz rozdział: Podstawy
288

genetyki populacji) wskazuje, że pule genowe tych ras są inne zarówno ze względu na występowanie w populacjach różnych alleli dla danego locus, jak i różnic we frekwencji tych samych alleli. Zróżnicowanie to dotyczy tak loci markerowych, jak i loci genów wpływających na kształtowanie się cech będących obiektem zinteresowania hodowcy. Skrzyżowanie tak dobranych rodziców daje wysoce heterozygotyczne pokolenie Fl, które jest kojarzone między sobą w celu uzyskania pokolenia F2. W pokoleniu F2 analizuje się odległości genetyczne między markerami oraz asocjacje między markerami i cechami użytkowymi, będącymi obiektem zainteresowania hodowców. Zbudowanie markerowej mapy genomowej, która mogłaby być użytecznym narzędziem służącym do identyfikacji genów kontrolujących ważne cechy użytkowe, jest zadaniem wymagającym współpracy specjalistów z wielu dziedzin, takich jak: genetyka molekularna, immunogenetyka, cytogenetyka czy biometria. Przekracza to zatem możliwości pojedynczych zespołów badawczych. Na początku lat 90. zostały utworzone międzynarodowe programy badawcze. Jako pierwszy powstał program Mapowania Genomu Świni - - PiGMaP. W przedsięwzięcie to zostało włączonych kilkanaście laboratoriów, wywodzących się z państw Wspólnoty Europejskiej. Rok później, na podobnych zasadach, powołano Program Mapowania Genomu Bydła — BovMap. W tym programie zarejestrowano udział ponad dwudziestu laboratoriów. Oprócz tych dwóch wiodących programów rozwijały się inne międzynarodowe przedsięwzięcia, zmierzające do stworzenie mapy genomu kury, konia, owcy, kozy czy psa (DogMap). W niektórych programach biorą udział również polskie laboratoria (mapa genomu konia i psa, a także świni). Ponadto, powstało wiele przedsięwzięć realizowanych przez laboratoria jednego kraju. Na przykład, w Polsce prowadzono badania w ramach Polskiego Projektu Mapowania Genomu Świni, który był realizowany w ramach współpracy między trzema zespołami badawczymi. Głównym celem tego projektu było poszukiwanie genów głównych, oddziałujących istotnie na kształtowanie cech związanych z tuczem i użytkowością rzeźną.

12.3.4. Aktualny stan map genomowych zwierząt gospodarskich
Dynamiczny rozwój badań nad mapami genomowymi utrudnia prezentację aktualnego stanu wiedzy z tego zakresu. Nieomal każdy dzień przynosi nowe informacje wzbogacające mapy różnych gatunków. Dane pochodzące z drugiej połowy 1996 roku wykazały, że w genomie bydła opisano już ponad 1600 loci, a w genomie świni — ponad 1300 loci. Rok później liczba ta wzrosła do 3300 u bydła i 1600 u świni. Wśród loci markerowych zdecydowanie przeważają markery klasy II, a bardzo ważne jest to, że są one równomiernie rozproszone w genomach obu gatunków. Oczywiście są
289

regiony silniej nasycone markerami, gdzie odległość między sąsiednimi loci wynosi poniżej l cM, ale są również i takie, gdzie odległość ta sięga 20 cM. Można jednak stwierdzić, że zakładany na początku lat 90. podstawowy cel, polegający na zbudowaniu mapy, w której odległość między dowolnymi sąsiednimi loci nie będzie większa niż 20 cM, został w odniesieniu do genomu bydła i świni już osiągnięty (tab. 12-11). Opracowana w 1997 roku mapa genetyczna genomu bydła, oparta na analizie segregacji 1240 markerów, charakteryzuje się znacznym nasyceniem loci markerowych. Średnia odległość między dwoma dowolnymi sąsiednimi loci wyniosła 2,5 cM. Ogólną długość genomu, będącą sumą cząstkowych odległości między kolejnymi loci w chromosomach, oszacowano na poziomie 2990 cM. W przypadku świni mapę skonstruowano na podstawie analizy segregacji 1042 loci. Średnia odległość między sąsiednimi loci wyniosła 2,2 cM, a ogólna długość genomu — 2286 cM. Prawie wszystkie badane loci należały do kategorii anonimowych sekwencji mikrosatelitarnych. Na uwagę zasługuje bardzo rozwinięta mapa genomu kury (tab. 12-11). Zauważyć trzeba nie tylko dużą liczbę markerów wykorzystanych do budowy mapy sprzężeniowej, ale także i to, że całkowita długość mapy (3800 cM) jest znacznie większa niż w przypadku ssaków. Szerokie zastosowanie analizy molekularnej hybrydowych linii komórkowych, powstałych na bazie komórek poddanych napromieniowaniu (tzw. mapowanie radiacyjne) przyczyniło się do gwałtownego zwiększenia nasycenia map genomowycn loci markerowymi. Obecnie coraz częściej publikowane są mapy poszczególnych chromosomów, a nie całych genomów. Na mapach takich uwzględnione są dane pochodzące z mapowania fizycznego (informacje pochodzące z zastosowania techniki hybrydyzacji in

290

zostanie ustalona sekwencja genomu bydła. W ślad za programem sekwencjonowania genomu człowieka podjęto analogiczne przedsięwzięcia dotyczące gatunków zwierząt laboratoryjnych (sekwencję genomu myszy opublikowano w grudniu 2002 r. a także łososia i pstrąga tęczowego. analizy hybrydowych komórek somatycznych. Warto zwrócić uwagę.) i domowych. a w tym i konkretnych chromosomów. dla którego ustalono sekwencję nukleotydów. Przewiduje się. są coraz lepiej poznane. świni i kury. Szczegółowe dane dotyczące map poszczególnych genomów. a w tym także mapowania radiacyjnego) i sprzężeniowego. 12-111). że również mapy genomów innych gatunków zwierząt gospodarskich. bawoła. Tak opracowane mapy określane są terminem map zintegrowanych (ang. takie jak: lis pospolity. jest genom psa. Powiązanie ze sobą markerowych map genomowych z sekwencją DNA genomu danego gatunku umożliwi jeszcze efektywniejsze poszukiwanie genów o dużym znaczeniu w hodowli zwierząt. 291 . Opublikowano ją we wrześniu 2003 r. Wśród tych ostatnich pierwszym genomem. są zamieszczone w internetowych bazach danych (tab.situ. królika. obok wymienionych w tabeli 12-11. Do grupy gatunków objętych mapowaniem dołączyły ostatnio również zwierzęta futerkowe. comprehensive map). Coraz więcej informacji pojawia się o mapach: kota. że do 2005 r. lis polarny oraz jenot.

marmurkowatość mięsa. homozygot recesywnych 292 . które polega na opisie struktury genu. exudative — PSE). tak aby pojedynczemu osobnikowi można było przypisać wartość fenotypową w zobiektywizowanej skali. jak i jakościowe. odpowiedzialnych za występowanie różnych alleli. np. a konkretnie przez allel recesywny. tzn. ang. Najpierw ustalono. Procedura postępowania opiera się na ścisłej współpracy naukowców z hodowcami. wydajność białka w mleku. soft. że z tym markerem jest sprzężony gen kontrolujący kształtowanie się badanej cechy lub istotnie na nią wpływający (tzw. choroby genetyczne itp. mięso blade.12. miękkie i wodniste. gen główny w przypadku cech ilościowych). która ma istotne znaczenie gospodarcze. Mogą to być zatem zarówno cechy ilościowe. jak i genotypów w jak największej liczbie loci markerowych. zlokalizowanych w różnych miejscach genomu.5. pale. który znajduje zastosowanie w identyfikacji genotypu osobnika na podstawie bezpośredniej analizy DNA. bezrożność. Jednocześnie poznawany jest produkt tego genu oraz jego szczegółowa funkcja biologiczna. dzięki czemu śledzi się równocześnie segregację alleli w loci markerowych i fenotypów badanej cechy. którego celem jest identyfikacja nieznanego genu. jest pokazany na rycinie 12-6. Dzięki takiej mapie możliwe jest wykrycie sprzężeń między markerem (-ami) genetycznym (-i) o znanym położeniu na mapie a loci poszukiwanych genów. Osiągnięcie takiego poziomu wiedzy o genie zazwyczaj pozwala na opracowanie testu molekularnego (najczęściej typu PCR-RFLP). polegająca na klasyfikacji fenotypów dla interesującej cechy. Wykorzystanie markerowych map genomowych w hodowli Markerowa mapa genomu stała się nieodzownym narzędziem służącym do identyfikacji loci genów. wskazuje. a w tym przede wszystkim ustaleniu sekwencji nukleotydów i wskazaniu miejsc zmutowanych. Analizę taką prowadzi się w obrębie rodzin (zazwyczaj trzypokoleniowych). wydajność rzeźna. że cecha ta warunkowana jest monogenowo. Wykrycie sprzężenia jest pierwszym krokiem na drodze do molekularnego scharakteryzowania poszukiwanego genu. że allele któregoś z markerów kosegregują z określonymi fenotypami cechy. odporność na infekcje specyficznymi patogenami. Stwierdzenie. Hodowca wskazuje cechę.3. Następnie opracowano test (inhalacja halotanem) do identyfikacji zwierząt podatnych na stres. Następnie podejmowana jest żmudna analiza. Ogólny schemat postępowania. które z hodowlanego punktu widzenia mają istotne znaczenie. Punktem wyjścia jest precyzyjne opisanie zmienności cechy. Klasycznym przykładem wykorzystania badań markerów genetycznych do identyfikacji genu wpływającego na ważną cechę produkcyjną jest historia 20-letnich poszukiwań genu odpowiedzialnego za podatność świń na stres i związanej z tym zmniejszonej wartości technologicznej mięsa (tzw.

Odkrycie to pozwoliło na wskazanie enzymu restrykcyjnego HhaI. Loci tych markerów umiejscowiono. locus układu grupowego krwi H oraz loci polimorficznych białek krwi . np. Zamiana ta jest skutkiem tranzycji C→T w pozycji 1843 cDNA genu RYR1. Był nim gen receptora rianodyny (RYR1).Ryć. Na podstawie tego testu wprowadzono symbol HAL na oznaczenie genu. Badania molekularne tego genu u osobników wrażliwych na stres wykazały.GP7. które okazały się ściśle sprzężone z locus HAL.in. za pomocą hybrydyzacji in situ. Kilka lat później zidentyfikowano pierwsze markery genetyczne (m. 12-7a). Ogólny schemat postępowania zmierzającego do identyfikacji nieznanego genu o dużym znaczeniu hodowlanym. Wreszcie w 1991 roku zidentyfikowano gen kandydujący (ang. która polega na zamianie argininy na cysteinę w pozycji 615. że jedna z kilkunastu zidentyfikowanych mutacji punktowych prowadzi do zmiany w łańcuchu polipeptydowym. którego produkt jest zaangażowany w transport jonów wapniowych w mięśniach szkieletowych. candidate gene). 12-6. który nie rozpoznaje 293 . genu głównego wpływającego na kształtowanie poligenicznych cech produkcyjnych (nn). PGD i A1BG). w chromosomie 6 świni (ryć.

wiadomo było. w których prawdopodobnie występują geny główne kontrolujące: (e) otłuszczenie tuszy i tempo wzrostu/ (f) otłuszczenie tuszy i zawartość mięsa w tuszy sekwencji zawierającej mutację. podwójne umięśnienie) u belgijskiego bydła błękitnego zależy od recesywnego genu mh (ang. Poszukiwanie markerów genetycznych sprzężonych z locus mh pozwoliło ustalić. Od połowy lat 80. wywodzących się z rasy belgijskiej 294 . (d) PRKAG3 oraz regionów chromosomowych. Analiza molekularna tego genu u zwierząt z hipertrofią mięśniową. muscular hyperthrophy). Porównanie tego regionu z homologicznym segmentem chromosomu ludzkiego doprowadziło do wskazania w 1997 roku na gen miostatyny (MSTN). 12-7b). że gen ten jest położony w części przycentromerowej ramienia długiego chromosomu 2 bydła. W ten sposób opracowano test PCR-RFLP (patrz rozdział: Zmienność cech). Lokalizacja niektórych genów głównych o znanej już budowie molekularnej: (a) KYR1. że hipertrofia mięśniowa (tzw. który umożliwia wykrycie allelu recesywnego w genotypie homozygot recesywnych i heterozygot.Ryć. jako gen kandydujący do miana odpowiedzialnego za hipertrofię mięśniową (ryć. (b) MSTN. (c) BMPR-IB. 12-7.

Locus tego genu jest sprzężony z markerami mikrosatelitarnymi BM1329 i OarAE101. 12-7c). że mutacja polegała na braku (delecji) 11 nukleotydów. że w chromosomie 4 świni. Locus genu RN umiejscowiono w chromosomie 15. 295 . że gen FecB to zmutowana postać genu BMPR-IB. W początkowym stadium badań zakłada się. wpływający na plenność owiec rasy merynos booroola. a konkretnie kontrolujący liczbę owulujących oocytów podczas rui. Badania zmierzające do identyfikacji genów głównych. Mutacja polegała na zmianie sekwencji nukleotydów G > A w kodonie 200 tego genu. oraz zmienności cechy produkcyjnej w rodzinie referencyjnej (najczęściej 3-pokoleniowej) może doprowadzić do wskazania regionu chromosomowego. Badania molekularne genu MSTN w innych europejskich rasach mięsnych doprowadziły do identyfikacji kolejnych czterech. które ma mniejszą wartość technologiczną. Osiągnięcie to pozwala na ustalanie genotypu zwierząt metodami genetyki molekularnej (patrz rozdział: Zmienność cech). wskazała na obecność w ich genotypie dwóch zmutowanych allełi (homozygota recesywna). które umiejscowione są w chromosomie 6 (ryć. kwaśnego mięsa.błękitnej i asturiana. które w znaczący sposób wpływają na cechy użytkowe. zakończyły się wieloletnie poszukiwania genu RN. dzięki identyfikacji sprzężonych markerów mikrosatelitarnych Sw120 i Sw936 (ryć. który jest biologicznie nieaktywny. Okazało się. czyli genu głównego. Efektem zwiększonej zawartości glikogenu jest uzyskanie po uboju tzw. Przykładem może być gen FecB. Rozwijające się dynamicznie badania nad mapami genomów zwierząt gospodarskich umożliwiły identyfikację markerów genetycznych sprzężonych z różnymi genami głównymi. że jest nim zmutowany allel genu PRKAG3. pokrywających w miarę równomiernie większość genomu. W 1994 roku ukazała się praca dowodząca. nie udało się jeszcze wskazać genów kandydujących. 12-7d). a allel recesywny rn+ mniejszą zawartość glikogenu. które na poziomie molekularnym nie zostały dotychczas jeszcze rozpoznane. W 2001 r. Analiza segregacji licznych markerów genetycznych. który koduje podjednostkę y kinazy białkowej aktywowanej przez AMP. Substytucja A > G w tym genie odpowiada za wbudowanie w pozycji 249 łańcucha polipeptydowego argininy zamiast glutaminy. są prowadzone w licznych ośrodkach naukowych. różnych mutacji uszkadzających funkcję białka miostatyny. Dominujący gen RN~ powoduje większą. co fenotypowo objawia się hipertrofią mięśniową. Innym przykładem jest gen RN. Okazało się. Co więcej. ustalono. W 2000 r. Powoduje to zmianę siły wiązania ligandów przez receptor kodowany przez gen BMPR-IB. który odpowiada za zawartość glikogenu w mięśniach. że zmienność wybranej cechy produkcyjnej może zależeć od jakiegoś genu z dużym efektem działania. Skutkiem tej mutacji jest powstanie skróconego łańcucha polipeptydowego (przedwczesne pojawienie się kodonu „stop"). w którym prawdopodobnie występuje locus genu głównego.

chore cielę — homozygota recesywna). Sugestia ta została potwierdzona także w innych badaniach. występuje locus (loci?) genu głównego wpływającego na odkładanie tłuszczu brzusznego i zawartość mięsa w tuszy (ryć. Oznaczało to. W przypadku genu IGF2 ekspresji podlega jedynie allel pochodzący od ojca. Badacze francuscy wytypowali 75 rodzin (buhaj nosiciel. Nosicielstwo genu recesywnego bd stwierdzono w 1999 roku w genotypie francuskiego buhaja. W 2001 r. czyli duży efekt fenotypowy pojawia się tylko wtedy. 12-7f). że w chromosomie 14 zlokalizowany jest gen wpływający w znaczący sposób na wydajność i skład mleka.in. że w chromosomie 12. że również wiele krów było nosicielkami zmutowanego genu bd. doniesiono. że mutacja typu podstawienia dwunukleotydowego AA > GC w genie DGTA1 (acylo-CoA: diacylogliceroloacylotransferaza) wywołuje zmianę lizyny na alaninę. bulldog disease). wykazano. Można się spodziewać. Do tej pory jednak nie udało się zaproponować genu (-ów?) kandydującego. że mutacja w intronie 3 genu IGF2 (insulinopodobnego czynnika wzrostu 2) wywołuje bardzo duży wpływ na mięsność świń. w budowie czaszki. Osiągnięcie to pozwalało na identyfikację potomków buhaja nosiciela. w których przeprowadzono analizę dziedziczenia markerów genetycznych rozproszonych równomiernie po całym genomie. Odnotowano też znaczące osiągnięcie dotyczące bydła. Jednym z przykładów może być letalna wada rozwojowa — achondroplazja. W początkowym okresie jego użytkowania stwierdzono. W efekcie dochodzi do znacznego zwiększenia wydajności tłuszczu w mleku. 296 . Z kolei w październiku 2003 r. że około l % potomków był obarczony letalnymi zniekształceniami czaszki i kończyn. krowa nosicielka. a to upośledza funkcję kodowanego enzymu. Trzeba zaznaczyć. 12-7e). Prosta substytucja G > A prawdopodobnie zakłóca interakcję DNA z nieznanym białkiem represorowym. występuje prawdopodobnie locus (loci?) genu głównego wpływającego na tempo wzrostu oraz otłuszczenie tuszy (ryć. Z badań prowadzonych w rodzinach referencyjnych wynikało. którzy również byli nosicielami tego niepożądanego genu. określana symbolem bd (ang. Mapy genomowe są powszechnie wykorzystywane do identyfikacji genów odpowiedzialnych za monogenowe choroby genetyczne lub markerów genetycznych z nimi sprzężonych. Wkrótce potem udało się zidentyfikować marker genetyczny silnie sprzężony z genem bd. czego efektem jest 3-krotny wzrost ekspresji genu IGF2.między markerami S0001 i S0067. że wkrótce zostanie również zidentyfikowany gen odpowiedzialny za powstanie tej wady wrodzonej. gdy zmutowany allel jest odziedziczony od ojca. w wyniku wykorzystywania do inseminacji nasienia buhaja nosiciela. między markerami mikrosatelitarnymi S0083 i S0090. ze względu na wywoływane zmiany m. Dzięki temu udało się zapobiec rozprzestrzenianiu niepożądanego genu. Podobne badania przeprowadzone w ramach Polskiego Projektu Mapowania Genomu Świni sugerują. że gen ten podlega piętnowaniu gametycznemu. charakteryzującego się wybitną wartością hodowlaną. który odpowiadałby za kształtowanie tych cech ilościowych.

U gatunku tego znanych jest ponad 300 jednostek chorobowych uwarunkowanych przez mutacje pojedynczych genów. że genetyka molekularna stała się kluczowym narzędziem służącym postępowi w hodowli zwierząt. Niestety badań tych nie opublikowano. Szczególne osiągnięcia dotyczące identyfikacji genów odpowiedzialnych za rozwój monogenowych chorób dziedzicznych odnotowano u psów. a opracowany test molekularny skomercjalizowano. ciężki złożony niedobór odporności psów rasy welsh corgi czy fukozydoza u angielskich springer spanieli. Wśród nich są geny wywołujące takie schorzenia. narkolepsja u dobermanów i labradorów. W latach 2001-2003 podjęto udane próby terapii genowej niektórych chorób dziedzicznych psa (np. . Dotychczas opisano na poziomie molekularnym trzydzieści genów i ich mutacji odpowiedzialnych za rozwój choroby dziedzicznej.W tym samym czasie w populacji duńskiej bydła holsztyńsko-fryzyjskiego zidentyfikowano inną letalną wadę rozwojową. CVM — central vertebral malformation). Przedstawione powyżej przykłady wykorzystania markerowych map genomowych do rozwiązywania konkretnych problemów hodowlanych pokazują. dziedziczny zanik siatkówki u owczarków francuskich). a ostatnio scharakteryzowano gen oraz mutację w nim występującą. jak: dziedziczna dystrofia siatkówki u owczarków francuskich (briardów). polegającą na zniekształceniu kręgów (ang. Wiele z tych mutacji występuje w ściśle określonych rasach. Również dla tego genu udało się zidentyfikować sprzężone markery genetyczne.

L. Roitt. W. Michejdy).B. pod red. pod red. W. pod red. Największe wyzwanie współczesnej genetyki i medycyny molekularnej (1997). Poznawanie zasad dziedziczenia (1997). J. Rozwiązywanie problemów medycznych (2003). Wydawnictwo Polskiego Towarzystwa Zootechnicznego. Biotechnologia zwierząt (1997). ang.D. Waśniewska-Brzeska i J. Wydawnictwo Naukowe PWN. CRC Press Inc. A. King. Cytobiochemia (1995). Wydawnictwo Naukowe PWN. USA. Brzeski). K. Wydawnictwo Naukowe PWN. ang. J. J. pod red. Węgleńskiego. Bala. Leksykon biologiczny (1992).R. Wydawnictwo Medyczne Słotwiński Yerlag. B. pod red. P. Berg i M. Biologia molekularna w medycynie. Rosłanowskiego. Prószyński i S-ka. Elementy genetyki klinicznej (2001). L. ang. Warszawa. T. Wężyka. z j. Genetyka człowieka. Krzyżosiaka. Prus-Głowackiego). Genetyka molekularna (1995). Augustyniaka i J. Wydawnictwo Naukowe PWN.C. Singer (tłum. 298 . pod red. K. Kłyszejko-Stefanowicz. Warszawa.A. The Major Histocompatibility Complex Region of Domestic Animal Species (1996). Cz. Karty z Dziejów Zootechniki Polskiej. Wydawnictwo Naukowe PWN. Nowicki i wsp. Immunologia (1996). pod red. II— lata 1972^-1997 (1997). Cz. Modlińskiego. Wiedza Powszechna.J. Warszawa. L. Żeromskiego). Schook i S. A. Korf (przekład pod red. z j. R.Literatura uzupełniająca Podręczniki Biochemia (1997). Jeżyk genów. Juszczaka i S. Małe (tłum. Wydawnictwo Naukowe PWN. Stryer (tłum. J. P. Brown (przekład pod red. z j. D. pod red. Leksykon terminów z zakresu genetyki i hodowli zwierząt (1994). I. Wydawnictwo Naukowe PWN. pod red. Zwierzchowskiego. Wydawnictwo Naukowe PWN. W. Leksykon rozrodu zwierząt (1996). Słownik terminów genetycznych (2002). Wydawnictwo Polskiego Towarzystwa Zootechnicznego. Filistowicza. Ośrodek Wydawnictw Naukowych PAN. Brostoff. M. B. Genom człowieka.. Poznań. Genomy (2001).. Krzanowskiej. Jury i H. P. Wydawnictwo Akademii Rolniczej w Poznaniu. Brema. Jaszczaka i J. Lamont. Stansfield (przekład zbiorowy pod red. Węgleńskiego). pod red. L. Pawlaka). J.

Beattie C. (2003). Friend S. Kamiński S.T. (1997). Freking B. Crawford A. Postępy Biologii Komórki 26 (supl. McGraw R. Anomalie chromosomowe przyczyną zamierania gamet i zarodków bydlęcych. Stoughton R. Journal of Applied Genetics 38: 65-76.. Journal of Applied Genetics 37 (3): 299-312. Grzybowski G. Prace i Materialy Zootechniczne. The dog genome: survey seąuencing and comparative analysis. Biotechnologia 3 (38): 38-50. Medycyna Weterynaryjna 54 (2): 92-96.A. Charon K. Parham P. Grzybowski G. Cotinot C.. Minireview — MHC studies in domestic animals.M. Postępy Biologii Komórki 24 (8): 69-75..T.Artykuły przeglądowe Barsh G. (1997). Mammalian Genome 9: 204-209.W.H. Pierzchała M. Molecular genetics of sex determination..S. Mapa genomu świni (Sus scrofa domestica). Dymnicki E.W. Dodds K. Ramikssoon Y. Długa historia krótkiego chromosomu — jak poznano geny płodności sprzężone z chromosomem Y u ssaków. Charon K. 12): 53-58. Long S.A. (1998).L. (1996). International Human Genome Seąuencing Consortium (2001).. Krzanowska H.M.. Kamiński S. Kappes S. (1996). DNA microarrays — a methodological breakthrough in genetics. (2002). Trends in Genetics 12 (8): 299-305.. (1996). Early steps in mammalian sex determination... Pareek Ch. Initial seąuencing and analysis of the human genome.. polimorfizmy i choroby.M. Wybrane praktyczne aspekty technik molekularnych — PCR-RFLP i automatycznego sekwencjonowania DNA — w badaniach genomu zwierząt gospodarskich. Ludzki genom mitochondrialny — mutacje. Wykorzystanie metod molekularnej analizy genomu zwierząt w pracy hodowlanej. Medycyna Weterynaryjna 52 (2): 89-93. Chromosome abnormalities in domestic sheep (Ovis aries).. Population biology of antigen presentation by MHC class I molecules. Kirkness E. (1998). Journal of Applied Genetics 37: 179-196.. Keele J. De Gortari M. Geny oddziałujące na jakość tuszy i mięsa świń. Ohta T. A second-generation linkage map of the sheep genome. Current Opinion in Genetics & Development 6: 316-321. European Journal of Immunogenetics 21: 209-215.. (2002).S. (1996).. Leymaster K. (1996). Goodfellow P. The genetics of pigmentation: from fancy genes to complex traits.G.M. Science 301: 1898-1903. (1998).P. i wsp.. Metody oraz znaczenie sterowania proporcją płci u bydła. Bartnik E. Magiczne mikromacierze. (1996).A. (1997). (1994). (1998).M. Ellis S.W. Postępy Nauk Rolniczych 7 (nr 5): 87-97. i wsp.B. (2002).A.. (1997).L. (1996). Genome Research 7: 235-249.. Bovine kappa-casein (CASK) gene — molecular naturę and application in dairy cattle breeding.. (1997). A second-generation linkage map of bovine genome. Stone R.F. Beattie C.P. Cuthbertson R. Prace i Materiały Zootechniczne 50: 69-78. Kamiński S. Naturę 409: 860-921.J.. Lopez-Corrales N. Journal of Applied Genetics 43: 123-130. Science 272: 67-74. (1999).W. Sonstegard T. Smith T. Prace i Materialy Zootechniczne 49: 7-28. Lechniak D. 299 . Kurył J.E. Znaczenie głównego układu zgodności tkankowej w hodowli zwierząt. Zeszyt specjalny 8: 9-18. Kappes S. Bovine leukocyte adhesion deficiency (BŁĄD) and its worldwide prevalence. Keele J... Stone R. Seminars in Reproductwe Medicine 20: 157-167. Świat Nauki 4 (128): 36-43.

. Synaptonemal complexes in domestic mammals — a review. (1998). Journal of Applied Genetics 40 (2): 117-128. Stranzinger G. (1999).W. Kwiatkowska J. Aberracje chromosomowe u bydła o użytkowości mięsnej.S. Biotechnologiczne wykorzystanie gruczołu mlecznego perspektywy manipulacji genetycznych białkami mleka. (2002). (1996). Medycyna Weterynaryjna 50 (8): 379-382. Zych S. Barciszewski J. Journal of Dairy Science 82 (suppl.. Słota E. Rohrer G. 10): 113-122. Determinacja płci u ssaków. (1998).W. Wybrane aspekty analizy loci markerowych w doskonaleniu ilościowych cech zwierząt. 10): 195-217. Waterston R. Prace i Materiały Zootechniczne 50: 11-39. Hu Z.Z. Postępy Biologii Komórki 25 (supl. Danielak B. Science 291: 1304-1351..J. Journal of Animal and Feed Sciences 2/3: 91-103. . Noncoding RNA transcripts. (1998). Krajowy system kontroli cytogenetycznej buhajów. Węgrzyn J.L. (1997). Prace i Materiały Zootechniczne 46: 29-40. Napierała D.H. Keele J. Reakcja łańcuchowa polimerazy (PCR) w badaniach naukowych i diagnostyce molekularnej. Genetyczne uwarunkowania odmian barwnych lisa pospolitego (Vulpes vulpes) i lisa polarnego (Alopex lagopus). Identyfication of animal major genes in field collected data by use of statystical methods. Szymański M.. opasowe i rzeźne — najnowsze osiągnięcia. (1997). Świtoński M... (1998). Medycyna Weterynaryjna 59: 847-852. (2003).. Wierzbicki H. (1997).. (2003). Kozubska-Sobocińska A. Postępy Biologii Komórki 25 (supl. Zwierzchowski L.A. Genome Research 6: 371-391. Initial seąuencing and comparative analysis of the mouse genome. Szwaczkowski T. Sysa P. 2):288-237.. i wsp. Inheritance of colours in horses. Barciszewska M... Medycyna Weterynaryjna 53 (10): 581-584. Smith T. (1993). Szydłowski M. Kulig H. Zwierzchowski L. Yenter C. Świtoński M. Biotechnologia 2 (41): 33-56. i wsp. (1998). Basics of gametic imprinting. — Celera Genomics (2001). (1998)..P. Świtoński M. Szatkowska L.. Rosochacki S. Transgeneza — możliwości i perspektywy zastosowania w produkcji zwierzęcej. Ruvinsky A. Walawski K. Stachurska A. Prace i Materiały Zootechniczne 52: 37-42. The seąuence of the human genome. Antigenic markers of protein genes and their nomenclature in cattle.. Journal of Heredity 89 (6): 473-480. Alexander L.. (1999).. Beattie C.J. Journal of Applied Genetics 38:195-204. Genetic aspects of mastitis resistance in cattle. Słomski R. Kurył J. Journal of Applied Genetics 44: 1-20.. Świtoński M. Journal of Applied Genetics 38 (3): 319-328.. Markerowe mapy genomowe i ich wykorzystanie w hodowli zwierząt.. (1998). Żywiecki M. Skiba E. Poszukiwanie genów kontrolujących cechy tuczne. Prace i Materiały Zootechniczne 53: 35-48. A comprehensive map of the porcine genome. Naturę 420: 520-562. (1994).Rejduch B. (1994).

na których hasła znajdują się na rysunku lub w jego podpisie.Skorowidz Opracowali: Krystyna M. . Charon. na których znajduje się główny opis. Marek Świtoński Numery stron. są pogrubione. Gwiazdką oznaczono numery stron.

Sign up to vote on this title
UsefulNot useful