(This is a sample cover image for this issue. The actual cover is not yet available at this time.

This article appeared in a journal published by Elsevier. The attached

copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elseviers archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright

Author's personal copy

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

Available online at www.sciencedirect.com

http://www.elsevier.com/locate/biombioe

Purification and characterization of exo-b-agarase

from an endophytic marine bacterium and its
catalytic potential in bioconversion of red algal cell
wall polysaccharides into galactans
Vishal Gupta, Nitin Trivedi, Manoj Kumar, C.R.K. Reddy*, Bhavanath Jha
Discipline of Marine Biotechnology and Ecology, CSIR-Council of Scientific and Industrial Research (CSIR), Gijubhai Badheka Marg, Bhavnagar
364002, India

article info

abstract

Article history:

An extracellular exo-b-agarase was characterized from an endophytic bacterial strain

Received 15 September 2011

Pseudomonas sp. isolated from the red alga Gracilaria dura. The enzyme was purified to

Received in revised form

homogeneity with a recovery of 28.2% and a purity fold of 8.33. The purified enzyme was

15 December 2012

composed of single polypeptide with a molecular mass of about 66 kDa. The enzyme

Accepted 19 December 2012

exhibited a maximum activity of 81.74 U mL
1 and a specific activity of 615.5 U mg
1. The

Available online

optimal pH and temperature for its maximum activity were 9.0 and 35  C respectively. The
enzyme stabilized its activity in alkaline pH 7e11 and high salt concentration up to

Keywords:

4 mol dm
3. The enzymatic hydrolyzed product of agar was characterized as neo-

Agar

agarobiose while the bacterium when incubated with G. dura biomass yielded galactose

b-Agarase

20% on dry wt basis. The agarolytic ability of the former was further confirmed by release of

Biofuel

protoplasts from G. dura tissue through digestion of cell wall polysaccharides. The bacte-

Enzymatic digestion

rium investigated in this study could possibly be used for bioconversion of marine red algal

Fermentable sugar

polysaccharides into energy feedstock and the purified enzyme for preparation of compounds having pharmaceutical importance.
2013 Elsevier Ltd. All rights reserved.

1.

Introduction

There is a rapidly growing interest in developing renewable

fuel sources in order to decrease the dependency on fossil fuel
supplies and also to mitigate the global warming arising from
burning of fossil fuels [1]. Seaweeds are gaining global attention
as a potential feedstock for biofuels because of their higher
growth rates and amenability for easy depolymerization due to
less complex cell wall composition [2]. Moreover, use of seaweeds for fuels circumvents the debate on food vs fuel often

being discussed for terrestrial biomass. Furthermore, seaweed

cultivation does not require land and agricultural inputs
such as fertilizer, pesticides and water for their farming. Most
recent study has demonstrated the possibilities of producing
ethanol from brown alga Laminaria japonica and red alga Gelidium amansii employing the commercial enzymes for hydrolyzing the biomass [3]. The cell wall matrix of red seaweeds
belonging to the genera of Gelidium, Gelidiella and Gracilaria is
composed of agar as one of the polysaccharide component [4].
Agar is a heteropolysaccharide consisting of D-galactose and 3,

* Corresponding author. Tel.: 91 278 256 5801/256 3805x6140; fax: 91 278 256 6970/256 7562.
E-mail address: crk@csmcri.org (C.R.K. Reddy).
0961-9534/$ e see front matter 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.biombioe.2012.12.027

Author's personal copy

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

6-anhydro-L-galactose as monomers alternatively linked by

a-1, 3- and b-1, 4-glycosidic bonds [5]. Complete hydrolysis of
agar releases energy molecule, galactose, and 3, 6anhydrogalactose [6]. Also, the incomplete hydrolysis results
in low molecular weight oligosaccharides which are reported
to have various physiological and biological activities [7]. The
hydrolysis of agar into high value galactans can be carried out
either by chemical or enzymatic routes. The enzymatic hydrolysis being a benign process is preferred over chemical hydrolysis. The agar hydrolyzing enzymes are classified as aagarase [8] and b-agarase [9] based on the cleavage site of glycosidic bonds. Among these two, b-agarases were reported to
hydrolyze the agar into neo-oligosaccharides that have various
degrees of polymerization and biological activities [10]. Several
b-agarases have been purified and characterized from different
bacterial species such as Pseudoalteromonas, Pseudomonas,
Alteromonas, Agarivorans, Vibrio, Cytophage, Bacillus and Saccharophagus [11], Saccharophagus degradans [10], Zobellia galactanivorans [12].
The potential applications of agarases include preparation
of agaro-oligosachharides of medical importance, breaking
down the complex cell walls of red algae for preparing the
protoplasts and extracting biomolecules such as fatty acids,
vitamins, carotenoids, betaine etc. [13]. Agarases also assume
significant importance in bioconversion of seaweed biomass
into high value galactans including the feedstock substrate
for biorefinery industry. However, the agarases investigated
so far have shown limited functional ability from moderate
to extreme conditions of pH, temperature and salinity [14]
limiting their wider industrial applications. Consequently,
mutant b-agarases have been developed to enhance the
thermostability (50  C) of the enzyme [12,15].
In this study, we report purification, characterization and
biochemical properties of an exo-b-agarase from an endophytic marine bacterium Pseudomonas sp. isolated from the
red alga Gracilaria dura (C. Agardh) J. Agardh. Further, the
depolymerization efficiency as well as characterization of
resultant hydrolyzed products as a result of both enzyme and
bacterium activity were also determined using agar and seaweed biomass respectively as substrates.

2.

Materials and methods

2.1.

Isolation of agar degrading bacteria

The endophytic bacterial strain was isolated from the surface

sterilized tissue explants of seaweed species G. dura. The biomass of G. dura was collected from Veraval (latitude 20.55 N
and longitude 70.20 E) along the West coast of India. The plants
were immediately transported to the laboratory in cool packs
under low temperature. The explants of G. dura were prepared
in want of their micro-propagation for their de-novo regeneration (Supplementary information S1 and Supplementary
Fig. 1). Explants were cultured on Petri dish containing 20 mL
of solidified 1.0% agar medium supplemented with PES medium and cultured at 21  1  C under cool white fluorescence
tube lights at a photon flux of 5e10 mmol m
2 s
1 with 12:12
light and dark photoperiod. After an incubation of 7 d, bacterial
growth was observed around the explants which on further

291

incubation liquefy the agar around the explants. The pure

culture of the strain was obtained by spread plate method on
Zobell marine agar plates after an incubation of 72 h at temperature 30  2  C. Colonies forming pits around them were
picked up and purified by the same spread plate method. The
strain was also cultured on the solid media plates containing
artificial seawater salts (g L
1) as NaCl (24.6), KCl (0.67),
CaCl2$2H2O (1.36), MgSO4$7H2O (6.29), MgCl2$9H2O (4.66),
NaHCO3 (0.18) supplemented with 1.5% agar as sole source of
carbon.

2.2.

Evaluation of agarase activity

The
100
mL
of
bacterial
suspension
containing
2  104 CFU mL
1 was inoculated on liquid media containing
artificial seawater salts as above but supplemented with
lower concentration of agar (0.2 vol%) as carbon source. The
culture was then incubated at 30  2  C on an orbital shaker at
15.7 rad s
1 for 72 h. After incubation, bacterial cells were
removed by centrifuging the suspension at 1047.2 rad s
1 for
15 min. This cell free extract was used as crude enzyme
suspension. Enzyme assay was carried out by estimating the
reducing sugar librated using 3, 5-dinitrosalisylic acid (DNS)
method [16] and evaluated against the standard curve of
galactose. For activity assay, 1 mL of the culture supernatant
was added to 1 mL of glycineeNaOH buffer (50 mol m
3, pH
9.0) containing agar (0.2 vol%) and thereafter incubated at
35  C for 30 min. Then 1 mL of the reaction solution was
mixed with 1 mL of DNS reagent, heated for 15 min in boiling
water bath and then cooled. The release of reducing sugar
was estimated by measuring the absorbance at 546 nm
against the standard curve of galactose. From the above
experiment, one unit of enzymatic activity was defined as the
amount of enzyme that released 1 mmol of reducing sugar (as
D-galactose) from agar per minute. Protein concentration of
the enzyme was measured by Bradford method [17] and
standard curve was prepared taking bovine serum albumin
(BSA) as standard.

2.3.

Purification of agarase

The cell free supernatant (100 mL) was precipitated overnight

at 80% saturation with (NH4)2SO4 at 4  C and the pellet was
recovered by centrifugation. The precipitate was re-suspended
in 40 mL of glycineeNaOH buffer (50 mol m
3, pH 9.0), sealed in
dialysis bag (cut-off 8000 Da) and dialyzed for 2 d at 4  C. The
removal of ammonium sulfate was monitored with Nesselers
reagent. For ion exchange chromatography, 5 mL of the dialyzate was applied to DEAE Sepharose column equilibrated
with glycineeNaOH buffer. Fractions of 1 mL each were collected with a linear gradient of 0.1e1.0 mol dm
3 NaCl in the
same buffer. The eluates were monitored continuously at
280 nm for protein and also assayed individually for agarase
activity as described above.
The fractions with highest enzyme activities were pooled
and further purified by gel filtration on DEAE Sephadex A-50
column using the same buffer. The fractions were eluted at
a flow rate of 0.8 mL min
1. Active fractions were lyophilized
and stored at
20  C. Fractions showing maximum activity
were further analyzed for purity by electrophoresis. Sodium

Author's personal copy

292

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

dodecyl sulfate- polyacrylamide gel electrophoresis (SDSPAGE) as well as native PAGE was performed at 8% separating
gel. Protein bands were detected after staining the gel with
silver nitrate. For in-vitro activity staining, native-PAGE gel
was overlaid onto 0.5% agar gel prepared in glycineeNaOH
buffer (pH 9.0) and incubated for 3 h at 35  C. Thereafter, the
gel was flooded with Lugols iodine solution (5% I2 and 10% KI
in distilled water).

2.4.
Influence of pH and temperature on enzyme activity
and stability
The optimum agarase activity was determined at different
temperatures (5, 15, 25, 35, 45 and 55  C) and at different pH as
7.0, 8.0 (50 mol m
3 phosphate buffer) to 9.0, 10.0, 11.0, 12.0
and 13.0 (50 mol m
3 glycineeNaOH buffer). The thermal and
pH stability of the enzyme was also determined by estimating
the residual activity of enzyme after a pre-incubation of 1 h at
the temperature and pH ranges as studied for optimum pH
and temperature.

2.5.

Effects of various additives

The effects of various metal ions and reagents on the activity

of purified enzyme were examined under the optimized assay
conditions. The additives used in this study were the salts of
Co2, Pb2, Hg2, Mg2, Mn2, Li2, Zn2 and EDTA (10 mol m
3
each) and residual activity was calculated as relative (%)
considering control as 100%. The residual activity was also
determined against phenylmethylsulfonyl fluoride (PMSF) and
iodoacetate at concentration of 5 mol m
3 each. Effect of
various detergents such as triton X-100, tween-20, tween-80
and SDS at a concentration of 10 vol% were also evaluated.
Different solvents acetone, benzene, butanol, chloroform,
cyclohexane, dichloromethane, dimethylsulfoxide, ethanol,
heptanes, isopropanol, methanol and toluene (10 vol%) were
also tested in this study. Also the influence of salt concentration on enzyme activity was studied at NaCl concentration
ranging from 0.1 to 4.0 mol dm
3.

2.6.

Characterization of agaro-oligosaccharides

Initially the enzymatic hydrolysis of agar was analyzed as

decline in its molecular weight by high performance liquid
chromatography (HPLC) with a gel permeation column Ultrahydrogel 500 coupled with refractive index detector. Isocratic
elution was carried out at 30  C with a mobile phase (water
containing 0.1 mol dm
3 sodium nitrate) at column flow rate
of 0.8 mL min
1. Molecular size markers ranging from 100 to
4,01,000 Da were used to determine the size of the end product
of the reaction.
The molecular mass distribution of agar oligosaccharides
was determined by mass spectrometry (Waters Q-Tof)
equipped with an electrospray ionization interface, MCP detector and Waters MassLynx software (version 4). Samples
were introduced by direct injection with a syringe pump. The
mass spectrometer was run employing direct flow injection
technique and the mass fragmentation was recorded on ESI
positive mode (ESI).

2.7.
Carbon-13 nuclear magnetic resonance
spectroscopy
After enzymatic hydrolysis, the oligomers were precipitated
with iso-propanol and dried at room temperature. The dried
material was dissolved in D2O for 13C NMR spectroscopy. The
NMR spectrum was recorded on Bruker-Avance II 500 at room
temperature. 13C chemical shifts were referenced to internal
standard DMSO (39.4 ppm).

2.8.

Strain identification

The characterizations of isolated bacterial strain include

Grams staining, metabolic activities and motility test. The
molecular characterization involved amplification of 16 S rDNA
sequence using universal primers (AGAGTTTGATCCTGGCTCAG and AAGGAGGTGATCCAGCC). Sequence thus obtained
was compared with the sequences in nucleotide database
(NCBI) using the BLAST N algorithm.

2.9.

Hydrolysis of agar-based biomass

The dried powder of alga G. dura was used for hydrolysis

study. The powder was mixed with artificial seawater salts in
an aqueous environment buffered to pH 9.0 (50 mol m
3 glycineeNaOH) and inoculated with the bacterial strain. The
mixture was incubated at 35  C for 72 h in an incubator shaker
with an orbital speed of 15.7 rad s
1. The mixture was centrifuged at 1047.2 rad s
1 for 15 min to remove the debris and
the clear supernatant was collected. The supernatant was
filtered through 0.2 mm filter (Milipore, USA). The filtrate was
analyzed on HPLC (Waters Alliance model) equipped with
refractive index detector (Waters 2414). A Supelco Gel 610-H
column (30 cm  7.8 mm) maintained at 30  C was used
as separation channel. Elution was carried out in a mobile
phase of 0.1% phosphoric acid in water with flow rate of
0.5 mL min
1. The galactose released was quantified by
standard peak area method as well as after spiking with
standard galactose for precision in analysis and to compensate the effect of plant matrix. The recovery % was determined
by the formula (AS$A
1
B )  100, where AS is area of the peak for
spiked sample and AB is area of peak in blank plant matrix.
The repeatability of the analysis was determined by the
intraday and interday precision with sample injections in
replicate of three. The galactose release was further confirmed
by GC-MS analysis (Shimadzu, Japan) as well. For GCeMS
analysis the hydrolyzed filtered supernatant was lyophilized
for complete removal of water. The dried material was then
derivatized to generate aldonitrile pentaacetate derivatives of
monosaccharide following the method described by Lawrence
and Iyengar [18].

2.10.

Protoplasts isolation

The efficacy of the purified enzyme was further verified by

digesting the cell wall of agarophytes to release protoplasts.
Protoplasts from an agarophytic seaweed, G. dura (C. Agardh)
J. Agardh was isolated following the protocol described by
Gupta et al. [19]. Enzyme mix for protoplast preparation was
prepared following the method of Gupta et al. [19] wherein the

Author's personal copy

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

commercial agarase (SigmaeAldrich, USA) was replaced with

bacterial agarase (2 vol%) and pH was adjusted to 8.0 with
TriseHCl (50 mol m
3).

2.11.

Statistical analysis

All the experiments were conducted in replicates of three and

the results are presented as mean  S.D. Further the significant differences among the mean values were evaluated by
Tukeys HSD test after performing one way ANOVA at p  0.05.

3.

Results and discussions

3.1.

Isolation and identification of agarolytic bacteria

The bacterial strain investigated in this study was isolated

from the tissue culture explants of the red alga G. dura
(Supplementary information S1). Incidentally, liquefaction of
agar was observed around the explants after a period of 7 d
culture that subsequently formed deep pits in Petri dishes
after 20 d of culture (Fig. 1A). The bacterial strain responsible
for agar liquefaction was characterized as an endophyte, gram
negative, rod, aerobic and motile bacterium (Fig. 1B).
The biochemical and physiological properties of the strain
are described in Table 1.
The preliminary identification based on the biochemical
and physiological characteristics showed that the strain belongs to the genus Pseudomonas (Bergeys Manual). Further, the
16S rDNA sequence revealed its 94% homology with unculturable bacterium from BLAST search of the NCBI database. Of
the various agarases investigated so far from marine sources,
there is only one report of characterizing this enzyme from
Pseudomonas which was also happened to be a seaweed
associated bacteria [6]. This species was reported to produce
endo-b-agarase I, b-agarase II and neoagarobiose hydrolase.
These enzymes with their sequential catalytic activities led to
the production of 3, 6-anhydro-L-galactose and D-galactose
from agarose [6]. The b-agarase from Pseudomonas sp. investigated in this study is found to yield neoagarobiose directly in

293

one step process indicating its exolytic mode of cleavage. But

the detection of galactose in bacterial culture medium with
seaweed biomass indicated the secretion of neoagarobiose
hydrolase enzyme too. This strain showed its unique characteristic of growth on both nutrient broth and seawater salt
medium with agar as sole source of carbon confirming its
haloduric physiology which is novel and unique. Further, nongalactose metabolizing activity of the strain (Table 1) together
with haloduric nature offers an opportunity for exploring its
possible application in bio-refinery utilizing marine biomass.
Moreover, the neoagarobiose obtained from the hydrolysis
of agar is reported to have various health care applications
[20,21] and the same had also been determined herein by
measuring the antioxidant potential using FRAP analysis as
well as DNA protective effect against the free radicals
(Supplementary information S2). The FRAP value thus estimated was 1.16 mg g
1 equivalent to that of the standard
L-ascorbic acid. The DNA protection induced by the hydrolyzed
product was estimated as 49.28  1.5, 50.18  2.2, 64.28  1.8
and 63.8  0.75% at concentration 10, 15, 20 and 25 mg respectively (Supplementary Fig. 2). The sugar moieties such as 3, 6anhydrogalactopyranose or galactopyranose at the reducing
end of neoagarobiose tend to open their hemi-acetal ring and
form aldehyde group that can quench the nucleophile attack of
free radicals. Commonly, antioxidants from seaweeds were
extracted by organic solvents and are water insoluble [22]. The
vitamin C and vitamin E both are natural water soluble antioxidants. Nevertheless, the neoagarobiose obtained in this
study showed promising antioxidant properties in aqueous
medium indicating its potential application in pharmaceutical
formulations (Supplementary information S2).

3.2.

Purification of agarase

The purification of crude agarase following ammonium sulfate, ion exchange chromatography and gel permeation
chromatography gave a yield of 28.2% of pure enzyme with
a purity fold of 8.33. The chromatograms for ion exchange and
gel permeation chromatography are given in supplementary
section (Supplementary Fig. 3A and B). The purity of the

Fig. 1 e (A) Tissue explants of Gracilaria dura on agar plate showing deep pits around them, (B) Staining and appearance of
isolated bacterial strain.

Author's personal copy

294

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

Table 1 e Morphological and physiological characteristics

of endophytic strain Pseudomonas sp.
Characteristics investigated
Cell shape
Production of pigment
Growth at 35  C
Anaerobic growth
Utilization of glucose, dextrose,
trehalose, fructose, xylose
Utilization of inositol, arabinose,
raffinose, galactose, cellobiose,
lactose, arabinose, adonitol, sucrose,
dulcitol, rhamnose, sorbitol
Motile
Bile esculin hydrolysis
Citrate utilization
ONPG test
Utilization of phenylalanine, nitrate,
ornithine
Reactions of deamination and nitrate,
melonate reduction
VogeseProskauer test
Oxidase, urease
H2S production

Results
Straight rods
No
Yes
No
Yes
No

Yes
Yes
Yes
No
No
No
No
No
No

enzyme was confirmed by obtaining a single band of molecular weight w66 kDa in both SDS-PAGE and native PAGE
(Fig. 2). Further, the in-vitro activity staining showed a halo at
the same position as observed in the native PAGE confirmed
the purity and molecular weight of the enzyme (Fig. 2).
The pure agarase attained the maximum activity of
81.74 U mL
1 with a specific activity of 615.5 U mg
1. The
purification steps and rate of recovery are summarized in

Fig. 2 e SDS-PAGE analysis of purified agarase. Lane 1

molecular mass markers, lane 2 purified agarase, lane 3
in-vitro activity staining.

Table 2. The extracellular b-agarase of similar molecular

weight (63 kDa) was also reported from Pseudomonas like
bacteria by Malmqvist [23].

3.3.
Influence of pH and temperature on enzyme activity
and stability
The residual activity measured at different pH and temperatures revealed that pH 9.0 and temperature 35  C are optimum
for the enzyme activity. The residual activity of about 85.2 and
78.2% at pH 10 and 11 respectively confirmed the enzyme as
an alkaliphile. Moreover, the enzyme showed stability against
broad range of alkaline pH and retained about 62% of its activity at pH 12 and almost 50% at pH 13 after a pre-incubation
of 1 h (Fig. 3A). The enzyme showed tolerance to narrow
temperature regime (30 and 35  C) for its activity. The studies
on stability of the enzyme showed that the enzyme is not
thermally stable as it lost 50% of its activity at 35  C after an
incubation of 1 h (Fig. 3B). The exo-b-agarase characterized
from other species such as Saccharophagus degradans [11],
Agarivorans albus YKW-34 [24], Vibrio sp. [25]. and Agarivorans
sp. LQ48 [26] were also reported to have short range of thermal
stability.

3.4.

Effect of various additives

The effect of various additives (10 mol m
3) were measured in

terms of the residual activity (%) of the enzyme compared to
that of the control (100%). Of the metal ions studied, the
enzyme activity was not influenced by the salts of Hg2, Mg2,
Li2 and retained 80% of its activity. The slight inhibition in the
enzyme activity under the influence of Hg2 indicated the key
role of thiol group in the enzyme active site conformation.
There was 44% increase in the activity in the presence of Mn2
ions compared to that of control. In contrast, Mn2 ions were
reported to strongly inhibit the activity of agarase isolated
from A. albus YKW-34 [24], Vibrio sp. [25]., and Pseudoalteromonas sp. AG4 [11]. However the same has shown stimulatory
effects on the agarase activity characterized and isolated from
Agarivorans sp. LQ48 [26]. Other metal ions studied such as
Zn2, Co2 and Pb2 as well as metal chelator EDTA resulted in
an abrupt decline in the enzymatic activity (Fig. 3C). The
occurrence of structural alterations in the catalytic moieties of
the enzyme due to the affinity of the metals for the SH, CO and
NH functional groups may be attributed for the decline in its
activity in the presence of divalent metal ions such as Zn2.
The inhibitory effect of chelator EDTA along with other metal
ions was also found in different agarases [11,26]. The enzyme
retained 65% of its activity in the presence of PMSF after 1 h of
incubation indicating that the enzyme belongs to cysteine
type protein. This was further confirmed by inhibition of its
activity with iodoacetate. Interestingly, the enzyme showed
tolerance against broad range of NaCl concentrations ranging
from 0.1 to 4.0 mol dm
3 (Fig. 3D). Along with the stability of
the enzyme in broad pH ranges, the salt tolerance is also very
high compared to other agarases reported.
Enzyme retained 89.2, 60.2 and 58% of residual activity in
the presence of non-ionic detergents such as tween-20, -80
and triton X-100 respectively while in SDS it lost its activity to
about 60% (Fig. 4A). Unlike previous studies, the enzyme

Author's personal copy

295

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

Table 2 e Summary of purification of enzyme agarase from Pseudomonas sp.

Steps
Crude enzyme
(NH4)2SO4 precipitation
DEAE sepharose
DEAE sephadex A-50

Volume
(mL)

Total activity
(U)

Total protein
(mg)

Specific activity
(U mg
1)

Purification
(fold)

Yield
(%)

400
15
16
5

1448
724
703
408.7

19.6
8.03
2.26
0.664

73.87
90.16
311.06
615.5

1
1.2
4.21
8.33

100
50
48.5
28.2

investigated in this study showed tolerance toward the nonionic detergents and the degree of inhibition observed in the
presence of anionic detergent SDS was also comparatively low
[26]. This inhibitory effect of SDS on enzyme activity could be
attributed for obtaining a faint band in SDS-PAGE analysis
(Fig. 2). This study also investigated the influence of various
organic solvents on enzyme activity as a result some extent of
tolerance for benzene and heptanes with residual activity of
63.5 and 50% respectively was observed while others showed
negative effects on activity (Fig. 4B).

3.5.

Characterization of agaro-oligosaccharides

The hydrolysis of agar with purified agarase enzyme was

confirmed primarily with the decline in its molecular weight
after gel permeation chromatography (Fig. 5A). There were
three major peaks in the chromatogram that corresponded to
the molecular weight (MW) 77791, 2311 and 328 Da (Fig. 5A).
The MW of 328 Da corresponds to the disaccharide unit neoagarobiose (C12H20O10) with formula weight of 324 indicating

for the b-cleavage. The decline in the MW of polymeric agar as

observed by other peaks of low molecular weight confirmed
the hydrolysis of agar. Further, the predicted molecular mass
of deprotonated disaccharide showed a peak at 323 (m/z) after
LC-MS analysis (Fig. 5B). The b-cleavage of agar was further
confirmed with 13C NMR spectroscopy. The NMR result
showed typical resonance signals at 103 and 99 ppm which
matched to the reducing end of neoagarobiose (Fig. 5C).
The enzyme b-agarases are known for their endo- as well as
exolytic cleavage producing mainly neoagarobiose and other
intermediate products such as neoagarotetrose and neoagarohexose [24]. The b agarase from Alteromonas sp. [27]. and
the recombinant agarase Ag50D from S. degradans have exolytic cleavage mode that mainly produces the neoagarobiose
[10]. The agarase enzyme investigated in this study also yielded neoagarobiose as a major product indicating for its exolytic cleavage of agar. 13C NMR analysis of oligosaccharides
deduced that the agarase produced 3, 6-anhydrogalactose as
the non reducing end and galactose as the reducing end. The
same has also been confirmed with LC-MS analysis. The above

Fig. 3 e Biochemical characterization of pure agarase describing effect of (A) pH, (B) temperature, (C) various additives and (D)
NaCl concentrations. Letters above or below the bars represent that the respective values are significantly different at
p 0.05.

Author's personal copy

296

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

Fig. 4 e Enzyme activity profile in presence of (A)

detergents and (B) solvents. Letters above or below the bars
represent that the respective values are significantly
different at p 0.05.

mentioned findings provide circumstantial evidence that the

enzyme investigated in this study is a b agarase with exolytic
cleavage of agar.

3.6.

Protoplast isolation

The tissue of G. dura treated with the enzyme mixture containing agarase purified in the present study resulted in the
softening of the algal tissue and subsequently release the
protoplasts (Fig. 6B).
The yield of protoplasts obtained was 2  0.5  103 g
1 FW
of the algal tissue. The release of protoplasts confirmed the
agar hydrolyzing potential of the enzyme. The protoplasts
yield in this study is however inferior to that of the same
obtained after digestion of cell wall with commercial agarase
[19]. This enzyme offers a cost effective alternate for releasing
the protoplasts for mass propagation of this alga.

3.7.

Hydrolysis of agar-based biomass

This part of the study was aimed at confirming the potentials

of the bacterium in hydrolyzing the seaweed biomass into
fermentable sugar i.e. galactose. The medium for the hydrolysis of biomass formed the sol/gel condition on autoclaving
which liquefied after 72 h of incubation with the isolated
bacterium. The solution thus obtained was analyzed and
showed galactose yield of 20% on dry weight basis of seaweed
biomass (Fig. 6A). However unidentified peaks were also
observed after HPLC analysis. The yield of galactose was calculated by analytical technique HPLC on the basis of standard
peak area method. The influence of plant matrix was avoided
after spiking the hydrolyzed product with the known

Fig. 5 e Analysis of agar hydrolyzed products based upon

(A) HPLC coupled with gel permeation chromatography, (B)
LC/Q-Tof mass spectroscopy and (C) 13C NMR spectroscopy.

concentration of standard galactose. The galactose released

was also confirmed qualitatively by obtaining a characteristic
mass fragmentation after GC-MS analysis of hydrolyzed
product (Supplementary Fig. 4). The agarase, thus, showed its
remarkable potential in yielding agar derived oligosaccharide
neo-agarobiose in one step process which is otherwise
reported to be a sequential activity of different enzymes [6].
Moreover, release of galactose after hydrolysis of red algal
biomass by this bacterial strain showed its promising role in
biofuel industry utilizing marine biomass. Seaweeds are
recently gaining worldwide attention as a promising source of
high energy molecules because of their higher growth and
amenability for easy depolymerization processes due to less
complex thallus structure in addition to their known higher
carbon sequestration potentials over terrestrial plants [28]. In
this context, polysaccharide degrading enzymes are getting
global attention for conversion of seaweed galactans into
fermentable sugars [29]. But lower activity and stability of
natural agarases at high pH and salt concentration largely
limit their applicability at industrial level. The bacterial strain
and the agarase enzyme characterized in this study showed

Author's personal copy

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

297

Fig. 6 e Functional characterization of purified agarase in (A) bioconversion of seaweed galactans into fermentable sugar
galactose and (B) isolation of protoplasts from seaweed species G. dura. Gal: Galactose.
tolerance to broad pH ranges and high salt concentration in its
natural state offering its suitability for bioconversion of seaweed galactans into bio-fuel or other industrial chemicals.
Most recently, Kim et al. [3] discussed the viable strategy for
ethanol production from seaweed biomass using commercial
enzymes. The release of galactose with a yield as high as 20%
on dry weight basis in this study unambiguously reveals the
prospective application of the agarase producing bacteria for
biorefinery applications.

Acknowledgments
The financial support received from Council of Scientific and
Industrial Research (NWP-018) is gratefully acknowledged. Mr.
Vishal, Mr. Nitin and Mr. Manoj would like to thank CSIR for
Senior Research Fellowship.

Appendix A. Supplementary data

4.

Conclusions

In conclusion, an endophytic bacterium associated with red

alga G. dura found to produce an extracellular exo-type bagarase enzyme that catalyzes conversion of agar into neoagarobiose while the bacterium have the potential to convert
the marine red algal biomass into energy feedstock chemicals.
The optimum enzymatic activity and stability of the purified
agarase at high alkaline and salt concentration together with
its potential role in bioconversion of marine red algal biomass
into fermentable sugar substantiate its scope for possible biorefinery applications.

Supplementary data related to this article can be found at

http://dx.doi.org/10.1016/j.biombioe.2012.12.027.

references

[1] Hahn-Hgerdal B, Galbe M, Gorwa-Grauslund MF, Liden G,

Zacchi G. Bio-ethanol e the fuel of tomorrow from the
residues of today. Trends Biotechnol 2006;24(12):549e56.
[2] Goh CH, Lee KT. A visionary and conceptual macroalgaebased third-generation bioethanol (TGB) biorefinery in
Sabah, Malaysia as an underlay for renewable and

Author's personal copy

298

[3]

[4]
[5]
[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

b i o m a s s a n d b i o e n e r g y 4 9 ( 2 0 1 3 ) 2 9 0 e2 9 8

sustainable development. Renew Sust Energ Rev 2010;14(2):

842e8.
Kim NJ, Li H, Jung K, Chang HN, Lee PC. Ethanol production
from marine algal hydrolysates using Escherichia coli KO11.
Bioresour Technol 2011;102(16):7466e9.
Bixler HJ, Porse H. A decade of change in the seaweed
hydrocolloids industry. J Appl Phycol 2011;23(3):321e35.
Araki C. Structure of the agarose consitituent of agar-agar.
Bull Chem Soc Jpn 1956;29(4):543e4.
Morrice LM, McLean MW, Williamson FB, Long WF. Betaagarases I and II from Pseudomonas atlantica. Purifications and
some properties. Eur J Biochem 1983;135(3):553e8.
Chen H, Yan X, Zhu P, Lin J. Antioxidant activity and
hepatoprotective potential of agaro-oligosaccharides in vitro
and in vivo. Nutr J 2006;5:31.
Potin P, Richard C, Rochas C, Kloareg B. Purification and
characterization of the a-agarase from Alteromonas
agarlyticus (Cataldi) comb. nov., strain GJ1B. Eur J Biochem
1993;214(2):599e607.
Kirimura K, Masuda N, Iwasaki Y, Nakagawa H, Kobayashi R,
Usami S. Purification and characterization of a novel bagarase from an alkalophilic bacterium, Alteromonas sp. E-1.
J Biosci Bioeng 1999;87(4):436e41.
Kim HT, Lee S, Lee D, Kim HS, Bang WG, Kim KH, et al.
Overexpression and molecular characterization of Aga50D
from Saccharophagus degradans 2-40: an exo-type b-agarase
producing neoagarobiose. Appl Microbiol Biotechnol 2010;
86(1):227e34.
Oh C, Nikapitiya C, Lee Y, Whang I, Kang D, Heo SJ, et al.
Molecular cloning, characterization and enzymatic
properties of a novel Beta agarase from a marine isolate
Psudoalteromonas sp. Ag52. Braz J Microbiol 2010;41(4):876e89.
Jang MK, Lee SW, Lee DG, Kim NY, Yu KH, Jang HJ, et al.
Enhancement of the thermostability of a recombinant bagarase, AgaB, from Zobellia galactanivorans by random
mutagenesis. Biotechnol Lett 2010;32(7):943e9.
Araki T, Lu Z, Morishita T. Optimization of parameters for
isolation of protoplasts from Gracilaria verrucosa
(Rhodophyta). J Mar Biotechnol 1998;6(3):193e7.
Fu XT, Kim SM. Agarase: review of major sources, categories,
purification method, enzyme characteristics and
applications. Mar Drugs 2010;8(1):200e18.
Shi C, Lu X, Ma C, Ma Y, Fu X, Yu W. Enhancing the
thermostability of a novel b-agarase AgaB through directed
evolution. Appl Biochem Biotechnol 2008;151(1):51e9.

[16] Miller GL. Use of dinitrosalicylic acid reagent for

determination of reducing sugar. Anal Chem 1959;31(3):
426e8.
[17] Bradford MM. A rapid and sensitive method for quantitation
of microgram quantities of protein utilizing the principle of
proteinedye binding. Anal Biochem 1976;72(1e2):248e54.
[18] Lawrence JF, Iyengar JR. Gas chromatographic determination
of polysaccharide gums in foods after hydrolysis and
derivatization. J Chromatogra 1985;350:237e44.
[19] Gupta V, Kumar M, Kumari P, Reddy CRK, Jha B. Optimization
of protoplast yields from the red algae Gracilaria dura (C.
Agardh) J. Agardh and G. verrucosa (Huds.) Papenfuss. J Appl
Phycol 2011;23(2):209e18.
[20] Wang J, Jiang X, Mou H, Guan H. Anti-oxidation of agar
oligosaccharides produced by agarase from a marine
bacterium. J Appl Phycol 2004;16(5):333e40.
[21] Hu B, Gong Q, Wang Y, Ma Y, Li J, Yu W. Prebiotic effects of
neoagaro-oligosaccharides prepared by enzymatic
hydrolysis of agarose. Anaerobe 2006;12(5e6):260e6.
[22] Yan X, Nagata T, Fan X. Antioxidative activities in some
common seaweed. Plant Foods Hum Nutr 1998;52(3):253e62.
[23] Malmqvist M. Purification and characterization of two
different agarose degrading enzymes. Biochim Biophys Acta
1978;537(1):31e43.
[24] Fu XT, Lin H, Kim SM. Purification and characterization of
a novel b-agarase, AgaA34, from Agarivorans albus YKW-34.
Appl Microbiol Biotechnol 2008;78(2):265e73.
[25] Zhang W, Sun Li. Cloning, characterization, and molecular
application of a beta-agarase gene from Vibrio sp. strain
V134. Appl Enviorn Microbiol 2007;73(9):2825e31.
[26] Long M, Yu Z, Xu X. A Novel b-Agarase with high pH stability
from marine Agarivorans sp. LQ48. Mar Biotechnol 2010;12(1):
62e9.
[27] Wang JX, Mou HJ, Jiang XL, Guan HS. Characterization of
a novel b-agarase from marine Alteromonas sp. SY37e12 and
its degrading products. Appl Microbiol Biotechnol 2006;71(6):
833e9.
[28] Lee KS, Hong ME, Jung S, Ha S, Yu BJ, Koo HM, et al. Improved
galactose fermentation of Saccharomyces cerevisiae through
inverse metabolic engineering. Biotechnol Bioeng 2010;
108(3):621e31.
[29] Michel G, Nyval-Collen P, Barbeyron T, Czjzek M, Helbert W.
Bioconversion of red seaweed galactans: a focus on bacterial
agarases and carrageenases. Appl Microbiol Biotechnol 2006;
71(1):23e33.