ARTICLES

Molecular quantification and mapping of lymph-node

micrometastases in cervical cancer
Philippe O Van Trappen, Valerie G Gyselman, David G Lowe, Andy Ryan, David H Oram, Peter Bosze, Anthony R Weekes,
John H Shepherd, Sina Dorudi, Stephen A Bustin, Ian J Jacobs

Summary

Introduction

Background A proportion of patients with cancer and lymph

nodes negative on histology will develop recurrence.
Reverse-transcriptase PCR (RT-PCR) is a highly sensitive
method for detection of lymph-node micrometastases, but
accurate quantitative assessment has been difficult.
Methods We studied primary tumours and 156 lymph nodes
from 32 patients with cervical cancer (stage IA2, IB1, and
IB2) and 32 lymph nodes from nine patients with benign
disease. A fully quantitative, real-time RT-PCR assay was
used to document absolute copy numbers of the epithelial
marker cytokeratin 19. Primers and probe were designed not
to amplify either of the two cytokeratin 19 pseudogenes.
Findings All primary tumours and histologically involved
lymph nodes (six) had more than 106 copies of cytokeratin
19 mRNA per g total RNA. Expression of cytokeratin 19 (up
to 11105 copies per g RNA) was detected in 66 (44%) of
150 histologically uninvolved lymph nodes, and in nodes
from 16 of 32 patients with cervical cancer. 15 of these 16
patients with evidence of micrometastases had the highest
cytokeratin 19 transcription level in a first lymph-node
drainage station (three obturator, six internal, and six
external iliac node). Transcription of cytokeratin 19 was
found at a low level in just one of 32 lymph nodes obtained
from nine patients with benign disease. Median copy
number of cytokeratin 19 transcription was significantly
higher (>103 copies) in association with adverse prognostic
features.
Interpretation The results suggest that about 50% of earlystage cervical cancers shed tumour cells to the pelvic lymph
nodes. The amount of cytokeratin 19 expression was related
to clinicopathological features. Further studies are required
to document the clinical implications of molecular
micrometastases.
Lancet 2001; 357: 1520

Academic Departments of Gynaecological Oncology

(P O Van Trappen MD, A Ryan PhD, D H Oram FRCOG,
Prof J H Shepherd FRCOG, Prof I J Jacobs MD) and Histopathology
(Prof D G Lowe MD), Queen Mary and Westfield College,
St Bartholomews Hospital, London, UK; Academic Department of
Surgery, Queen Mary and Westfield College, Royal London
Hospital, London (V G Gyselman MSc, S Dorudi PhD, S A Bustin PhD);
Department of Gynaecological Oncology, Saint Stephan Hospital,
Budapest, Hungary (Prof P Bosze MD); and Department of
Gynaecology, Harold Wood Hospital, Romford, Essex, UK
(A R Weekes FRCOG)
Correspondence to: Dr Philippe O Van Trappen, Academic
Department of Gynaecological Oncology, Queen Mary and Westfield
College, St Bartholomews Hospital, London EC1A 7BE, UK
(e-mail: p.o.vantrappen@mds.qmw.ac.uk)

The presence or absence of metastatic disease in pelvic

lymph nodes is an important prognostic factor in cervical
cancer, and careful histology of pelvic lymph nodes is
crucial in decision-making about subsequent adjuvant
therapy. Patients with histologically normal pelvic lymph
nodes and clear surgical margins around the primary
cervical tumour have a good prognosis and a low risk of
recurrent disease. However, despite favourable
prognostic features, pelvic recurrence occurs in about
10% of patients in this category.1 Histologically
undetectable or dormant micrometastases in the
lymphatic system probably account for disease recurrence
after variable disease-free intervals.2
Advances in understanding of cellular biology
combined with developments in molecular technology
have provided new methods for detection of metastatic
cancer cells, which are likely to be more sensitive than
conventional histopathology. One approach has used
PCR-based techniques to analyse lymphatic tissue for
specific somatic genetic alterations (eg, point mutations)
that are known to be present in the primary cancer.3 This
approach is not useful in cervical cancer, because no
specific gene mutations have yet been identified that are
present in the majority of these cancers. In cervical
cancer, molecular techniques have focused on the
detection of human papillomavirus DNA or its E6/E7transforming gene transcripts in blood and lymph
nodes.4,5 However, specific tumour DNA found in
histologically normal lymph nodes may originate from
dead cell material or macrophages, and viral DNA can be
found in various cell types, which limits its usefulness as a
molecular marker for micrometastases.
We have pursued a different approach, directed at
identifying ectopic expression in pelvic lymph nodes of
cytokeratin 19. This gene is transcribed specifically by
epithelial cells, including those of the female genital tract,
but it is not normally expressed by lymphoid cells and
therefore high expression in normal lymph nodes would
not be expected. Importantly, cytokeratin 19 expression6
remains stable throughout neoplastic transformation.7
Reverse-transcriptase PCR (RT-PCR) is a standard and
sensitive technique of RNA analysis, but quantitative
information has been difficult to obtain owing to
limitations of specificity and reproducibility.8,9 To address
these problems and the possibility of low-level and
illegitimate10 transcription of cytokeratin 19 in lymph
nodes, we used a fully quantitative, real-time11 RT-PCR
assay combined with primers and a probe designed to
prevent amplification of the two cytokeratin 19
pseudogenes.12

Methods
Surgical samples
This prospective cohort study was approved by the Local
Research Ethics Committee of the East London and
City Health Authority. Lymph-node samples were
obtained after dissection of pelvic lymph nodes in
patients undergoing surgery for cervical cancer at

15

THE LANCET Vol 357 January 6, 2001

For personal use only. Not to be reproduced without permission of The Lancet.
Copyright 2001 All Rights Reserved

ARTICLES

CK19
CK19a
CK19b

exon 2

exon 3

TCGACAACGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGG
-----------------------------------------AG---------G-------------------GA--A----T--T-AA------------------T------------ -TT----T--TT

Figure 1: Amplicon generated by amplification of cytokeratin 19 mRNA

Arrows identify location of upstream and downstream primers. The sequence recognised by the labelled probe is shaded. Sequences of pseudogenes
CK19a and CK19b are also shown. =deletion in CK19b compared with CK19. Vertical bar indicates exons 2 and 3 splice junction.

St Bartholomews Hospital, Harold Wood Hospital, and

the University Hospital of Budapest, between January,
1998, and January, 2000. 156 lymph nodes and samples
from the primary tumour were collected from 32 patients
with early-stage cervical cancer, and the location of each
lymph node was documented. A further 32 lymph nodes
were available from nine patients who had suspected
malignant disease, found to be benign ovarian cysts on
postoperative histology. Each lymph node was labelled
and bisected. One half was snap-frozen in liquid nitrogen
and stored at 70C until extraction of RNA. The
remainder was fixed in formalin and embedded in
paraffin for conventional histopathology.
Procedures
Histological diagnosis and staging were based on the
guidelines of the International Federation of Gynecology
and Obstetrics (FIGO). Up to three 3 m sections were
cut from each node, stained with haematoxylin and eosin,
and carefully reviewed by one specialist histopathologist
(DGL) without knowledge of the cytokeratin 19 mRNA
expression. Histological type, histological grade, and
lymphovascular space involvement (LVSI) were assessed
on sections prepared from the tumour, stained with
haematoxylin and eosin.
Total cellular RNA was extracted from all samples by
the acid guanidinium isothiocyanate, phenol, chloroform
method.13 Tissue was broken down by vortexing and
homogenisation. The RNA samples were stored in 50 L
diethyl-pyrocarbonate-treated distilled water at 70C.
RNA samples were further purified by use of an RNeasy
Mini Protocol (Qiagen Ltd, Crawley, UK) and quantified
on a Genequant spectrophotometer (Pharmacia,
St Albans, UK).
Cytokeratin 19 (Genbank accession number Y00503)
primers and probe were designed by use of Primer
Express software (PE-ABI; version 1.6). The primers
bind to sequences in exons 2 and 3, generating an
amplicon of 75 bp, with the probe binding to both exons
of the cytokeratin 19 gene. Amplification and detection
of CK19a pseudogene14 (Genbank accession number
M33101) is unlikely, because the probe and the
downstream primer contain three and two mismatches,
respectively. Amplification and detection of CK19b
pseudogene12 (Genbank accession number U85961) is
impossible, because both primers have several
mismatches and the region complementary to the probe
has extensive deletion (figure 1). The primers for
the housekeeping gene glyceraldehyde-3-phosphate
dehydrogenase (Genbank accession number G04038)
bind to sequences in exons 2 and 3, generating an
mRNA

Amplification

Cytokeratin 19

Exons 2 and 3

Product size (bp)

75

GAPDH

Exons 2 and 3

226

amplicon of 226 bp, and the probe binds to exon 3

(table).
All 5-nuclease15 assays used a one-tube, one-enzyme
RT-PCR protocol (Taqman).9 To prevent carry-over of
contaminating DNA, the reaction was carried out in the
presence of dUTP. Before reverse transcription, the RNA
template was heated for 2 min at 50C in the presence of
001 U/L uracil N-glycosylase. Total RNA (50100 ng)
was reverse transcribed in a 25 L reaction mixture at
60C for 30 min. After 5 min denaturation at 92C, PCR
was carried out for 40 cycles with denaturation at 92C
for 20 s and extension at 62C for 60 s in the presence of
an oligonucleotide probe containing a fluorescent dye
(6-carboxyfluorescein) at its 5-end and a quencher
(6-carboxytetramethylrhodamine) at its 3-end.11 The
RT-PCR assay for cytokeratin 19 was done four times for
each RNA sample to assess consistency of results. After
target amplification, the probe anneals to the amplicon
and is displaced and cleaved between the reporter and
quencher dyes by the nucleolytic activity of the
recombinant Thermus thermophilus DNA polymerase.
The amount of product resulting in detectable
fluorescence at any given cycle within the exponential
phase of PCR is proportional to the initial number of
template copies. The number of PCR cycles (threshold
cycle) needed to detect the amplicon is therefore a direct
measure of template concentration. To monitor
contamination, reactions were done with two notemplate controls in every amplification run, one
prepared before the tubes were opened and the other at
the end of the experiment. Reactions were recorded and
analysed with the ABI 7700 Prism Sequence detection
system (Perkin-Elmer Applied Biosystems, Warrington,
UK). Accurate quantification was achieved through
the generation of standard curves by serial dilution
of cytokeratin 19 and glyceraldehyde-3-phosphate
dehydrogenase RNA transcribed by T7 RNA
polymerase.
Statistics
Statistical analyses used SPSS software (SPSS for
windows, version 6.1.3). The Mann-Whitney U test was
used to compare the median copy number and range of
cytokeratin 19 mRNA in histologically uninvolved lymph
nodes between the different tumour grades, FIGO stages,
and presence or absence of LVSI.

Results
Transcription of glyceraldehyde-3-phosphate dehydrogenase was confirmed in all samples studied, and no
significant difference was found in the median number of

Primers

Probe (5-6-carboxyfluorescein-3-6-carboxytetramethylrhodamine)

Forward: TCGACAACGCCCGTCTG
Reverse: CCACGCTCATGCGCAG

CCGAACCAAGTTTGAGACGGAACAGG

Forward: GAAGGTGAAGGTCGGAGTC
Reverse: GAAGATGGTGATGGGATTTC

CAAGCTTCCCGTTCTCAGCC

Primer and probe sequences for RT-PCR amplification of cytokeratin 19 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
mRNA

16

THE LANCET Vol 357 January 6, 2001

For personal use only. Not to be reproduced without permission of The Lancet.
Copyright 2001 All Rights Reserved

ARTICLES

107
106
105
104

Number positive
= 31 (33%)

Number positive
= 41 (67%)

103
102
101

Number negative
= 64 (67%)

Number negative
= 20 (33%)

100
Grades 1 and 2
(n = 95)

Grade 3
(n = 61)

Cytokeratin 19 mRNA (log copy numbers)

Tumour grade
108

108
107
106
105
104
103 Number
102

positive

= 15 (35%)

= 23 (70%)

= 26 (39%) = 10 (71%)

= 28 (65%)

= 10 (30%)

= 40 (61%) = 4 (29%)

101 Number
negative

100
Obturator
(n=43)

Internal
iliac
(n=33)

External
iliac
(n=66)

Common
iliac
(n=14)

Cytokeratin 19 mRNA (log copy numbers)

FIGO stage
108

Figure 3: Cytokeratin 19 mRNA transcription in all lymph nodes

according to anatomical location

107

Error bars=95% CI.

106

with cervical cancer (22 squamous-cell carcinomas, two

clear-cell carcinomas, six adenocarcinomas, and two
adenosquamous carcinomas; one FIGO stage IA2, and
31 FIGO stage IB1/2) who underwent primary surgery
(radical hysterectomy and pelvic lymphadenectomy).
The age range was 2670 years (median 41). Cytokeratin
19 transcription was detected in all primary tumours with
a median copy number of 81106 per g RNA (range
42105 to 58108 per g RNA).
The patients with benign disease ranged in age from 45
to 66 years (median 53). Cytokeratin 19 transcription
was detected in just one of 32 lymph nodes, at a copy
number of only 66 per g RNA. This lymph node was
from a patient diagnosed with a benign serous
cystadenoma of the ovary.
Six of the 156 lymph nodes from the 32 patients with
cervical cancer had histological evidence of metastatic
involvement. All six showed cytokeratin 19 transcription
with copy numbers similar to the primary tumour
(median 7106 per g RNA [range 34106 to 56107
per g RNA). Two of the four patients with histologically
involved lymph nodes showed cytokeratin 19
transcription in all other lymph nodes, which were
histologically uninvolved. Both patients had poorly
differentiated stage IB2 tumours, with LVSI.
Of the 150 histologically uninvolved lymph nodes, 66
(44%) showed cytokeratin 19 transcription (median
49103 per g RNA) over a range up to 11105 copy
numbers per g RNA. There were significant
associations between the degree of cytokeratin 19
transcription in histologically uninvolved lymph nodes
and clinicopathological prognostic features (figure 2).
Cytokeratin 19 transcription was higher in the lymph
nodes from patients with poorly differentiated (grade 3)
tumours than in those with well or moderately
differentiated tumours (median copy number 38103 vs
0 per g RNA; p<00001). Patients with tumours of
FIGO stage IB2 had higher copy numbers than those of
FIGO stage IA2/IB1 (median 2103 vs 0 per g RNA;
p=00002). Cytokeratin 19 transcription was also higher
in the lymph nodes from patients whose primary tumour
had evidence of LVSI than in those that did not (median
1103 vs 0 per g RNA; p=00001). In lymph nodes
associated with poorly differentiated tumours, stage
IB2 disease, or LVSI, the median copy number was

105
104

Number positive
= 31 (33%)

Number positive
= 41 (65%)

103
102
101

Number negative
= 62 (67%)

Number negative
= 22 (35%)

100
Stages IA2 and IB1
(n = 93)

Stages IB2
(n = 63)

LVSI
108
107
106
105
104

Number positive
= 23 (30%)

Number positive
= 49 (61%)

103
102
101

Number negative
= 53 (70%)

Number negative
= 31 (39%)

100
Absent
(n = 76)

Present
(n = 80)

Figure 2: Associations between cytokeratin 19 transcription

and clinicopathological prognostic features
The six lymph nodes with transcriptions higher than 11105 copies per
g RNA have histological evidence of metastatic involvement. Error
bars=95% CI for distribution of copy numbers in each group.

these transcripts in lymph nodes from patients with

cervical cancer and those with benign disorders (median
copy number 10107 vs 18107 per g RNA; p=069).
We studied primary cervical tumours from 32 patients

17

THE LANCET Vol 357 January 6, 2001

For personal use only. Not to be reproduced without permission of The Lancet.
Copyright 2001 All Rights Reserved

ARTICLES

1103 per g RNA. In each case the proportion positive

for cytokeratin 19 expression was higher in the worse
prognostic category than in that with better prognosis.
Among the 16 patients with detectable cytokeratin 19
mRNA expression in their lymph nodes, the highest
expression was found in the obturator nodes in three
cases, in the internal iliac nodes in six, in the external
iliac nodes in six, and in the common iliac node in one.
According to anatomical location, the lowest copy
numbers were found in the obturator nodes (median 0
per g RNA; figure 3). These copy numbers were
significantly lower than those in the internal iliac nodes
(median 7102 per g RNA, p=001) and common iliac
nodes (median 37103 per g RNA, p=0005). The
proportions positive were highest among common and
internal iliac nodes.
The mean follow-up of the patients with cervical
cancer was 21 months. Three patients developed
recurrence, one with a distant metastasis. The first
patient developed recurrence 3 months after primary
surgery and showed recurrent disease centrally and at the
pelvic side wall. This patient was initially diagnosed with
a histologically node-negative, stage IB1, poorly
differentiated squamous-cell carcinoma of the cervix
with LVSI in the primary tumour. High cytokeratin 19
mRNA copy numbers (>103) were found in all six
uninvolved lymph nodes from this patient. The second
patient developed recurrent disease with a distant
metastasis in a lymph node in the neck 12 months after
primary surgery. This patient was initially diagnosed with
a stage IB2, poorly differentiated adenocarcinoma of the
cervix with LVSI in the primary tumour. Two pelvic
lymph nodes were histologically involved, and
quantitative RT-PCR analyses revealed presence of
cytokeratin-19-positive tumour cells (with >103
transcripts per g RNA) in all six histologically
uninvolved lymph nodes analysed. The third patient, who
was initially diagnosed with a node-negative, stage IB1,
moderately differentiated, squamous-cell carcinoma of
the cervix and LVSI in the primary tumour, developed
recurrent disease 18 months after primary surgery.
Quantitative RT-PCR revealed the presence of
cytokeratin-19-positive tumour cells (103 transcripts per
g RNA) in an internal iliac node at the time of primary
diagnosis.

Discussion
The concept of the sentinel node as the first drainage
station in breast cancer was introduced in 1994.16
Immunohistochemistry has been used to assess the
presence of micrometastases in nodes classified as
uninvolved on conventional histology, because a
proportion of patients with node-negative breast cancer
will develop recurrence.17 Rates of conversion based on
immunohistochemistry vary between 8% and 41%.18,19
The use of a more sensitive technique, RT-PCR for
cytokeratin 19 mRNA, has shown even higher conversion
rates in patients with node-negative breast cancer.19
However, several issues need to be addressed about
the significance of micrometastases. Since the first
report in 1991 by Smith and colleagues, several
molecular markers for micrometastases in various cancers
and different PCR protocols have been described, but
none has been introduced in standard clinical practice.20,21
Nevertheless, one study has shown the clinical potential
of RT-PCR and found significant differences in 5-year
survival between patients with stage II colorectal cancer
with and without evidence of micrometastases, by use of
RT-PCR for expression of carcinoembryonic antigen

18

mRNA.22 For most cancers, however, there are no

methods yet to detect which patients with
micrometastases will develop recurrence and how this
will affect survival, because not all micrometastases will
develop into distant tumours. Benson and Querci della
Rovere raised the important issue of potential
overstaging.19 Because of the increasing number of
reports on detection of micrometastases with
conventional RT-PCR, new questions have arisen. Is the
total burden of micrometastases important? How can we
assess their behaviour to predict potential further growth?
And do we need to remove all lymph nodes if the sentinel
node is negative? The aim of our study was to quantify
the amount of cytokeratin 19 mRNA expression with a
novel molecular technique, real-time quantitative RTPCR. We also undertook lymphatic mapping to assess
the pattern of micrometastatic spread.
We documented high transcription of cytokeratin 19 in
all 32 primary cervical tumours studied. We were able to
quantify accurately cytokeratin 19 transcription in lymph
nodes with putative occult micrometastatic disease. To
assess the specificity of cytokeratin 19 mRNA as a
molecular marker for micrometastases in lymph nodes,
we analysed 32 nodes from patients with benign epithelial
disease. Only one showed transcription of cytokeratin 19
and only at a very low level. This transcription could be
due to expression of cytokeratin 19 by myoepithelial cells
surrounding blood vessels present in lymph nodes, or
illegitimate transcription of the gene by lymphoid cells.10
The frequency of cytokeratin 19 positivity in lymph
nodes from patients without cancer is lower in our study
than reported by others.8,23 A possible explanation is that
the recently identified second pseudogene12 was amplified
in earlier conventional (nested) RT-PCR assays for
cytokeratin 19, giving a higher false-positive rate. We
specifically designed primers and probe not to amplify
either of the two known pseudogenes.
50% of the patients with cervical cancer in our study
showed cytokeratin 19 transcription over a broad range in
their lymph nodes, suggesting occult micrometastases.
This proportion broadly accords with that in a study of
colorectal cancer,24 but it is slightly higher than that
reported in some studies of breast cancer.8,23 The
inconsistency in the proportion of micrometastases
detected in lymph nodes of cancer patients by RT-PCRbased assays has several possible explanations. First,
different methods have been used for sample processing
and RNA extraction. Second, RT-PCR protocols are not
standardised, and different primers for the same
molecular marker or altogether different markers have
been used for the same cancer. Third, the number of
lymph nodes analysed per patient has varied
substantially, from three to 15. Our high proportion of
putative occult micrometastases (44%) in normal lymph
nodes from patients with cervical cancer may be related
to the high sensitivity of real-time quantitative RT-PCR,
which enables us to detect low transcription of
cytokeratin 19. The histologically involved lymph nodes
in our study showed similar degrees of transcription of
cytokeratin 19 to the primary cervical tumours. The
degree of transcription was also similar to that detected in
histologically involved lymph nodes from other
gynaecological cancers (data not shown). All additional
uninvolved lymph nodes from one of the patients with
node-positive cervical cancer showed more than 103
copies of cytokeratin 19 mRNA per g total RNA. One
node-negative patient had more than 103 copies per g
RNA in all lymph nodes. Both patients developed
recurrent disease.

THE LANCET Vol 357 January 6, 2001

For personal use only. Not to be reproduced without permission of The Lancet.
Copyright 2001 All Rights Reserved

ARTICLES

We found significant differences in transcription

according to differentiation, stage, and the absence or
presence of LVSI in the primary tumour. These three
prognostic factors are associated with clinical outcome in
cervical cancer.1,25 Whether the apparent threshold value
of 103 copies of cytokeratin 19 transcripts per g RNA in
histologically uninvolved lymph nodes will also indicate a
poor prognosis is not yet known.
The potential first lymph-node drainage stations for
cervical cancer are the obturator, parametrial, and
internal and external iliac nodes. Dargent and colleagues
used a dye solution to identify the sentinel node with
laparoscopy in 23 patients with early-stage cervical
cancer.26 They were able to identify one or two sentinel
nodes per patient, mostly in the internal iliac area. With
haematoxylin and eosin staining, they found between one
and three nodes with evidence of metastatic involvement
on histology and in all these cases the sentinel node was
positive. We found no consistent anatomical location for
the lymph node with the highest cytokeratin 19
transcription, although 15 of 16 patients with evidence of
micrometastases had the highest transcription in a first
lymph-node drainage station. The finding of the highest
cytokeratin 19 copy numbers in the lymph nodes most
proximal to the primary cancer supports the concept that
cervical cancers (like several other cancers) metastasise
via a sentinel lymph-node. Real-time quantitative RTPCR might be valuable in detection of micrometastases
in sentinel nodes found after the application of a dye
solution or radioisotope. Van der Velde-Zimmermann
and colleagues reported a possible strategy for analysing
sentinel nodes in melanoma patients by use of RT-PCR
as first diagnostic tool.27 This highly sensitive and quick
technique can be used effectively to preselect nodes for
further immunohistochemistry of serial sections, and it
seems both rapid and cost-effective.
Slade and colleagues proposed the use of competitive
RT-PCR to improve the specificity of the conventional
cytokeratin 19 RT-PCR assay.28 Although this technique
aims to quantify cytokeratin 19 transcripts by means of a
competitor template and seems to be more specific than
nested PCR, such an assay is too complicated for routine
clinical use. The method we used has several advantages
as a molecular diagnostic tool compared with
conventional RT-PCR. It is at least as sensitive as
conventional nested RT-PCR but far more specific, it
requires no post-PCR manipulation such as gel
electrophoresis or Southern blotting, and it lends itself to
easy automation.11 Absolute quantification of mRNA
copy numbers is easily achieved by use of standard curves
for each molecular marker used.
We have shown that 50% of patients with early-stage
cervical cancer shed tumour cells in the lymphatic
system, and that the amount is significantly associated
with poor clinicopathological prognostic features.
Evidence from necropsy data and animal models suggests
that most cancer patients have dormant micrometastases.
However, only a very small fraction of these
micrometastases continue to grow to form tumours.2,29,30
Quantification, characterisation, and assessment of the
potential of distant tumour growth of micrometastases is
therefore essential in further studies on micrometastases.
The results of this study provide a proof of principle for
molecular studies of micrometastases. Ultimately, a panel
of RT-PCR markers including other tumour products
such as angiogenic factors may provide optimum clinical
information. Such a panel may enable clinicians to
identify the small group of patients who are destined to
develop recurrent disease.

Contributors
Philippe Van Trappen was responsible for the conception, design,
arrangement of ethical approval, and collection of surgical specimens,
conduct of molecular experiments, analyses, interpretation of the data,
and drafting of the paper. Valerie Gyselman constructed the standard
curves and was involved in technical support during the molecular
experiments. David Lowe was responsible for the histopathological
analyses. Andy Ryan was involved in practical arrangements for the
collection of tumour samples and RNA extractions. David Oram,
Peter Bosze, Anthony Weekes, and John Shepherd were involved in the
organisation of sample collections and follow-up of patients. Sina Dorudi
provided the quantitative RT-PCR facilities. Stephen Bustin designed the
primers and probes and contributed to the design of the methods.
Ian Jacobs was involved in the design of the study, interpretation of the
data, and drafting of the paper.

Acknowledgments
We thank Janice Thomas for her assistance in the statistical analyses and
Pal Siklos for providing samples. The ABI 7700 Prism Sequence
detection system (PE-ABI) was donated by the London Immunotherapy
Cancer Trust. POVT was supported by the Luxembourg Cancer
Foundation and the Joint Research Board of the Special Trustees of St
Bartholomews Hospital, London.

References
1

3
4

10

11
12

13

14

15

16

17

18

Inoue T, Morita K. The prognostic significance of number of positive

nodes in cervical carcinoma stages IB, IIA and IIB. Cancer 1990; 65:
192327.
Holmgren L, OReilly M, Folkman J. Dormancy of micrometastases:
balanced proliferation and apoptosis in the presence of angiogenesis
suppression. Nat Med 1995; 1: 14953.
Hayashi N, Ito I, Yanagisawa A, et al. Genetic diagnosis of lymphnode metastasis in colorectal cancer. Lancet 1995; 345: 125759.
Czegledy J, Iosif C, Forslund O, Willen R, Hansson BG. Detection of
human papilloma virus DNA in lymph nodes extirpated at radical
surgery for cervical cancer is not predictive of recurrence. J Med Virol
1998; 54: 18385.
Pao CC, Hor JJ, Yang FP, Lin CY, Tseng CJ. Detection of human
papillomavirus mRNA and cervical cancer cells in peripheral blood of
cervical cancer patients with metastasis. J Clin Oncol 1997;
15: 100812.
Stasiak PC, Purkis PE, Leigh IM, Lane EB. Keratin 19: predicted
amino acid sequence and broad tissue distribution suggest it evolved
from keratinocyte keratins. J Invest Dermatol 1989; 92: 70716.
Moll R, Levy R, Czernobilsky B, Hohlweg-Majert P,
Dallenbach-Hellweg G, Franke WW. Cytokeratins of normal
epithelia and some neoplasms of the female genital tract. Lab Invest
1983; 49: 599610.
Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer
micrometastasis in axillary lymph nodes by using polymerase chain
reaction. Cancer Res 1994; 54: 298690.
Bustin SA, Gyselman VG, Williams NS, Dorudi S. Detection of
cytokeratins 19/20 and guanylyl cyclase C in peripheral blood of
colorectal cancer patients. Br J Cancer 1999; 79: 181320.
Chelly J, Concordet JP, Kaplan JC, Kahn A. Illegitimate
transcription: transcription of any gene in any cell type. Proc Natl
Acad Sci USA 1989; 86: 261721.
Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative
PCR. Genome Res 1996; 6: 98694.
Ruud P, Fodstad , ,Hovig E. Identification of a novel cytokeratin 19
pseudogene that may interfere with reverse transcriptase-polymerase
chain reaction assays used to detect micrometastatic tumor cells.
Int J Cancer 1999; 80: 11925.
Chomczynski P, Saachi N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem 1987; 162: 15659.
Savtchenko ES, Schiff TA, Jiang CK, Freedberg IM, Blumenberg M.
Embryonic expression of the human 40-kD keratin: evidence from a
processed pseudogene sequence. Am J Hum Genet 1988; 43: 63037.
Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of
specific polymerase chain reaction product by utilizing the 5-3
exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl
Acad Sci USA 1991; 88: 727680.
Giuliano AE, Kirgan DM, Guenther JM, Morton DL. Lymphatic
mapping and sentinel lymphadenectomy for breast cancer. Ann Surg
1994; 220: 391401.
Cote RJ, Peterson HF, Chaiwun B, et al. Role of
immunohistochemical detection of lymph-node metastases in
management of breast cancer. Lancet 1999; 354: 896900.
McIntosh SA, Going JJ, Soukop M, Purushotham AD, Cooke TG.
Therapeutic implications of the sentinel lymph node in breast cancer.
Lancet 1999; 354: 570.

19

THE LANCET Vol 357 January 6, 2001

For personal use only. Not to be reproduced without permission of The Lancet.
Copyright 2001 All Rights Reserved

ARTICLES

19 Benson JR, Querci della Rovere G. Sentinel lymph node in breast

cancer. Lancet 1999; 354: 1998.
20 Smith B, Selby P, Southgate J, Pittman K, Bradley C, Blair GE.
Detection of melanoma cells in peripheral blood by means of reverse
transcriptase and polymerase chain reaction. Lancet 1991; 338:
122729.
21 Raj GV, Moreno JG, Gomella LG. Utilization of polymerase chain
reaction technology in the detection of solid tumors. Cancers 1998;
82: 141942.
22 Liefers G-J, Cleton-Jansen A-M, van de Velde CJ, et al.
Micrometastases and survival in stage II colorectal cancer. N Engl J
Med 1998; 339: 22328.
23 Schoenfeld A, Luqmani Y, Sinnett HD, Shousha S, Coombes RC.
Keratin 19 mRNA measurement to detect micrometastases in lymph
nodes in breast cancer patients. Br J Cancer 1996;
74: 163942.
24 Futamura M, Takagi Y, Koumara H, et al. Spread of colorectal
cancer micrometastases in regional lymph nodes by reverse
transcriptase-polymerase chain reactions for carcionembryonic
antigen and cytokeratin 20. J Surg Oncol 1998; 68: 3440.
25 Alvarez RD, Soong SJ, Kinney WK, et al. Identification of prognostic

20

26

27

28

29

30

factors and risk groups in patients found to have nodal metastasis at

the time of radical hysterectomy for early-stage squamous carcinoma
of the cervix. Gynecol Oncol 1989; 35: 13035.
Dargent D, Martin X, Roy M, Mathevet P. Identification of a
sentinel node with laparoscopy in cervical cancer. Proc SGO Meeting
2000; abstract 44: 128.
van der Velde-Zimmermann D, Schipper ME, de Weger RA,
Hennipman A, Borel Rinkes IH. Sentinel node biopsies in melanoma
patients: a protocol for accurate, efficient, and cost-effective analysis
by preselection for immunohistochemistry on the basis of Tyr-PCR.
Ann Surg Oncol 2000; 7: 5154.
Slade MJ, Smith BM, Sinnett HD, Cross NC, Coombes RC.
Quantitative polymerase chain reaction for the detection of
micrometastases in patients with breast cancer. J Clin Oncol 1999; 17:
87079.
Luzzi KJ, MacDonald IC, Schmidt EE, et al. Multistep nature of
metastatic inefficiency: dormancy of solitary cells after successful
extravasation and limited survival of early micrometastases.
Am J Pathol 1998; 153: 86573.
Cifuentes N, Pickren JW. Metastases from carcinoma of mammary
gland: an autopsy study. J Surg Oncol 1979; 11: 193205.

THE LANCET Vol 357 January 6, 2001

For personal use only. Not to be reproduced without permission of The Lancet.
Copyright 2001 All Rights Reserved