Option The code broken

1. The structure of a gene provides the code for a

polypeptide
DNA: a gene contains a sequence of bases to code for a protein
RNA: RNA is similar to DNA except that instead of deoxyribose as the sugar, it has ribose. It
is single stranded, and instead of thymine, there is uracil.

Describe the processes involved in the transfer of

information from DNA through RNA to the production of a
sequence of amino acids in a polypeptide
Protein synthesis is a coordinated process for the manufacture of proteins using information
on sections of DNA, that is the genes
Protein synthesis is the process:
Experiments have shown that the
proteins are made in the cytoplasm of a
cell, but almost all DNA is restricted to
the nucleus
There are three forms involved in
protein synthesis
o mRNA: Messenger RNA carries
the genetic code out of the
nucleus, into the cytoplasm,
where it can be read by the
ribosomes
o tRNA: Transfer RNA carries the
amino acids to the ribosome to
link and form a polypeptide
chain. At the bottom of every
tRNA molecule is an anti-codon
that binds to the codon on the
mRNA strand. This is how the
amino acid is linked to the codon
o Ribosomal RNA: Ribosomes are made up of protein and RNA
Ribosome: The ribosome is the active site for polypeptide synthesis. It is made up of protein
and RNA molecules. It can accommodate 2 tRNA at a time.
Enzyme: The enzyme that controls the formation of mRNA is polymerase.
Stage one: Transcription:
A double stranded DNA molecule in the nucleus unwinds a section of itself that
consists of a single gene.
One of the strands coding for the gene exposes itself to the nucleoplasm

Option The code broken

The enzyme moves along the strand, attaching loose RNA nucleotides to the DNA,
with A-U and C-G, until the whole gene is copied
This new RNA strand is called messenger RNA (mRNA)
A start codon and a stop codon determine the length of the gene
Transcription is the step in protein synthesis during which the gene produces a
complementary strand of mRNA

The mRNA then moves from the nucleus to the cytoplasm of the cell
Stage two: Translation:
The mRNA strands bind to a ribosome in the cytoplasm, with the start codon being
AUG (always).
The ribosome moves along the mRNA strand to read more of its bases
tRNA molecules floating in the cytoplasm, which have anti-codons complementary to
the codons of mRNA enter the ribosome. e.g. If the mRNA had an AAG codon, the
UUC tRNA would bind to it.
As the tRNA releases its amino acid to attach to the ribosome, it leaves to find another
amino acid. The ribosome can only accommodate 2 tRNA
The ribosome moves along the mRNA and more and more amino acids are attached
with peptide bonds on the growing polypeptide chain.
When a stop codon is reached, the polypeptide chain is released into the cytoplasm
for further processing to become a protein.
Translation is where the mRNA base sequence is translated into an amino acid
sequence of a polypeptide. Translation occurs in the cytoplasm of the cell on the
ribosomes

Choose equipment or resources to perform a first-hand

investigation to construct a model of DNA
Parts of DNA
Bases different coloured pegs
Backbone String through the pegs
Difficulties
String didnt show the difference between the phosphate and the sugars

Process information from secondary data to outline the

current understanding of gene expression

A gene is fully expressed when its polypeptide is synthesised, converted to a protein

and the protein is fully functional
Gene expression chooses which part of the DNA is actually being used in particular
cells
Only about 5 percent of a cells functioning genes are being expressed at a particular
time

Option The code broken

Option The code broken

2. Multiple alleles and polygenic inheritance provide
further variability within a trait
Give an example of characteristics determined by multiple
alleles in an organism other than humans

Some characteristics have more than two alternative forms and more than two alleles
In clover plants the pattern of chevrons on the leaves is controlled by seven different
allelic genes
Each plant inherits one gene from each parent for leaf pattern, but with seven alleles
to chose from, there are many possible genotypes and phenotypes
They have a total of 28 gene combinations, each giving a different phenotype

Compare the inheritance of the ABO and Rhesus blood

groups

The inheritance of the D rhesus factor is entirely dependent of the ABO antigens and
is controlled by two alleles which show a simple dominant-recessive pattern
When describing a persons blood type, both the ABO and Rh classifications are
described. e.g. blood type AB+ means that the cells carry A, B and D. e.g. Blood
type A- means the cells carry antigen A only
Various symbols are used to denote the rhesus factor alleles, but the simplest system is
to use D for Rh+ and d for RhThe rhesus factor is inherited in a Mendelian pattern:
o Two dominant-recessive alleles only
The ABO blood types are inherited by a multiple alleles system:
o 3 alleles give 6 genotypes and 4 phenotypes

Define what is meant by polygenic inheritance and describe

one example of polygenic inheritance in humans or another
organism

Poly = many
Genic = referring to genes
A polygenic trait is a characteristic which is controlled by many different, independent
genes
The classic example of polygenic inheritance in humans is the way that height is
inherited
How tall you grow depends on many factors, including:
o Environmental influences such as nutritional diseases during childhood

Option The code broken

o From a genetic angle, each person inherits a potential height which might be
achieved

Outline the use of highly variable genes for DNA

fingerprinting for forensic samples, for paternity testing and
for determining the pedigree of animals

DNA fingerprinting can be used in forensics, paternity tests or for pedigreeing

animals
In the DNA there are:
o Parts that are the same for many individuals
o Parts that vary a lot from one individual to the next
Variable parts used for DNA fingerprinting
The variable DNA can have base sequences that are repeated over and over again
e.g. CATCATCATCATCATCATCATCATCAT
o The number of repetitions varies from person to person

TO GET A DNA FINGERPRINT THESE VARIABLE PIECES MUST BE SEPERATED

FROM OTHER PIECES.
1. The DNA is cut using restriction enzymes which cut on either side of the variable
DNA
2. The DNA is placed on the edge of a gel
3. An electric current charge makes them move across the gel
4. To make the DNA become visible, a radioactive probe is used (i.e. a small piece of
DNA with the opposite sequence to the variable strand)
e.g. GTAGTAGTAGTAGTAGTAGTAGTAGTA
5. The probes connect to the variable strands whenever the sequence matches
6. This stands out on film, the more radioactive pieces, the thicker the bands

Solve problems to predict the inheritance patterns of ABO

blood groups and the Rhesus factor

Blood types:
o A dominant IA
o B dominant IB
o AB dominant IAB
o A recessive IAi
o B recessive IBi
o AB recessive IABi
o O ii

Option The code broken

An AB blood type person had sex with an O type person, gametes were:
o IA
IB
X
i
i
i
i

IA
IAi
IAi

IB
IBi
IBi

Therefore, the offspring were 50% A type recessive and 50% B type recessive

Process information from secondary sources to identify and

describe one example of polygenic inheritance
Human height
Different parts of peoples bodies contributes to their height in different ways
o e.g. long body, short legs
o or long legs short body
The length of each section of their body is determined by a separate totally
independent set of genes
Overall, the height of each person is the effect of many, separate gene systems
THIS IS POLYGENIC INHERITANCE

Option The code broken

3. Studies of offspring reflect the inheritance of genes
on different chromosomes and genes on the same
chromosomes
Use the terms diploid and haploid to describe somatic and
gametic cells

A normal body cell is called a somatic cell and is always diploid, meaning the
chromosomes are present in matching homologous pairs
During meiosis and the formation of gametes, the chromosome number is halved, and
each gametic cell contains only one chromatid from each original homologous pair of
chromosomes
A gamete cell, with half the diploid number of chromosomes, is said to be haploid

Describe outcomes of dihybrid crosses involving simple

dominance using Mendels explanations
Dihybrid crosses involve two characteristics that are inherited independently
Each characteristic is found on a different chromosome
e.g. A heterozygous green-smooth shaped seeded plant is crossed with a yellow
seeded plant that is heterozygous for seed shape
Parent genome
GgSs

ggSs

GS Gs gS ss gs

gS gs

Gametes

gS
gs

GS
GgSS
GgSs

Gs
GgSs
Ggss

gS
ggSS
ggSs

gs
ggSs
ggss

Genotype ratio:
1:
2:
1:
1:
2:
1
GgSS GgSs Ggss ggSS ggSs ggss
Phenotype ratio:
3:
Green smooth

1:
Green wrinkled

3:
Yellow smooth

1
Yellow wrinkled

Option The code broken

Predict the differences in inheritance patterns if two genes
are linked

If the chromosomes are linked, the gametes cannot be assorted independently

Instead of four gametes, there are only two combinations which can occur

Explain how cross-breeding experiments can identify the

relative position of linked genes

Linked genes have a higher likelihood of being inherited together (ending up on the
same gamete)
However, due to crossing over the genes may sometimes switch chromosomes and not
be inherited together
Strand of chromatid:
A

If two genes are next to each other on the chromosome, like A and B, they are very
unlikely to cross-over.
If the two genes are a long way apart like A and D then they are more likely to cross
over and be inherited separately
By looking at the degree of crossing over between genes in a cross breeding
experiment, we can pinpoint the relative position of the genes in the chromosome

e.g. gene W crosses over with gene Y 3% of the time, whereas gene Y crosses with
gene X 15% of the time and gene W and gene X cross over 12% of the time

Discuss the role of chromosome mapping in identifying

relationships between species

By comparing chromosome maps between species it is possible to identify

relationships
The assumption is that the closer the two chromosome maps are the more closely
related the two species are

Option The code broken

Process information from secondary sources to analyse the
outcome of dihybrid crosses when both traits are inherited
independently and when they are linked
Dihybrid:

Traced two features through two generations

Inherited independently i.e. each characteristic is found on a different chromosome
Law of independent assortment (random segregation)
Dihybrid cross ratio 9:3:3:1

Example:

F0

Green, Round
GG

Yellow, wrinkled

RR

gg

GR

rr
gr

F1

Gametes

Green, Round
Gg, Rr

F1 cross

Green, Round
Gg

Green, Round

Rr

Gg

GR, Gr, gR, gr

GR
GR
Gr
gR
gr
F2

Green, round- 9
Green, wrinkled-3

Rr

GR, Gr, gR, gr

Gr

gR

gr

Option The code broken

Yellow, round- 3
Yellow, wrinkled- 1

Sometimes the genes are not contained on different chromosomes but on the same
chromosome are said to be linked. They do not sort independently but stay together
e.g. heterozygous grey (B) bodied normal (W) winged fly is crossed with a black (b)
bodied curved (w) winged fly

PARENT GENOTYPES:

GAMETES:

BbWw

BW

BW
BbW

bw
bbw

bw

bbww

bw

bw

bw

1
:
Grey
Normal

1
Black
Curved

Perform a firsthand investigation to model linkage

Option The code broken

4. The Human Genome Project is attempting to identify
the position of genes on chromosomes through whole
genome sequencing
Discuss the benefits of the Human Genome Project
Genome:
The complete set of genes in all the chromosomes of a species

The Human Genome Project began in 1989

The initial phase was expected to take 25 years but improving technology sped up this
process
There are about 4,000 known human hereditary diseases and disorders

Potential benefits:
Provide new insights into human evolution
o By comparing genomes of differing groups
Improved and more accurate diagnosis of genetic disorders
o It is possible to determine if an individual has the correct or mutated version
Identify the products of genes
o Makes it possible to infer how mutant alleles that cause genetic disorders
produce their undesirable effects and knowing the product of normal genes
will generate new treatments
Identifying genetic factors that predispose people to disabling conditions. e.g. strokes
and cancers
o Enables people at risk to be identified and treatment to reduce or prevent the
condition developing will be produced also
Development of new technologies. e.g. Polymerase chain reactions
o Enables a small amount of DNA to be multiplied many times and has enabled
tiny samples of tissue to be used for DNA testing

Describe and explain the limitations of data obtained from

the Human Genome project

We know that less than 5% of all the DNA in the human genome is actually gene
coding for polypeptides. The rest seem to have no function.

The data from the Human Genome Project is in the form of a base sequence. e.g.
AGGCTATTC
A lot of the base sequence does not code for genes
o Therefore what are genes and what are not genes need to be determined
The data does not tell us what the genes do

Option The code broken

o The protein must be sequenced and its function determined

Some expressions require several genes
o The interaction between genes must be determined and is not available from
the data
Many expressions involve some environmental interaction
o It cannot be determined from the data

Outline the procedure to produce recombinant DNA

Recombinant DNA simply refers to DNA molecules that have been chemically broken
up, then recombined with a new piece of DNA

Process:
1. The desired gene is cut from a chromosome using restriction enzymes. e.g. the
human insulin gene
2. A circular piece of DNA (a plasmid) is removed from bacterial cells (e.g. E-coli). It is
cut open with the same restriction enzyme used above
3. The plasmid and the other gene are mixed and joined. The enzyme DNA lignase
bonds the sticky ends
4. The recombant plasmid is introduced back into the bacterial cells by mixing with a
culture under the correct conditions
5. The recombinant plasmids are reproduced when the bacterial cells reproduce
6. The introduced gene will now be expressed by the bacterial cells (i.e. they will
produce the appropriate protein/polypeptide)

Explain how the use of recombinant DNA technology can

identify the position of a gene on a chromosome
1. A gene can be identified using a probe
e.g. we may want to find the gene for making insulin
2. The probe must be made
3. We know the protein structure, then by working backwards, we can identify the base
sequence coding for it and the fragment of DNA can then be produced
4. The probe can be made radioactive and then mixed in with a single-stranded
chromosome
5. The probe will combine with appropriate bases on the chromosome
6. Radioactive tracers can locate this position

Process information from secondary sources to assess the

reasons why the Human Genome Project could not be
achieved by studying linkage maps

Option The code broken

Option The code broken

5. Gene therapy is possible once the gene responsible
for harmful conditions are identified
Gene therapy: The treatment of serious, inherited disorders or diseases, that result from
damage to DNA (such as cancer and AIDS) by replacing faulty genes with healthy ones

Describe current use of gene therapy for an identified

disease
Severe Combined Immunodeficiency (SCIDs)
Any one of several genes fail to make a protein essential for B and T cell function
Treatment is:
o To isolate bone marrow stem cells from each child
o Treat the cells by using a retrovirus carrying the normal gene
o Return the stem cells to the bone marrow

Process and analyse information from secondary sources to

identify a current use of gene therapy to manage a genetic
disease, a named form of cancer or AIDS