Mol Biol Rep

DOI 10.1007/s11033-013-2820-z

Dynamics of withanolide biosynthesis in relation to temporal

expression pattern of metabolic genes in Withania somnifera (L.)
Dunal: a comparative study in two morpho-chemovariants
Niha Dhar Satiander Rana Wajid Waheed Bhat Sumeer Razdan
Shahzad A. Pandith Shabnam Khan Prabhu Dutt Rekha S. Dhar
Samantha Vaishnavi Ram Vishwakarma Surrinder K. Lattoo

Received: 11 February 2013 / Accepted: 24 October 2013

Springer Science+Business Media Dordrecht 2013

Abstract Withania somnifera (L.) Dunal synthesizes

large array of pharmacologically active secondary metabolites known as withanolides. It has been extensively
investigated in terms of chemistry and bioactivity profiling.
However, there exists fragmentary information about the
dynamics of withanolide biosynthesis at different phenophases in concert with the expression analysis of key
pathway genes. In the present study, two morpho-chemovariants of W. somnifera were harvested at five developmental stages, dissected into leaf and root tissues and
assayed for three major withanolides viz. withanolide-A
(WS-1), withanone (WS-2) and withaferin A (WS-3) content using high performance liquid chromatography. The
present investigation also analyzed the expression pattern
of five withanolide biosynthetic pathway genes namely
squalene synthase, squalene epoxidase, cycloartenol synthase, cytochrome P450 reductase 1, cytochrome P450
reductase 2 to corroborate with the metabolite flux at different developmental stages. The relative transcript profiles

N. Dhar  S. Rana  W. W. Bhat  S. Razdan 

S. A. Pandith  S. Khan  R. S. Dhar  S. K. Lattoo (&)
Plant Biotechnology, Indian Institute of Integrative Medicine
(CSIR), Canal Road, Jammu 180001, India
e-mail: sklattoo@iiim.ac.in
P. Dutt
Natural Products Division, Indian Institute of Integrative
Medicine (CSIR), Canal Road, Jammu 180001, India
S. Vaishnavi
School of Biotechnology, Shri Mata Vaishno Devi University,
Katra 182320, India
R. Vishwakarma
Medicinal Chemistry, Indian Institute of Integrative Medicine
(CSIR), Canal Road, Jammu 180001, India

of identified genes at various ontogenetic stages illustrated

significant variation in leaf and root tissues and were largely concurrent with the alteration in withanolide pool.
Comparatively, the concentrations of withanolide A,
withanone and withaferin A along with expression levels of
all the five genes were appreciably higher in the leaves than
in roots. Relative dynamics in terms of quantitative and
qualitative profiles of withanolides in leaf and root tissues
revealed least correspondence between the pattern of
accumulation, possibly indicting towards de novo tissuespecific biosynthesis.
Keywords Withania somnifera  Withanolides 
Ontogenetic  Gene expression analysis  HPLC 
Semi-quantitative RT-PCR

Introduction
Withania somnifera (L.) Dunal (Solanaceae) commonly
known as ashwagandha is a small woody shrub growing
abundantly as wild under tropical, sub-tropical and semitemperate climates of India. It enjoys tremendous popularity as a traditional medicinal plant since antiquity. It is
often compared with Korean ginseng (Panax ginseng) for
its rejuvenating properties and thus also known as Indian
ginseng. Ashwagandha is used in the treatment of variety
of physiological disorders and constitutes an important
ingredient of more than 100 herbal formulations in Ayurveda, Siddha and Unani systems of medicine [1]. W.
somnifera perpetuates sexually through seeds and can also
be propagated asexually through soft or semi-hardwood
cuttings. Its versatile reproductive strategy of mixed mating
and robust chemotypic variability enables it to thrive under
marginal and xeric habitats with a wider geographic

123

Mol Biol Rep

Fig. 1 Putative biosynthetic pathway of withanolides. GA-3P

glyceraldehyde-3-phosphate, DOXP 1-deoxy-D-xylulose 5-phosphate
pathway, DXS 1-deoxy-D-xylulose 5-phosphate synthase, DXR
1-deoxy-D-xylulose-5-phosphate reductoisomerase, MEP 2-Cmethyl-D-erythritol 4-phosphate, DMAPP dimethylalyl pyrophosphate, IPP isopentenyl pyrophosphate, IPI isopentenyl diphosphate

isomerise, HMG-CoA 3-hydroxy-3-methylglutaryl-coenzyme A, SQS

squalene synthase, SQE squalene epoxidase, CAS cycloartenol
synthase, CPR cytochrome P450 reductase. Single dark arrows
represent one step, two or more dark arrows represent multiple steps

distribution [2]. Chemoprofiling of W. somnifera shows

wide spectrum of chemical compounds in the form of more
than 40 withanolides, 12 alkaloids and several sitoindosides. It also presents a fascinating array of chemotypes
with several-fold variability in withanolides [2, 3]. In
recent years there has been a surge in pharmacological
studies on withanolides, with increasing evidence of antitumor, antiarthritic, antiageing, and neuroprotective properties [410]. Substantial pharmacological activities have
been accredited to two main withanolides, withaferin A
(WS-3) and withanolide D (WS-D). These compounds

have been reported to inhibit angiogenesis, Notch-1, NFjB

in cancer cells and induce apoptosis in breast cancer cells
[1012].
Withanolides, a class of phytosteroids deriving their
name from Withania, are a novel group of C-28 steroidal
lactones built on an intact or rearranged ergostane framework in which C-22 and C-26 are oxidised to form a six
membered d-lactone ring [13]. Putatively, withanolides (C30) are synthesized via both mevalonate (MVA) and nonmevalonate (DOXP) pathways through cyclization of 2,3oxidosqualene to cycloartenol, wherein 24-methylene

123

Mol Biol Rep

cholesterol is the first branching point towards the biosynthesis of various withanosteroids. Production of withanolides includes a series of desaturation, hydroxylation,
epoxidations, cyclization, chain elongation, and glycosylation steps (Fig. 1).
Withania somnifera has been extensively studied in
terms of its chemical profile which encompasses extraction,
isolation and identification of various withanolides from
different parts of the plant. These primarily abound in
leaves and roots of the shrub which are the main tissues
approved for remedial use in the traditional systems of
medicine [10, 14].
Secondary metabolite biosynthesis and accumulation is a
multistage and multilevel dynamic process prone to a range
of intrinsic (developmental/physiological) and extrinsic
(environmental) signals. Metabolite plasticity in plant species invariably increases the fitness, sustainability and
defence mechanism under varied biotic and abiotic stress.
These physiological and adaptation roles are often controlled by tight regulation of metabolic circuitries of biosynthetic, storage and transporter genes [15, 16]. In recent
years there have been some reports pertaining to tissuespecific site of synthesis and accumulation of withanolides
in W. somnifera. The literature presents ambiguity vis-a`-vis
de novo synthesis and translocation of withanolides [14, 17,
18].
Tissue-specificity does not necessarily reveal the general
trend of plant secondary metabolism as secondary metabolites are spatially and temporally synchronized in terms of
biosynthesis, accumulation and translocation. In many
instances few get structured and stored at the same location
in the plant, while as others get reallocated from the site of
synthesis to other tissues of the plant. It is mainly to confront various physiological discrepancies to enhance the
overall fitness of a species [15, 19]. Noticeable variations
in secondary metabolites are also evident in plant life cycle
encompassing various phenophases/ontogenetic stages
from vegetative to reproductive growth phases. Za0 rate
et al. [20] studied such variations in Catharanthus pusillus
where the highest concentration of terpenoid indole alkaloid was recorded at flowering and fruiting stages. Similarly in Salvia sclarea essential oil production peaked at
full bloom stage with turnover of essential oil (66.1 % of
loss) and monoterpenes (23.6 % loss) occurring late in
development at maturation stage [21].
Apart from very restricted physiological studies in W.
somnifera, there exists sparse information regarding the
genes involved in the biosynthesis of withanolides. Recently
various biochemical and molecular studies have been initiated to elucidate biosynthetic pathway for various withanolides in W. somnifera [2224]. Biosynthetically the origin of
withanolides is the five-carbon precursor isopentenyl
diphosphate (IPP) which constitutes the common precursor

pool for large array of secondary metabolites. As a part of our

on-going endeavour to investigate various pathway genes in
withanolide biosynthesis, we have probed and characterized
some key pathway genes which include squalene synthase
(NCBI GenBank Acc. No. GU474427), squalene epoxidase
(NCBI GenBank Acc. No. GU574803), cycloartenol synthase (NCBI GenBank Acc. No. GU590576) and two paralogs of cytochrome P450 reductase (NCBI GenBank Acc.
Nos. HM036710 and GU808569). These studies showed
change in expression of the cloned genes by various elicitor
treatments and the expression pattern corroborated positively with the flux in withanolide accumulation [22, 24].
It is well known that genotypic effects, ontogenetic variability, tissue-specificity and seasonal changes have a profound influence on the secondary metabolite production. It
was therefore tempting to study the dynamics of withanolide
biosynthesis at different temporal phases of plant development in two distinct varieties of W. somnifera. Further, it was
aimed to understand the changes in withanolide flux in corroboration with relative transcript abundance of five key
pathway genes. The scope of present study also entailed to
investigate the congruence in the qualitative and quantitative
pattern of withanolide accumulation in leaf and root tissues
to provide an insight into the synthesis and reallocation of
metabolites. The current investigation also helps us to
determine the optimum time of harvest in relation to withanolide yields at different stages of plant maturity to
account for commercial feasibility.

Materials and methods

Plant material
The present study was conducted at Indian Institute of
Integrative Medicine (CSIR), Jammu, India (3244N longitude, 7455E latitude, 304 m in altitude), where the
annual temperature fluctuates between 5 and 45 C and mean
annual rainfall measures up to 113 cm. The material for
present study comprised of open pollinated seeds of two
distinct varieties of W. somnifera designated as WS-Y-08
(2530 cm tall with yellow berries) and WS-R-06
(100125 cm tall with red berries). These two accessions
differ appreciably in their capacity to synthesize and accumulate different withanolides. Seed lots of two accessions
were separately germinated in earthen pots containing mixture of soil and sand in the proportion of 4:1 under outdoor
conditions during the month of May, 2009. The plants were
transplanted after 35 days of germination into 2.5 9 2.0 m
plots at spacing of 50 9 60 cm apart. Plants were raised in
well-drained sandy loam soil (pH 7.4) with periodic organic
manuring and irrigation under uniform cultivation conditions. The root and leaf tissues from the established trials

123

Mol Biol Rep

Table 1 Description of ontogenetic stages/phenophases of Withania
somnifera
Stage

Description

S-I Vegetative

Plant with multiple shoots diverging from the basal

shoot crown bearing ovate, sub-acute pubescent
leaves

S-II Flowering

Plant with profuse lurid-yellow, sub-sessile, fivemerous flowers in umbellate cyme (520 flowers/
cyme) in the axils of leaves

S-III Fruit-set

Plant with sizeable fruit-set (* 6,500 berries/

plant), berry greenenveloped in persistent
inflated conical calyx, globose, glabrous with
numerous seeds, creamy-white, immature,
discoid

S-IV Fruitmaturation

Plants with red or yellow berries enveloped in

conical membranous/papery calyx, 36 mm in
diameter, pulp fleshy, seeds mature, smooth,
yellow

S-V Overmaturation

Plants with slightly wrinkled berries, papery calyx

withered, leaves minutely stellate, dull green in
colour

were used as a source material for high performance liquid

chromatography (HPLC) analysis, RNA extraction and
cDNA preparation. Sampling from WS-Y-08 and WS-R-06
was performed at five ontogenetic stages of plant growth.
These stages included vegetative (S-I), flowering (S-II),
fruit-set (S-III), fruit-maturation (S-IV) and over-maturation
(S-V) stages during seed to seed life cycle of the plant
(Table 1). Freshly harvested tissue samples at each phenophase were dried in the drying oven (Vision Scientific,
Yuseong-gu Daejeon, Korea) at 30 1 C, ground and
assayed for three withanolides: withanolide-A (WS-1),
withanone (WS-2) and withaferin A (WS-3) content using
HPLC.
RNA isolation and cDNA synthesis
Leaves and roots at each phenophase were flash frozen in
liquid nitrogen immediately after collection until use for
RNA preparation. Total RNA was isolated using TRIzol
reagent following the manufacturers instructions (Invitrogen, Carlsbad, CA, USA) and treated with DNase I
(Fermentas, Burlington, ON, Canada) at 37 C for 30 min
to remove any traces of genomic DNA contamination.
Concentration of isolated total RNA was estimated by
measuring the absorbance at 260 nm in a spectrophotometer (AstraAuriga, Cambridge, UK). Further, quality of
RNA was assessed by determining the ratio of absorbance
at 260 and 280 nm (A260/280) and formaldehyde-denatured
agarose gel electrophoresis.
First strand cDNA was synthesized according to the
manufacturers protocol [RevertAid cDNA synthesis kit
(Fermentas, Burlington, ON, Canada)] by reverse

123

transcription. 3 lg of DNase I treated total RNA was used

in a total volume of 20 ll containing 3 lg total RNA,
10 mM dNTPs, 10 lM oligo (dT) primer, 1 ll M-MuLV
reverse transcriptase (200 U ll-1) and 19 first strand
buffer (250 mM trisHCl, pH 8.3, 250 mM KCl, 20 mM
MgCl2, 50 mM DTT). The reaction was incubated for
60 min at 42 C followed by 5 min at 70 C to inactivate
the reverse transcriptase.

Extraction and quantification of withanolides

Apparatus and analytical conditions
HPLC analysis was performed with Shimadzu HPLC system (Shimadzu, Tokyo, Japan) equipped with 515 quaternary gradient pump, 717 Rheodyne injector, 2996 PDA
detector and CLASS-VP software v 6.14.
Extracts were separated on a RP-18 (4.6 9 250 mm,
5 lm; Merck, Bangalore, India) column. The mobile phase
consisted of methanolwater (60:40; v/v) delivered at a
flow rate of 0.7 ml min-1. The samples were analyzed at
30 C to provide efficiency to the peaks and the UV
chromatograms were recorded at 237 nm.
Preparation of sample solutions
Total withanolides were extracted and quantified as described by Dhar et al. [3]. Concisely, leaf and root samples of the
two varieties were sampled at designated developmental
stages (Table 1), powdered and extracted with 50 % ethanol
(v/v) with stirring at room temperature (26 2 C). The
samples were filtered through 0.45 lm (Millipore, Bedford,
MA, USA) filter and the solvent was removed under vacuum.
The extracts obtained from each sample were prepared in
HPLC-grade methanolwater 50:50 (v/v) for quantitative
analysis. Standards (1.2 mg ml-1) were prepared in HPLCgrade methanol.
Semi-quantitative expression analysis at five
phenophases
Expression profile of five genes namely squalene synthase
(WsSQS), squalene epoxidase (WsSQE), cyloartenol synthase (WsCAS), cytochrome P450 reductase 1 (WsCPR1)
and cytochrome P450 reductase 2 (WsCPR2) was studied
using semi-quantitative PCR method at five developmental
phases. For this tissue harvesting was done at five selected
phenophases, snap frozen in liquid nitrogen, stored at
-80 C and further used for RNA isolation and cDNA
synthesis as described above.
Specific primers for all the five genes were designed namely
WsSQSRTF and WsSQSRTR, WsSQERTF and WsSQERTR,

Mol Biol Rep

Table 2 List of primers used in
the study

Primers

Sequence (50 30 )

Direction

WsSQSRTF

ATGCAAGGAGGTGGAAACAA

Forward

WsSQSRTR

ATCTTCCTTCCCAGAGGCAT

Reverse

WsSQERTF

GCAAGGAGGTGGAAACAACCGATG

Forward

WsSQERTR

GTGCAATGCCTCAATGACATGGTCA

Reverse

WsCASRTF

GCTAATCAACCCTGCTGAGAC

Forward

WsCASRTR

CAATACAGTGTTCCACTTCTT

Reverse

WsCPR1RTF

AGCAAGGTATGAGAAGGCAGTTGT

Forward

WsCPR1RTR

CAGCATTATCAGTTGGCTCACCAT

Reverse

WsCPR2RTF

AGTGTGGCCTAAATTGGATAAGTTGC

Forward

WsCPR2RTR

ACGATAACATGTCCATTTGCATGAC

Reverse

RTActinF

GAGAGTTTTGATGTCCCTGCCATG

Forward

RTActinR

CAACGTCGCATTTCATGATGGAGT

Reverse

WsCASRTF and WsCASRTR, WsCPR1RTF and WsC

PR1RTR and WsCPR2RTF and WsCPR2RTR. (Table 2). The
constitutive b-actin gene was used as endogenous control and
amplified in parallel with the target genes. Conventional PCR
method was used for amplification in which PCR cycles for
each gene was optimized to their exponential stage. The
reaction mixture for each sample contained 10 mM tris HCl
pH 9.0, 50 mM KCl, 2.5 mM MgCl2, 200 lM dNTP, 1 lM
RT primers, 0.5 ll of cDNA template, and 0.5 U of Taq DNA
polymerase (Fermentas, Burlington, ON, Canada). The PCR
conditions were as follows: one cycle 94 C for 1 min, 27
cycles of 94 C for 30 s, 60 C for 20 s and 72 C for 25 s. The
expression levels of the five genes were observed on 1.2 %
agarose gel with respect to the endogenous control b-actin
gene.

Results and discussion

Withanolide accumulation in leaf and root tissues
at different phenophases
Synthesis of secondary metabolites in plants is a multifaceted process highly coordinated in space and time of
which biosynthesis and accumulation are the two key
gears. Metabolite production is most often compartmentalized and tissue-specific depending on the developmental
stage and environmental conditions. Since most of these
processes are controlled by genes, hence understanding the
respective gene expression in relation to metabolite turnover is also decisive.
In view of the complexity of secondary metabolism, present investigation demonstrated variation in withanolide production at different ontogenetic stages in two morpho-chemo
variants of W. somnifera. Metabolite flux was found to be
related with the transcript abundance of five pathway genes.

HPLC based chemoprofiling of WS-Y-08 and WS-R-06

revealed significant differences in the concentration of
three key withanolides in leaf and root tissues at different
phenophases. However, the metabolite dynamics through
different developmental phases in the two accessions did
not present any congruence in the pattern of metabolite
accumulation.
Withaferin A (WS-3) showed a consistent variation in
leaves of both the varieties along five ontogenetic stages.
The maximum amount of WS-3 peaked at fruit-set stage
(3.5 %) in the leaves of Ws-Y-08 (Fig. 2a). Sabir et al. [25]
also reported a similar trend for the biogenesis of withaferin A which was found to be tightly linked to green tissue/
shoot differentiation during in vitro morphogenesis of W.
somnifera. Further, optimum level of WS-3 recorded in
WS-R-06 was 0.1 % which was coincident with fruitmaturation stage (Fig. 2b).
Withanolide A (WS-2) accumulation in the leaves of
WS-Y-08 was optimum at fruit-maturation stage (0.80 %)
while as leaves of WS-R-06 exhibited maximum amount at
fruit-set stage (1.2 %) like that of WS-3 (Fig. 2c, d).
Conversely, there was a decline in WS-2 concentration in
comparison to other two withanolides namely WS-3 and
WS-1. Leaves of WS-Y-08 displayed no traceable amount
of WS-2 at three of the five developmental stages and
registered a considerably meagre accumulation of 0.01 %
at both fruit-set and over-maturation stages (Fig. 2e).
Likewise, WS-2 was also absent at two of the developmental stages of WS-R-06, with maximum concentration
detectable at vegetative stage (0.08 %) (Fig. 2f).
In comparison to leaves, roots of both the varieties
accumulated significantly less WS-3 and presented maximum accumulation at fruit-set stage which was coincident
with the leaf accumulation pattern. The maximum content
of WS-3 in WS-Y-08 and WS-R-06 roots were 0.38 and
0.22 % respectively (Fig. 2a, b).

123

Mol Biol Rep

Fig. 2 Withanolide accumulation at five developmental stages.

HPLC analysis demonstrated the change in withanolide A (WS-1),
withanone (WS-2) and withaferine A (WS-3) at vegetative (S-I),
flowering (S-II), fruit-set (S-III), fruit-maturation (S-IV) and overmaturation stages (S-V). WS-1, WS-2 and WS-3 were observed to be
predominant in leaf as compared to root. WS-3 accumulation pattern
at five developmental stages in leaf and root tissues of WS-Y-08

(a) and WS-R-06 (b) accessions. WS-1 accumulation at five

developmental stages in leaf and root tissues of WS-Y-08 (c) and
WS-R-06 (d) accessions. WS-2 accumulation at five developmental
stages in WS-Y-08 (e) and WS-R-06 (f). Accumulation of WS-1,
WS-2 and WS-3 at different developmental stages was statistically
significant at p \ 0.05 level. All values obtained were means of
triplicate with standard errors

Unlike WS-3, optimal WS-1 accumulation in roots of

both the morpho-chemovariants did not match with the
accumulation pattern in leaves. The maximum amounts
were discernible at vegetative phase in both WS-Y-08
(0.35 %) and WS-R-06 (0.34 %) (Fig. 2c, d). The same
trend corresponded well with the optimum concentration of
WS-2 in roots as it also peaked at vegetative stage (0.58 %)
in both the varieties (Fig. 2e, f).

Towards the over-maturation stage all the three withanolides showed a dwindling trend with either absence or accumulation in meagre amounts. This may be attributed to the
allocation and utilization of finite resources towards the
reproductive maturation and seed development. In terms of
energy budgeting, W. somnifera invests considerable resources in reproductive effort as the mean number of flowers per
plant that mature into fruits is around 6,525.3 231.47

123

Mol Biol Rep

(*49 %) and the number of seeds per fruit average

25.24 0.54 [2]. Presumably, the channelization of limited
resources results in such qualitative and quantitative metabolite variations which are essential to optimise various putative cost expenses involved in adaptation and growth of a
plant.
Present investigation suggests that there is no particular
single developmental stage which is suitable for obtaining
the maximum amount of withanolides as peak accumulation
stages differ with regard to three withanolides. For WS-2
and WS-1, vegetative stage seems to be the optimum time
of harvesting while as WS-3 displays its highest accretion at
fruit set stage. Purview of literature reveals that metabolite
accumulation in several plant species is coincident with
different developmental stages and there is not always a
direct association between the developmental stage and
metabolite accumulation. For instance in Artemesia annua,
sesquiterpene lactone endoperoxide artemisinin production
peaks during flowering [26]. However, induction of flowering well in advance by constitutively expressing flowering
promoter factor gene (fpf1) and the early flowering gene
CONSTANS from Arabidopsis, in A. annua, did not lead to
a parallel increase in the artemisnin content [27, 28]. These
studies suggest that there is no straight regulatory relationship between flowering and artemisinin synthesis.
Hence it may be contended that there are several other
factors that concur to regulate the production of secondary
metabolites. Among these, physiological demands, weather,
condition of plantation and various aboveground and
belowground stresses are a few factors leading to variation
in secondary metabolite production. As plants are sessile
and devoid of immune system, alternative strategies have
evolved to guard them against various vagaries by enormous variety of secondary metabolites. Additionally, secondary metabolites play pivotal role in surmounting stress
constraints and to survive changing environment by showing huge variations both qualitatively and quantitatively
[29]. This resultant systemic defence response of the plant
can impinge on even the most distant tissues making plants
the powerful mediators of interactions.
Comparative preponderance of withanolides in leaf tissue
in comparison to root can be substantiated by many instances in literature wherein it has been reported that interactions
between aboveground and belowground plant responses,
invariably result in overall increase in basal levels of shoot
terpenoids. It has been demonstrated that root or shoot
treatments with herbivory, artificial damage, and plant
defence hormone application result in enhancement of shoot
concentrations of terpenoids in Gossypium herbaceum and
maize [3032]. Such aboveground and belowground interactions are mediated by plant hormones in the form of a
decisive element of the regulatory network underlying plant
growth, development, and defence reactions [33]. Sangwan

et al. [18] have anticipated the withanolides to act as growth

regulators owing to their partial coinciding biosynthetic
route with brassinosteroids. Therefore, it is postulated that
withanolides may be mediating in various aboveground and
belowground functions and interactions. Their tissue-specific disparity in terms of total content and subtype of withanolide in roots and leaves may be viewed in context of
their intrinsic regulation in response to varied extrinsic
factors.
Predominant leaf concentration of withanolides has been
reported earlier also and presumed to result in import of
withanolides from leaves to roots. Likewise, leaves of both
WS-R-06 and WS-Y-08 exhibit maximum concentrations
of all the three withanolides as compared to roots. However, a relative analysis between root and leaf chemoprofiles of the present study refutes the idea of import by
showing no subsequent increase in root withanolides with
the declining leaf withanolide concentrations. This implicates de novo biosynthesis of withanolides in roots as also
argued by Sangwan et al. [18] by providing experimental
evidence for the biosynthesis of withanolide A in cultured
roots as well as native roots of W. somnifera.

Tissue and development specific gene expression

analysis
The spatial, temporal, and inducible biogenesis of secondary metabolites and the transcripts of related biosynthetic genes are under strict transcriptional regulation.
Transcriptional control involving mRNA helps in integrating both developmental and environmental signals.
WsSQS, WsSQE, WsCAS, WsCPR1 and WsCPR2 genes
comprise vital genic components of biosynthetic pathways
leading to production of phytosterols and a large array of
triterpenoids. These are the upstream genes involved in the
withanolide biosynthesis which regulate the flux by channelizing the downstream precursors. During our earlier
investigations, we have corroborated the changes in
expression levels of genes in response to different elicitors
[22]. Elicitor treatments resulted in enhanced transcript
levels which showed positive correlation with the withanolide production.
The relative transcript profiles of identified genes at
different developmental stages showed appreciable variation in leaf and root tissues of WS-Y-08 and Ws-R-06
(Fig. 3). Expression level of all the five genes was significantly higher in leaves of both the varieties as compared to
the roots. These results were in conformity with our earlier
studies.
Squalene synthase (SQS) (farnesyl diphosphate:farnesyl
diphosphate farnesyltransferase, EC 2.5.1.21) is a common
downstream enzyme of both MVA and MEP pathways and

123

Mol Biol Rep

Fig. 3 Comparative expression levels of WsSQS, WsSQE, WsCAS,

WsCPR1 and WsCPR2 at vegetative (S-I), flowering (S-II), fruit-set
(S-III), fruit-maturation (S-IV) and over-maturation (S-V) stages in

Withania somnifera. Total RNA from each sample was used for
quantitation. Actin was kept as internal control

catalyses the first enzymatic step committing carbon pool

away from the central isoprenoid pathway towards the biosynthesis of phytosterols, brassinosteroids and triterpenoids
[34]. Expression profile of WsSQS showed least deviation in
expression pattern in leaf and root tissues of both the varieties (Fig. 3a).
WsSQE exhibited up-regulation with each progressing
phenophase in leaf and root tissues of two varieties
(Fig. 3b). Principally, squalene epoxidase (EC 1.14.99.7)
functions as a rate-limiting step in catalyzing the stereospecific epoxidation of squalene to 2,3-oxidosqualene [35].
Therefore, the increase in WsSQE transcript level may be
linked to enhanced pool of 30-carbon intermediate, 2,3oxidosqualene which further gets diverted and cyclised by
members of oxidosqualene cyclase family for the synthesis
of sterol and a suite of triterpenoids (Fig. 1).
WsCAS transcripts were the most abundant among the
five genes investigated. Its expression followed the same
increasing trend along progressing ontogenetic stages
(Fig. 3c). Cycloartenol synthase [(S)-2,3-epoxysqualene
mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]
performs the important function of breaking 11 bonds and
forming 11 new ones to transform 2,3-epoxysqualene to the
plant sterol precursor cycloartenol [36, 37]. It is presumed
that cycloartenol bifurcation takes place for the biogenesis
of sterol and withanolides in W. somnifera (Fig. 1). Probably because of this division of cycloartenol, WsCAS
expression was the maximum and on the rise with each
advancing phenophase to generate a reservoir of cycloartenol which may get channelized towards the two routes
leading to the biosynthesis of phytosterols and withanolides. Our previous studies vis-a`-vis WsCAS revealed a
copy number of two (unpublished) possibly indicating the
separate role of each copy of WsCAS in sterol and withanolide biosynthesis. Duplicate copy number of WsCAS
is plausibly a trigger for higher expression.

CPR shuttles electrons derived from NADPH through

FAD and FMN domains into the heme iron-centre of the
various P450 enzymes and thus confront the high demand of
electron supply during biotic and abiotic stress or differential
expression at various stages of plant development [38]. We
have cloned and functionally characterized two paralogs of
NADPH-cytochrome P450 reductase designated as WsCPR1
and WsCPR2 [24]. WsCPR1 transcript level like WsSQS
exhibited no change (Fig. 3d), whereas WsCPR2 showed a
slight increase along the developmental phases (Fig. 3e)
possibly implicating its role in biosynthesis of withanolides.
Thus by integrating and understanding the various
interactions between genomes, metabolomes or molecular
networks in their entirety, we can infer that the changes in
secondary metabolite composition during ontogenesis are
characteristic for each developmental stage. All such
ontogenetically determined changes are the product of
interaction between genotype and environment.

123

Conclusion
Withania somnifera represents a rich repository of bioactive molecules in the form of withanolides which are being
positioned as promising lead molecules for screening
against various critical diseases and ailments. Understanding of metabolite dynamics in relation to expression
pattern of important pathway genes is imperative to obtain
optimum metabolite yields with reference to developmental stages. The present study reveals that the dynamics of
accumulation of withanolides and the transcriptomic
abundance of various key pathway genes during ontogenesis are synchronized. The withanolide variation pattern
through different developmental phases possibly reflects
differential capacity by leaf and root tissues of the same
plant in response to intrinsic and extrinsic factors. It has

Mol Biol Rep

also been shown that leaves as compared to roots constitute

the main tissue for accumulation of withanolides. Comparative quantitative and qualitative chemoprofile of leaf
and root tissues reveals no correspondence between the
pattern of accumulation in the two tissues, thus apparently
pointing towards de novo tissue-specific synthesis of
withanosteroids in W. somnifera.
Acknowledgments This work was supported by a grant from the
Council of Scientific and Industrial Research (CSIR), Government of
India, New Delhi under Network Project BSC0108. N. Dhar, S. Rana,
W. W. Bhat and S. Razdan are thankful to Council of Scientific and
Industrial Research (CSIR), Government of India; New Delhi for
Senior Research Fellowship (CSIR-SRF). S. A. Pandith is grateful to
University Grants Commission, Government of India, New Delhi for
Senior Research Fellowship (UGC-SRF). This manuscript represents
institutional communication number IIIM/1530/2013.

References
1. Tuli R, Sangwan RS (2009) Ashwagandha (Withania somnifera)a model Indian medicinal plant. Council of Scientific and
Industrial Research (CSIR), New Delhi
2. Lattoo SK, Dhar RS, Khan S, Bamotra S, Dhar AK (2007)
Temporal sexual maturation and incremental stamina movement
encourages mixed mating in Withania somniferaan insurance
for reproductive success. Curr Sci 92:13901399
3. Dhar RS, Verma V, Suri KA, Sangwan RS, Satti NK, Kumar A,
Tuli R, Qazi GN (2006) Phytochemical and genetic analysis in
selected chemotypes of Withania somnifera. Phytochemistry
67(20):22692276. doi:10.1016/j.phytochem.2006.07.014
4. Singh AP (1981) Chemistry and genetics of withanolides in
Withania somnifera hybrids. Phytochemistry 20:27412748
5. Budhiraja RD, Sudhir S (1987) Review of biological activity of
withanolides. J Sci Ind Res 46:488491
6. Ray AB, Gupta M (1994) Withasteroids, a growing group of
naturally occurring steroidal lactones. Fortschr Chem Org Naturst
63:102106
7. Jayaprakasam B, Zhang Y, Seeram NP, Nair MG (2003) Growth
inhibition of human tumor cell lines by withanolides from
Withania somnifera leaves. Life Sci 74:125132
8. Choudhary MI, Nawaz SA, Haq ZU, Lodhi MA, Ghayur MN,
Jalil S, Riaz N, Yousuf S, Malik H, Gilani AH, Atta-ur-Rahman
A-U (2005) Withanolides, a new class of natural cholinesterase
inhibitors with calcium antagonistic properties. Biochem Biophys
Res Commun 334:276287
9. Kuboyama T, Tohda C, Komatsu K (2005) Neuritic regeneration
and synaptic reconstruction induced by withanolide A. Br J
Pharmacol 144:961971
10. Kaileh M, Berghe WV, Heyerick A, Horion J, Piette J, Libert C,
Kukeleire DD, Essaw T, Haegeman G (2007) Withaferin A
strongly elicits IjB kinase b hyperphosphorylation concomitant
with potent inhibition of its kinase activity. J Biol Chem
282:42534264
11. Hahm ER, Moura MB, Kelley EE, Van Houten B, Shiva S et al
(2011) Withaferin A-induced apoptosis in human breast cancer
cells is mediated by reactive oxygen species. PLoS One
6(8):e23354
12. Koduru S, Kumar R, Srinivasan S, Evers MB, Damodaran C
(2010) Notch-1 inhibition by withaferin-A: a therapeutic target
against colon carcinogenesis. Mol Cancer Ther 9:202210

13. Mirjalili MH, Moyano E, Bonfill M, Cusido RM, Palazon J

(2009) Steroidal lactones from Withania somnifera, an ancient
plant for novel medicine. Molecules 14:23732393
14. Sangwan RS, Chaurasiya ND, Misra LN, Lal P, Uniyal GC,
Sangwan NS, Srivastava AK, Suri KA, Qazi GN, Tuli R (2005)
An improved process for isolation of withaferin-A from plant
materials and products therefrom. US Patent # 7,108,870
15. Eldin HHN, Andersen TG, Burow M, Madsen SR, Jrgensen ME,
Olsen CE, Dreyer I, Hedrich R, Geiger D, Halkier BA (2012)
NRT/PTR transporters are essential for ranslocation of glucosinolate defence compounds to seeds. Nature 488:531534. doi:10.
1038/nature11285
16. Yang CQ, Fang X, Wu XM, Mao YB, Wang LJ, Chen XY (2012)
Transcriptional regulation of plant secondary metabolism. J Integr Plant Biol 54(10):703712
17. Glotter E (1991) Withanolides and related ergostane-type steroids. Nat Prod Rep 8:415440
18. Sangwan RS, Chaurasiya ND, Lal P, Misra L, Tuli R, Sangwan
NS (2008) Withanolide A is inherently de novo biosynthesized in
roots of the medicinal plant ashwagandha (Withania somnifera).
Physiol Plant 133:278287
19. Tholl D, Lee S (2011) Terpene specialized metabolism in
Arabidopsis thaliana. Arabidopsis Book 9:e0143
20. Za0 rate R, Dirks C, Heijden RVD, Verpoorte R (2001) Terpenoid
indole alkaloid profile changes in Catharanthus pusillus during
development. Plant Sci 160:971977
21. Lattoo SK, Dhar RS, Dhar AK, Sharma PR, Agarwal SG (2006)
Dynamics of essential oil biosynthesis in relation to inflorescence
and glandular ontogeny in Salvia sclarea. Flavour Fragr J
21:817821. doi:10.1002/ffj.1733
22. Bhat WW, Lattoo SK, Razdan S, Dhar N, Rana S, Dhar RS, Khan S,
Vishwakarma RA (2012) Molecular cloning, bacterial expression
and promoter analysis of squalene synthase from Withania somnifera (L.) Dunal. Gene 499:2536
23. Razdan S, Bhat WW, Rana S, Dhar N, Lattoo SK, Dhar RS,
Vishwakarma RA (2013) Molecular characterization and promoter analysis of squalene epoxidase gene from Withania somnifera (L.) Dunal. Mol Biol Rep 40:905916. doi:10.1007/
s11033-012-2131-9
24. Rana S, Lattoo SK, Dhar N, Razdan S, Bhat WW, Dhar RS,
Vishwakarma R (2013) NADPH-cytochrome P450 reductase:
molecular cloning and functional characterization of two paralogs
from Withania somnifera (L.) Dunal. PLoS one 8(2):e57068
25. Sabir F, Mishra S, Sangwan RS, Jadaun JS, Sangwan NS (2012)
Qualitative and quantitative variations in withanolides and
expression of some pathway genes during different stages of
morphogenesis in Withania somnifera Dunal. Protoplasma. doi:10.
1007/s00709-012-0438-y
26. Ferreira JF, Simon JE, Janick J (1995) Developmental studies of
Artemisia annua: flowering and artemisinin production under
greenhouse and field conditions. Planta Med 61:167170
27. Wang H, Ge L, Ye HC, CHong K, Liu BY, Li GF (2004) Studies
on the effects of fpf1 gene on Artemisia annua flowering time and
on the linkage between flowering and artemisinin biosynthesis.
Planta Med 70:347352
28. Wang H, Liu Y, Chong K, Liu BY, Ye HC, Li ZQ, Yan F, Li GF
(2007) Earlier flowering induced by over-expression of CO gene
does not accompany increase of artemisinin biosynthesis in
Artemisia annua. Plant Biol. 9:442446
29. Edreva A, Velikova V, Tsonev T, Dagnon S, Gurel A, Aktas L,
Gesheva E (2008) Stress-protective role of secondary metabolites: diversity of functions and mechanisms. Gen. Appl. Plant
Physiol 34:6778
30. Bardgett RD, Wardle DA (2003) Herbivore-mediated linkages
between aboveground and belowground communities. Ecology
84:22582268

123

Mol Biol Rep

31. Bezemer TM, Wagenaar R, Van Dam NM, Van Der Putten WH,
Wackers FL (2004) Above- and below-ground terpenoid aldehyde induction in cotton, Gossypium herbaceum, following root
and leaf injury. J Chem Ecol 30:5367
32. Rasmann S, Ko llner TG, Degenhardt J, Hiltpold I, Toepfer S,
Kuhlmann U, Gershenzon J, Turlings TCJ (2005) Recruitment of
entomopathogenic nematodes by insect-damaged maize roots.
Nature 434:732737
33. Woodward AW, Bartel B (2005) Auxin: regulation, action, and
interaction. Ann Bot (Lond) 95:707735
34. Abe I, Rohmer M, Prestwich GD (1993) Enzymatic cyclization of
squalene and oxidosqualene to sterols and triterpenes. Chem Rev
93:21892206
35. Han JY, In JG, Kwon YS, Choi YE (2010) Regulation of ginsenoside and phytosterol biosynthesis by RNA interferences of

123

squalene epoxidase gene in Panax ginseng. Phytochemistry

71(1):3646. doi:10.1016/j.phytochem.2009.09.031
36. Rees HH, Goad LJ, Goodwin TW (1968) Cyclization of 2,3oxidosqualene to cycloartenol in a cell-free system from higher
plants. Tetrahedron Lett 9:723725
37. Rees HH, Goad LJ, Goodwin TW (1969) 2,3-Oxidosqualene
cycloartenol cyclase from Ochromonas malhamensis. Biochim
Biophys Acta 176:892894
38. Simmons DL, Lalley PA, Kasper CB (1985) Chromosomal
assignments of genes coding for components of the mixedfunction oxidase system in mice. Genetic localization of the
cytochrome P-450PCN and P-450PB gene families and the
nadph-cytochrome P-450 oxidoreductase and epoxide hydratase
genes. J Biol Chem 260:515521