Arch Microbiol (2005) 184: 158167

DOI 10.1007/s00203-005-0036-x

O R I GI N A L P A P E R

Razia Kutty George N. Bennett

Biochemical characterization of trinitrotoluene transforming

oxygen-insensitive nitroreductases from Clostridium
acetobutylicum ATCC 824
Received: 1 July 2005 / Revised: 15 August 2005 / Accepted: 25 August 2005 / Published online: 27 September 2005

Springer-Verlag 2005

Abstract The genes that encode oxygen-insensitive nitroreductases from Clostridium acetobutylicum possessing 2,4,6-Trinitrotoluene (TNT) transformation activity
were cloned, sequenced and characterized. The gene
products NitA (MW 31 kDa) and NitB (MW 23 kDa)
were puried to homogeneity. The NitA and NitB are
oxygen-insensitive nitroreductases comprised of a single
nitroreductase domain. NitA and NitB enzymes show
spectral characteristics similar to avoproteins. The
biochemical characteristics of NitA and NitB are highly
similar to those of NfsA, the major nitroreductase from
E. coli. NitA exhibited broad specicity similar to that
of E. coli NfsA and displayed no avin reductase
activity. NitB showed broad substrate specicity toward nitrocompounds in a pattern similar to NfsA and
NfsB of Escherichia coli. NitB has high sequence similarity to NAD(P)H nitroreductase from Archaeoglobus
fulgidus. NitA could utilize only NADH as an electron
donor, whereas NitB utilized both NADH and
NADPH as electron donors with a preference for
NADH. The activity of both nitroreductases was high
toward 2,4-Dinitrotoluene (2,4-DNT) as a substrate.
Both the nitroreductases were inhibited by dicoumarol
and salicyl hydroxamate. The nitroreductases showed
higher relative expression on induction with TNT,
nitrofurazone and nitrofurantoin compared to the
uninduced control.
Keywords Oxygen-insensitive nitroreductase
Trinitrotoluene biotransformation Flavoprotein

R. Kutty G. N. Bennett (&)

Department of Biochemistry and Cell Biology MS-140,
Rice University, Houston, TX 77005-1892, USA
E-mail: gbennett@rice.edu
Tel.: +1-713-3484920
Fax: +1-713-3485154

Introduction
Nitroaromatics are used in multiple applications viz.
synthesis of pharmaceuticals, pesticides and explosives.
Explosives and many nitro-substituted aromatics are
widely distributed as environmental contaminants. TNT
represents a major contaminant at the Department of
Defense sites (Noyes, 1996). The toxic eects of nitrosubstituted aromatics have been well established (Padda
et al. 2003; Tan et al. 1992; Won et al. 1976). Bioremediation (using either bacteria or plants) is inherently cost
eective and holds promise for addressing explosive
contamination problems (Fiorenza et al. 1991). Research on nitroreductases has been of signicant interest
because of their role in the bioremediation of nitroaromatic compounds (Nishino et al. 1993; Somerville et al.
1995; Basran et al. 1998; Groenewegen et al. 1992;
French et al. 1998; Kitts et al. 2000; Fiorella et al. 1997).
The aerobic and anaerobic metabolism of TNT has
been previously described in various bacteria viz. Pseudomonas consortium, Methanococcus sp. (strain B),
Clostridium thermoaceticum and Clostridium acetobutylicum (Boopathy et al.1994; Boopathy 1994; Huang et al.
2000; Hughes et al.1998). Earlier studies have investigated
the role of nitroreductases towards a variety of nitrocompounds (Spain 1995). These enzymes are categorized
as oxygen-sensitive nitroreductases reported in Pseudomonas and Desulfovibrio sp (Boopathy et al. 1994;
Boopathy et al. 1993) and oxygen-insensitive nitroreductases in E. coli and Enterobacter cloacae (Kitts et al.
2000). Extensive studies have analyzed the oxygeninsensitive (type I nitroreductases) group which reduces
nitroaromatic compounds through successive two-electron reductions of the nitro group to nitroso which is
reduced to hydroxylamino and ultimately to amino substituents. The oxygen sensitive group of enzymes such as
NADPH cytochrome P-450 oxidoreductase and NADPH
b5 oxidoreductase catalyzes one electron reduction of
nitro moiety leading to the formation of anionic-free
radicals (Boopathy et al. 1994; Boopathy et al. 1993).

159

Previous studies have demonstrated the nitrocompound-reducing capability of nitroreductases from different bacteria. Escherichia coli resting cells have been
demonstrated to transform TNT reductively (Yin et al.
2004). NfsA, the major oxygen insensitive nitroreductase
from E. coli has been puried and biochemically characterized. It can reduce nitrofurazone generating a twoelectron transfer product and has a tightly associated
avin mononucleotide (Zenno et al. 1996a). Purication
and characterization of NfsB, a minor oxygen-insensitive nitroreductase from E. coli has been reported
(Zenno et al. 1996b). The NfsA and NfsB nitroreductases have also been shown to function as lawsone (2hydroxy-1,4-napthoquinone)-dependent azo reductases
under anaerobic conditions (Rau and Stolz 2003).
The type I nitroreductases are either monomeric or
homodimeric avin mononucleotide (FMN)-containing
proteins with a subunit size of approximately 25 kDa
and use NAD(P)H as a reductant (Blehert et al. 1999).
Flavoproteins containing FMN are able to transform
glycerol trinitrate and pentaerythritol tetranitrate and
catalyze the NAD(P)H-dependent cleavage of nitro
groups releasing nitrite (Blehert et al. 1999). Although
the nitrate ester reductases have been isolated on the
basis of their potential to release nitrite from nitrate
esters, they also have the ability to transform TNT.
An oxygen-insensitive, type I nitroreductase puried
from Enterobacter cloacae strain 96-3 shows a broad
substrate specicity, reducing nitro groups on such diverse nitroaromatic compounds as TNT, 4-nitrophenol,
4-nitroacetophenone and 4-nitrobenzene methyl sulfonate (Bryant and DeLuca 1991). The most extensively
studied FMN-containing protein catalyzing the reduction of quinones, as well as the reduction of the olenic
bond of a,b-unsaturated aldehydes and ketones and
sharing sequence similarity with bacterial xenobiotic
reductases is old yellow enzyme (OYE) identied in
several species of yeast (Karplus et al. 1995; Kohli and
Massey 1998; Schopfer and Massey 1991). The nitrate
ester reductases form a part of the OYE family (Rieger
and Knackmuss 1995).
There are rare reports on the oxygen-insensitive nitroreductases from Clostridium species. NADH-dependent nitroaryl reductase activity has been partially
puried and characterized from Clostridium kluyveri,
Clostridium spec. La 1 and Clostridium sporogenes
(Angermaier and Simon 1983). Flavoprotein from
Clostridium perfringens has been demonstrated to possess both the azoreductase and nitroreductase activity
(Rai and Cerniglia 1993). Characterization of oxygeninsensitive nitroreductases from Clostridium acetobutylicum will allow the identication of nitroaromatic
transforming potential of these enzymes which is of
biotechnological importance and allow insight into their
potential role in Clostridial metabolism.
Our previous reports have demonstrated rapid
transformation of TNT by C. acetobutylicum ATCC 824
(Hughes et al. 1998; Khan et al.1997). The clostridial
enzymes conclusively associated with nitroreductase

activity, namely hydrogenase (Watrous et al. 2003) and

carbon monoxide dehydrogenase (Huang et al. 2000),
are dierent from the classical Type I (oxygen insensitive) and Type II (oxygen sensitive) nitroreductases
puried from aerobic and facultative bacteria. However,
the sequence of the Clostridium acetobutylicum ATCC
824 genome (http://jura.ebi.ac.uk:8765/ext-genequiz/
genomes/ca0108/) indicates the presence of genes
encoding nitroreductase family proteins, which have
sequence homology to oxygen-insensitive nitroreductases puried from aerobic and facultative bacteria. This
work represents the rst report on cloning, purication
and characterization of nitroreductases from Clostridium acetobutylicum ATCC 824. Nitroreductase enzymes
NitA (MW 31 kDa) and NitB (MW 23 kDa) are encoded by the nitroreductase genes (CAC 0718) and
(CAC 3555) respectively, from the Clostridium acetobutylicum ATCC 824 chromosome. These are FMNcontaining avoproteins catalyzing the NAD(P)Hdependent transformation of TNT. The enzymes were
further characterized biochemically to determine the
substrate specicity and eect of inhibitors. The relative
expression and inducibility of the nitroreductase genes
NitA and NitB of Clostridium acetobutylicum with nitrocompounds as inducers were examined by real-time
quantitative PCR (Q-PCR) analysis.

Materials and methods

Restriction enzymes were obtained from New England
Biolabs, Inc. (Beverly, MA, USA). Solid chemicals: 2,4,6
Trinitrotoluene (99% purity) was procured from Chem
Service (West Chester, PA, USA). FMN, FAD, NADH,
NADPH and other nitrosubstrates were obtained from
Sigma (St. Louis, MO, USA). All these and other
chemicals used were of the highest grade commercially
available. All reagents required for reverse transcription
PCR and Q-PCR were from Applied Biosystems (Foster
City, CA, USA).
Bacterial strain and plasmids
C. acetobutylicum ATCC 824 DNA, prepared as previously described (Green et al. 1996), was used as a
template for PCR. The expression constructs in pTrcHis2-TOPO vector were transformed into E. coli TOPO
10 F cells from Invitrogen (Carlsbad, CA, USA) and
veried by sequence analysis.
Cloning, purication and characterization
of nitroreductases NitA and NitB
The nitroreductase genes (CAC 0718) and (CAC 3555)
were amplied by PCR using a combination of forward
and reverse synthetic oligonucleotide primers. NitAForward: ATG AAT AAT ACA ATA GAT ACA ATG

160

AAA AAT CAT AG; Reverse : TTT AGT TTT TAG

TCC TTG TTT ATT AAT AGC GCC and NitB-Forward: ATG ATA GAT TTA AAA ACT AGA AGA
AGC ATA AG; Reverse: TTT AGA ATA TTT GTC
GTA ATG AAG TTT ATT TAA AG. Genomic DNA
(80100 ng) was used as template and the PCR products
were cloned into the pTrcHis2 TOPO expression vector
with a C-terminal His -tag (Invitrogen) producing pTrcHis2-NitA and pTrcHis2-NitB. TOP10 F E. coli strain
was transformed with the recombinant plasmids following the suppliers protocol. The recombinant strains
were grown in Luria-Bertani medium at 37C and the
expression was induced with 1 mM isopropyl-b-Dgalactoside. Purication was carried out by probond
nickel column (Invitrogen) according to the suppliers
protocol. The cell pellet from 25 ml of culture which
expressed the His- tag fusion protein was suspended in
2 ml lysis buer (50 mM potassium phosphate buer
pH 7.0, 1 mM EDTA, 0.1 mM DTT and 0.1 mM
phenylmethylsulfonyluoride), lysed by sonication for
15 min at 4C and centrifuged at 10,000 rpm for 20 min
at 4C. The supernatant was used for probond nickel
chromatography. The puried NitA was dialyzed
against 50 mM potassium phosphate buer pH 7.0 and
NitB against 50 mM potassium phosphate buer pH 7.0
with 150 mM NaCl.
Enzyme assays and inhibition studies
The protein concentration was determined by the
Bradford method (Bradford 1976) using a protein assay kit from Biorad, and employing bovine serum
albumin as a standard. TNT reductase activity was
assayed under reaction conditions described below.
The reaction was carried out at 25C. A typical
reaction mixture (1.0 ml) contained 50 mM Tris-HCl
buer (pH 7.0), 0.16 mM NADH or NADPH,
0.05 mM of a given electron acceptor and a suitable
amount of enzyme. The reaction was initiated by
addition of NADH or NADPH. The rate of nitroreductase catalyzed oxidation of NADH/NADPH by
various nitroaromatics was determined by monitoring
absorbance at 340 nm spectrophotometrically. The
molar extinction coecient of NADH/NADPH
6.22103 M 1cm 1 was used for the calculation of
enzyme activity. Enzyme was incubated in buer in the
presence of a specic concentration of inhibitor for
5 min for the inhibition studies, subsequently nitroreductase activity was determined.
Kinetic parameters
Kinetic parameters were determined by varying the
concentration under standard conditions while holding
the concentration of NADH xed at 0.16 mM. Conversely kinetic parameters for NADH were determined
by varying the concentration under standard conditions

with the concentration of TNT xed at 0.05 mM. The

Km and Vmax values were calculated using LineweaverBurk plots.
Real-time quantitative PCR
RNA was isolated from the culture of C acetobutylicum
by using the manufacturers protocol for SV total RNA
isolation system from Promega (Madison, WI,
USA).The RNA content was determined spectrophotometrically and up to 1 lg per reaction was reverse
transcribed with random hexamer primers in a nal
volume of 20 ll by using the reverse transcription system
from Promega following the suppliers protocol. The
resulting cDNA was stored at 80C.
mRNA levels were quantied by subjecting cDNA to
Q-PCR analysis in triplicate using ABI prism 7000 sequence detection system (Applied Biosystems). The
forward and reverse specic primers designed are listed
in Table 1 All the reactions were performed in 20 ll
reaction volumes that contained 1X SYBR green PCR
master mix (Applied Biosystems), 1.25 pmol each of
forward and reverse primers and 40 ng of cDNA.
Amplication began with 10-min incubation at 95C
to activate AmpliTaq Gold DNA polymerase followed
by 40 Cycles of denaturation at 95C for 15 s with 60 s
of annealing and extension at 60C. Standards and
samples were assayed in triplicates. Analyses of data
were accomplished using the ABI PRISM 7000 Sequence Detection Software. The calculations for relative
gene expression were done by the relative quantication
method (Livak and Schmittgen 2001).

Results
Expression of recombinant NitA and NitB in E. coli
SDS-PAGE analysis indicated that recombinant proteins NitA and NitB of monomeric molecular weights 31
and 23 kDa respectively, were over expressed in E coli
with the C-terminal His-tag contributing 34 kDa to the
size of the protein (Fig. 1). Cell extracts of E. coli
bearing the NitA and NitB constructs exhibit prominent
bands that comigrated with puried recombinant nitroreductase proteins. In contrast, lysates from control
E. coli harboring the plasmid pTrcHis2- TOPO lacking
the DNA insert did not exhibit protein bands that comigrated with NitA or NitB. In vitro activity assays
conducted with cell extracts conrmed that the expressed proteins NitA and NitB had catalytic activity
and exhibited 89 and 17-fold greater specic activity
respectively with TNT as acceptor substrate and NADH
as source of reducing equivalent than cell extracts from
E. coli harboring the control plasmid (Table 2). The
NitB protein showed migration corresponding to a
higher molecular mass than would be estimated from the
DNA sequence.

161
Table 1 Forward and reverse specic Q-PCR primers designed for NitA and NitB
Primer pair

Source

NitA

C.acetobutylicum
ATCC824
C.acetobutylicum
ATCC824

NitB

PCR (bp)
134 bp
188 bp

Direction

Sequence

Forward
Reverse
Forward
Reverse

ACTGCTCACTCCATGGGTCT
TTTCTTTCTTCGTCCGGGTA
TCTGTTGTTGCTGCCGAAT
TGTGATTCATCAGCCGGATA

and 276 nm. The absorbance spectra of NitA and NitB

in the upper part of the spectrum matched to that of free
FMN but were shifted slightly (Fig. 2). As with NfsA
from E. coli the solution of NitA and NitB was yellow
and this coloration was still present after dialysis.
Substrate specicity of the nitroreductase

Fig. 1 Denaturing gel electrophoresis analysis of NitA and NitB

10 lg of NitB and NitA puried from E. coli (lanes 4 and 6,
respectively), 10 lg of cell extracts from E. coli expressing NitB and
NitA (lanes 2 and 5, respectively) E. coli harboring plasmid
pTrcHis2-TOPO lacking the insert (lane 3). Lane 1. Molecular mass
standards of 200, 116, 97, 66, 45, 31, 28 and 14.4 kDa

The pH optimum for enzyme activity was determined in 50 mM sodium acetate buer in the pH range
of 4.0-5.5, 50 mM potassium phosphate buer in the
pH range of 6.07.5 and in 50 mM Tris-HCl buer in
the pH range of 7.59.0. The optimum pH was estimated to be 6.5 for NitA and 6.0 for NitB enzymes.
The temperature optimum measured in 50 mM phosphate buer pH 7.0 was estimated to be 30C, for both
NitA and NitB.
The free FMN spectrum has peaks at 443, 372, 265
and 222 nm, while peaks in the NitA spectrum are 441,
344 and 267 nm. NitB spectrum has peaks at 440, 360
Table 2 In vitro activity assays conducted with E. coli cell extracts.
The assay conrmed that the expressed proteins NitA and NitB
had catalytic activity and exhibited 89 and 17 fold greater specic
activity respectively than cell extracts from E. coli harboring the
control plasmid
Cell extract

Specic activity (U/mg)a

E. coli TOPO 10/pTrcHis2 NitA clone

E. coli TOPO 10/pTrcHis2 NitB clone
E. coli TOPO 10/pTrcHis2 control

2.68
0.51
0.03

One unit of activity is dened as the oxidation of 1 lmol of

NADH per min in the presence of 50 lmol TNT in 50 mM
potassium phosphate buer (pH 7.0) at room temperature

Both enzymes exhibit the greatest rates of NADH

oxidation when 2,4-DNT was provided as an electron
acceptor. However NitA nitroreductase exhibited 17fold greater activity with TNT than the NitB nitroreductase. 2,4-DNT and 2,6-Dinitrotoluene (2,6-DNT)
were reduced to various degrees by NitA enzyme
(Table 3), whereas NitB enzyme exhibited essentially no
activity toward 2,6-DNT (Table 3). However, NitB
enzyme catalyzes reduction of nitrofurazone, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and octahydro1,3,5,7-tetranitro-1,3,5,7-tetrazocine
(HMX)
with
oxidation of NADH, whereas the NitA enzyme has an
activity less than 0.1 U/mg for NADH oxidation during reduction of these compounds (Table 3). The
analysis of the metabolites formed by the transformation of TNT by these nitroreductases will be reported
separately. NitA and NitB nitroreductases transformed
TNT into 2-hydroxylamino-4,6-dinitrotoluene and
2-amino-4,6-dinitrotoluene as identied by LC-MS.
NitA can utilize NADH as an electron donor for TNT
reduction, whereas NitB can use either NADH or
NADPH with preference for NADH. The TNT
reduction activity of NitB was 2.8-fold higher with
NADH as electron donor compared to that with
NADPH. Insignicant activity was observed when
FMN (0.06 mM), FAD (0.025 mM) or riboavin
(0.05 mM) was used as electron acceptors with NADH
as electron donor (data not shown).

Kinetic properties of nitroreductase NitA

The Km and Vmax values of puried NitA from E. coli
for TNT, 2,4-DNT and 2,6-DNT have been shown in
Table 4. The NitA nitroreductase had Km values of
8.51 lM and 555 lM for TNT and NADH, respectively. The NitA enzyme had the highest eciency
towards 2,4-DNT compared to that toward TNT and
2,6-DNT as determined by the Vmax/Km values. NADH
could not be substituted with NADPH with NitA
nitroreductase.

162
Table 4 Kinetic parameters for nitroreductase NitA
Substrates

Km (lM)

Vmax (lmol min

TNT
2,4 DNT
2,6 DNT
NADH

8.51
3.75
657
555

44
50
70
210

mg 1)

Vmax/Km
5.1
13.3
0.1
0.378

The values were determined by varying the concentration of substrates under standard conditions while holding the concentration
of NADH xed at 0.16 mM. Conversely kinetic parameters for
NADH were determined by varying the concentration under
standard conditions with the concentration of TNT xed at
0.05 mM. The Km and Vmax were calculated using a LineweaverBurk plot

Fig. 2 Absorbance spectrum of oxidized NitA expressed in E. coli.

A sample of protein 30 lM in 50 mM potassium phosphate buer
pH 7.0 (thin line) and 25 lM free FMN (thick line) was measured in
a 1 cm path cuvette. The free FMN spectra (second Y axis) showed
peaks at 443, 372, 265 and 222 nm. The NitA spectrum has peaks
at 441, 344, 267 and 222 nm. The inset shows the absorbance
spectra of oxidized NitB (25 lM) with peaks at 440, 360 and
276 nm

Inhibitors of nitroreductases
Both the nitroreductases were inhibited by dicoumarol
and salicyl hydroxamate, whereas chelating agents
EDTA and 1,10-phenanthroline as well as iodoacetamide caused no inhibition (Table 5).
Database comparisons and sequence analysis
The deduced amino acid sequences of the nitroreductases NitA and NitB were compared with the sequences in
Gen bank using the NCBI BLASTP program (Fig. 3).
The NitA has 46% similarity with NitB on amino acid
sequence alignment. The protein sequence analysis
indicates that NitA and NitB are oxygen-insensitive
nitroreductases comprised of a single nitroreductase
Table 3 Comparison of the substrate specicities of puried recombinant nitroreductases from Clostridium acetobutylicum
Substrate

TNT
2,4-Dinitrotoluene
2,6- Dinitrotoluene
Hexahydro-1,3,5-trinitro-1,3,5-triazine
Octahydro-1,3,5,7-tetranitro1,3,5,7-tetrazocine
Nitrofurazone

Specic activity
(U/mg)a
NitA

NitB

9.2
10.0
0.65
NS
NS

1.12
2.5
NS
0.15
0.1

NS

0.1

NS Activity not signicant (less than 0.1)

One unit of activity is dened as the oxidation of 1 lmol of
NADH per min in the presence of 50 lmol of substrates in 50 mM
potassium phosphate buer (pH 7.0) at room temperature

domain. The members of this family utilize FMN as a

cofactor. The amino acid segment from 1115 has been
shown to be involved in FMN binding in avin reductase P of Vibrio harveyi (Tanner et al. 1996). The corresponding residues in NitA and NitB are conserved
(Fig. 3). Site-directed mutagenesis of the Arg203 and
Arg208 residues in NfsA from E. coli resulted in a low
catalytic activity demonstrating the involvement of these
residues in NADPH binding, however, the mutants
showed low but similar relative activities with NADH as
electron donor due to dierence in the structure of
NADPH and NADH. Arg203 is a completely conserved
residue in the active site of NfsA and the avin reductase
P of Vibrio Harveyi, whereas Arg208 in NfsA corresponds to Lys208 in avin reductase P (Kobori et al.
2001). The corresponding residues in NitA which does
not utilize NADPH are replaced by Ile and Lys,
respectively. NitB utilizing both NADH and NADPH
has Ala and His residues corresponding to Arg203 and
Arg208 of NfsA.
Real-time quantitive PCR
The relative expression of the nitroreductase genes NitA
and NitB of C. acetobutylicum in cultures with nitrocompounds as inducers was examined by Q-PCR analysis. Total RNA was extracted from the C.
acetobutylicum cultures induced with 100 lM of TNT,
metronidazole, nitrofurazone and nitrofurantoin as
inducing compounds. The relative expression is compared to the uninduced control. The level of NitA increased by 8.1, 1.4, 9.2 and 5.3-fold on induction with
TNT, metronidazole, nitrofurazone and nitrofurantoin,
respectively, compared to control. The relative expression of NitB was higher by 7.4, 11 and 5.3-fold on
induction with TNT, nitrofurazone and nitrofurantoin.
The expression level remained stable on induction with
metronidazole (Fig 4 a,b).

Discussion

This paper reports characterization of trinitrotoluene

transforming oxygen-insensitive nitroreductases. The

163
Table 5 Eects of specic inhibitors on nitroreductase activity of
expressed recombinant NitA and NitB
Inhibitors

Chelating agents
EDTA (buer only)
1,10 Phenanthroline
(buer only)
Salicyl hydroxamate

Concentration
(mM)

Percentage of
Activity remaining
SDa
NitA

NitB

5.0
5.0

1025
1002

1002
1032

0.1
0.01

480
1001

761
1001

263
1002

403
1002

361
392

101
503

881
703

811
803

Sulfhydryl inhibitors
N- ethylmaleimide
1.0
Iodoacetamide
1.0
Electron transport inhibitors
Dicoumarol
0.01
Sodium azide
1.0
Reducing agent
Dithiothreitol
1.0
Glutathione
1.0

a
The rate of oxidation of NADH (micromoles per minute per
milligram of protein) in the presence of inhibitor expressed as a
percentage of the rate observed in the absence of inhibitor

absorption spectrum of the puried NitA and NitB enzymes, the colour of which are yellow, showed spectral
characteristics similar to free FMN suggesting that each
is a avoprotein containing an oxidized form of avin.
Similar to NfsA and NfsB nitroreductases from E. coli,
NitB possesses broad substrate specicity toward nitrocompounds (Zenno et al. 1996b). NitA and NitB both
use pyridine nucleotide which is a common property
among members of this family of avoproteins. A previous report has shown varying preferences for cofactor
requirement during TNT transformation by cell extracts
from Pseudomonas aeroginosa, Bacillus sp. and Staphylococcus sp. (Kalafut et al 1998).
Substrate specicity
Similar to NfsB, a concentrated solution of NitB and
NitA was yellow and this coloration was resistant to
dialysis (Zenno et al. 1996b). NitA and NitB exhibited
no reductase activity toward avins FMN, FAD and
riboavin suggesting that possibly the articial electron
acceptors do not bind the protein moiety. NfsA from
E. coli has been demonstrated to exhibit low level of
avin reductase activity (Zenno et al. 1996a). NitA has a
specic activity of reducing TNT over eightfold more
eectively than NitB. NitB is less eective towards
reduction of RDX, HMX and nitrofurazone compared
to its activity on TNT, whereas NitA showed a specic
activity of NADH oxidation less than 0.1 U/mg during
reduction of these compounds. 2, 4 DNT reduction was
higher than that of 2,6 DNT in NitA which implies that
the enzyme has high anity toward parasubstituted
compounds. The 4-position of TNT has also been shown
to be preferentially reduced (Lenke et al. 2000). Signi-

cant preference for reduction in the para versus ortho

position of TNT by E. coli cultures has been reported
(Yin et al. 2004). The Km of NitA for TNT is lower than
that of Enterobacter nitroreductase (144 lM) (Anlezark
et al. 1992) and higher than that of E. coli (6 lM)
(Bryant and Deluca 1991). The kinetic parameters
indicate that 2,4-DNT is the preferred substrate of
nitroreductase NitB. The metabolites of TNT transformation identied were 2-hydroxylamino-4,6-dinitrotoluene and 2-amino-4,6-dinitrotoluene which is similar to
the result obtained during TNT transformation by
NAD(P)H nitroreductase I from Klebsiella sp. C1 (Kim
et al. 2005).
Comparison with other avoproteins
The examination of amino acid sequences of the two
nitroreductases showed signicant similarity to the aminocid sequence of E. coli NfsA nitroreductase. The
biochemical characteristics were also found to be similar
with that of NfsA (Zenno et al. 1996c). The two nitroreductases showed insignicant similarity to the OYE
class of avoproteins which reduce a variety of electrophilic substrates and are extensively characterized. The
transformation of TNT has been investigated in ve
members of old yellow family of avin-dependent oxidoreductases which show a high degree of conservation
of regions of primary and secondary structures but followed dierent pathways involving reduction of the
aromatic ring or the nitrogroup (Williams et al. 2004).
The P. putida and P. uorescens xenobiotic reductases and the oxygen-insensitive type I nitroreductases are
broad-specicity, FMN-containing avoproteins that
reduce nitro-substituted compounds by using NAD(P)H
as a reductant (Kitts et al. 2000; Blehert et al. 1999).
However, amino acid sequence alignments comparing
these nitroreductases and the NitA and NitB nitroreductases do not reveal sequence similarities between
these enzymes.
The X-ray structures of FMN-containing avin reductases, FRP of Vibrio harveyi and avin reductase
(FRase) I of V. scheri that possess a common protein
fold have been reported (Koike et al. 1998; Tanner et al.
1996). NfsA of E. coli shows similarity in sequence and
biochemical properties to FRP and FRase (Zenno et al.
1998; Zenno et al. 1996b). The crystal structure of the
major oxygen-insensitive nitroreductase from E. coli
NfsA indicates that it is a homodimeric avoprotein
with one FMN as a cofactor per monomer using
NADPH for the reduction of nitroaromatic compounds
(Kobori et al. 2001).
Native PAGE analysis of NitA and NitB indicated
that they existed as oligomers (data not shown). NitA
shows similarity to E. coli NfsA major nitroreductase
and Frp, a luminescent bacterium avin reductase not
only in amino acid sequence but also in many
biochemical properties strongly suggesting a close evolutionary relationship between the E. coli-related

164

Fig. 3 ClustalW alignment of amino acid residues of NitA and

NitB with the amino acid sequences of other nitroreductases. NitB
showed 23% identity and 42% similarity to NfsA nitroreductase
from E. coli (Accession BA07425). NitA showed 35% identity and
51% similarity to NfsA nitroreductase. The similar proteins
identied included NAD(P)H nitroreductase (Accession
AAB88993) from A. fulgidus showing 32% identity to NitB and
59% similarity, NADPH nitroreductase from Methanothermobacter thermautotrophicus showing 31% identity to NitB and 58%
similarity, hypothetical oxidoreductase YcnD from Bacillus subtilis
(Accession P94424) showing 26% identity to NitB and 50%
similarity, whereas NitA showed 46% identity and 68% similarity.
NitB showed 27% identity and 47% similarity to nitro/avin
reductase from Bacillus subtilis (Accession P39605), whereas NitA

showed 40% identity and 58% similarity. NitB showed 25%

identity and 40% similarity to Cr (VI) reductase (Accession
P96977) from Pseudomonas sp. G-1, whereas NitA showed 33%
identity and 51% similarity. Putative NADH dehydrogenase/
NAD(P)H nitroreductase from A. fulgidus (Accession 030013)
showed 27% identity to NitB and 49% similarity, whereas NitA
showed 25% identity and 51% similarity. Flavin reductase P from
Vibrio harveyi (Accession Q56691) showed 34% identity and 51%
similarity to NitA and 24% identity and 43% similarity to NitB.
Asterisks indicate the residues which are fully conserved. Two dots
indicate the conservation of strong groups and single dot indicate
the conservation of weak groups. The shaded residues comprise the
putative FMN binding site, amino acids corresponding to Arg203
and Arg208 of E. coli NfsA

165

genes encoding enzymes (oxidoreductases, hydroxylaminobenzene mutase or aminomuconate deaminase)

with a putative role in the detoxication mechanism of
nitroaromatics according to the identication and
functional assignment from the sequence (Nolling et al.
2001). nitA gene is anked by epoxide hydrolase and
glycosyl hydrolase proteins, whereas nitB gene is
anked by siderophore/surfactin synthetase-related
protein and S-layer protein.
Inhibitors of nitroreductases

Fig. 4 The relative expression (lled square) of the nitroreductase

genes NitA (a) and NitB (b) of C. acetobutylicum with nitrocompounds as inducers. The gene expression was examined by Q-PCR
analysis. Total RNA was extracted from the C. acetobutylicum
cultures grown to O.D600 of 0.4 in triplicates, induced with 100 lM
of inducer compounds TNT, metronidazole (MT), nitrofurazone
(NF) and nitrofurantoin (NT). The relative expression is compared
to uninduced control. The error bars indicate the standard
deviation

oxygen-insensitive nitroreductase family and the avin

reductase family in luminescent bacterium (Koike et al.
1998). The sequence homology between the FRP/NfsA
pair is insignicant, however, there is a structural similarity in overall protein folds. The GC content of NitA
and NitB is found to be 31.8 and 36 %, respectively,
which is comparable to 36.2% of E. coli NfsA indicating
that NitA and NitB genes might have originated in
E. coli or C. acetobutylicum.
Physiological role of the nitroreductases
The physiological role of nitroreductase has not been
well established. The genes involved in similar metabolic activities are often arranged together on the
bacterial chromosome. The genes encoding P. putida
II-B and P. uorescens I-C xenobiotic reductases xenA
and xenB are anked by enzymes and/or regulatory
proteins that may function in detoxication reactions
(Blehert et al. 1999). However, the C. acetobutylicum
nitroreductase nitA and nitB genes are not anked by

Dicoumarol inhibited both the nitroreductases which is

consistent with the report of inhibition of avin reductase from Vibrio scheri and NfsA from E. coli (Zenno
et al. 1996a, 1996c;). Dicoumarol has also been shown to
be an inhibitor of diaphorase (Anlezark et al. 1992) and
menadione reductase (Tatsumi et al. 1982). The inhibitor
dicoumarol has been demonstrated to bind E. coli nitroreductase NTR by p- stacking and hydrophobic
interactions. One of the hydroxycoumarin subunits of
dicoumarol stacks above the plane of the FMN via poverlap with the alloxazine ring penetrating deep into
the groove. (Johansson et al. 2003). Chelating agents
EDTA and 1,10-phenanthroline caused no inhibition
suggesting that puried nitroreductases have no essential
metal cofactor. N-ethyl maleimide which is a sulfhydryl
agent caused inhibition of both nitroreductases. The
lack of inhibition by iodoacetamide, however, does not
support the presence of sulfhydryl groups at the active
site in both the enzymes. The inhibition caused by salicyl
hydroxamate, a nonheme iron reagent can be attributed
due to its interaction with the active site of the enzymes
(Somerville et al. 1995).
Real-time quantitative PCR
The increase in expression of the nitroreductases on
induction indicates the substrate specicity of C. acetobutylicum toward these compounds. The oxygeninsensitive NAD(P)H nitroreductase from Enterobacter
cloacae and nitroreductases NfsA and NfsB of E coli
have been reported to reduce nitrofurazone and nitrofurantoin under aerobic conditions (Bryant and DeLuca
1991; Zenno et al. 1996c). The oxygen-insensitive nitroreductase A of E. coli catalyzing the divalent reduction of nitrocompounds, quinones and dyes by NADPH
has been demonstrated to be inducible by paraquat and
is a member of the SoxRS regulon (Liochev et al. 1999)
suggesting its physiological role in defense against oxidative stress. The mRNA levels of the gene xenA
encoding xenobiotic reductase in Pseudomonas putida
were constant on the addition of 0.9 mM glycerol trinitrate (Blehert et al. 1999).
In this study the nitroreductases NitA and NitB from
C. acetobutylicum were cloned, overexpressed in E. coli
and characterized. Both the nitroreductases possess the

166

potential to transform TNT and are members of nitroreductase family proteins.

Acknowledgement This material is based upon work supported by
the U.S. Army Research Oce DOD ARMY W911NF-04-1-0179.

Reference
Anlezark GM, Melton RG, Sherwood RF, Coles B, Friedlos F,
Knox RJ (1992) The bioactivation of a 5-(aziridin-1-yl)-2,4-dinitrobenzamide (CB1954)-I. Purication and properties of a
nitroreductase enzyme from Echerichia coli-a potential enzyme
for antibody-directed enzyme prodrug therapy (ADEPT). Biochem Pharmacol 44:22892295
Angermaier L, Simon H (1983) On nitroaryl reductase activities in
several Clostridia. Hoppe Seylers Z Physiol Chem 364:16531663
Basran A, French CE, Williams RE, Nicklin S, Bruce NC (1998)
Degradation of nitrate ester and nitroaromatic explosives by
Enterobacter cloacae PB2. Biochem Soc Trans 26:680685
Blehert DS, Fox BG, Chambliss GH (1999) Cloning and sequence
analysis of two Pseudomonas avoprotein xenobiotic reductases. J Bacteriol 181:62546263
Boopathy R (1994) Transformation of nitroaromatic compounds
by a methanogenic bacterium, Methanococcus sp.(strain B)
Arch Microbiol 162:167172
Boopathy R, Manning J, Montemagno C (1994) Metabolism of
trinitrobenzene by a Pseudomonas consortium. Can J Microbiol
40:787790
Boopathy R, Kulpa CF, Wilson M (1993) Metabolism of 2,4,6trinitrotoluene (TNT) by Desulfovibrio sp. (B strain). Appl
Microbiol Biotechnol 39:270275
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantitites of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248254
Bryant C, DeLuca M (1991) Purication and characterization of an
oxygen-insensitive NAD(P)H nitroreductase from Enterobacter
cloacae. J Biol Chem 266:41194125
Bustin SA (2000) Absolute quantication of mRNA using real-time
reverse transcription polymerase. J Mol Endocrinol 25:169193
Fiorenza S, Dunston KL, Ward CH (1991) Decision making - is
bioremediation a viable option. J Hazard Mater 28:171283
Fiorella P, Spain J (1997) Transformation of 2,4,6-trinitrotoluene
by Pseudomonas pseudoalcaligenes JS52. Appl Environ Microbiol 63:20072201
Fox KM, Karplus PA (1994) Old yellow enzyme at 2 A resolution:
overall structure, ligand binding, and comparison with related
avoproteins. Structure 2:10891105
French CE, Nicklin S, Bruce NC (1998) Aerobic degradation of
2,4,6-trinitrotoluene by Enterobacter cloacae PB2 and by pentaerythritol tetranitrate reductase. Appl Environ Microbiol
64:28642868
Green EM, Boynton ZL, Harris LM, Rudolph FB, Papoutsakis
ET, Bennett GN (1996) Genetic manipulation of acid formation
pathways by gene inactivation in Clostridium acetobutylicum
ATCC 824. Microbiology 142:20792086
Groenewegen PE, Breeuwer P, van Helvoort JM, Langenho AA,
de Vries FP, de Bont JA (1992) Novel degradative pathway of
4-nitrobenzoate in Comamonas acidovorans NBA-10. J Gen
Microbiol 138:15991605
Higuchi R, Dollinger G, Walsh PS, Grith R (1992) Simultaneous
amplication and detection of specic DNA sequences. Biotechnol (NY) 10:413417
Huang S, Lindahl PA, Wang C, Bennett GN, Rudolph FB, Hughes
JB (2000) 2,4,6-Trinitrotoluene reduction by carbon monoxide
dehydrogenase from Clostridium thermoaceticum. Appl Environ
Microbiol 66:14741478
Hughes JB, Wang CY, Bhadra R, Richardson A, Bennett GN,
Rudolph F (1998) Reduction of 2,4,6-trinitrotoluene by Clostridium acetobutylicum through hydroxylamino intermediates.
Environ Toxicol Chem 17:343348

Johansson E, Parkinson GN, Denny WA, Neidle S (2003) Studies

on the nitroreductase prodrug-activating system. Crystal
structures of complexes with the inhibitor dicoumarol and dinitrobenzamide prodrugs and of the enzyme active form. J Med
Chem 11:40094020
Kalafut T, Wales ME, Rastogi VK, Naumova RP, Zaripova SK,
Wild JR (1998) Biotransformation patterns of 2,4,6-trinitrotoluene by aerobic bacteria. Curr Microbiol 36:4554
Karplus AP, Fox KM, Massey V (1995) Structure-function relations for old yellow enzyme. FASEB J. 9:15181526
Khan TA, Bhadra R, Hughes JB (1997) Anaerobic transformation
of 2,4,6-trinitrotoluene and related nitroaromatic compounds
by Clostridium acetobutylicum. J Ind Microbiol Biotechnol
18:198203
Kim HY, Song HG (2005) Purication and characterization of
NAD(P)H-dependent nitroreductase I from Klebsiella sp. C1
and enzymatic transformation of 2,4,6-trinitrotoluene. Appl
Microbiol Biotechnol Mar 24 [Epub ahead of print]
Kitts CL, Green CE, Otley RA, Alvarez MA, Unkefer PJ (2000).
Type I nitroreductases in soil enterobacteria reduce TNT
(2,4,6,-trinitrotoluene) and RDX (hexahydro-1,3,5-trinitro1,3,5-triazine). Can J Microbiol 46:278282
Kobori T, Sasaki H, Lee WC, Zenno S, Saigo K, Murphy ME,
Tanokura M (2001) Structure and site-directed mutagenesis of a
avoprotein from Escherichia coli that reduces nitrocompounds: alteration of pyridine nucleotide binding by a single
amino acid substitution. J Biol Chem 276:28162823
Kohli RM, Massey V (1998) The oxidative half-reaction of old
yellow enzyme. J Biol Chem 273:3276332770
Koike H, Sasaki H, Kobori T, Zenno S, Saigo K, Murphy ME,
Adman ET, Tanokura M (1998) 1.8 A crystal structure of the
major NAD(P)H:FMN oxidoreductase of a bioluminescent
bacterium, Vibrio scheri: overall structure, cofactor and substrate-analog binding, and comparison with related avoproteins. J Mol Biol 280:259273
Lenke H, Achtnich C, Knackmuss HJ (2000) Perspectives of bioelimination of polynitroaromatic compounds. In: Spain JC,
Hughes JB, Knackmuss HJ (eds) Biodegradation of nitroaromatic compounds and explosives. CRC Press, Boca Raton Fla,
pp 91126
Livak KJ, Schmittgen TD (2001) Analysis of Relative gene
expression data using real-time quantitative PCR and the
22DDCT method. Methods 25:402408
Liochev SI, Hausladen A, Fridovich I (1999) Nitroreductase A is
regulated as a member of the soxRS regulon of Escherichia coli.
Proc Natl Acad Sci USA 96:35373539
Matthews RG, Massey V, Sweeley CC (1975) Identication of phydroxybenzaldehyde as the ligand in the green form of old
yellow enzyme. J Biol Chem 250:92949298
Noyes R (1996) Chemical weapons destruction and explosive
waste/unexploded ordinance remediation. Noyes Publications,
New Jersey, pp 102141
Nishino SF, Spain JC (1993) Degradation of nitrobenzene by a
Pseudomonas pseudoalcaligenes. Appl Environ Microbiology
59:25202525
Nolling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q,
Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI,
Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P,
Daly MJ, Bennett GN, Koonin EV, Smith DR (2001) Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol
183:48234838
Padda RS, Wang C, Hughes JB, Kutty R, Bennett GN (2003)
Mutagenicity of nitroaromatic degradation compounds. Environ Toxicol Chem 22:22932297
Rau J, Stolz A (2003) Oxygen-insensitive nitroreductases NfsA and
NfsB of Escherichia coli function under anaerobic conditions as
lawsone-dependent Azo reductases. Appl Environ Microbiol
69:34483455
Rai F, Cerniglia CE (1993) Comparison of the azoreductase and
nitroreductase from Clostridium perfringens. Appl Environ
Microbiol 59:17311734

167
Rieger PG, Knackmuss HJ (1995) Basic knowledge and perspectives on biodegradation of 2,4,6-trinitrotoluene and related nitroaromatic compounds in contaminated soil. In: Spain JC (ed)
Biodegradation of nitroaromatic compounds. vol 49. Plenum,
New York, pp 118
Schopfer LM, Massey V (1991) A study of enzymes, mechanisms of
enzyme action. In: Kuby SA (ed) Old yellow enzyme. CRC,
Boca Raton, pp 247269
Somerville CC, Nishino SF, Spain JC (1995) Purication and
characterization of nitrobenzene nitroreductase from Pseudomonas pseudoalcaligenes JS45. J Bacteriol 177:38373842
Spain JC (1995) Biodegradation of nitroaromatic compounds
Annu Rev Microbiol 49:523555
Spain JC, Hughes JB, Knackmuss HJ (ed) (2000) Biodegradation
of nitroaromatic compounds and explosives. Lewis Publishers,
Boca Raton, pp 91126
Tan EL, Ho CH, Griest WH, Tyndall RL (1992) Mutagenicity of
trinitrotoluene and its metabolites formed during composting.
J Toxicol Environ Health 36:165175
Tanner JJ, Lei B, Tu SC, Krause KL (1996) Flavin reductase P:
structure of a dimeric enzyme that reduces avin. Biochemistry
35:1353113539
Tatsumi K, Doi T, Yoshimura H, Koga H, Horiuchi T (1982)
Oxygen-insensitive nitrofuran reductases in Salmonella typhimurium TA 100. J. Pharm Dyn 5:423429
Watrous MW, Clark S, Kutty R, Huang S, Rudolph FB, Hughes
JB, Bennett GN (2003) 2,4,6-Trinitrotoluene reduction by an
Fe-only hydrogenase in Clostridium acetobutylicum. Appl
Environ Microbiol 69:15421547

Won WD, DiSalvo LH, Ng J (1976) Toxicity and mutagenicity of

2,4,6-trinitrotoluene and its microbial metabolites. Appl Environ Microbiol 31:576580
Williams RE, Rathbone DA, Scrutton NS, Bruce NC (2004) Biotransformation of explosives by the old yellow enzyme family of
avoproteins. Appl Environ Microbiol 70:3566357
Yin H, Wood TK, Smet BF (2005) Reductive transformation of
TNT by Escherichia coli:pathway description. Appl Microbiol
Biotechnol 67:397404
Zenno ST, Kobori T, Tanokura M, Saigo K (1998) Conversion of
NfsA, the major Escherichia coli nitroreductase, to a avin
reductase with an activity similar to that of Frp, a avin
reductase in Vibrio harveyi, by a single amino acid substitution.
J Bacteriol 180:422425
Zenno S, Koike H, Kumar AN, Jayaraman R, Tanokura M, Saigo
K (1996a) Biochemical characterization of NfsA, the Escherichia coli major nitroreductase exhibiting a high amino acid
sequence homology to Frp, a Vibrio harveyi avin oxidoreductase. J Bacteriol 178:45084514
Zenno S, Koike H, Tanokura M, Saigo K (1996b) Gene cloning,
purication, and characterization of NfsB, a minor oxygeninsensitive nitroreductase from Escherichia coli, similar in biochemical properties to FRase I, the major avin reductase in
Vibrio scheri. J Biochem (Tokyo) 120:736744
Zenno S, Koike H, Tanokura M, Saigo K (1996c) Conversion of
NfsB, a minor Escherichia coli nitroreductase, to a avin
reductase similar in biochemical properties to FRase I, the
major avin reductase in Vibrio scheri, by a single amino acid
substitution. J Bacteriol 178:47314733