Professional Documents
Culture Documents
Brief communication
College of Life Science, Northwest A&F University, Yangling, Shaanxi 712100, China
Key Laboratory of Agriculture Molecular Biology in Shaanxi, Yangling, Shaanxi 712100, China
Received 24 October 2006; received in revised form 18 January 2007; accepted 21 January 2007
Abstract
MicroRNAs (miRNAs) are a group of short (22 nt) noncoding RNAs that specifically regulate cellular gene expression at the post-transcriptional
level. miRNA precursors (pre-miRNAs), which are imperfect stem loop structures of 70 nt, are processed into mature miRNAs by cellular RNases
III. To date, hundreds of miRNAs and their corresponding targets have been reported in kinds of species. Although only a few of these miRNA/target
pairs have been functionally verified, some do play important roles in regulating normal development and physiology. Several viruses (e.g. the
Epstein-Barr virus and human herpesvirus Kaposis sarcoma-associated herpesvirus) has been reported to encode miRNAs. Here, we extend the
analysis of miRNA-encoding potential to the Hepatitis B virus (HBV). Using computational approaches, we found that HBV putatively encodes
only one candidate pre-miRNA. We then matched deduced mature miRNA sequence from this pre-miRNA against a database of 3 untranslated
sequences (UTR) from the human genome. Surprisingly, none of cellular transcripts could potentially be targeted by the viral miRNA (vmiRNA)
sequence. However, one viral mRNA was found to be targeted by the vmiRNA when we searched the target from viral mRNAs. We propose that
HBV has evolved to use vmiRNAs as a means to regulate its own gene expression for its benefit.
2007 Elsevier Ltd. All rights reserved.
Keywords: HBV; MicroRNA; Identification; Target
Corresponding author at: College of Life Science, Northwest A&F University, Yangling, Shaanxi 712100, China. Tel.: +86 29 8702 6171;
fax: +86 29 8709 2262.
E-mail address: guoaiguang@yahoo.com.cn (A.-G. Guo).
1476-9271/$ see front matter 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.compbiolchem.2007.01.005
125
Fig. 1. Potential hairpin structures on HBV genome. Red ringed sequence is miRNA candidate. (For interpretation of the references to colour in this figure legend,
the reader is referred to the web version of the article.)
Table 1
Sequence and location of miRNA
Virus miRNA
miRNA sequence
Localization on HBV genome
#2
CAUGUCCUACUGUUCAAGCCUC
18501871
18861907 (4a)
25492570 (4b)
30813012 (4c)
Fig. 3. RNA enriched for small RNAs (<80 nt) was extracted from blood cells
with mock-infected (lane 1) or HBV-infected (lanes 2 and 3) and was separated in
15% polyacrylamide8 M urea gel and hybridized to vmiRNA#2-specific probe
(top) or to control 5S rRNA probe (bottom). The strong hybridization signal on
lane 2 indicated high expression of the vmiRNA in latency cells, and the faint
signal on lane 3 showed very low-abundance of vmiRNA in activity cells.
126
Fig. 4. Potential region targets in mRNA by miRNA (red ring). (For interpretation of the references to colour in this figure legend, the reader is referred to the web
version of the article.)
Acknowledgement
The authors thank Dr. Ning Gao, Second Affiliated Hospital, Xian Jiaotong University, for providing necessary RNA
samples.
References
Bartel, D.P., 2004. MicroRNAs, genomics, biogenesis, mechanism, and function. Cell 116, 281297.
Fire, A., Xu, S., Montgomery, M.K., et al., 1998. Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans. Nature
391, 806811.
Griffiths-Jones, S., 2004. The microRNA registry. Nucl. Acids Res. 32 database
issue, D109D111.
Hofacker, I.L., Fontana, W., Stadler, P.F., Bonhoeffer, S., Tacker, M., Schuster, P., 1994. Fast folding and comparison of RNA secondary structures.
Monatshefte f Chemie 125, 167188.
Hunter, C., Poethig, S.R., 2003. Missing links, miRNAs and plant development.
Curr. Opin. Genet. Dev. 13, 372378.
Kim, V.N., 2004. MicroRNA precursors in motion: exportin-5 mediates their
nuclear export. Trends Cell Biol. 14, 156159.
Lee, R.C., Feinbaum, R.L., Ambros, V., 1993. The C. elegans heterochronic
gene lin-4 encodes small RNAs with antisense complementarity to lin-14.
Cell 75, 843854.
Lee, Y., Jeon, K., Lee, J.T., Kim, S., Kim, V.N., 2002. MicroRNA maturation,
stepwise processing and subcellular localization. EMBO J. 21, 46634670.
Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., Kim, V.N., 2003. The nuclear RNase III Drosha initiates
microRNA processing. Nature 425, 415419.
Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge, C.B., 2003.
Prediction of mammalian microRNA targets. Cell 115, 787798.
Lewis, B.P., Burge, C.B., Bartel, D.P., 2005. Conserved seed pairing, often
flanked by adenosines, indicates that thousands of human genes are
microRNA targets. Cell 120, 1520.
Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John,
B., Enright, A.J., Marks, D., Sander, C., Tuschl, T., 2004. Identification
of virusencoded microRNAs. Science 304, 734736.
Zeng, Y., Cullen, B.R., 2004. Structural requirements for pre-microRNA binding
and nuclear export by Exportin 5. Nucl. Acids Res. 32, 47764785.
Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization
prediction. Nucl. Acids Res., 34063415.