Basic ResearchBiology

Effect of Dental Materials Calcium Hydroxidecontaining Cement, Mineral Trioxide Aggregate, and Enamel Matrix Derivative on Proliferation and Differentiation of Human Tooth Germ Stem Cells
Esra Pamukcu Guven, DDS, PhD,* Mehmet Emir Yalvac, MSc, Fikrettin Sahin, PhD, Munevver M. Yazici, MSc, Albert A. Rizvanov, PhD, DrSci,k and Gunduz Bayirli, DDS, PhD*
Abstract
Introduction: Biocompatibility of pulp capping materials is important for successful use in dentistry. These materials should be nontoxic and permissive for proliferation and induction of odontogenic differentiation of pulp cells. The aim of our study was to evaluate the effects of enamel matrix derivative (EMD), mineral trioxide aggregate (MTA), and calcium hydroxidecontaining cement (DYCAL) on proliferation and odontogenic differentiation of human tooth germ stem cells (hTGSCs) in which cells belonging to both pulp tissue and dental follicle exist. Methods: The 96-well plates, 24-well plates, and special chamber slides were coated with biomaterials for cell proliferation, differentiation, and scanning electron microscopy analysis. Odontogenic differentiation of hTGSCs was evaluated by analyzing mRNA expression of dentin sialophosphoprotein (DSPP) by real-time polymerase chain reaction expression analysis, measurement of alkaline phosphatase activity, and visualization of calcium depositions by von Kossa staining. Results: Our results demonstrate that EMD is the best material in terms of inducing differentiation and proliferation of hTGSCs. DYCAL was found to be toxic to hTGSCs; however, EMD-coated DYCAL showed less toxicity. EMD-coated MTA was not efcient at inducing proliferation and differentiation. Conclusions: Pulp capping materials come in direct contact with dental pulp cells; thus, they require comprehensive evaluation of interactions between cells and biomaterials. Therefore, we cultured hTGSCs, capable of odontogenic differentiation, on pulp capping materials directly. Our results suggest that combination of capping materials with EMD would increase the quality of capping by increasing biocompatibility of capping materials. (J Endod 2011;37:650656)

Key Words
Calcium hydroxide-containing cement (DYCAL), enamel matrix derivative (EMD), human tooth germ stem cells, mineral trioxide aggregate (MTA), pulp capping

From the*Department of Endodontics, Faculty of Dentistry, and Department of Genetics and BioEngineering, College of Engineering and Architecture, Yeditepe University, Istanbul, Turkey; and Department of Genetics, Faculty of Biology and Soil Sciences, Kazan State University; Core Research Laboratory, Kazan State Medical University; and kRepublic Clinical Hospital, Kazan, Russia. This study was supported by Yeditepe University (Turkey), grants from the Russian Foundation for Basic Research, Russian Federal Agency for Science and Innovations government contracts FCP. A.A.R. was supported in part by NATO reintegration grant NR.RIG.983007. Address requests for reprints to Dr Esra Pamukcu Guven, Department of Endodontics, Faculty of Dentistry, Yeditepe University, TR-34728, Istanbul, Turkey. E-mail address: esrapamukcu@gmail.com 0099-2399/$ - see front matter Copyright 2011 American Association of Endodontists. doi:10.1016/j.joen.2011.02.008

ecent advances in stem cell biology provide new strategies for regenerative endodontics. It has been shown that bone marrow stem cells, which are currently most widely used in clinical applications, are able to differentiate into odontoblasts and form hard tissue (1). On the other hand, dental stem cells including dental pulp cells (DPCs), dental follicle cells, and periodontal stem cells were isolated, characterized, and used in tooth tissue engineering (2). In the presence of signaling molecules transforming growth factor-beta (TGF-b), bone morphogenetic proteins BMP-2, BMP-4, BMP-7, and heme oxygenase-1 enzyme, DPCs differentiated into odontoblast cells (35). During treatment of exposed vital pulp, differentiation and proliferation of pulp cells are also affected dramatically by the interactions of DPCs and pulp capping materials. Calcium hydroxidecontaining cement (DYCAL) is an antibacterial material that is routinely used as pulp capping agent. Induction of inammation in clinical use is disadvantage of DYCAL (6). Mineral trioxide aggregate (MTA) has been shown to induce hard tissue formation within 2 weeks with limited inammation (7). It was suggested that MTA increases dentin regeneration more effectively than calcium hydroxide (8) probably as a result of release of large numbers of Ca2+ ions (9) or inducing periodontal broblasts to secrete BMP-2 and TGF-b1 (10, 11). Enamel matrix derivative (EMD) has been reported to be very effective in regeneration of cementum, periodontal ligament, and bone (12). It was hypothesized that EMD exerts its therapeutic effect by providing an extracellular matrix that forms a more natural microenvironment for cells, stimulating cell attachment and differentiation (13). Biologically active molecules, present in EMD, do not cause severe allergic reactions except minimal inammation (13, 14), but they increase proliferation of cells and increase hard tissue formation (15). In a recent study it was demonstrated that when MTA and EMD were applied to human DPCs together, the cells differentiated into odontoblast-like cells, suggesting a synergistic effect of 2 materials (16). In clinical use, pulp capping materials are in direct contact with pulp tissue. Most of the studies investigating the effects of pulp capping materials on dental stem cells used plate inserts or conditioned medium obtained by incubation with materials. In our study, it was aimed to investigate the direct interaction between cells and the pulp capping materials by directly culturing the cells on the materials. We also tested the effects of combination of EMD with DYCAL and MTA on hTGSCs, which might be considered a new approach for pulp capping applications.

650

Guven et al.

JOE Volume 37, Number 5, May 2011

Basic ResearchBiology
We studied interactions between materials and cells by directly culturing cells on materials. In our model we used human tooth germ stem cells (hTGSCs), which are multipotent featured, capable of proliferation and odontogenic differentiation. We also tested combinations of DYCAL and MTA with EMD that might increase efciency of capping treatments. Odontogenic differentiation of cells was monitored by detection of alkaline phosphatase (ALP) activity and mRNA expression of odontoblastic markers, such as dentin sialophosphoprotein (DSPP) and collagen type I, by real-time polymerase chain reaction (PCR) and immunouorescence analyses. Calcied nodule structures were evaluated by using von Kossa method. Attachment of hTGSCs on the surfaces of materials was visualized by scanning electron microscopy (SEM).

Materials and Methods

Cell Culture Isolation of hTGSCs from human impacted third molar tooth germ of a 14-year-old healthy patient was performed as described previously (17). Established cell line was maintained in growth medium consisting of Dulbecco modied essential medium (DMEM) (Inv-itrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS), 2 mmol/L of l-glutamine (Invitrogen), and 1% of penicillin, streptomycin, and Fungizone solution (PSF) (Invitrogen), and incubated at 37 C in a humidied atmosphere of 5% CO2. hTGSCs were subcultured by using trypsinethylenediaminetetraacetic acid solution (1) (Invitrogen). All tissue culture plates and asks were purchased from TPP (Winiger, AG Wohlen, Switzerland). Flow Cytometry Analysis The surface antigens of hTGSCs were analyzed by ow cytometry. Cells were trypsinized and incubated in phosphate-buffered saline (PBS) for 45 minutes with primary antibodies against CD14 (cat# SC-7328), CD29 (cat# BD556049), CD34 (cat# SC-51540), CD45 (cat# SC-70686), CD90 (cat# SC-53456), CD105 (cat# SC-71043), CD133 (cat# SC-65278), CD166 (cat# SC-53551) (Santa Cruz Biotechnology Inc, Santa Cruz, CA), and CD73 (cat# 550256) (Zymed, San Francisco, CA). After washing off the excess primary antibodies, cells were incubated with uorescein isothiocyanate conjugated secondary antibodies (cat# SC-2989) at 4 C for 45 minutes, except for CD29, against which phycoerythrin, red light harvesting protein containing chromophore, conjugated monoclonal antibody was used for budgetary reasons only. The ow cytometry analysis of the cells was carried out by using Becton Dickinson FACSCalibur ow cytometry system (Becton Dickinson, San Jose, CA), with 10,000 events being counted for each case. Material Preparation and Cell Seeding MTA (Dentsply Tulsa Dental, Tulsa, OK) and DYCAL (Dentsply Caulk, Milford, DE) were purchased and prepared according to the manufacturers instructions. They were applied to the bottom of 96-well plate and 4-well chamber slides (Nunc; Thermo Fisher Scientic, Waltham, MA), forming 32 mm2 plugs with 2.5-mm thickness and 200 mm2 plugs with 10-mm thickness, respectively (Fig. 1). Slides were incubated at 37 C for 4 days for drying and stored at room temperature until EMD preparation and application were completed for a day. Original stock of EMD (Emdogain; Biora AB, Malm, Sweden) at 30 mg/ o mL was dissolved in 10 mmol/L acetic acid to obtain nal concentration of 200 mg/mL. For EMD coating, wells were covered with diluted EMD solution and incubated overnight at 4 C. Before seeding cells, plates and chamber slides were sterilized under UV light for 30 minutes. Cells were seeded at 3000 cells/well for 96-well plates and 25,000 cells/well for chamber slides.
JOE Volume 37, Number 5, May 2011

Figure 1. Coatings of tissue culture plastic with dental materials. (A) Fourwell shamber slides; (B) 96-well plates. M, MTA; D, DYCAL; E, EMD; ME, MTA + EMD; DE, DYCAL + EMD.

Cell Viability Assay After 48-hour incubation on various materials, cell viability was measured by MTS assay (CellTiter96 Aqueous One Solution; Promega, Southampton, UK) according to the manufacturers instructions. MTS (3-(4, 5-dimethyl-thiazol-2-yl)-5-(3-carboxy-methoxy-phenyl)-2(4-sulfo-phenyl)-2H-tetrazolium) is a tetrazolium saltbased colorimetric assay for detecting the activity of enzymes (mostly in the mitochondria) that reduces MTS to formazan, giving a purple color whose absorbance was read by a 96-well plate reader (Bio-Tek Instruments, Winooski, VT). SEM Analysis Cells cultured on chamber slides were used for SEM analysis. First, cells were xed by using 2% paraformaldehyde and air-dried at room temperature for 1 hour. Visualization of the cells on chamber slides was performed by using a Karl Zeiss EVO 40 model SEM instrument (Dresden, Germany). The slides were coated with a gold layer (10-nm thickness) by using a sputter coater (Model BAL-TEC SCD 005 Sputter Coater, Balzers, Liechtenstein) to impart electrical conductivity. The accelerating voltage was 5 kV for all experiments. SEM images were obtained from specic areas of interest at various magnications (200 and 5000). Differentiation of hTGSCs on Materials Cells were induced to differentiate into odontogenic cells by incubating with odontogenic differentiation medium consisting of DMEM supplemented with 10% FBS, PSF, 2 mmol/L L-glutamine, 50 mg/mL ascorbic acid (Sigma, St Louis, MO), and 2 mmol/L 2-glycerolphosphate (Sigma) for 14 days, with medium change every other day. Immunocytochemistry Analysis hTGSCs induced for odontogenic differentiation were xed with 2% paraformaldehyde and permeabilized by incubation with 0.1% Triton-X100/PBS for 5 minutes. Nonspecic binding of antibodies
Effect of Dental Materials on hTGSCs

651

Basic ResearchBiology
was blocked by adding 2% goat serum (diluted in PBS) for 20 minutes. Samples were incubated with primary anticollagen type-I antibody (cat# SC-80565) and anti-DSPP antibody (cat# SC-33586) overnight at 4 C. Each sample was washed twice for 5 minutes with PBS to remove unbound primary antibodies. After washing, goat polyclonal anti-rabbit immunoglobulin GAlexa 488 conjugate (Invitrogen) secondary antibodies were added and incubated for 1 hour. DAPI (60 -di-amidino-2-phenyl-indole) (Sigma Chemical Co) was used as a nuclear counterstain. Stained cells were visualized by using Leica TCS SP2 SE confocal microscope (Leica, Bensheim, Germany). mRNAs was analyzed by using SYBR green reverse transcriptase (RT)-PCR method. The PCR primers were as follows: glyceraldehyde3-phosphate dehydrogenase (GAPDH) (sense: 50 TAT CGT GGA AGG ACT CA30 , antisense: 50 GCA GGG ATG ATG TTC TGG A 30 ) (18), DSPP (sense: 50 GAGGATAAAGGACAACATGG30 , antisense: 50 AAGAAGCATCTCCTCGGC 30 ) (19). cDNAs were mixed with primers and SYBR Premix Ex Taq (including TaKaRa Ex Taq HS, dNTP Mixture, Mg2+, SYBR green-I) in a nal volume of 20 mL. GAPDH gene was used as the reference housekeeping gene for normalization of the data. All RT-PCR experiments were done by using iCycler RT-PCR detection system (Bio-Rad, Hercules, CA).

Reverse TranscriptasePCR and Quantitative Reverse TranscriptasePCR Analysis Total RNA from hTGSCs was isolated by using High Pure RNA Isolation Kit (Roche Applied Science, Indianapolis, IN) according to the manufacturers instructions. cDNA synthesis was performed by using random hexamer primers and the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science). Relative expression of DSPP

ALP Activity After 24-day incubation with odontogenic differentiation medium, the cells were trypsinized and collected by centrifugation at 1200 rpm for 5 minutes, followed by resuspension of the cell pellets in 500 mL of lysis buffer (0.2% Triton-X 100 in PBS). Suspension was incubated for 30 minutes with agitation (300 rpm). Twenty-ve microliters of cell

Figure 2. Immunophenotypic characteristics of hTGSCs. Flow cytometry analyses revealed that hTGSCs were positive for cell surface antigens CD29, CD73, CD90, CD105, and CD166, but negative for hematopoietic markers such as CD14, CD34, CD45, and CD133. FITC, uorescein isothiocyanate; PE, phycoerythrin.

652

Guven et al.

JOE Volume 37, Number 5, May 2011

Basic ResearchBiology

Figure 3. Analysis of odontogenic differentiation of hTGSCs. Cells were incubated in differentiation medium for 14 days. (A) Calcied nodule formations. (B) Expression of collagen type-1 (green). (C) Von Kossa staining of calcium mineralizations. (D) Expression of DSPP (green). Cell nuclei stained by DAPI (blue). Scale bar, 100 mm.

lysate was mixed with 75 mL Randox ALP commercial reagent (Randox Laboratories, Crumlin, UK) in 96-well plate and incubated for 1 hour, measuring absorbance at 15-minute intervals by using 96-well plate reader (Bio-Tek Instruments).

Von Kossa Staining After 14-day incubation with odontogenic differentiation medium, cells were xed with 2% paraformaldehyde at 4 C for 30 minutes. Then, cells were stained by using von Kossa staining kit (Bio-optica, Milano, Italy), and calcied mineralization was observed by using phase contrast light microscope (Nikon TS100, Minnesota, MN). Statistical Analysis For statistical analysis, Mann-Whitney U test was used. P value <.05 was accepted as statistically signicant. Results are presented as mean standard deviation (SD). Calculations were performed by using Sigma Stat Software (Jandel Scientic, San Rafael, CA).

cytotoxic effect, resulting in very few number of cells attached to the surface. On the other hand, DYCAL coated with EMD was less toxic to the cells, although morphology of the cells was signicantly different from that of cells growing on EMD and TCP (Figs. 4 and 5). MTA also was less toxic to the cells than DYCAL, causing no signicant changes in cell morphology (Fig. 5). Because MTA is less solid and smooth than DYCAL, we were not able to achieve acceptable coating of MTA with EMD. During culture of cells on EMD-coated MTA, pieces of MTA came oating off, which could signicantly affect cells attachment to the surface. Efciency of odontogenic differentiation of hTGSCs on various surfaces was assayed by ALP activity, which was highest on EMDcoated surfaces (Fig. 6A). Real-time PCR analysis demonstrated that

Results
The immunophenotypic analysis revealed that hTGSCs are stained positive for MCS markers CD29, CD73, CD90, CD105, and CD166 but stained negative for hematopoietic markers CD14, CD34, CD45, and CD133 (Fig. 2). After incubation for 14 days in odontogenic differentiation medium, hTGSCs were stained positive for collagen type I and expressed odontogenic marker DSPP (Fig. 3). Differentiated cells formed nodule-like structures and calcied mineralizations that were stained by von Kossa method (Fig. 3). To study the effect of pulp capping materials DYCAL, MTA, and EMD on proliferation of hTGSCs, cells were seeded onto wells coated with material in 96-well plates. After 48 hours, cell viability analysis showed that the number of attached cells was highest on EMD-coated wells and regular tissue culture plate (TCP) (Fig. 4). DYCAL has exerted
JOE Volume 37, Number 5, May 2011

Figure 4. Effects of various coatings of TCPs on hTGSC viability. Cells were tested for viability 48 hours after seeding on different materials by using MTS test. Viability was highest for EMD-coated plate and lowest for DYCALcoated plate. EMD coating of DYCAL signicantly reduced cytotoxicity of DYCAL. Twenty percent dimethyl sulfoxide was used as negative control.

Effect of Dental Materials on hTGSCs

653

Basic ResearchBiology

Figure 5. SEM analysis of hTGSCs cultured on various surfaces. hTGSCs were grown on different surfaces for 48 hours: (A) DYCAL, (B) DYCAL + EMD, (C) MTA, (D) MTA + EMD, (E) EMD, (F) TCP. Cells demonstrated highest proliferation on EMD-coated surface and TCP. DYCAL exerted cytotoxic effect, resulting in very few cells attached to the surface. EMD-coated DYCAL demonstrated reduced cytotoxicity and increased number of viable cells.

EMD was able to induce expression of DSPP during odontogenic differentiation of hTGSCs (Fig. 6B). EMD-coated DYCAL and MTA exerted cytotoxic effect on cells during long-term culture; therefore, we could not assay ALP activity or expression of odontogenic markers after odontogenic induction for 14 days.

Discussion
Recent studies demonstrated that human tooth germs contain multipotent stem cells that are able to differentiate into cells of all 3 germ layers: ectoderm, mesoderm, and endoderm (20). hTGSCs isolated from third molars of young adults include cells originated from both dental pulp and dental follicle because germ tissues are not fully developed into adult tooth yet (21). Dental pulp stem cells are able to differentiate into odontogenic cells, which is very important for regenerative endodontics (22, 23). In our experiments, we used hTGSCs to study proliferation and odontogenic differentiation of cells on different pulp capping materials. We demonstrated that hTGSCs are able to differentiate into odontogenic cells, which was conrmed 654

by analysis of DSPP and increased ALP activity. Immunocytochemistry analysis showed that on induction of differentiation, hTGSCs express DSPP and collagen type I forming nodule-like structures and calcium depositions, suggesting that hTGSCs can be used as a source of stem cells for studying odontogenesis. Thus, the use of HTGSCs might not only mimic the behavior of dominant cell type in pulp (broblasts) but also represent stem cell population, which is essential for regenerative capacity of the tooth. Pulp capping materials aimed to protect exposed vital pulp by sealing and inducing healing process in wounded region. In this regard, DYCAL and MTA are widely used materials with distinct advantages and disadvantages (24, 25). DYCAL has antibacterial property; however, it causes necrosis and inammation when in contact with pulp tissue (26). On the other hand, MTA has been reported to cause little inammation and supports odontogenesis, resulting in more efcient pulp tissue regeneration (27). Tissue regeneration is a multidirectional subject including cellular responses such as migration, adhesion, and proliferation. Migration effect of MTA on mesenchymal stem cells was rst shown under in vitro conditions (28). Inducing effect for
JOE Volume 37, Number 5, May 2011

Guven et al.

Basic ResearchBiology
formation. The number of viable cells decreased on EMD-coated MTA, which was probably not due to EMD but due to changes to physical properties of MTA as a result of coating with EMD, dissolved in 1 mmol/ L acetic acid. EMD-coated MTA did not form a suitable surface for cells to attach, suggesting a new protocol has to be developed to evaluate the effect of EMD coating of MTA on hTGSC proliferation and differentiation. Comparing odontogenic differentiation of hTGSCs on various surfaces, it was shown that EMD was highly efcient at increasing ALP activity and mRNA expression of odontogenic marker DSPP. We could not study the effect of DYCAL on odontogenic differentiation of hTGSCs because of excessive cell death during 14-day incubation. Although EMD-coated DYCAL showed much higher cellular viability than DYCAL itself after 48-hour incubation, it still demonstrated cytotoxicity during long-term incubation with hTGSCs. Increasing the amount of EMD used in coating of DYCAL might reduce cellular toxicity and increase pulp regeneration. In summary, for the rst time we tested the effects of EMD, MTA, and DYCAL on proliferation and odontogenic differentiation of hTGSCs in a direct contact system. Our data support the evidence that EMD increases hard tissue regeneration and suggests that EMD can be used as one of the components in pulp capping procedure along with MTA and DYCAL to increase the efciency of the therapy.

Acknowledgments
Figure 6. (A) Analysis of ALP activity in hTGSC extracts after odontogenic differentiation. EMD coating of culture surfaces was more efcient at increasing ALP activity than MTA during odontogenic differentiation. (B) Real-time PCR analysis of DSPP. EMD and MTA induced expression of DSPP mRNA in HTGSCs. Control group: hTGSCs that were not induced to differentiate. *P < .05 in comparison with control group.

We would like to thank Burcin Keskin for her great help in preparation of cells for ow cytometry analysis. The authors deny any conicts of interest related to this study.

References
1. Hasegawa N, Kawaguchi H, Hirachi A, et al. Behavior of transplanted bone marrowderived mesenchymal stem cells in periodontal defects. J Periodontol 2006;77: 10037. 2. Lindroos B, Maenpaa K, Ylikomi T, Oja H, Suuronen R, Miettinen S. Characterisation of human dental stem cells and buccal mucosa broblasts. Biochem Biophys Res Commun 2008;368:32935. 3. Nakashima M, Nagasawa H, Yamada Y, Reddi AH. Regulatory role of transforming growth factor-beta, bone morphogenetic protein-2, and protein-4 on gene expression of extracellular matrix proteins and differentiation of dental pulp cells. Dev Biol 1994;162:1828. 4. Shiba H, Fujita T, Doi N, et al. Differential effects of various growth factors and cytokines on the syntheses of DNA, type I collagen, laminin, bronectin, osteonectin/ secreted protein, acidic and rich in cysteine (SPARC), and alkaline phosphatase by human pulp cells in culture. J Cell Physiol 1998;174:194205. 5. Kim SJ, Min KS, Ryu HW, Lee HJ, Kim EC. The role of heme oxygenase-1 in the proliferation and odontoblastic differentiation of human dental pulp cells. J Endod 2010; 36:132631. 6. Yasuda Y, Ogawa M, Arakawa T, Kadowaki T, Saito T. The effect of mineral trioxide aggregate on the mineralization ability of rat dental pulp cells: an in vitro study. J Endod 2008;34:105760. 7. Zarrabi MH, Javidi M, Jafarian AH, Joushan B. Histologic assessment of human pulp response to capping with mineral trioxide aggregate and a novel endodontic cement. J Endod 2010;36:177881. 8. Min KS, Kim HI, Park HJ, Pi SH, Hong CU, Kim EC. Human pulp cells response to Portland cement in vitro. J Endod 2007;33:1636. 9. Takita T, Hayashi M, Takeichi O, et al. Effect of mineral trioxide aggregate on proliferation of cultured human dental pulp cells. Int Endod J 2006;39: 41522. 10. Guven G, Cehreli ZC, Ural A, Serdar MA, Basak F. Effect of mineral trioxide aggregate cements on transforming growth factor beta1 and bone morphogenetic protein production by human broblasts in vitro. J Endod 2007;33: 44750. 11. Pistorius A, Willershausen B, Briseno Marroquin B. Effect of apical root-end lling materials on gingival broblasts. Int Endod J 2003;36:6105. 12. Gestrelius S, Andersson C, Lidstrom D, Hammarstrom L, Somerman M. In vitro studies on periodontal ligament cells and enamel matrix derivative. J Clin Periodontol 1997;24 (Pt 2):68592.

angiogenic factor secretion (23) and granulation tissue formation (29), which was related with wound healing, were also noted. MTA supports healing of pulp by being a biocompatible barrier that protects pulp from exposure to different physical and chemical stress conditions and provides calcium ions that are necessary for mineralization (3032). Enamel extracellular matrix proteins in the form of EMD have been used for the regeneration of periodontal tissues because it triggers osteogenesis and mineralization of the tissues at the site of application (33). EMD contains proteins that are targeting receptors on the periodontal stem cells, inducing them to proliferate and differentiate into osteogenic cells (34). Currently, there are no reports questioning clinical safety of EMD (35). A recent study has shown that EMD increases effect of MTA in formation of hard tissue, which might increase the efciency of pulp capping treatment (16). Most of the studies investigating the effect of pulp capping materials on hard tissue formation and proliferation of dental pulp cells used systems with no direct contact between materials and cells, which might not accurately model clinical setting. Developing a model that would allow studying the effect of direct interaction between materials and pulp cells would be important for developing novel procedures for regenerative endodontics. In our study we cultured hTGSCs directly on EMD, MTA, and DYCAL coated surfaces that provided direct contact between materials and cells. In addition, the effects of EMD + MTA and EMD + DYCAL combinations on hTGSCs were also analyzed. After 48-hour incubation on materials, we checked the cytotoxicity of materials by using MTS test. Our results suggest that EMD coating of surfaces increased cell proliferation of hTGSCs. DYCAL caused cellular toxicity that was reduced by additional coating with EMD. This nding suggests that DYCAL can be applied with EMD in pulp capping treatment with the aim of reducing cellular toxicity and inducing hard tissue
JOE Volume 37, Number 5, May 2011

Effect of Dental Materials on hTGSCs

655

Basic ResearchBiology
13. Suzuki N, Ohyama M, Maeno M, Ito K, Otsuka K. Attachment of human periodontal ligament cells to enamel matrix-derived protein is mediated via interaction between BSP-like molecules and integrin alpha(v)beta3. J Periodontol 2001;72:15206. 14. Johnson DL, Carnes D, Steffensen B, Cochran DL. Cellular effects of enamel matrix derivative are associated with different molecular weight fractions following separation by size-exclusion chromatography. J Periodontol 2009;80:64856. 15. He J, Jiang J, Safavi KE, Spangberg LS, Zhu Q. Emdogain promotes osteoblast proliferation and differentiation and stimulates osteoprotegerin expression. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97:23945. 16. Min KS, Yang SH, Kim EC. The combined effect of mineral trioxide aggregate and enamel matrix derivative on odontoblastic differentiation in human dental pulp cells. J Endod 2009;35:84751. 17. Yalvac ME, Ramazanoglu M, Rizvanov AA, et al. Isolation and characterization of stem cells derived from human third molar tooth germs of young adults: implications in neo-vascularization, osteo-, adipo- and neurogenesis. Pharmacogenomics J 2010;10:10513. 18. Lisignoli G, Cristino S, Piacentini A, et al. Cellular and molecular events during chondrogenesis of human mesenchymal stromal cells grown in a three-dimensional hyaluronan based scaffold. Biomaterials 2005;26:567786. 19. Alliot-Licht B, Bluteau G, Magne D, et al. Dexamethasone stimulates differentiation of odontoblast-like cells in human dental pulp cultures. Cell Tissue Res 2005;321: 391400. 20. Ikeda E, Yagi K, Kojima M, et al. Multipotent cells from the human third molar: feasibility of cell-based therapy for liver disease. Differentiation 2008;76:495505. 21. Yalvac ME, Ramazanoglu M, Tekguc M, et al. Human tooth germ stem cells preserve neuro-protective effects after long-term cryo-preservation. Curr Neurovasc Res 2010;7:4958. 22. Yu J, Wang Y, Deng Z, et al. Odontogenic capability: bone marrow stromal stem cells versus dental pulp stem cells. Biol Cell 2007;99:46574. 23. Paranjpe A, Zhang H, Johnson JD. Effects of mineral trioxide aggregate on human dental pulp cells after pulp-capping procedures. J Endod 2010;36:10427. 24. Isermann GT, Kaminski EJ. Pulpal response to minimal exposure in presence of bacteria and Dycal. J Endod 1979;5:3227. 25. Barrieshi-Nusair KM, Qudeimat MA. A prospective clinical study of mineral trioxide aggregate for partial pulpotomy in cariously exposed permanent teeth. J Endod 2006;32:7315. 26. Kuratate M, Yoshiba K, Shigetani Y, Yoshiba N, Ohshima H, Okiji T. Immunohistochemical analysis of nestin, osteopontin, and proliferating cells in the reparative process of exposed dental pulp capped with mineral trioxide aggregate. J Endod 2008;34:9704. 27. Shin SY, Albert JS, Mortman RE. One step pulp revascularization treatment of an immature permanent tooth with chronic apical abscess: a case report. Int Endod J 2009;42:111826. 28. D Anto V, Di Caprio MP, Ametrano G, Simeone M, Rengo S, Spagnuolo G. Effect of mineral trioxide aggregate on mesenchymal stem cells. J Endod 2010;11: 183943. 29. Dammaschke T, Stratmann U, Wolff P, Sagheri D, Schfer E. Direct pulp capping o with mineral trioxide aggregate: an immunohistologic comparison with calcium hydroxide in rodents. J Endod 2010;36:8149. 30. Simon S, Cooper P, Smith A, Picard B, I CN, Berdal A. Evaluation of a new laboratory model for pulp healing: preliminary study. Int Endod J 2008;41:78190. 31. Nair PN, Duncan HF, Pitt Ford TR, Luder HU. Histological, ultrastructural and quantitative investigations on the response of healthy human pulps to experimental capping with mineral trioxide aggregate: a randomized controlled trial. Int Endod J 2008;41:12850. 32. Tecles O, Laurent P, Aubut V, About I. Human tooth culture: a study model for reparative dentinogenesis and direct pulp capping materials biocompatibility. J Biomed Mater Res B Appl Biomater 2008;85:1807. 33. Schlueter SR, Carnes DL, Cochran DL. In vitro effects of enamel matrix derivative on microvascular cells. J Periodontol 2007;78:14151. 34. Kaida H, Hamachi T, Anan H, Maeda K. Wound healing process of injured pulp tissues with emdogain gel. J Endod 2008;34:2630. 35. Garrocho-Rangel A, Flores H, Silva-Herzog D, Hernandez-Sierra F, Mandeville P, Pozos-Guillen AJ. Efcacy of EMD versus calcium hydroxide in direct pulp capping of primary molars: a randomized controlled clinical trial. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;107:7338.

656

Guven et al.

JOE Volume 37, Number 5, May 2011