You are on page 1of 317

STEVE JONES

A
vrnkben
van
Fordtotta
Kada Jlia
STEVE JONES

A
vrnkben
van
Amirl a gnek meslnek

'

Officina Nova
A fordts az albbi kiads alapjn kszlt:
Steve Jones: ln the Blood. God, Genes and Destiny
HarperCollins Publishers, 1996
Copyright Steve Jones, 1996.
Originally published in English by HarperCollins Publishers Ltd.
The Author asserts the moral right to be identified
as the Author of this work."

Hungarian translation Kada Jlia, 1998

OFFICINA NOVA KNYVEK

Magyar Knyvklub, Budapest, 1998


Felels kiad Breitner Mikls igazgat
Irodalmi vezet Ambrus va
Felels szerkeszt Greguss Ferenc
Mszaki vezet Szilassy Jnos
A bortt tervezte Ghyczy Gyrgy
Mszaki szerkeszt Szedlk Gyrgy
Szedte a Jet Set Tipogrfiai Mhely
Nyomta a Kner Nyomda Rt.,
Drer Nyomda s Kiad Kft., Gyula
Megjelent 28,2 (A/5) v terjedelemben

ISBN 963 548 575 1


TARTALOM

ELsz: Isten, a gnek meg a sors

BEVEZET: A vrnkben van 3

I.: Armageddon ellentmondsa 37

II.: Nemek s adk 83

III.: Az elveszett trzsek 124

IV.: A br alatt a llek 168

V.: Eredend bn 207

VI.: Hall vagy feltmads 243

'
ELSZ

Isten, a gnek meg a sors

Mert nem vr s test ellen van nknk


tusakodsunk, hanem a fejedelemsgek ellen,
a hatalmassgok ellen, ez let sttsgnek
vilgbri ellen, a gonoszsg lelkei ellen,
melyek a magassgban vannak.

PL LEVELE AZ EFZUSBELIEKHEZ 6:12

Ez A KNYV Hitler rasztalnl kszlt. Termszetesen nem az eredeti da


rabnl- azt senki sem ltta, mita 1945-ben az oroszok kezre kerlt-, ha
nem egy msolatnl, sznpadi kellknl, amelyet olcsn meg lehetett kap
ni, mikor a msodik vilghbor elzmnyeirl szl darab lekerlt a m
sorrl. A ltogatknak kiss knos magyarzattal szolglni felle, de tbb
mint kt s fl ngyzetmteres lapja kitnen megrakhat knyvekkel,
vagy akr kllel verhet a kudarc pillanataiban.
Sokan taln gy vlik, egy genetikus jobbat nem is kvnhat, ha elkpze
lseit paprra akarja vetni. Az ember rkltt tulajdonsgai s a nci ideo
lgia kapcsolata kzismert: az eugenika, az emberi faj biolgiai eszkzk
kel trtn nemestse mindig kzel llt a politikai szlssgekhez, jobb
s baloldaliakhoz egyarnt. Sokan szvesen hasznljk fel a genetika mlt
jt, hogy lejrassk a jvre vonatkoz terveit. Amelyek egybknt - a
megtervezett csecsemk, az eugenikus sterilizls, a faji besorols- inkbb
csak az ellenzk kpzeletnek mvei, a valsghoz nem sok kzk van. Az
rkls szakemberei jobbra ismerik kutatsi terletk hatrait, s flsle
gesnek tartjk, hogy megvdjk trgyukat az idejtmlt vdaskodstl.
A genetika, akrcsak Nmetorszg, vgre eljutott odig, hogy felhagyjon'a
mentegetzssel mltja miatt.
m szembe kell nznie egy ravaszabb veszllyel: a realitsokat messze
meghalad vrakozsokkal. A tudomnyos-fantasztikus mfaj egyik nagy
pillanata, amikor Flash Gordon az idegen lnyek ell meneklve kinyitja
rhajja kaznjt, s odakiablja a legnysgnek: Rakjatok r tbb
urnt!" Az 1950-es vekben az urnt csodkra tartottk kpesnek, s az r-

vu
A VRNKBEN VAN

utazs mr a kszbn llt. Nyilvnvalnak ltszott, hogy az rhajk a


Skciba tart gyorsvonat, a Flying Scotsman javtott vltozatai lesznek.
Manapsg hasonl a helyzet a gnekkel: az emberi szervezet DNS-alap, az
emberek trsadalmi s orvosi problmkkal kszkdnek, ergo, ha a DNS-t
megrtjk, a problmk rvidesen megolddnak.
A vrnkben van cm azon a szles krben elterjedt meggyzdsen ala
pul, hogy vgzetnk velnk szletett. Maga a natra kifejezs a latin natus,
azaz szletett szbl szrmazik, s ugyanez a nci gykere is. A vr latin
sanguis szavbl ered a vrmes, szangvinikus, az angol sanguis kifejezs je
lentse pedig magabiztos, remnyteli.
A mai napig elevenen l az elkpzels, hogy ltnk alapja a biolgia - a
vr. Biolgiai krds", hogy valaki mennyire szeretne angol sznekben jt
szani: az zsiaiakbl meg a ngerekbl hinyzik a fehrek bszke azono
sulsa Anglival" - bizonygatja a Wisden Cricketers' Almanack egyik i995-
ben megjelent cikke. Az rs cme: A vrnkben van?" Egyre inkbb a g
neket teszik felelss a sorsunkrt mg azok is, akik nem foglalkoznak nyl
tan a faji krdssel. Mind valsznbbnek ltszik, hogy hallunk be van
programozva ltezsnkbe. Az embert a gnek lik meg; e knyv olvasi
nak ktharmada rkltt tulajdonsgaira visszavezethet okokbl fog
meghalni. Hamarosan eljutunk odig, hogy a csecsem hallnak valsz
n idpontjt rviddel a szletse utn meg tudjk mondani. A fertz
betegsgeket taln mr legyztk, de vajon sikerl-e valaha rr lenni a
velnk szletett betegsgeken?
Sokak szemben mindez az emberi nllsgot veszlyezteti. Ha min
den bele van kdolva a DNS-be, mi marad a szabad akaratnak? Ha az em
ber csak egy megdicslt majom, akkor hol a llek? s ha a trsadalom
vgeredmnyben a gnek trktsnek biztostsra szolgl mechaniz
mus, hol a helye a jnak meg a rossznak? Mg azokat is nyugtalantja, hogy
a biolgia minden misztriumtl megfosztja az letnket, akik egybknt
nem sokat bajldnak effle elvont okoskodssal.
A genetika, mivel gyakran vrjk tle a tansgttelt a hiedelmekrl,
hogy mit jelent embernek lenni, a legtbb tudomnynl kzelebb ll az er
klcsi s vallsi elmletekhez. A Biblia, a Tra s a Korn mind a ltezst
meghatroz szablyokat kutatja: a teremtst, az rkldst, az ember he
lyt a termszetben, a jt, a gonoszt, a sorsot s a megvltst. Az testa
mentum volt a legels genetikai szveg. Nagyrszt a kivlaszts dokumen
tuma: arrl szl, ki tartozik a vlasztottak kz. A mindenkit egymshoz
fz rokonsg, a kzs emberisg gondolata csak az jtestamentumban
jelenik meg. A legtbb vallsos rshoz hasonlan ez a kett is a trsada-

Vlll
ELSZ

Lelkest kp i930-bl,
amikor a tudomny mg DNLY HEALTHY SEED
M U S T .8 E S 0 W N !
egyszernek ltswtt:
a fajnemest mozgalom -
az eugenika - jvszemllete.
(Felirat: Csak egszsges
magot ltess! Fojts el
-

csrjban minden rkltt


betegsget s gyengesget,
lgy fajnemest)

lom szablyozsnak trvnyknyve. Egyeseket alacsonyrendnek nyilv


ntanak, msokat uralkodsra szletettnek. Az emberi tulajdonsgokat a
bibliai idkben, akrcsak ma, velnk szletettnek s befolysolhatatlannak
tartottk. Azokon az si fldeken az r a vrsgi kapcsolat volt, amely a
mai napig megrizte jelentsgt, hiba tartjuk olyan tolernsnak sajt ko
runkat.
Manapsg, amikor hrom s fl milli amerikai vallja magrl, hogy va
lamikor idegen lnyek fogsgba esett, s mg sokkal tbben hisznek ab
ban, hogy Mzes knyve a teremtsrl szrl szra igaz, ezek a dolgok
sszer magyarzatot ignyelnek. De amikor a tudomny megprbl el
llni vele, idegenked rdekldssel fogadjk; ugyanilyen vegyes rzelmek
kel viseltetnek sokan a valls irnt. Minden tudomny, amely rsznja ma
gt, hogy legalbb a sajt korltozott lehetsgeinek megfelelen megma-

lX
A VRNKBEN VAN

gyarzza a vilgot, szksgszeren sszetkzsbe kerl azokkal, akik sz


vesebben alapozzk meggyzdsket hitre, mintsem bizonytkokra.
A tudomny s a valls mindig is vitban llt. Mi tagads, a vitt rend
szerint az utbbinak a mveli kezdemnyeztk (akik ltalban rdeke
sebbnek talljk a tudomnyt, mint a tudsok a teolgit). Hborjuk leg
inkbb a cpa s a tigris kzdelmre hasonlt. Sajt terletn mindkett le
gyzhetetlen: de ha valamelyik az ellenfl birodalmba tved, semmi sem
vja meg a veresgtl. Mindazonltal a tigris is, a cpa is nyilvn tklete
sen sszernek tallja a mdot, ahogyan krnyezett uralja. A tudatlansg
termszetfltti magyarzatra szorul tengere ma kisebb, mint valaha, de
senki sem tudja, mikor szrad ki, ha egyltaln kiszrad. A hit s szkepti
cizmus vitja mg sokig eltart.
Br a valls dolgait illeten ppolyan mkedvel vagyok, mint legtbb
kollgm, gy ltom, rdemes szemgyre venni a ltezs alternatv magya
rzatait, ha msrt nem, ht azrt, hogy a prhuzamokra rmutassunk.
Mivel a teolgia s a genetika hasonl krdseket vet fel, A vrnkben van
lazn ugyan, de bibliai tmk kr szervezdik: dm s va, az eredend
bn, Izrael npnek kizetse, a feltmads, a npek csatja, az utols tlet
s msok kr. Ilyen mdon rendkvl gyorsan eljutunk a teremtstl a
DNS-ig. Br az si krdsekre vlaszt ma sem tallunk, legalbb j mdon
tudjuk fltenni ket.
Az eljrs sorn a biolgia olyan helyzetben van, mint 1858-ban, amikor
Charles Darwin s Alfred Russel Wallace ismertette a termszetes kivlasz
tds evolcis elmlett a londoni Linn Trsasgban. A gondolat, hogy a
fajok - a sajtunkat is belertve - nem vltozatlanok, hanem talakulhat
nak egymsba, nagy felhborodst vltott ki vallsi krkben. gy lt
szott, veszlyezteti az emberisg pratlan helyzett, s semmiv teszi Isten
s ember kapcsolatt. A darwinizmus hamarosan szinte j vallss ntte ki
magt, legalbbis lelkes hvei szemben: olyan rendszer volt, amelynek r
vn igazolhat, st szervezhet a trsadalmi rend. Az evolci beleszv
dtt a tizenkilencedik szzad szellemi letbe, s senki sem mondhatta
magt mvelt embernek, aki nem ismerte legalbb felletesen.
Szzadunkban a genetiknak sikerlt nagyjbl ugyanez. gyesen adta
el magt a nagykznsgnek, amely boldogan fizeti a szmlt. Egy 1976-os
felmrs megllaptotta, hogy az angol egyetemi hallgatk egyharmada
soha letben nem hallott a DNS-rl, s ktszer ennyinek fogalma sincs a
ketts spirlrl. m egy tizenkt vvel ksbbi felmrs sorn mr a meg
krdezettek nyolcvan szzalka vlaszolni tudott egszen bonyolult krd
sekre az rkldssel kapcsolatban - holott ktharmaduk mg mindig azt

x
ELSZ

hitte, hogy a radioaktv tej forralssal rtalmatlann tehet. A genetikusok


kitnen megtantottk a trsadalmat, mire kpes a tudomnyuk. Semmi
ktsg, ltvnyos sikereket rtek el. Hsz vvel ezeltt alig szz gn helyt
hatroztk meg az emberi kromoszmkon. Mra krlbell negyvenezer
kerlt a helyre a huszonhrom kromoszmapr mentn.
Arrl azonban mr kevesebb sz esett, hogy mivel maradt ads a tudo
mnyuk. A nagykznsg krben tz kzl csak egy ember fogadn szve
sen a gnmanipulcit egy gyermek intelligencijnak nvelse vagy a ho
moszexualitsi hajlam eslynek cskkentse cljbl (egybknt ugyan
ennyien ltnnak szvesen egy vizsglatot, amely lehetv tenn a homo
szexualitsra hajlamos embrik abortuszt). Ezek az ambcik, tekintet

Egy a szmtalan gnyrajz kzl Darwinrl: a kp, amely a Punch egyik korabeli szmban je
lent meg, a tizenkilencedik szzad optimista nzett illusztrlja, mely szerint az evolcival
egytt jr a fejlds. (Felirat: Az ember csak freg.)

MA.N l.SBVTAWOR.._ --

Xl
A VRNKBEN VAN

Benjamin Watcrhouse-nak, a londoni Termszettudomnyi Mzeum pitsznek illusztr


cija Charles Danvin Az ember szrmazsa m munkjhoz.

nlkl erklcsi tartalmukra, tudomnyos rtelemben merben sszertle


nek. Br annak igen fejlett a technolgija, hogy a DNS-bc betit sor
rendbe rakjuk, arrl, hogy legnagyobb rszk milyen feladatot lt el, sem
mit sem tudunk. gy tnik, a mkd gnek az rtelem ozisait jelentik az
rtelmetlensg sivatagban, az rkltt anyag nagy rsznek ugyanis nincs
lthat funkcija.
A genetika jelenleg ott tart, ahol egy j videomagn bszke tulajdonosa,
aki a hasznlati utastst szeretn megfejteni. Nagy bnatra a fele hiny
zik, a tbbi pedig mer zagyvasg. S ami mg nagyobb baj, japnul van; a
szavakat felismeri, de itt megll a tudomnya. Mg az rt is csak prbl
gatssal kpes belltani, mintha ki se nyitotta volna a hasznlati utastst
Ha pedig elromlik s javtsra szorul a gp, a baj mg nagyobb. A hasz
nlati utasts nem segt, mert szinte semmit sem rul el arrl, hogyan
mkdik ez a nyilvnvalan nagyszer berendezs. A srlt DNS kicser
lst rgta grik. Az els hrek az ttrsrl tbb mint egy vtizede lt
tak napvilgot. f:s i996-ban mg egyetlen esetrl sem tudunk, amikor a
kezels sikere egyrtelmen a gnterpinak volt ksznhet. A lelkesen

Xll
ELSZ

beharangozott eredmnyekbl semmi sem lett, s a jelek szerint nem is


lesz egyhamar.
A nagykznsg mgis soha nem ltott rdekldssel fordul a genetika
fel, mghozz olyan okokbl, amelyeknek kevs kzk van az egszsg
mindennapi problmihoz. Az 1960-as vekben httrbe szorult a biol
giailag meghatrozott vgzet gondolata. Eddig mindenki tbb-kevsb
szabad szellem volt, nem nygztk a szlets korltai. De a fggetlensg
rvid korszaka lezrult. Megint kszsgesen tudomsul vesszk, hogy az
letet a biolgia szabja meg. Akik rgta cfoljk, hogy az emberi ltezs
rl sokat elrulnak a gnek, azok is elismerik (gyakran kelletlenl), hogy
az rkletes anyag legalbbis kijelli a hatrokat, melyek kzt lni lehet.
Senki sem vitatja, hogy a trsadalmi helyzet rkldik: azok kzl,
akiknek az apja szerepel a Ki kicsodban, minden tdik maga is bekerl a
knyvbe, a npessg tlagbl azonban csak minden ezertszzadik. Az
rklds fontossgnak nhny lelkes szszlja gy vli, ez a DNS-be
van kdolva. Cambridge-ben William Bateson volt a genetika els pro
fesszora. Azt vallotta, hogy az rklds a trsadalmi rend kzponti t
nyezje. A trsadalmi reformok eszmnye semmikpp sem lehet az osz
tlyok eltrlse, hanem annak biztostsa, hogy lehetsg szerint minden
ki a neki megfelel osztlyba kerljn s ott megmaradjon, akrcsak ut
na rendszerint a gyermekei" - rta i912-ben kzreadott Biological Fact and
the Structure of Society (A biolgiai tnyek s a trsadalom szerkezete) c
m knyvben. Nyolcvan vvel ksbb egy amerikai kutat egyetrtett

vele: Az amerikai gazdasgban a siker vagy kudarc egyre inkbb azon ll


vagy bukik, hogy valaki milyen gneket rkl. . . Ezen nem sokat vltoz
tathatnak a htrnyos helyzetek lehetsgeinek kibvtst clz prog
ramok" - nyilatkoztatta ki Charles Murray, a Harvard professzora, akinek
i994-es sikerknyve, a The Bell Curve (A Bell-grblet) utalt r, hogy a bi
olgiailag htrnyos helyzet alsbb osztly mr kialakult.
Mg az is elfordul, hogy a DNS tehernek, a tkletlensg hordozjnak
minsl. Lassan ez lesz a vgs fellebbezsi frum. i994-ben egy gyilkos
sggal vdolt amerikai fiatalember perben a vdelem jszer stratgit
dolgozott ki, hogy megmentse gyfelt a villamosszktl. Kegyelmi kr
vnyben a vdlott lltlagos veleszletett kegyetlenkedsi hajlamra hi
vatkozott: Nem hibztatnak egy vakot, amirt nem tudja elolvasni az t
jelz tblkat, nem hibztatnak egy sketet, amirt nem hallja, amit mon
danak neki .. . s ha van egy biokmiai alap .. . ez nem igazolja a bncselek
mnyt, de cskkenti a felelssget." A sajt, mint ez elre lthat volt, fel
hborodott.

Xlll
A VRNKBEN VAN

Msok szerint mr el is jtt az id, amikor az rkltt rendellenessg


ben szenvedket hallra tlik. II. Jnos Pl ppa szerint a genetikai szrs
szges ellenttben ll az erklcsi trvnyekkel, ha clja az eredmnytl
fgg esetleges abortusz. A testi hibt vagy rkltt betegsget megllap
t diagnzis nem lehet egyenl a hallos tlettel." Knban viszont az
i995-s Anya- s Gyermekgondozsi Trvny ktelezv teszi a magzat
vizsglatt, amelyet a terhessg megszaktsa kvet, amennyiben rendelle
nessget tallnak. .
Kizrlag az emberre jellemz a gondolat, hogy a halottak tovbb lnek,
s trvnyeket szabnak az lknek. Egyetlen llat sem ismer a szleitl ta
nultaknl gazdagabb hagyomnyt vagy a sajt csaldjnl sokkal tgabb
trsadalmi berendezkedst. A mi szemnkben azonban a mlt mindig
rsze volt a jelennek. A gnek letre keltik a mltat. Megmutatjk, hogy
minden csaldot s minden nemzetet a rokonsg lthatatlan hlja fz
egybe. A nacionalistknak csak a vrkzssg szmt: nzetk szerint a
trtnelem az gyban kszl. Eszmik prbja a biolgia, amely rendsze
rint rjuk cfol.
A DNS-ben benne foglaltatik a faj - s az emberisg - trtnelme is.
A csimpnzok gytrelmesen s bosszantan emberiek", llaptotta meg
Viktria kirlyn, amikor elszr ltogatott el a londoni llatkertbe. Vajon
hogyan fogadta volna a felfedezst, hogy biolgiai llomnyunk kilenc
vennyolc szzalka kzs velk, s mr semmi jogcmnk sincs arra, hogy
valamifle biolgiai cscsra helyezzk magunkat, ahol egyetlen ms te
remtmnynek sincs helye? s hogyan birkzott volna meg a gondolattal,
hogy az eurpai npek kzt sokkal kisebb a klnbsg, mint azok kzt az
egyms szomszdsgban l afrikai trzsek kzt, amelyeket az gyarmati
kzigazgatsnak egyetlen tisztviselje tart felgyelete alatt? Az evolci
elmlete s az rklds termszetnek megrtse egyttesen j megvil
gtsba helyezi a npcsoportok rkltt felsbb- vagy alsbbrendsgrl
alkotott nzeteket.
Mindez taln riasztnak ltszik. Lehetsges, hogy a genetika - amint sok
amatr lltja - valban olyan kzel jutott a politikai, st erklcsi krd
sekhez, hogy az mr veszlyezteti a termszeti s szellemi dolgok kapcsola
tt. De tanulhatunk valamit a mltbl, amikor a darwinizmusban lttak
hasonl veszlyt. Mgpedig azt, milyen vgtelen az ember kpessge arra,
hogy semmin se csodlkozzk. Mindssze harminct vvel a Darwin
Wallace-elads eltt a dl-walesi Gower-flsziget egy barlangjban meg
talltk az els emberi maradvnyknt azonostott skori leletet. Felfede
zjt, William Bucklandet (aki Oxfordban volt a geolgia professzora)

XIV
ELSZ

WI

DAi

Jelenet az 1960-ban kszlt Aki szelet vet cm filmbl, amely (nagy vonalakban) a Ten
nessee llambeli Daytonban 1925-ben megtartott Scopes-per esemnyeit dolgozza fel. John
T. Scopest azzal vdoltk, hogy megszegte a Butler-trvnyt (amelyet 1967-ig nem helyeztek
hatlyon kvl); ez a trvny megtiltotta az llami iskolkban az evolcis elmlet tantst,
mivel ellentmond a Bibliban olvashat teremtsmagyarzatnak. A majomper (ahogy ak
koriban neveztk) arrl vlt hress, hogy a kivl gyvd, Clarence Darrow megtmadta a
trvnyt mint alkotmnyellenest, s William Jennings Bryan korbbi klgyminiszter cs
fos kudarcot vallott, amikor vitba szllt vele. Scopest eltltk, s 100 dollr brsg fizetsre
kteleztk, m a Fellebbviteli Brsg megvltoztatta az tletet. 1996-ban ugyanebben az l
lamban a trvnyhozs megtiltja, hogy tnyknt" tantsk az evolcit, s ne puszta elm
let" gyannt.

meghkkentette a lelet rgisge. A pavilandi vrs hlgy" (ahogyan ok


kerfoltos csontjai utn neveztk) nyilvn mrhetetlenl rgi, gondolta -
taln mg Britannia rmai hdoltsgriak idejbl val. Bucklandet, aki
hitt a bibliai znvzben, ennl messzebbre nem vitte vissza a kpzelete.
A nagykznsget sem.
Ma mr tudjuk, hogy a pavilandi lelet (egy frfi maradvnya, nem egy
n) kora nem ktezer, hanem huszontezer v; kevss klnbzik t
lnk, s a modern felfogs szerint halla ta alig egy perc telt el az evolci
s idbl. Angliban a legrgibb lelet szerinti sember (az i994ben felfe-

xv
A VRNKBEN VAN

dezett Boxgrove-i ember) flmilli vvel ezeltt lt, s felismerheten a


mai britek biolgiai eldje volt. A nagykznsg kzmbsen fogadta a
felfedezst, mindssze egy pillanatra lobbant fel a nemzeti bszkesg, ami
rt haznk a legsibb eurpai ember hona (ennek is hamar vget vetett egy
hromszzezer vvel korbbi spanyol s flfedezse). Az evolcis elmlet
ma mr kznapi dolog, szinte senki sem vitatja, akinek egyltaln eszbe
jut. Nem veszlyezteti sem a filozfit, sem a vallst, brmennyire fltettk
tle mindkettt a Viktria kori emberek. Csak egy jabb tny, amelyet Is
ten nagy tervbe illeszthet, akinek kedve tartja.
A drwinizmus ltalnos trhdtsbl mg egy tanulsgot levonhat
mindenki, aki nagyon sokat vr a tudomnytl. Azok, akik flnek a biol
gitl, s azok, akik megvltst remlnek tle, egyarnt meg vannak gy
zdve arrl, hogy e tudomnygnak mdjban ll igazolnia vagy megc
folnia az emberi llapotrl kialaktott elkpzelseket. Holott a tudomny
nem trekszik erre, s nem is kpes r. Meghisult minden erfeszts a
trsadalom tudomnyos alapon trtn megszervezsre (pedig volt pp
elg). pp ilyen hibaval igyekezet erklcsi trvnyekkel szablyozni,
hogy mit mondhat a tudomny, amint ezt az evolci tanainak visszaszo
rtsra irnyul ksrletek pldja is mutatja.
Az ilyesfajta erfesztsek a tudomny illetkessgre vonatkoz tvkp
zetekbl erednek. A tudomny lnyegben az emberi viszonyokon tli ma
gyarzatokat keresi. A fajok eredete cmoldaln egy idzet ll William
Whewelltl, a termszettuds" sz feltalljtl: Ami pedig az anyagi vi
lgot illeti, annyit mindenesetre szrevehetnk, hogy az esemnyeket az is
teni hatalom nem gy hozza ltre, hogy minden egyes esetben kln-k
ln beavatkozik a dolgokba, hanem gy, hogy ltalnos trvnyeket szab."
Ezek a trvnyek tlmennek a mi morlis s etikai megfontolsainkon a
termszetben elfoglalt helynket illeten. Vagyis a termszettudomnyban
nem rhetjk be azzal, hogy si szvegekben vagy akr a modern filoz
fiban kutatunk a megoldsok utn: objektv vizsglat sorn kell olyan
szablyokat keresnnk, melyek minden teremtmnyre rvnyesek, akr
ember, akr nem. Mivel az etikai meggyzds maga is emberi alkots,
nem tanulmnyozhat ilyen mdon. Hiba fznek hozz nagy remnye
ket azok, akik a biolgitl remlnek megvltst, a ketts spirlnak nincs
erklcsi tartalma.
A Linn T rsasg szkhelye most is ott van, ahol Darwin s Wallace is
mertette elgondolst. A Burlington House-t manapsg inkbb a biolgu
sok s geolgusok trsasgval kzs pletben tallhat Kirlyi Akad
mia otthonaknt tartjk szmon. A hz i665-ben plt, s Burlington

XVl
ELSZ

earljnek rezidencija volt.A Piccadillyn ll, mely akkoriban London egyik


legdivatosabb rsznek szmtott a Westminster-aptsg s a St. James-pa
lota szomszdsgban. A krnyk jelenleg inkbb az olyan e vilgi intz
mnyekrl hres, mint a Ritz Szll vagy a Fortnum s Mason ruhz.
London egyik klnlegessgt az utcanevek jelentik (Jones trtnetesen
csak egy van kztk: jelentktelen kis mellkutca, a Berkeley. trrl nyl
Jones kz). A Piccadilly azonban egyedlllan furcsa nv. Vajon mit je
lenthet? Ha fellapozunk egy tiknyvet, olyan vlaszt tallunk, amely jelle
gben kzel ll azokhoz, akik rmmel elfogadjk az emberi llapot meta
fizikai magyarzatait. A sugrutat egy bizonyos Higgins nev szabrl"
neveztk el, aki az els hzat pttette itt, s aki vagyona nagy rszt a
Pickadilleknek, az akkoriban Anglia-szerte divatos gallroknak kszn
hette". s az tiknyv mr t is tr a kvetkez utcra; magyarzatnak
ennyi elg. A problma megoldshoz, legalbbis a turista kvncsisgnak
megfelel szinten, az is elg, ha rszletesebben kifejtjk.
Csakhogy gy ppen az rdekes krds marad figyelmen kvl. Mirt
hvtak egyltaln pickadillnek egy gallrt? Errl sajnos hallgat a knyv.N
rni sztrbngszs utn kiderl, milyen sokat vesztettnk. A hres gall
rok finoman ttrt, klnleges szabs darabok voltak. Spanyolorszgbl
kerltek t Angliba; a picado spanyolul szrst, tdfst jelent - ugyanez a
gykr tallhat a pikk, pikns s a kar jelents picket szban. A picado
viszont a latin pica szbl szrmazik, amely az les s hegyes dolgokat je
llte, pldul a madr csrt (ezt a latin nevet adta Linn annak a szarka
pldnynak, mely ma egy ketrecben lthat a Burlington House-ban). Tu
lajdonkppen nem lehet befejezni; mg egy londoni utcanv felletes vizs
glata is a nyelv eredetre vonatkoz behat kutatshoz vezet.
Ez a termszettudomny ismertetjele. Ezrt szges ellentte mindenf
le hitbl tpllkoz meggyzdsnek: a vizsgldsnak nincs hatra, a
magyarzat sohasem teljes. A tudomny abban klnbzik a vallstl,
hogy a legmagasabb tekintlyre val hivatkozssal sem ri be. Remlem,
hogy - legalbbis ami a genetikt illeti - sikerlt rzkeltetnem az ellent
tet a knyvnkben elfordul ktfle magyarzattpus kztt.
A knyv a BBC Vrvonal cm tvsorozathoz kapcsoldik (br na
gyobb terletet fog t, mint a sorozat: egy sz ezer filrnkockval flr). So
hasem kszlhetett volna el a munkban rszt vev BBC-munkatrsak, el
ssorban a producerek, Robin Brightwell, Chris Hale, Tessa Livingstone s
Dana Purvis szakrtelme s elktelezettsge nlkl. Judith Bunting s Ro
salind Arden valsgos mestere lett annak, hogy meglep trtneteket
hzzon ki a legvalszntlenebb emberekbl, s sikerlt minden vrako-

XVll
A VRNKBEN VAN

zsomat fellmlan elkpeszt hiedelmeket felkutatniuk a gnekrl,


skrl s sorsrl. Ebben a munkban dnt szerepe volt Lucinda Jarrett
nek is, aki tretlen energival s lelkesedssel dolgozott a vilg knyelem
ben szegny vidkein.
Sokan olvastak rszleteket a kziratbl: Neil Bradman, Norman Cantor
professzor, dr. David Cesarani, Andrew Cottom, John Griffith professzor,
Christopher Huhne, dr. Laurence Hurst, Andrew Huxley, Philip Gwyn
Jones, a HarperCollins munkatrsa, Marek Kohn, Brian Lapping, Michael
Morgan, Linda Partridge s Norma Percy. Mindannyian szrevettek egy
kt trgyi vagy rtelmezsbeli tvedst: nhny hiba ktsgtelenl maradt
a szvegben, szoks szerint s teljes mrtkben az n hibmbl. A kp
anyagot Frances Abraham lltotta ssze. Ksznettel tartozom neki, ami
rt a termszettudomny oly sok mvszi illusztrcijt sta el. A terve
z, Philip Lewis a maga jogn szpsges trgyat hozott ltre. Vgl ksz
netet kell mondanom kollgimnak a londoni University College-ban,
akik tartottk a frontot (fizetetlen) szabadsgom alatt, amg az angol egye
temi rendszer csndben hanyatlott tovbb.
Nem tpllok illzikat, hogy ez a knyv majd megvltoztatja brkinek
a felfogst az let rtelmrl. Nem is ebben a remnyben rdott. A tudo
mnynak s a vallsnak vgs soron nem sok kze van egymshoz. i529-
ben a bzeli kprombolk a reformci hevben, hitk tteleinek prbja
knt tudomnyos ksrletet vgeztek. Nekitmadtak egy faragott Krisztus
nak, s azt kiabltk: Ha Isten vagy, vdd meg magad: ha ember vagy, v
rezz!" A szobor mindkettvel ads maradt. m a tudsokkal ellenttben a
hvk nem gondoltak arra, hogy taln tvednek. Isten igenis ltezett; csak
kpmsai voltak hamisak. gy viselkedtek, mint a mai teolgusok, amikor
j, knyelmetlen igazsgokkal talljk szemben magukat: mondhat a tu
domny, amit akar, Isten akkor is ltezik. A problmk, amelyeket ebben a
knyvben vizsglunk, ktsgtelenl beilleszthetk brmely hitrendszerbe.
A modern genetika tnyei azonban olyan rdekesek, hogy szgyenkezs
nlkl megllnak mellkszempontok nlkl is; fggetlenl azoknak a vle
mnytl, akik tanulmnyozzk ket.

XVlll
A VRNKBEN VAN

'
BEVEZET

A vrnkben van

A te atydfinak vre kilt n hozzm a fldrl."

MZES I. 4,10

A VR EGSZEN FURCSA NEDV. Goethe, aki megfogalmazta ezt a tmr


mondatot (nmetl mg jobban hangzik), ezttal nem tudsknt beszlt
br az is elfordult nha -, hanem kltknt. Faust pp megkttte az al
kut. Eladta lelkt az rdgnek egy tudsban s hatalomban gazdag letrt,
melyben a dmont szolglja, s radsul remnye van a halhatatlansgra is.
Mefiszt, jl ismervn az zletktsek termszett, arra kri, hogy vrvel
rja al a szerzdst. Br, pergamen, mrvny vagy rc; vs, rvessz vagy
toll nem elg. Csak a vr felel meg.
A szerzds szntelenl ksrti Faustot, mert gy rzi, elkerlhetetlen
vgzet szabja meg sorst. Goethe hse beletrdik, hogy elbb-utbb a
pokol tzre jut: gy kell fizetnie, amirt engedett sajt termszetnek.
A vr azta sokkal klnsebb nedvnek bizonyult, mint Goethe valaha
_
is gondolhatta. m a vrrel rt szerzds manapsg mr puszta jelkp.

Faust sajt vrvel rja


al a Mefisztval kttt
szerzdst.

3
A VRNKBEN VAN

A vrbossz, vrtestvr, kk vr, hidegvr, rossz vr - mind tkerlt a tudo


mny krbl a metafork birodalmba. De ha kiss vltoztatunk a sz
hasznlaton, s a vrt" gnekkel" helyettestjk, mris itt vagyunk a mo
dern vilgban. Eljtt a biolgia erejbe vetett hit j korszaka, s az j flele
m attl, amit nmagunkrl megtudhatunk.
Mefiszt pp akkor jelenik meg, amikor Faust elhatrozza dolgozszo
bjban, hogy megli magt. Krlveszik tudskellkei: fst, por, kny
vek, csontok s eszkzk. Az egyik ksrts, amelyet az rdg felajnl, hogy
elnyerje a lelkt, ugyanaz, amit a kgy knlt vnak: Eritis sicut deus,
scientes bonum et malum" - Olyanok !sztek, mint az Isten: jnak s go
nosznak tudi." A titokban krrvend Mefiszt tudja, milyen veszlyes
adomny ez egy halandra nzve. A tudomny, vagyis a dmon, amelyet
Faust megidzett, ma mg kordban tarthat: de egyre n a flelem, hogy
visszatr, s a jusst kveteli.
A vr megrizte hatalmt. Japnban, Mijaima szent szigetn a budd-

Vrcsoportokon alapul
japn jvendmond
automata". A ngy nyls
ngy vrcsoportot jelent: A, B,
AB s 0. Az eszkz genetikai
alapon jvendli meg
azoknak a sorst, akiknek
ez megr nhny jent.

4
BEVEZET

hista szently eltt van egy vrs lda, rajta ngy nyls A, B, AB s 0
felirattal.
Mindegyik nyls mgtt sszehajtogatott zeneteken ll a megfelel
vrcsoportba tartoz emberek jvje. A 0-s vrcsoportak lltlag kny
nyedek; vezetsre trnek, de nem rtenek a rszletekhez. Az A-hoz tartozk
konzervatvok s egyttmkdsre kszek, a B vrcsoporthoz tartozk ex
centrikusak. Az AB vrcsoportak bels ellentmondsossguk kvetkezt
ben szeszlyesek s zrkzottak. Az A s B kerlje egymst, de AB partnerrel
mindegyik boldog lehet. A 0-s vrcsoportak maradjanak meg egyms
kzt, s rizkedjenek a B-sektl. Az sszehzasodni kszl japnok gyak
ran megtudakoljk egyms vrcsoportjt, s vannak mr ksrletek arra is,
hogy az irodkban gondoskodjanak a dolgozk megfelel sszettelrl, s
ilyen mdon biztostsk a harmonikus munkakapcsolatokat.
Az elgondolst szerencsre alvetettk tudomnyos vizsglatnak is. Leon
Bourdel francia antropolgus egy sor gondosan kidolgozott ksrletben ta
nulmnyozta a klnbz vrcsoportokhoz tartoz emberek szvversnek
ritmust zenehallgats kzben. Azt tapasztalta, hogy az A vrcsoportakat a
harmnia, a B vrcsoportot a ritmus, a 0-st a dallam vonzza. Az AB-sek
mindhrmat szerettk (s klnskppen rajongtak Bachrt). Szmukra
tancsos, ha sok halat esznek, s kerlik a paradicsomot.
Knny nevetni a gondolaton, hogy a vrcsoport meghatrozza a sze
mlyisget. Holott mindssze eltlzott vltozata az ltalnos hiedelemnek
arrl, mi mindenre kpesek a gnek. si s megingathatatlan a meggyz -

ds, hogy az ember valami mdon szletstl magban hordja sorst.


Hogy igaz-e - s mikpp -, ez a valls, a filozfia s a tudomny kzponti
problmja.
Semmi j sincs abban, hogy a vr az emberi lt esszencija. A barlang
festmnyeken elnagyoltan megrajzolt szvnek szegezett nyl lthat. A r
mai arnban a nzk sszeverekedtek a gyztes gladitor letnedvnek
egy-egy cseppjrt, mert elixrnek hittk, amelybl ert merthetnek.
A zsidk elleni pogromokat gyakran az a vd robbantotta ki, hogy keresz
tny gyerekeket lnek meg, s vrkkel stik a kenyeret pszahkor; htbor
zongat megnyilvnulsa ez annak a gondolatnak, hogy a vr a fiatalsg s
rtatlansg hordozja- a vr maga az let.
A vr mindig szorosan ktdtt a vallshoz. Egyetemes szimbolikja- a
menstrucis tabuk, a lelt llatok vrnek ivsa, a hs megszabdalsa val
lsos rvletben - si gykerekre utal. A krlmetls taln a gyermekl
dozattl a kasztrcin t a jelkpes vrontsig vel folyamat emlke.
Freud az ldozst, Krisztus vrnek metaforikus ivst egy kannibl rtus,

5
A VRNKBEN VAN

az istenevs maradvnynak tartotta. A keresztnyek szemben mindig is


jelentsgazdag szimblum volt a szent nedv. Megtiszttotta a hvket, s
beszennyezte azokat, akik sketek maradtak Krisztus zenetre. A ni
misztikusok vrt knnyeztek vagy vertkeztek, vrzett az orruk, vagy
olyan rzkeny volt a brk, hogy a legkisebb rints is felvrezte.
Az i380-ban harminchrom vesen elhunyt Sienai Szt. Katalinon ez a
rgeszme a vgskig elhatalmasodott. Napljban arrl beszl, hogy szinte
semmiv sorvasztotta a testt, vaslncokkaI korbcsolta magt, s torkt
nizskaporggal csiklandozta, hogy kihnyja, amit megevett. Azt lltotta,
vrz stigmk jelennek meg rajta Krisztus sebeinek helyn, s ltomsai
ban az vrt issza, mint valami termszetfltti tejet. Egyik levelben le
rja, hogyan vezetett a vrpadra egy eltltet: Keblemen nyugtat fejt. Or
romban rzm vrnek rmt, illatt, de szagt sajt vremnek is, melyet
a Drga Vlegnyrt, Jzusrt vgytam ontani. Az eltlt mell hajtm feje
met a tkre ... Mlysges nyugalommal grnyedt al. Fejt a tkre tet
tem, felje hajoltam, s a Brny Vrre emlkeztettem t. Jzus-Kata
lin, mormoltk ajkai egyre. Mg e szavakat mond, kezembe fogadm fe
jt ... Egyszerre megltm az Istent s embert, amikppen a nap fnyess
gt ltjuk. Jzus feltrul oldala befogad a szenved vrt. .. Lelkem bk
ben s csndessgben nyugodott a vr szagban. Nem vitt r semmikpp,
hogy lemossam a rem frccsent vr cseppjeit."
....
A tizentdik szzadban olyan eleven volt ez a mtosz, hogy a gyengl
ked VIII. Ince ppt fiatal fik vrnek tmlesztsvel prbltk megfia
taltani. A ksrlet kudarcot vallott, hisz csak babonn alapult. 1666-ban
azonban Robert Boyle, a fizikus levlben vetette fel - hamistatlan tudo
mnyos stlusban - dr. Lowernek, akadmikus kollgjnak a krdst:
...vajon egy szelindek vre, melyet gyakorta mlesztenek t vrebbe
avagy spnielbe, nem krostja-e annak szimatt." Alig egy vvel ksbb
Denis francia professzor borjvrt adott egy bizonyos M. Mauroynak, aki
valamely szerelmi gy sorn szerzett szgyenteljes krsgbl ered ma
kacs delriumban" szenvedett. Azt remltk, enyhesge s frissessge ltal
a borjvr tn lecsendesti nnn vrnek hevt s forrongst." Az els
kt vrtmleszts ltszlag hasznlt (jllehet M. Mauroy vizelete megfe
ketedett, valjban a sztroncsolt borjvr-maradvnyoktl). A harmadik
vrtmleszts utn a beteg meghalt. Az gy brsg el kerlt, s az az t
let szletett, hogy M. M. felesge beleunt a sznni nem akar szerelmi
gyekbe, s megmrgezte frjt. A kptelen eljrst (rendszerint inkbb
brny, mint borj vrvel) mg ktszz vig folytattk. Azt tartottk rla,
hrom birka kell hozz: a brny, a beteg s az orvos.

6
BEVEZET

Krisztust szlknt
prselik ki, gy osztja
szt vrt a hvk
kztt; az ldozs
szimbluma egy
tizentdik szzadi
kdexben.

Az els sikeres vrtmlesztst egy amerikai sebsz hajtotta vgre 1818-


ban. Ktsgbeesett vgs lehetsgknt folyamodott hozz, hogy megment
sen egy haldokl beteget. Az asszony gy rezte, mintha az eleven letet
mlcsztettk volna bel". Szerencsje volt. Akkoriban mg mit sem tudtak a
vrcsoportokrl, s egy a hromhoz volt az esly, hogy az adomny nem le
tet, hanem hallt mleszt bel, mert nem egyezik a sajt vrcsoportjval.
A tudomny azta minden klt kpzelett fellmlan jelents tulaj
donsgokkal ruhzta fel a vrt. Minden felnttnek krlbell t liter vre
van. Semmi ktsg, igen furcsa nedv. Krlbell a fele vrsvrsejtekbl
A VRNKBEN VAN

ll. Ezeknek az a klnleges tulajdonsga, hogy nincs bennk DNS; gene


tikai utastsaikat fejldsk sorn elhagyjk. Vannak klnfle fehrvr
sejtek is, melyek egy szalmaszn folyadkban, a plazmban sznak. Noha a
vr nem az let elixrje, mint seink hittk, rendkvli dolgokra kpes.
Krlbell tmilli vrsvrsejt van minden kbmillimter vrben. Ha
egyetlen ember vrsvrsejtjeit egyms mell tennnk, 3800 ngyzetm
tert bortannak be, majdnem egy futballplya terlett, a br felletnek
ktezerszerest. Minden vrsvrsejt tele van egy bizonyos fehrjvel, a he
moglobinnal; amely szivacs mdjra szvja magba az oxignt, majd lerak
ja ott, ahol szksg van r. Visszafel szn-dioxidot szllt a klvilgba.
A vr a test legfbb vdekezszerve. Minden vgst azonnal lezr egy al
vadkkal, ami egyszernek ltszik ugyan, de kmiai reakcik bonyolult so
rnak eredmnye. A plazmban tbbmillirdnyi sejttredk is tallhat: a
vrlemezkk. Ezek srls esetn egymshoz tapadnak. Az els apr alva
dk bonyolult reakcik zuhatagt indtja meg, amg el nem zrdik a seb.
Az j alvadk mrete egy rn bell felre cskken azoknak a fehrjknek a
hatsra, amelyek az izmok sszehzdst is okozzk. Elfordul, hogy az

Kt, hemoglobinnal teli vrsvrsejtet vesznek krl a fehrvrsejtek csoportjba tartoz


nyiroksejtek, amelyek az antitestek termelsrt felelsek.

8
BEVEZET

alvads elgtelen: ez a vrzkenysg. A kialakulst elidz genetikai m


dosuls - mutci - adott elszr alkalmat az emberi rklds trvny
szersgeinek megfigyelsre. Ni gon rkldik, de hatsa gyakrabban
mutatkozik meg a frfiakon. Ezt mr Kr. u. 200-ban felfedeztk, amikor a
ptrirka Jds rabbi felmentette a krlmetls all a harmadik fit arra
az esetre, ha kt btyja elvrzik - s ugyanezt a felmentst a fik unokatest
vreinek is megadta.
A szervezetnek kifinomultabb vdelme is van a behatolk ellen. A fehr
vrsejtek szntelenl vndorolnak az rrendszer s a szvetek kztt. Az a
feladatuk, hogy lekzdjk a fertzst. Nmelyikk gy tmadja meg s
puszttja el a belp baktriumot, hogy lyukakat t a faln, s ers enzi
mekkel feloldja. Msok - a nyiroksejtek - antitesteket termelnek, olyan
klnleges, a behatolk elpuszttsra beprogramozott fehrjket, ame
lyeknek rendkvli kpessgk van az idegen molekulk - az antignek -
felismersre. Kt fehrje, amely sznatomok ezreit tartalmazza, akkor is
megklnbztethet, ha egyetlen atom pontos dlsszgben trnek el.
Nmelyik nyiroksejt megrzi a rgi csatk emlkt. Ha egy tmad jabb
rohamot ksrel meg, pr ellenfele mr ott vr tartalkban. Azonnal tma
dsba lendlnek, s az ellensg gyenge pontjairl rztt tudsukat tovbb
adjk a nyiroksejtek j nemzedknek, amely sokasodik s legyzi a tma
dt. Ezzel a szervezeten belli evolcival - genetikai vltozssal - alkal
mazkodnak a sejtek a vltoz krlmnyekhez.
A vrsejtek magukon hordozzk azonossgi jelzseiket, az n. vrcso
port-antigneket. Ezeknek ltezst szzadunk els veiben fedeztk fel,
jval az els vrtmleszts utn, amikor mg kevertk a klnbz em
berektl szrmaz vrt. Bizonyos keverkek tkletesen illettek egyms
hoz, msokban azonban egymshoz tapadtak a vrsvrsejtek, mert az
egyik vrtpus antignjei reakciba lpnek a msik antitestjeivel. Az anti
testek ugyanis bekertik s elpuszttjk az idegen vrsvrsejteket.
Br a szemlyisget vagy a zenei zlst - tudomsunk szerint - nem befo
lysolja a vrcsoport, a betegsgekre val hajlamot igen. Egyesek vdelml
szolglnak bizonyos betegsgek ellen, msok ellenllbb tesznek a fertz
sekkel szemben. Ktsgtelenl van ms feladatuk is. De a legfontosabb,
hogy ezek mutattk meg elszr az egyn pratlan mivoltt: a mrhetetlen
szm rkltt klnbsg ltezst. Mindenki tud az ABO-s vrcsopor
tokrl, de szmtalan hasonl rendszer ltezik. Olyan sokfle vrcsoportvl
tozat fordul el, hogy ha semmi mst nem vesznk figyelembe, csak az anti
gneket a vrsejtek felletn, akkor is minden ma l ember klnbzik
mindenki mstl - s mindenkitl, aki valaha lt vagy valaha lni fog.

9
A VRNKBEN VAN

Vralvads. A vrsvrsejteket a fibrinszlak hlja tartja fogva.

Az eltrsek nlkl nem volna genetika. A vrcsoportok feltrtk a bio


lgia egyik nagy megvlaszolatlan krdst: mirt van ilyen sokfle vlto
zat? Egyszeren a felhalmozott genetikai hibk sorrl van sz, vagy ez a
szmtalan egyedlll minsg valban jelent valamit? A vrcsoportok te
kintetben valsznleg igen, de hogy a DNS ms terletein mi rejlik az el
trsek sokasga mgtt, arrl mg semmit sem tudunk.
Mg a vrplazmnak is megvannak a sajt pontosan meghatrozott fel
adatai. Nemcsak az antitesteket hordozza, hanem az emsztsi termkeket
is elszlltja a blbl. A benne lv fehrjk szablyozzk a vz ramlst a
szvetekbe, s megakadlyozzk, hogy a test a sajt nedveibe fulladjon.
Ms fehrjk azt a szerny munkt vgzik, hogy segtenek eljuttatni a va
sat, jdot, zsrokat s a test egyb mindennapi szlltmnyait az elllts
helytl a felhasznls terletig. A plazma a test informcis hlzathoz
tartozik, amely a kmiai vezrls adathordozit, a hormonokat eljuttatja a
forrstl a clig. A hormonokat kln mirigyek termelik, melyeknek sze
repe hossz vekig homlyban maradt az anatmusok eltt. A nyakban l
v pajzsmirigyrl hajdan - a tudomnyos gondolkods nagyobb dicss-

10
BEVEZET

gre - azt mondtk: rendeltetse, hogy a nyak regeit kitltse, gy teltebb


s szebb tegye formjt, klnsen a fehrszemlyeknl, akiknek ezen
okbl nagyobb mirigy adatott".
A Vr cm orvosi szaklap (amelynek cme ppolyan lnyegre tren
tkrzi tartalmt, mint trs, a Bl) vente tbb mint kilencezer oldalnyi
mlyrehat kutatst ismertet. Ha cmt begpeljk egy adatbzisba, egy
tlagos hten bell ezer kln cikk jelenik meg a kpernyn. Teljes mun
kaidt venne ignybe csak nhnyat is elolvasni folyamatosan a termsbl.
Goethe nagy polihisztor volt: klt, filozfus, biolgus ( aki tletes - br
tves - elmletet alaktott ki a sznltsrl, az embriolgirl s a levelek
feladatrl). Manapsg az ember mr kizrlag a vr tmakrben sem le
het polihisztor.
A vrt hossz ideig az rklds hordozjnak tartottk. Elsnek P
thagorasz vetette fl a gondolatot, hogy az emberi let akkor kezddik,
amikor a frfi s ni nedvek vagy ondk sszevegylnek, hogy j nemze
dket hozzanak ltre. Arisztotelsz ,szerint az ond valjban megtisztult
vr. Nhny klns angol hzassgi tilalom mutatja, hogy ezt a gondola
tot sz szerint rtelmeztk. 1907-ig egy zvegyember nem vehette felesgl
elhunyt felesge ntestvrt. A Bibliban az ll , hogy a frfi egy test" a fe
lesgvel. Ezrt feltteleztk, hogy vrk ugyanaz, gy a felesg ntestvr
vel kttt hzassg vrfertzs lenne. Tbb mint hatvant v s negyvent
parlamenti vita kellett, mg egy megzvegylt frjnek vgre megengedtk,
hogy felesgl vegye korbbi hitvese legkzelebbi rokont.
Pthagorasz utn ktezer vig senki sem cfolta meg az elkpzelst,
hogy az let nedvek keverke, melyek kzl mindegyik magban hordja
nemzje lnyegt. William Harvey (a szvmkds s a vrkerings felfe-

Kt ember sszekevert
vl!re. Baloldalt
a vrcsoportok
sszecsapdnak;
jobboldalt nem.
sszeegyeztethetetlen
vrcsoportok
keveredsekor
a vrsverjtck nagy
rgkben tapadnak
ssze. Vrtmleszts
sorn ez valsznleg
hallt okoz.

11
A V RNKBEN VAN

dezje) jtt r, hogy a szarvasembrik valjban nem apr szarvasok, ha


nem kis gmbk, amelyek- vlemnye szerint- a petesejtbl alakulnak ki,
nem valamifle nedvbl.
Az rklds - eltren, mondjuk, a blmkdstl - olyan tudom
nyos terlet, amelyrl mindenkinek van vlemnye. De sajnos csaknem
mindegyik felfogs tvesnek bizonyult, brmilyen szenvedlyesen ragasz
kodtak hozz tmogati. Manapsg a legtbben a gneknek az emberi vi
szonyokban jtszot jelents vagy lnyegtelen szerepvel foglalkoznak. De
Pthagorasz ta ktezer ven t az rkldsnek mg a mkdsrl is
csak tallgatsok voltak. A kifejtett elgondolsok gyakran tkletesen
sszernek tntek (annak tnnek ma is). Nem is volt velk ms baj, csak
az, hogy nem feleltek meg a valsgnak. Manapsg annak a bizonytkai,
hogy a tudomnyban az sszersg gyakran hamis prfta. Hiba ltszik
kzenfekvnek, hogy amikor a tz g, valami eltvozik belle, s ez alkotja
a lngokat; ez a valami" - a flogiszton, ahogy annak idejn neveztk -
nem ltezik, hanem (brmit mondjon a megrzs) valami ms ppen fl
emsztdik: az oxign. A problma abban rejlik, amit a tudomny ter
mszetellenes jellegeknt" szoktak emlegetni: ami nyilvnval, rendsze
rint nem igaz.
Kvetkezskpp brmilyen fontos krds az rklds termszete, ez
volt az ismeretek utols nagy terlete, amely homlyban maradt. Szza
dunk kezdetig szinte teljes volt a zrzavar. Darwin vilgosan ltta, hogy
bizonyos betegsgek rkldnek a csaldokban, de a jelensgeket nem
tudta megmagyarzni. Pldul: a sketsg jra meg jra elfordul egy csa
ldon bell, de nincs benne semmi rendszeressg. Csupn rgztette azt a
rendkvli tnyt, hogy noha gyakran elfordul egyazon csaldban tbb
sketnma, s nem ritka, hogy ezen llapot unokatestvreiknl s ms ro
konaiknl is mutatkozik, mindazonltal szleik csak elvtve sketn
mk . . . Ismereteink jelenlegi fokn biztosabb az egsz gyet egyszeren
megmagyarzhatatlannak tekintennk."
Brmi okozta a sketnmasgot (a beszdkptelensget, mely azrt ala
kult ki, mert a gyermek nem tudott megtanulni semmilyen nyelvet), nyil
vnvalnak ltszott, hogy sok ms tulajdonsghoz hasonlan rkldik.
Hogy mirt, az titok maradt. A sketsg s sok ezer ms tulajdonsg rejt
lyt - rszben - a modern biolgia rendkvli fejlemnyei oldottk meg.
De azrt a tizenkilencedik szzadi tvedseknek megvan a modern megfe
leljk: az a hit, hogy jelenlegi genetikai ismereteink alapjn vlaszolni tu
dunk minden si krdsre azt illeten, melyek a velnk szletett adotts
gok s melyek nem azok. Ez a knyv bizonysg arrl, milyen kevss igaz

12
BEVEZET

ez; a fejezet pedig arrl, milyen nehezen lthat t mg az egyni sajtoss


gok trkldsnek mechanizmusa is.
Darwin azt hitte, valamilyen mdon a vr az a hordoz, a szli let
nedv, amely gyermekeikben keveredik. Tovbb olyan mly benyomst
tett r a szlk s gyermekeik hasonlsga, hogy megfogalmazta a hasz
nlat s nemhasznlat" trvnyt: azok a tulajdonsgok, amelyeknek egy
nemzedk j hasznt veszi, rkldnek, mg azok, amelyeket nem hasznl
nak, lassan eltnnek.
Az ilyesfajta elkpzelsek annyira meggyzek, szinte igazsgtalansg
nak rezzk, hogy nem helytllak. Darwint remnytelenl ingovnyos
vidkre vezettk a hibaval ksrletek, hogy az rklstani felfogst s
evolcis elmlett sszhangba hozza. Minl tbbet gondolkodott a kr
dsrl, annl vilgosabban ltta a problmkat, amelyek abbl addnak,
ha az rklds valban a szlk tapasztalatain s gyermekeik vrn ala
pul. Manapsg rendszerint tapintatosan ftylat bortunk A fajok eredet
nek A vltozs trvnyei cm fejezetre, amelyben erre vonatkoz nzete
it kifejti. A maguk idejn azonban sszernek ltszottak; s utlag megl
lapthatjuk, hogy Darwinnak s kortrsainak szmos szrevtele valjban
helytll. Csakhogy ezek puszta kivtelek az rklds mechanizmusnak
nagy igazsghoz kpest, amely kevsb nyilvnval, de sokkal egysze
rbb, mint brki sejtette volna.
Nemcsak Darwin vette szre a vgzetes hibt abban az elkpzelsben,
hogy a vr az egymst kvet genercikban kevered tulajdonsgok hor
dozja, hanem a brit kormny is, amikor 1971-ben hozzltott, hogy jra
megfogalmazza az angolsg lnyegt, sanguist.
Az angol llampolgrsg valamikor egyrtelm dolog volt. Kizrlag at
tl fggtt, a Korona uralma s fennhatsga alatt ll terleten szle
tett-e" valaki. Az i971-es Bevndorlsi s llampolgrsgi Trvny ki nem
mondott clja, hogy tvol tartsa a sznes bevndorlkat. De nmi gondot
okozott, hogy egy lltlag liberlis trsadalomban nincs helye a faji meg
klnbztetsnek. Mrpedig a hatsgok nem akartk kirekeszteni a
Nemzetkzssg minden llampolgrt. A fehr dl-afrikaiakat, kenyaia
kat vagy ausztrlokat felhbortotta volna, ha nem trhetnek vissza abba
az orszgba, amelyet sokan mg mindig hazjuknak tekintettek. gy kel
lett kialaktani a Brit-szigetekre nyl ajtt, hogy csak az lphessen be rajta,
aki odatartoznak minsl.
Egyszer, cinikus s lelemnyes megoldst talltak ki. Az angliai letele
peds jognak megszerzst jonnan szablyoztk az rklds politikai
hasznlatra alkalmas modellje alapjn. Az tlevl mr nem volt elg. Meg-

13
A VRNKBEN VAN

szletett a honossg" eszmje. Ez pedig a vrben rejlett. Lehetsges, hogy


a brit vr egszen furcsa nedv, m a meghatrozs szerint van egy vgzetes
hibja. Ha felhgtjk, erejt veszti.
Az j szablyok rtelmben a beutazs joga attl fggtt, kell arny
ban csrgedezik-e a valakinek az ereiben a mgikus folyadk. Az Egyeslt
Kirlysg s gyarmatai brmelyik llampolgra - mrpedig sok milli van
bellk Ugandtl Hongkongig - csak akkor nyerhetett honossgot,
vagyis letelepedsi jogot, ha maga vagy valamelyik szlje, esetleg nagy
szlje ezeken a szigeteken szletett. A trvny rtelmben az minslt
valdi angolnak, teht jogosultnak az angliai letelepedsre, aki e fld sz
ltttl rklte vrnek legalbb egynegyedt valamelyik nagyszlje
rvn. A Nemzetkzssg fggetlen orszgainak (pldul Kanadnak
vagy Ausztrlinak) az llampolgraira mg szigorbb trvnyek vonat
koztak. k csak akkor nyerhettek honostst, ha anyjuk vagy apjuk Ang
liban szletett.
Kellemes krlmny, hogy az id tjt, mikor a dnt fontossg nagy
szlk vagy szlk a vilgra jttek, a Brit-szigetek legtbb lakja fehr b
r volt. A sok milli afrikai s zsiai pedig, akinek korbban azt mondtk,
legyen bszke kapcsolatra a demokrcia szlhazjval, egyszerre azt ta
pasztalta, hogy hiba van kemny kk tlevele, az okmny nem sokat r.
A kanadaiak s ausztrlok szempontjbl a helyzet - tmenetileg - vala
mivel jobb volt; egy ideig a trvny megengedte, hogy a hbor utn ki
vndorolt angolok gyermekei visszatrjenek. Unokiknak azonban fls
leges letelepedsrt folyamodniuk.
Napjainkban, egy genercival a trvny megszvegezse utn a legtb
ben mr elvesztettk a letelepedsi jogot. Az id mlsval egyre kevesebb
tengeren tl szletett utd hivatkozhat a kellen szoros rokoni kapcsolat
ra. Mr nincs meg bennk megfelel arnyban az Angliban szletett
egynek kritikus arny rksge, azok, akik truhzzk utdaikra a jo
got, hogy az Egyeslt Kirlysgban ljenek. Ahogy mlnak az vek, a Nem
zetkzssg polgrai kzl egyre kevesebben hivatkozhatnak arra, hogy
megfelel mennyisg, kivltsgos szlktl vagy nagyszlktl rklt
valdi angol vr folyik az ereikben. Idvel szinte senki, aki ezeken a szigete
ken kvl szletett, nem kapja meg automatikusan a jogot, hogy itt ljen;
az lds annyira felhgul, hogy mr semmit sem jelent.
Az Egyeslt llamokban pp fordtva alkalmaztk a vrkeveredsi tr
vnyt. Akinek egyetlen fekete se volt, brmilyen tvoli, az feketnek mi
nslt. Egyetlen cseppnyi fekete vr rkre beszennyezte a leszrmazsi
gat. A trvny eredetileg arra szolglt, hogy a rabszolgatartk trvnyte-

14
BEVEZET

Julius Caesar lova, amelyet lbujjakkal s egyszarvknt brzolnak. Lbfeje lltlag csak
nem olyan volt, mint egy ember. Nyilvn fennmaradtak benne a lbujjak gnjei, mg a leg
tbb l lbfeje az vmillik sorn egyetlen patv alakult.

len gyerekeivel nveljk a rabszolgk szmt. Mg 1986-ban is elfordult,


hogy a Legfelsbb Brsg nem volt hajland fellvizsglni a dntst,
amely feketnek minstett egy fehr br louisianai asszonyt, mert a fe
kete k-k-knagyanyja egy francia ltetvnyes szeretje volt.
Mindez szksgszer kvetkezmnye a felhgulson alapul rklds
nek. Ha a nedvek keverednek, elbb-utbb mindenki egyforma lesz. Ak
kor pedig a genetika csak az tlagot tanulmnyozhatja, a klnbsgeket
nem. A fajok eredete megrsakor Charles Darwinnak (akrcsak a brit kor
mnynak) az volt a vlemnye, hogy az rklds alapja a testnedvek keve
...
redse. is rjtt, hogy ebben az esetben rvid id alatt minden elnys
tulajdonsg annyira felhgul, hogy rtkt veszti, akr a kis mennyisg
angol vr. De az evolci egytt jr a javak igazsgtalan elosztsval, vagy
is a bvelkedk fellkerekednek a szklkdkn. Minden olyan folyamat
fkezi ezt, amely nmkden egyenlsghez vezet. Erre a problmra
Darwin soha nem tallt megoldst.
Nyugtalantotta az rklds msik furcsasga is, amelyet nem tudott
sszeegyeztetni a vrkevereds eszmjvel: ez az atavizmus. Elfordul,

15
A V RNKBEN VAN

hogy olyan egyed szletik, amely nem szlei tlagra, hanem valamelyik
tvoli sre vagy rokonra t. A legtbb lnak mindegyik lba egyetlen pa
tban vgzdik, br a lbon bell megmaradtak az apr csontok, az si
lbujjak maradvnyai. De Julius Caesar csatalovnak s Bucephalusnak,
Nagy Sndor csatamnjnek lbujjai voltak, ppen olyan hasznlhatk,
mint egy kutya vagy macska lbujjai.
Ami ltrehozta ket, annak ott kellett rejlenie az llat rkltt adotts
gai kzt, ho_gy sok nemzedkkel ksbb vltozatlan formban felbukkan
jon. Ugyanez elfordul az embernl is. Nhny ember - a kutykhoz ha
sonlan - tbb cseccsel szletik; mg kevesebb (a kzpkor ta mintegy
tven) majomszeren vastag szrzettel arcn s testn.
Ez semmikpp sem frt ssze a kevered nedvek gondolatval. Hogyan
maradhattak fenn ezek az adottsgok ilyen megklnbztethet form
ban, ha nemzedkek ezrei sorn cskevnyesedtek, ahnyszor csak az adott
tulajdonsg hordozja olyasvalakivel prosodott, akibl ez a tulajdonsg
hinyzott?
A vlasz egyszer volt, de senki sem jtt r. Csak 1860-ban fedezte fel
(Darwin tudtn kvl) egy Gregor Mende} nev szerzetes, az els biolgus,
aki mricskls helyett inkbb szmolt. Mendel eltt a genetikban nem
trtnt semmi jelents lps. A trgy korai trtnelme res, ellenttben
mondjuk a vegyszetvel, amelyben fontos szerepet jtszott az alkmia.
Mendel azzal jrult hozz a genetika fejldshez, hogy kimutatta: az
rkldst apr rszecskk hatrozzk meg, amelyeket egyik nemzedk
vltozatlanul ad t a msiknak. Megtette a dnt lpst: levlasztotta az
zenetet (a gneket) kzvettirl (az egyedekrl), melyek tovbbtjk.
Csupn az zenet szmt - terjesztinek sorsa vajmi kevss tartozik a

Atavisztikusan" szrs arc


mexiki hlgy. Nhny hasonlan
szrs arc leszrmazottja
ma is l Mexikban.

16
BEVEZET

trgyhoz. Abbl, hogy az rkletes informci kln egysgekbe van k


dolva, melyeknek rszecski a gnek, egyenesen kvetkezik, hogy a ksei
leszrmazottakban romlatlan llapotban jelenhet meg akr rg halott
nemzedkek rksge is. A genetikban minden ms rszletkrds.
Mendei kimutatta, hogy az rkltt zenet nem a vrben vagy az ond
ban rejlik folykony llapotban, hanem a hm ivarsejt s a petesejt rvn
tovbbtott informcis egysgekben. A genetika legnehezebben megra
gadhat, de legfontosabb igazsga, hogy az rkltt zenet lete elklnl
hordozja lettl. A vr a genetikai gpezet termke, nem maga a gpezet.
Azok a jellemz sajtossgok, melyekre lete sorn tesz szert az egyn, nem
rkldnek. Pontosabban nem a biolgiai gpezet rvn rkldnek; hisz
senki sem tagadja, hogy a mveltsg, gazdagsg s trsadalmi helyzet -
igen, a kk vr - egyik genercirl a msikra szll. Ma mr persze tudjuk,
hogy Mendel rszecskinek" fizikai valsga van, ngy klnll kmiai
bet sokmillinyi kombincijnak DNS-be kdolt s kromoszmkban
trolt formjban.
Az, hogy Darwin nem tudta elvlasztani a gnek sorst hordoziktl,
legnagyobb tvedshez vezetett: a hasznlat s nemhasznlat trvny
hez, a szerzett tulajdonsgok rkldsnek elvhez. A mai biolgusok
termszetesen kitkozzk ezt a gondolatot, cfolatval kezddik minden
genetikai elads-sorozat. Az ellene szl bizonytkok ktsgbevonhatat
lannak ltszanak. A tizenkilencedik szzad egyik monumentlis, m olvas
hatatlan knyve, William Paley A teremts bizonytkai cm munkja az
zal lepi meg az olvast hress vlt els oldaln, hogy amikppen a hanga
fves rten tallt ra ktsgbevonhatatlanul bizonytja az rs ltezst,
olyankppen szolgl bizonysgul az let tkletessge alkotjnak, Isten
nek ltezsrl. Paley knyvnek tbbi rsze kevsb emszthet, mivel
nagyrszt latin szavaktl hemzseg. A szerz megemlti, hogy a zsid gyere
kek fitymval szletnek, teht nem igaz, hogy az let sorn szerzett sajtos
sgok trkldnek a kvetkez nemzedkre.
Knny gnyoldni a primitv elkpzelsen, hogy a gyermekek sorsa
szleik tapasztalataiban rejlik. Persze hogy a zsid fik krlmetletlenl
szletnek; fitymjukon vagy vrvonalukon nem vltoztat apjuk krnyeze
tnek egyetlen tnyezje sem. De az mr kevsb nyilvnval, hogy az
olyan jellegzetessgeket, mint a magassg, testsly, intelligencia vagy
egszsges alkat, rkre megszabja a biolgia. Ahogy a tudomny tbb is
meret birtokba jut, vatosabban bnik a kijelentssel, hogy az egyszer
szablyok szerint rkltt tulajdonsgokat felttlenl a gnek szabjk
meg. Vilmos herceg, Anglia leend uralkodja (taln) viseli majd a koro-

17
MENDEL: A BIOLGIA ELFELEJTETT LNGELMJE

Mendelnek az volt a szerencsje, hogy megfelel


l szervezeteket vlasztott: nem embereket, ha
nem zldborst. Ez kt nagy elnnyel jrt. Elszr
is itt a leszrmazsi gak tisztn elklnthetk.
Egy-egy leszrmazsi gon bell minden nvny
egyforma. De a klnbz lesznpazsi gak tu
lajdonsgai eltrnek egymstl (pldul a sznk
vagy a formjuk). Msodszor a bors ktnem,
ugyanannak az egyednek vannak hm s ni ivar
sejtjei, gy (sok ms, hasonl tulajdonsg lnnyel
ellenttben) kpes az nmegtermkenytsre.
Amikor Mendei zld borsj nvnyt srga bor
sjnak a virgporval termkenytett meg, min
den utd srga lett. Ez magban is fontos felfede
zsnek szmtott, mivel a borsk csak az egyik sz
lre hasonltottak, s nem a kett keverkei lettek.
De a srga borsj nvnyek els genercij
nak nmegtermkenyts ( vagyis nbeporzs) r
vn ltrehozott utdai meglepetssel szolgltak.
Az utdok kzt ismt akadtak zld borsszemek.
Akrmi tette ket zldd, egy nemzedk utn is
mt felbukkant. Ez egyltaln nem volt ssze Gregor Mendei, a rendfnk, a tanr s a genetika
egyeztethet az rkltt tulajdonsgok kevered megalaptja. Ez a portr letnek ksovbi szakasz
snek elmletvel. ban brzolja, amikor aptsgnak szellemi s gya
A borsszemek megszmllsa mg tbbet korlati vezetjeknt dolgozott, korai, br kzreadott
rult el. A msodik nemzedkben hrom srga ksrletei pedig mrfeledsbe merltek.
borst term nvnyre egy zld borst term ju
tott. Ugyanez vonatkozott a tbbi tulajdonsgra is:
pldul a szemek gmblysgre vagy rncoss
gra. Amikor tbb tulajdonsgban is klnbz
nvnyek keresztezsre kerlt sor (pldul rncos
zld bors kerek srgval), a szn s forma rkl
dsi arnya fggetlen volt egymstl.
Mendei ebbl arra kvetkeztetett, hogy a n
vny kls megjelenst valamely bels s (szm
ra) lthatatlan elem szabja meg. Nem valami fizi
kai anyagnak, hanem informcinak kell eljutnia
egyik nemzedkbl a msikba. Felttelezte, hogy a
virgpor s a csrasejt egyarnt hordoz egy-egy
pldnyt a meghatrozott szn ltrehozshoz
szksges utastsbl. Az informcis egysgek
(amelyeket ksbb gneknek neveztek el) ktflk

18
MENDEL: A BIOLGIA ELFELEJTETT LNGELMJE
"

Mendei kertje a brni


kolostorban. Ma letnek
s tudomnyos
munkssgnak szentelt
mzeum, a Mendelanium.

lehetnek. Az uralkodkbl ( dominnsokbl) egy Ugyanez volt a helyzet a bors tbbi tulajdonsg

az embernl is. Mendei dnt jelentsg munks


pldny is elg, hogy jelenltk megnyilvnuljon. val - s a legtbb ms szervezetnl, tbbek kztt
A lappangkbl (latensekbl) kett kell! A lap
pangk jelenlte rejtve marad abban a nvnyben, sga azonban harminc vre elveszett szem ell; csak
amely uralkod egysget is hordoz. a huszadik szzad els vben fedeztk fel jra.
gy amikor Mendei els genercijnl meg
trtnt a srga nvnyek nrnegtermkenytse, LENT: Az brrl minden leolvashat. Baloldalt:
mindegyikben ktfle virgpor s csrasejt alakult hmivar palnta (POLLEN), melynek kt gnje van
ki, egyik a srga, msik a zld bors gnjvel. Ami a srga sznre (Y, Y), megtermkenyt egy nivart
(EGGS) kt gnnel a zldre (G, G). Minden utdba
addott: srga a srgval (az esetek 1/.i-e), srga a
kor ezek tallkoztak, hrom lehetsges kombinci
jut egy msolat mindkt gnbl (YG), s mindegyik
zlddel (1h-e) s zld a zlddel (1/.i-e). Mivel a srga pldny srga lesz. Az nmegtermkenyts (SELF
a zldhz kpest dominns, az els kt csoport sr FERTILIZE) utn megjelenik Mendei arnya: a h
ga utdokat termett, ez magyarzza a p arnyt. rom srga (YY, YG, YG) az egy zldhz (GG).

HMIVAR
y y y G
1
1 1

G YG 1
YG y yy 1
YG
NMEGTER-
1 1
1 1
::::> 1 1
0:: 1 1
1 1 '
<t

:
> - - - - - - - - - -+ ---------- ----------+----------
1
1
z 1 M K ENYTS
1

G YG YG G YG GG
1
1
1
1

19
A VRNKBEN VAN

nt, mert rkli apjtl. Hasonl okbl elll fle lesz. A korona mg sincs
a gnekbe kdolva, mint a fl.
Gyakran nem vilgos, mi tulajdonthat a kzs gneknek s mi a kzs
krnyezetnek vagy mindkettnek - s hogy ez a megklnbztets egyl
taln fontos-e. A vita politikai s tudomnyos vonatkozsai a Mendel elt
ti idkre nylnak vissza, s a mai napig sem sikerlt tisztzni ket. Bal- s
jobboldal egyforma meggyzdssel lltja vagy tagadja, hogy az emberrel
vele szletnek a tul_ajdonsgai; de egyik sem gondolkodik el, mit is jelent ez
valjban.
Az alkat s neveltets vitja legjobban a Szovjetuniban lezdtt ki,
ahol ideolgiai okokbl huszont vig egy helyben toporgott a genetika.
A marxistk nem tudtak beletrdni abba, hogy az ember nem befolysol
hat bizonyos tulajdonsgokat, mert biolgiailag kdolva vannak. A trt
nelem folyamn mindssze kt llatrl mondtk, hogy alkalmatlan a ta
nulmnyozsra: az emberrl az inkvizci idejn s az ecetmuslicrl
Sztlin idejn. A szovjetek ppoly elszntan hangoztattk, hogy a gnek
nem jk semmire, mint trsaik a politikai sznkp tls vgn azt, hogy
mindennl fontosabbak.
Az 1930-as vek Oroszorszgban gyorsan fejldtt a genetika. Csak
hogy szntelenl trtkeltk osztlyszempontok alapjn. Marx annak
idejn azt bizonygatta, hogy az talakul trsadalom tformlja az embert;
ha gyz a forradalom, kialakul az j s jobb embertpus. Ez nmagban is
rkldsi elmlet volt. Az j embertpus - a Homo sovieticus kialakt
-

sban a Szovjetuni ment a legmesszebb. A tmegek ngy v alatt teljes


tettk az els tves tervet, s kzben kulkok s rtelmisgiek - rombolk
s szabotrk - millii pusztultak el. Ha az ember lete sorn szerzett tu
lajdonsgok valban rkldnnek, ennek az risi kollektv erfeszts
nek a tudat kzs megvltozsval kellett volna jrnia, amely aztn az j
nemzedkre is trkldik. Elfogadhatatlan gondolat volt, hogy bizonyos
tulajdonsgok llandak, brmilyen legyen is a politikai krnyezet. i938-
ban az odesszai ssz-szvetsgi Genetikai s Kivlasztsi Kutatintzet
lre Sztlin kvnsgra Trofim Gyenyiszovics Liszenkt neveztk ki, aki
azonnal hozzltott, hogy a marxista ideolgit alkalmazza a genetikra,
s derekasan hozzjrult mindkettnek a tnkrettelhez.
A msodik vilghbor utn (amikor mr szmos orosz genetikus el
tnt a tisztogatsokban) Oroszorszgba ltogatott Julian Huxley angol bi
olgus. Magyarzza meg, krte Liszenkt, hogy ha gnek nincsenek, mi
kpp lehetsges, hogy a nagyszlk tulajdonsgai egy nemzedket kihagy
nak, s az unokkban jelennek meg ismt (a jelensget szegregcis folya-

20
BEVEZET

T. D. Liszenko,
kezben bzakalsszal
- amelyet a szerzett
tulajdonsgok
rkldsnek
mgija rvn lltlag
sikerlt rvenni,
hogy megteremjen
Szibriban.

matnak nevezik). n ismeri a megtermkenytsi elmletemet- vlaszol


ta Liszenko. A megtermkenyts nem ms, mint egyms klcsns be
-

kebelezse.Magunkrl is tudjuk, hogy az emszts nem tkletes. Ilyenkor


mi trtnik? Bfgnk. A szegregci a termszet bffense: az asszimil
latlan rkldsi anyagot bfgi fel." Ennyit zeltl Liszenko tudom
nyos gondolkodsrl.
Ha a fitiszfzike tl sok hernyt eszik, kakukktojst tojik, mondta Li
szenko (nmi tjkozatlansgrl tve bizonysgot a kakukkok termszet
rajzt illeten). Kollgi levontk a megfelel kvetkeztetseket elkpzel
seibl. .. Liszenko akadmikus ezeket a tnyeket felhasznlja majd az el
.

lensges ideolgival folytatott kzdelemben. Ha a tpllk meg tudja vl


toztatni a szervezet rkltt tulajdonsgait, akkor el kell vetnnk a gnek
elmlett." Ez az ideolgia - a meghamistott ksrletekkel egytt - ka
tasztroflis kvetkezmnyekkel jrt. 1942-ben Liszenko kijelentette, hogy
ha az szi bzt (amelyet egybknt a neki megfelel enyhbb ghajlaton
termesztenek) Szibriban a (nyron nv) tavaszi bza tarljn vetik el, a
leghidegebb telet is kibrja. A parasztokat rknyszertettk a bza-jarovi
.

zcira" (ami egyltaln nem vlt be), s ez hnsghez vezetett.
1948-ban a Szovjetuniban megsznt a genetika. A Lenin ssz-szvet
sgi Mezgazdasgtudomnyi Akadmia kzgylsn meghirdettk a tisz
togatst. A ]egyz'knyv: A biolgiai tudomny helyzete gytrelmes olvas
mny manapsg. Az hnsget nem a kollektv gazdasgok sszeomlsa
okozta, hanem a genetikusok. Ideje, hogy felismerjk: a mi morganis
tink-mendelistink vgeredmnyben azoknak a nemzetkzi reakcis

21
DNS: A HORDOZ
S AZ ZENET

Ahogy a tizenkilencedik szzadot a gzmozdony,


a huszadikat a DNS szzadaknt fogjk szmon
tartani. A DNS nemcsak az informci tvitel
nek eszkze, hanem annak a folyamatnak is,
amelynek sorn fehrjk alakulnak ki egy msik
bonyolult nukleinsav, az RNS kzvettsvel.
A molekula fknt cukrokban klnbzik a
DNS-tl.

BALRA: Munkban a DNS. A DNS-molekulrl


az RNS hrviv molekula olvassa le az
informcit. A hrviv RNS-molekula fonala
egyre hosszabbodik, amint leolvassa a DNS
kdot, aztn levlik, s tviszi az zenetet
a sejtfehrjegyrt gpezetnek tovbbi rszbe.

TLOLDALT: Egy DNS-molekula szmtgpes


brja: a (zld szn) vzmolekulkfelhjvel
krlvett ketts spirl. A nukleotidok szne
kk s piros, foszftalap tmasztvzuk lila
s narancssrga. A DNS-informci ngyfle
nukleotidba (bzisba) van kdolva; ezek
rvidtve az A, G, C s T.

Emberi kromoszmk
csoportja. Mindegyik
kromoszmban ott
a DNS, amely szorosan
sszecsavarodva simul
a fehrjevzra.

22
23
A VRNKBEN VAN

erknek az uszlyba kerltek, amelyek nemcsak a gnek megvltoztatha


tatlansgnak, hanem a kapitalista rendszer vltoztathatatlansgnak is
burzso apologetikusai . . . A formlis genetika risi krokat okozott."
A szerzett tulajdonsgok rkldse trvny lett.
J nhny genetikus, tudvn, milyen sors vr a msknt gondolkodk
ra, bocsnatkr levelet olvasott fel: Dicssg a Nagy Sztlinnak, npnk
vezrnek s a halad tudomny lharcosnak!" nkritikjuk fogadtat
srl gy szmol be a Jegyzknyv: Viharos, hosszan tart s egyre fokoz
d tapsviha s ljenzs. Mindenki felll." A szovjet genetika meghalt.
Maga meg a ksrletei elmehetnek a holdba" - mondta Hruscsov jval
ksbb Liszenknak, s az 1970-es vekben a szovjet genetika ismt csatla
kozott a tudomnyos vilghoz.
Liszenko felfogsa tkrkpe volt annak az 1930-as vekben Nmetor
szgban s msutt vallott nzetnek, hogy minden a gneken mlik. Maga
Hitler lltlag olvasott egy tanknyvet az emberi genetikrl, s a fajtisz
tasg" (ahogy akkoriban a tmt neveztk) szmos szakrtje vett rszt a
megsemmistsi mozgalomban. A trsadalom megjavtsnak egyetlen
mdja, hogy azokat tenysztjk tovbb, akiknek a gnjei a legjobbak, s el
trljk a fld sznrl azokat, akiknek a legrosszabbak. Ez az elkpzels
sem llta ki a trtnelem prbjt.
Termszetesen ma mr egyszer s ltalnosan elfogadott tnynek lt
szik, hogy a biolgiai zenet elklnl attl, amit ltrehoz: a vrtl, csont
tl vagy agytl. Tbb nem szmt eretneksgnek, ha valaki hisz a genetikai
programban, amely klnbzik a szervezettl, amelyet ltrehoz, s egyik
nemzedk adja t a msiknak. Ez lett a biolgia j ortodoxija; s akrcsak
Liszenko idejben, gnynak teszi ki magt, aki ktsgbe meri vonni.
Csakhogy ez nem magtl rtetd megolds az rklds mkds
re. Akkor mr a liszenkizmus els pillantsra kzenfekvbbnek ltszik.
A szerzett tulajdonsgok (tbbek kztt a gazdagsg s a trsadalmi hely
zet) ktsgtelenl rklhetk. Gyakran elfordul, hogy a gyerekek ma
gassga s slya pldul szleiknek tlaga, s nem azok szerint az egyszer
arnyok szerint alakul, melyeket Mendel figyelt meg. Mg a gnek sorsa
sem vlik el olyan tkletesen hordoziktl, mint valaha gondoltk. Az
egyedek vltoznak a korral; felttelezheten nincs ez mskpp biolgiai
rksgkkel sem.
Ejima Kiszeki japn klt Characters of Worldly Young Men (Nagyvilgi
ifjak tulajdonsgai) cm, 1715-ben rott munkjban a vilg minden tjn
l ids emberek nevben szlt, mikor megllaptotta: A modern vilg
les szem megfigyelje bizonnyal szreveszi, hogy mindent sszevve a

24
BEVEZET

fiak hitvnyabbak apiknl, s az unokk is csekly remnyt nyjtanak a


javulsra." Akik szerint egyik genercirl a msikra ugyanolyan vltoz
sok kvetkeznek be, mint egy-egy let sorn, azok magtl rtetdnek
tartjk, hogy a szerzett tulajdonsgok rkldnek. Elkerlhetetlen hanyat
ls vr az egymst kvet nemzedkekre is, hisz mindegyiket az elznek a
vre alapozza meg.
Abban az idben, amikor gy vltk, az rkldst a vr hordozza, nyil
vnvalnak ltszott, hogy a mgikus nedv bemocskoldsa a szennyezds
tovbbrkldsvel fenyeget. Ez logikusan kvetkezett a darwini hasz
nlat s nemhasznlat" elvbl. Ebbl az egyszer gondolatbl fakadt a
rettegs az rkld degenerldstl, attl, hogy az apk bnei jvtehe
tetlenl trkldnek gyermekeikre.
gy vltk, az egyik nemzedk vtkei megfertzhetik a mg meg nem
szletettek rksgt.A kszvny a mrtktelen italozs kvetkezmnye, de
ha egyszer bekerlt a csaldba, llandsul, s nemzedkek jzan mrtkle
tessge is nehezen tudja kitrlni. A reszketeg, dhng, lveteg alkoholis
tk vrhatan gyengeelmjsget rktenek t utdaikra. Az egyszer be
mocskolt vr rkre szennyezett marad. A tizenkilencedik szzadban ez a
hit tterjedt a npi kpzeletre is. Egsz csaldok viseltk egy-egy felttelezett
szgyenfolt blyegt. Ez a szemllet Wells, Conan Doyle s Conrad mvei
ben is megtallhat.Valamikor csak a gazdagokrl hittk, hogy az lvhajh
szs krostja rksgket. A szzad vgre azonban mr mindenki attl
tartott, hogy a jelen egyetemes kicsapongsai veszlyeztetik a jvt. Akinek
a csaldjban az idk folyamn elfordult brmilyen betegsg - valamifle
rkletes fogyatkossg -, mindent megtett, hogy titokban tartsa.
A nyugtalansg nem volt alaptalan. A tizentdik szzadban pusztt
jrvny szguldott vgig Eurpn: A kzelmltban ... belopzott Gallia
nyugati sarkaibl egy krsg, mely oly kegyetlen, oly fjdalmas, oly elbor
zaszt, hogy ahhoz foghatan irtzatosat, nla iszonybbat vagy ocsm
nyabbat mg nem ismertek e fldn." Senki sem akarta vllalni a felelss
get, hogy tle eredt a bujakr ".
A francik olasz betegsgnek neveztk; az olaszok viszonoztk a szves
sget. A szifilisz" kifejezs Girolamo Fr acastoro velencei klttl szrm<b
zik, akinek i530-ban rott balladjban egy ilyen nev psztor kapta meg a
betegsget. Ez volt annak az elkpzelsnek a forrsa, hogy mindenron el
kell kerlni a vr beszennyezdst, s innen ered, hogy sokig nem tudtak
klnbsget tenni fertzs s rkls kztt.
A tizenkilencedik szzad vgre minden tizedik brit megfertzdtt.
A felelssget nyltan a nkre hrtottk - a prostitultakra, a fertzs for-

25
A VRNKBEN VAN

FENT: A szifiliszfertzs hordozja, a Treponema

pallidum spirochaeta, amint a hcrcsejtekre tapad.

BALRA: Albrecht Drer 1484-bl szrmaz metszete


egy szifiliszes frfirl: a betegsg akkoriban j volt
s rmletes.

rsaira. A2 i864-es Fertz Betegsgek Trvnye brtnbntetsre tlte


azokat, akikrl kiderlt, hogy fertzttek. A2 els vilghbor idejn
hszezer amerikai nt helyeztek vesztegzr al; egy nmet lvedk tisz
tbb, mint egy szajha" - mondtk a katonknak.
Randolph Churchill 1873-ban, egyetemi hallgat korban kapta meg a szi
filiszt. A kezdeti tnetek jelentktelenek voltak: fjdalom a fertztt rszen
s lz. A2tn enyhltek a tnetek. vekkel ksbb Churchill kezdett furcsn
viselkedni. Obszcenitsokat vlttt oda az ellenzknek az alshzban, s
elfordult, hogy egy banketten vistott, mint egy diszn. Hsz vvel ksbb
elmebetegen halt meg, mert a betegsg agya nagy rszt elpuszttotta.
A szifilisz trkldhet egyik genercirl a msikra, mert a gyermekek
megfertzdhetnek az anyamhben. Ma mr tudjuk, hogy a betegsg kz
vett anyagt - a Treponema pallidum nev spirochaett - sajt vrram
bl juttatja a magzatba az anya.
A2 tvitel mdja pontosan megfelel az rkltt degenerltsg elkpzel
snek: a szl vtke krhozatra tli a gyermekeket. A2 rklt vrbaj vak
sgot, elmebetegsget s - olykor - hallt okoz. Churchill fia, Winston sze-

26
BEVEZET

rencsre nem fertzdtt meg, mert alig hat hnappal Randolph megbe
tegedse utn fogant - kzvetlenl a fertz peridus leteltvel. Anyja,
Jennie Churchill (aki utbb a walesi herceg, a ksbbi VII. Edward szeret
je lett) nem kapta meg a betegsget. A kapcsolat az anya fertzttsge s a
gyerekkori betegsg kztt a szlk s utdaik betegsge kzti szlesebb
kr sszefggsekre utalt.
Az rkltt vrbaj egyik tnete a slyos sketsg, amely a fertztt
anyrl rkldik t a gyermekre. ppen a sketsg volt az az rkltt tu
lajdonsg, amelyet Darwin egyszeren rthetetlennek" minstett. Persze
semmit sem tudott a gnekrl vagy mkdskrl. Az rkltt sketsg
krdseit mg ennek a tudsnak a birtokban sem knny tisztzni. Hi
szen ami nyilvnvalnak ltszik, az jra meg jra tvesnek bizonyul, az ele
inte kptelennek tn elmletekrl pedig kiderl, hogy van bennk nmi
igazsg. A vrkevereds, degenerlds s vrszennyezds elmlete is se
gtett megmagyarzni a tnyeket. Mindez figyelmeztets azoknak, akik gy
vlik, hogy a genetika az orvostudomny vagy a trsadalom minden kr
dsre vlaszolni tud- vagy egyikre sem -, s megknnyti annak a belt
st, mirt maradt oly sokig rejtve az igazsg az rkldsrl.
A tudomnyt mindig az utlagos blcsessg birtokban tantjuk. Egy
genetikai elads-sorozat tretlenl halad Mendeltl s a gneknek mint
rszecskknek a gondolattl a kromoszmkon s a DNS-en t addig,
hogy az rkltt informci ngybets kd formjban addik tovbb.
Innen mr csak egy kis lps annak kifejtse, hogy a genetikai betegsgek a
kdolsi hibk - mutcik - kvetkezmnyei, s a molekulris biolgia
csodi rvn (taln) ki lehet majd javtani ket. A hallgat mindezt egye
nes irny fejldsnek ltja. Hogyan is lehettek olyan ostobk az elttnk
jr nemzedkek? Hogyan vehettk kszpnznek a felttelezst, hogy az
emberi tulajdonsgok hordozja a vr, s hogy a krnyezet knnyszerrel
mdosthatja ket?
A helyzet az, hogy a genetika trvnyei nem trhatk fel Darwinnak s
trsainak az ismeretei alapjn. A tizenkilencedik szzadi biolgusok olyan
kvetkeztetsekrl vitatkoztak - vget nem ren -, amelyeket az emberi
csaldokban tapasztalhat jelensgekbi vontak le. Csakhogy az emberi
genetika lersa manapsg is szinte mindannak a katalgusa, ami kivtel a
mendelizmus all. Mai tudsunk birtokban tkletesen rthet, hogy
Darwin nem tallta meg a genetikai kulcsot sem a sketsghez, sem ms
hoz. Megfigyelseinek szmos rszre van mendeli magyarzat, msokra
azonban nincs; vagy azrt, mert kivtelek a trvny all, vagy azrt, mert
lteznek a DNS-en tlmen rklsi mdok is. A rendellenessgek, me-

27
A MEGFEJTETT SKETSG

Mendei zldborsval dolgozott, trvnyei azonban az emberekre is rv


nyesek. Azt tapasztalta, hogy a gnek nllan rkld rszecskk. A test
minden sejtjnek kt rszecskje (vagyis gnje) van minden tulajdonsgra;
a hm ivarsejtnek, illetve a petesejtnek csak egy. Ktfle gn ltezik. A domi
nnsokbl elg egyetlen pldny. Brmi legyen a msik, mindig a dominns
gn tulajdonsga rvnyesl. Elfordul azonban, hogy a latens gn hatsa
mutatkozik meg. Ehhez kt pldny szksges: ha az egyn egy dominns
s egy latens gnt rkl, csak a dominns tulajdonsga lesz jellemz.
A dominns esetben legalbb az egyik szlben megvolt ez a gn. Az
adottsg nem hagy ki nemzedkeket. A betegsget okoz gneknl ltal
ban az a helyzet, hogy a dominns gn hordozja meg nem tmadott sze
mllyel kt hzassgot, akinek kt pldny latens normlis gnje van. Az
ilyen csaldokban a gyerekeknek mintegy a felt tmadja meg a betegsg.
Ha pldul apjuk a betegsg hordozja, a hm ivarsejtek felbe dominns,
felbe latens gnek kerlnek, gy a megtermkenytett petesejtek fele - br
normlis gnt is hordoz - megkapja az rtalmas dominns gnt.
Az albbi csaldfn egy William Brown nev skt frfi leszrmazottai
lthatk, aki a tizennyolcadik szzadi Virginiban lt. Mindegyik vzszin
tes vonal egy nemzedk, a fggleges vonalak a szlket s gyermekeiket
ktik ssze. A frfiakat ngyszgek, a nket krk jelzik, a betegsgtl

28
A MEGFEJTETT SKETSG

megtmadottakat fekete sznek. William Brown ngyszztvenhat le


szrmazottjt sikerlt felkutatni, de a korai nemzedkekbl csak a megt
madott szemlyek s hzastrsaik szerepelnek az brn.
A csald csontnvekedst krost gnt hordoz. Ennek tbbfle hatsa
lehet; kivlthatja pldul az ujjzletek vagy a boka merevsgt, olykor a
lbujjak sszenvst. Sokan sketek, mert a hangot tovbbt apr cson
tok letapadnak a fl bels rszre. A leszrmazsi tblzat a dominns
rklds jellegzetes pldja. Minden betegnek van egy megtmadott sz
lje, s a betegsg egyetlen genercit sem hagy ki. Egy csaldban krlbe
ll minden msodik gyereken megmutatkozik. Termszetesen nem min
dig ez a pontos arny. Mint amikor pnzdarabot dobunk fel, vannak vlet
lenszer ingadozsok.
Hasonltsuk ezt ssze a msodik leszrmazsi tblzattal. Ezttal latens
gnrl van sz. A sketsg kihagy nemzedkeket, illetve egszsges szlk
nek sket gyereke szletik. Ugyanis a betegsg csak akkor mutatkozik meg,
ha az utd mindegyik szltl rkl egy hibs gnt. A hordoz frfi hm
ivarsejtjeinek felben tallhat a sketsg gnje, akrcsak hordoz partne
re petesejtjeinek felben. Annak az eslye, hogy a sketsg latens gnjt
hordoz hm ivarsejt ugyanilyen petesejttel tallkozik, 1/2 x 1/2, vagyis 1/.i. Az
rintett csaldokban minden negyedik gyerek lesz sket.

29
A V RNKBEN VAN

lyek a termszet velejri, oda vezetnek, hogy a modern genetika olykor a


. legvalszntlenebb Mendei eltti elmleteket visszhangozza. Mg az
alapvet felfedezs sem mindig rvnyes, hogy az zenet sorsa elklnl
hordozi sorstl. Darwin tvedse igazn megbocsthat.
A sketsget sidk ta ismerik. Krlbell minden ezredik brit szletik
fogyatkos hallssal, a legtbben tkletesen egszsges szlktl. A Tal
mud korltozza a sketek jogait, s Szent goston szerint a szletstl val
sketsg akadlya a hitnek, mert ki sket fllel jtt e vilgra, az igt nem
hallhatja s nem fogadhatja be". Sokan hangoztattk: nem szabad engedni,
hogy a hallskptelenl szletettek utdokat hozzanak a vilgra. Alexander
Graham Bell, a telefon feltallja plyja sorn fkpp sketekkel foglalko
zott. Aggasztotta, hogy mivel gyakran egyms kzt hzasodnak, a tovbbi
nemzedkekben a betegsg gyakoribb vlhat. rtekezs az emberi faj siket
vltozatnak kialakulsrl cm munkjban az ilyesfajta hzassgok be
tiltst javasolja. Tancsnak megfelelen ksbb nhny amerikai llam
ban sterilizltk a sketeket, hogy ne szlethessenek gyerekeik.
Sokan gy gondoltk, hogy normlis halls szlk sajt hibjukbl ad
tak letet sket gyereknek. Jellegzetes pldval szolgl a tmrl az 1648-
ban megjelent els angol nyelv knyv: Anyja, midn visels volt vele, lo
pssal vdoltatvn megeskdtt, hogy ha a vd igaz, gyermeke vilgra
jvn sose tudjon beszlni, hanem egsz letre Nma maradjon." Szmos
trtnet jrta arrl, hogy terhes nk, akik sketekkel tallkoztak, utna ha
sonlkppen krosodott gyermeket hoztak vilgra. Egy francia orvos sze
rint a krosodst a rmlet okozta, melyet Franciaorszgnak a szvets
gesek ltal val 1814-ik s 1815-ik vi lerohansa, valamint az utna kvet
kez megszlls" a terhes anykbl kivltott. Mindebben a szerzett tulaj
donsgok rklhetsgnek bizonytkt lttk.
Egyes helyeken igen gyakori volt a betegsg. Derbyshire-ben, Svjcban,
Zaire-ban s az amerikai Nagy-tavak krnykn sok hallssrlt gyerek
szletett. Marco Polo ugyanezt tapasztalta a knai Turkesztnban. A beteg
sg idnknt katasztroflis mreteket lt: Zaire egyes rszein minden ha
todik gyerek sketen s gyakran slyos mentlis krosodssal szletik. Az
egyik gc a massachusettsi partok mentn tallhat Martha's Vineyard ne
v szigeten volt. Chilmark vrosban a tizenkilencedik szzad kzepn
minden tdik ember hallskptelenl szletett.
Mi okozza ezt a jelensget? Taln valamilyen krnyezeti tnyez. 1883-
ban Alexander Graham Bell elhatrozta, hogy utnajr a dolognak. Ellto
gatott Martha's Vineyardra, s tanulmnyozta az rintett csoportok csa
ldtrtnett. Darwinhoz hasonlan sem jutott eredmnyre. Taln a ta-

30
BEVEZET

lajjal fgg ssze a betegsg, gondolta. Ahol a sketsg gcai voltak a szige
ten, ott egy bizonyosfajta agyagos talajra bukkant. Az tlet egy francia or
vostl szrmazott, aki svjci falvakban tanulmnyozta ennek a betegsg
nek a gyakori elfordulst, s egyrtelmnek ltta fldtani sszefggst.
A svjci hegyek talajban van egy bdt elem", vetette fel, amely ismeret
len okbl elidzi, hogy a gyermekek e ltfontossg rzk nlkl jnnek
vilgra. Knyvnek azonban az rtekezs afizikai s erklcsi elkorcsosulsrl
cmet adta, s a megtmadott szemlyek elklntst szorgalmazza ben
ne, nehogy betegsgk tterjedjen a kvetkez nemzedkre.
Bellnek is az volt a vlemnye, hogy br a betegsgnek krnyezeti oka le
het, veszlyezteti a vrvonalat, s gyakoribb vlik, ha semmit sem tesznek
ellene. Arra nem tallt magyarzatot, mirt cskkent (ahelyett, hogy nve
kedett volna) a tizenkilencedik szzad folyamn a sketen szletett gyere
kek szma Martha's Vineyardon. Ugyangy alakultak a betegsg svjci el
fordulsnak adatai is.
Br a gyerekkori sketsg megjelensi formja hasonltott Svjcban s
Martha's Vineyardon, tnyleges okai merben eltrek voltak. Derbyshire
ben, Svjcban s sok ms helyen a szletett sketsg helyi gcait valban
olyasmi hozta ltre, ami a talajban volt- pontosabban nem volt. Mindegyik
helyen rkk esik az es, egykor rvizek vagy gleccserek bortottk a talajt,
amelybl gy az sidkben kilgozdtak az svnyi sk, s a pajzsmirigy
mkdshez szksges jdbl kevs maradt benne. Nha azonnali volt a
hats. j-Guineban a tvoli Jimi-vlgy laki egy jdban gazdag termsze
tes ks fogyasztsrl az 1950-es vekben ttrtek a boltokban kaphat k
znsges sra. Rvidesen nagyszm sket gyerek szletett.
A pajzsmirigy nemcsak arra val, hogy teltebb s formsabb tegye a
nyakat, amint az anatmusok hittk valamikor, hanem a test energiafo
gyasztsnak szintjt szablyoz hormon forrsa is. Ez a hormon szab
lyozza pldul az embri egy rsznek fejldst. A jdszegny vidkeken
lk pajzsmirigye gyakran megnagyobbodik vagy krosodik, ezt az llapo
tot derbyshire-i nyaknak" is hvjk. Az ilyen emberek gyerekei hallssr
lshez (s slyos rtelmi krosodshoz) vezet pajzsmirigy-elgtelensggel
szletnek. A betegsg albbhagyott, amint az emberek utazni kezdtek, s
szlfalujukbl eljutottak normlis talaj vidkekre. Tbb jd kerlt a
szervezetkbe, s a sketek szma cskkent. Svjcban az i920-as vek ta
jdozzk a st, gy sikerlt rr lenni a betegsgen.
Zaire-ban csakugyan volt egy bdt elem". A helybeliek manikt et
tek, amely csak akkor fogyaszthat, ha mr kiztattk belle a mrgeket.
Ha nem jrnak el kell alapossggal, a visszamarad mrgek krosthatjk

31
A V R NKBEN VAN

a pajzsmirigyet. Azon a vidken a terhes nk jelenleg injekcikban kapnak


jdtartalm olajat, hogy a magzat normlisan fejldjn.
Martha's Vineyardon viszont a sketsg nem krnyezeti, hanem geneti
kai eredet (jllehet ezt szmos helybeli vitatta, mert nem tallt semmifle
rendszert a csaldokon bell). Az itteniek vrben volt, br inkbb kple
tes, mint bet szerinti rtelemben. Minden rintett ugyanabbl a nhny
csaldbl szrmazott: a Luce-ok, a Meyhew-k, a Smithek, az Allenek kzl,

s mg egy-kt csaldbl, amelyek mind Kentbl vndoroltak be a tizen


hetedik szzad elejn. A szigeten zrt kzssgben ltek, mg szz vvel a
Fggetlensgi Nyilatkozat utn is fontot, shillinget s pennyt hasznltak
(nem pedig dollrt s centet). Egyms kzt hzasodtak, az 1700-as vekben
mr kilencvenhat szzalkuk kzeli rokonval lt hzassgban. Chilmark
ban csaknem mindenkinek kenti neve van, ez is jelzi a genetikai kapcsola
tot angol szlhelykkel (amely maga is a Brit-szigetek elszigetelt, nma
gnak l rsze). T rtnetesen Martha's V ineyard klnleges talaj rszn
telepedtek le, ez azonban puszta vletlen volt. A kzs gnek egyestettk
ket, amelyeket genercikon t vittek tovbb a hm ivarsejtek s petesej
tek si otthonuktl tvol is.
Az itt lakk angol eldeiktl rkltk a sketsget. A magyarzat kul
cst Samuel Pepys adta meg, aki a londoni nagy tzvszrl rott beszmo
ljban idz egy beszlgetst Sir George Downinggal (akirl a Downing
Street a nevt kapta). Downingrl kztudoms volt, hogy a kormny
kmje, aki sketnma besgkbl ptette ki hlzatt, mert azok mg
knzs hatsra sem rulhattk el a titkokat. maga tudott velk kommu
niklni: Bejtt az a nma fi . . . aki flttbb jratos itt, s ismeretsgben
van Downinggal; klns jeleket mutogatott a tzrl, meg hogy a kirly
klfldn van, meg szmos egybrl, amit k rtettek, n azonban nem;
ezen elcsodlkoztam, s emltst is tettem rla Downing eltt. - Semmisg
- mondotta -, nmi gyakorlat szksges csupn, s n is jtszi knnyedsg
gel megrti t, s megrteti magt vele." Downing Kentben ntt fel az
1630-as vekben, ppen a New England-i kivndorls idejn. Nyilvn azrt
rtette a jelbeszdet, mert olyan gyakori volt a sketsg szlfalujban,
hogy gyerekknt rdemes volt megtanulnia ezt a nyelvet. Ktszz vvel k
sbb Martha's Vineyardon majdnem mindenki hasznlni tudta a jeJ.Pesz
det, akr sket volt, akr nem.
A vineyardi csaldi okmnyok tansga szerint az rkldsi smk
megfelelnek Mendel trvnynek a lappang gnek trktsrl. Alexan
der Graham Bellnek az 1880-as vekbl szrmaz kiadatlan jegyzetei kzt
van is egy megjegyzs (hsz vvel Mendel munkssgnak jrafelfedezse

32
BEVEZET .

A fl a halls s az
egyensly szerve. A kls
flet zsrral blelt csatorna
kti ssze a kzpfllel,
amelyben rezgsbe hozza
a dobhrtyt. A rezgs
hrom csontocska
kzvettsvel j ut a fl
belsejbe. Ott a spirlis
bels fl (a csigajrat)
alaktja t az agyba fut
idegjelekk. Fltte hrom,
folyadkkal telt flkrves
csatornban apr
rszecskk gyakorolnak
nyomst az alattuk
lv idegvgzdsekre,
innen erred az egyensly
s a gyorsuls rzete.

eltt), hogy azokban a csaldokban, ahol a szlk hallanak, de a gyerekek


sketek, krlbell minden negyedik gyerek szletett ezzel a betegsggel.
Bell szinte jra feltallta a mendelizmust, kt vtizeddel megelzve kort.
Annak, hogy a sketek szma cskkent Vineyardon - ami olyan sok fej
trst okozott neki-, ms oka volt, mint ugyanennek a jelensgnek Svjc
ban. Amint a sziget a keleti parti elkelsgek dlhelye lett, s mivel
tbben ltogattak ide, a helybeliek egyre ritkbban hzasodtak rokonaik
kal. gy kevesebb volt az olyan hzassg, amelyben mindkt szl hordozta
a srlt gn egy-egy pldnyt, kvetkezskpp a kt srlt gnnel szletett
sket gyermek is. Ma mr Martha's Vineyardon nincs rkltt sketsg.
Szzadunk tvenes veiben haltak meg az utolsk, akik sketen szlettek.
Senki sem tudja, melyik gn okozta a betegsget, s soha nem talltak lta
la krostott kenti rokonokat.
A gyerekkori sketsg j plda arra, hogyan idzheti el ugyanazt az l
lapotot a gnek mkdse (mint Massachusettsben) vagy krnyezeti hats
(mint Svjcban). Szmtalan egyb oka is van (tbbek kzt a terhessg alat
ti rzsahiml-fertzs, amely krostja a fejld magzatot). A veleszletett
sketsg eseteinek krlbell a fele genetikai eredet. Tbb mint harminc
klnbz gn okozhatja, mindegyik a hallszervek ms rszre hat. gy a
klnbz csaldokbl szrmaz sketek hzassgbl valsznleg nor-

33
HROM SKET EGR - MEG EGY MACSKA

A humngenetikai vizsglatokat egyre inkbb llatokon vgzik, hiszen vg


eredmnyben a tbbi teremtmny rokonai vagyunk. A gnek megmutatjk,
milyen kzeli ez a rokonsg. Az emberi gnek szzainak (kztk a betegsget
okoz gneknek is) megvan a megfelelje az egerekben vagy ms emlsk
ben. A sok milli ves evolci sorn a gneknek mg a kromoszmk men
tn val elrendezdse is megrzdtt: maradt annyi hasonlsg a klnf
le emlsk kztt, hogy rdemes legyen elkszteni az egerek - vagy kutyk,
macskk - genetikai trkpt is abban a remnyben, hogy nyomra bukka
nunk a srlt emberi gneknek. Mivel az egr gyorsan szaporodik, s fel
hasznlhat olyan ksrletekhez, amelyeket magunkon nem vgezhetnnk
el, egyre nagyobb szerepet jtszik az rkltt betegsgek kutatsban.
Darwin is szrevette, hogy a fehr macskk gyakran sketek. Ma mr
tudjuk: ennek az az oka, hogy a melaninnak - a br, a haj, a szrzet sznt
ad festkanyagnak - szerepe van az rzkszervek mkdsben. Az alb
nk, st a szletstl sz hajak kzt is sok a hallskrosodott. A megfelel
gnek az egerekben is sketsget okoznak. Az egerek gnjeinek feltrkpe
zse segtett a gn emberi megfeleljnek felkutatsban; megmutatta azt
is, hogy a problma a fejlds korai szakaszban jelentkezik, amikor a
melanint tartalmaz sejtek nem jutnak el a flbe, s nem vgzik el - korb
ban ismeretlen - munkjukat, nem szablyozzk az elektromos ramlst
ezekben az rzksejtekben.
Egyes egrmutnsok mozgs- s hallsproblmkkal kszkdnek. Izeg
nek-mozognak, s a flk szinte ki sem fejldik. A jelensget a korai ideg-

LENT: Ez az egr annak a szntelen mutcinak


a hordozja, amely eltvoltja a pigmentet a bels
flbl, s sketsget okoz.
JOBBRA: Kk szem!fehr macska - szintn sket.

34
BEVEZET

A csald tagjainak egybkntfekete brn fehrfoltok lthatk. Akiknl a fehr folt a flre is ki
terjed, azok sketek.

rendszer fejldsben szerepet jtsz gn okozza. Amikor emberi megfele


ljt kerestk, vratlanul kiderlt, hogy ez a gn okozza a Wardenburg
szindrma nven ismert emberi sketsget.
Nhny gyerek sketen s vakon szletik: valami elromlott a klvilgbl
rkez jeleket- fnyt s hangot- felfog rendszer kzpontjban. A sket
vaksg legltalnosabb formja Usher-szindrma nven ismeretes. Nem
csak a betegek szem- s flsejtjei mutatnak rendellenessgeket, hanem hm
ivarsejtjeik is. A gn azonostsnl felhsznltk azt a tnyt, hogy az ege
rek egyik flmutnsban- a shaker-I-ben - hasonl srlt sejteket talltak
(br az llatok nem voltak vakok) .
Ezt keresztekkel jelltk a trkpen, s az emberi kromoszma megfele
l helyn megtalltk a Usher-szindrma gnjt. St az egr gnjnek szer
kezete arra utal, hogy az izomfehrjvel, a miozinnal rokon fehrjt llt
el. Br a kezelsre mg nincs remny, lnyegi informcit nyertnk arrl,
milyen hiba okozza ezt a betegsget az emberben.

35
A VRNKBEN VAN

mlis halls gyerek szletik; csak minden hatodik hzassgbl szrmazik


srlt utd. Mert elfordulhat ugyan, hogy az ilyen gyerek mindegyik sz
ljtl rkl egy-egy hibs gnt, de mindegyik a fl ms rszre hat - a
betegsget pedig csak a gn kt azonos pldnya idzi el -, gy az utd
hallsa nem krosodik.
Mendelnek ktsgtelenl ppilyen fejtrst okozott volna a jelensg
(akrcsak a humngenetikusok egsz nemzedknek, amg nem sikerlt
tbb-kevsb tisztzni a folyail).atot). A sketsg rkldsnek tanulm
nyozsa sorn l}legvan a helye Darwin szinte minden elkpzelsnek. A vr
rel val kzvetlen tadsnak (mint a szifilisznl), a szerzett tulajdonsgok
rkldsnek a jdszegny vidkeken, s az atavizmusnak, amikor olyan
rokonok hzasodnak ssze, akik ugyanannak a gnnek egy-egy pldnyt
hordozzk; a veleszletett hallskrosods valamelyik formjnak kialaku
lsban mindegyik szerepet jtszik. A biolgia csupa ktrtelmsg - ez a
sketsg zenete mindenkinek, aki hajland meghallani. Ami egyszernek
ltszik, arrl rendszerint kiderl, hogy bonyolult, zrzavaros s bizonytalan.
Ezeket a fogalmakat nem szoktk a kztudatban a termszettudomny
hoz trstani. A politikai, vallsi vagy erklcsi elmletek elsznt hvei meg
vannak gyzdve rla, hogy tanaikhoz minden j tnynek illeszkednie kell.
A kutatk kzt viszont gyakori a vlemnyklnbsg, nha mg trgyuk
alapkrdseit illeten is. Ezrt kell a tudomnynak alulmaradnia a vitban,
mondjk gyakran a hvk. Holott pp az ellenkezjrl van sz. A bizonyos
sg az igazsgkeress halla. A tudomny mindenekfltt a bizonytalansg
mvszete. Elvben eldnthet minden tudomnyos vita, ha vannak olyan
megllaptsok, amelyekkel mindenki egyetrt; csakhogy ismt kezddik,
amint felmerl egy j bizonytk, melynek fnyben elhamarkodottnak lt
szik a dnts. A politika meg a valls mdszere ms, ez napnl vilgosabb.
Goethe is felismerte a rendthetetlen meggyzds veszlyeit. Hatvan
vbe telt, amg befejezte a Faustot. A tmt egy bizonyos dr. Faustus egysze
r kzpkori histrijbl mertette, aki eladta lelkt az rdgnek, s vg
romlsba jutott. Goethe a feltrul vgzet egyenes vonal trtnett ember
s termszet viszonynak bonyolult rajzv formlta. A tudomny gretei
rl s veszlyeirl beszl, a hibs vrrl s az ember vgyrl, hogy isten le
gyen. Faust halla eltt megtagadja a halhatatlansg keresst, de egy titok
megmarad. Vajon megvltst nyer, vagy fizetni tartozik? Goethe nem tudta
eldnteni a vr s a szabad akarat vitjt, mve a szerz s olvas szmra
egyarnt mlysgesen ktrtelm maradt. Azt tanstja, hogy az let legna
gyobb veszlye a bizonyossg. A genetika trtnete pedig azt sugallja, hogy
minden bizonyossg kzt a tudomnyos alapokon ll a legveszlyesebb.
1. FEJEZET

Armageddon ellentmondsa

Bsgesen megsokastom a t e magodat mint


az g csillagait, s mint a fvnyt, mely a tenger
partjn van."
MZES I. 22,17

ARMAGEDDON - HRHEZ KPEST - nmi csaldst okoz az odaltoga


tnak. Knny megtallni: szak-Izraelben a Jezreel-sksgon tallhatk
Megiddo vrosnak maradvnyai. Neve a fordts sorn talakult, s az t
let napjnak szinonimja lett. A vros romjai mlt jelkpei a pusztuls
nak. Ngyezer ves trtnete sorn Megiddt hsz alkalommal romboltk
le s ptettk jj.

Armageddon a levegbl: Megiddo vrosnak feltrt maradvnyai a falakkal s a hatalmas ga


bonaveremmel, melyben az ostrom idejre sznt tartalkot troltk. A romok a vros hatezer
vvel ezeltti kezdete s Kr. e. 722-ben trtnt asszr lerombolsa kzti idszakban keletkeztek.

37
A V RNKBEN VAN

A vrost a knanitk alaptottk Kr. e. 4000 krl. Kt vezreddel k


sbb III. Tutmzisz egyiptomi fra hdtotta meg. Rvidesen Izraelnek
az gret Fldjre bevonul npe vette ostrom al. Dvid kirly a tizenha
todik vrost ptette fl a rgiek romjain, s Salamon idejben Megiddo
ktszer akkora volt, mint Jeruzslem.
Hanyatlsa az asszrok invzijval kezddtt. Kr. e. 734-ben III. Tiglat
Pilszr kirly meghdtotta Izrael nagy rszt, a Jdetl szakra fekv te
rletet. Utda bevgezte a mnkt, s Kr. e. 722-ben lerohanta a kirlysg
utols szigett, Szamarit. Egy vvel ksbb Szargon asszr trnrks le
rombolta Izrael szmos memlkt (tbbek kzt Megiddt), s npt Ba
bilonba hurcolta, amint ezt egy diadalmas feliratban hrl adja az utkor
nak. Az elhurcoltak utdai termszetesen mindig arra vgytak, hogy
visszatrjenek. Ebbl a vgybl ntt ki az lom, hogy a Messis eljvetele
kor az dvzltek egybegylnek Armageddonnl.
Genetikai trgy ltoms ez, hiszen a genercik kzti kapcsolatrl be
szl, a ma lk tallkozsrl seikkel. Akkor majd mindenki hazra lel ott,
ahol ,,nem lszen tbb hall, sem bnat, sem knyhullats, s nem lszen
tbb fjdalom: mert ami azeltt volt, elenyszik". Az utols tlet pedig a
termszetes kivlasztds rvn trtn evolci utols lehetsge; az iga
zak dvssget nyernek, a tkletessg hjn valk pedig mindrkre a s
ttsgbe vettetnek.
Megiddo buksa volt az els az Izraelt sjt szmtalan csaps kzl.
Mindegyikbl az apokalipszis jabb ltomsa bontakozott ki. Ezkiel - aki
maga is a szmzttek kztt volt - arrl az idrl rt, amikor egy vlgy
ben a csontok sszesereglenek s hatalmas hadsereget alkotnak, Dniel
prfta tengerbl felbukkan ngy llatot jsolt vasfogakkal s tz szarv
val. Jnos jelenseiben ott a csillag (melynek neve rm) s egy htpecs
tes knyv. Az Antikrisztus kveti a 666-os szmot viselik, a Fenevad jelt.
Brhogyan alakuljanak a cselekmny rszletei, Armageddon rdekes
esemny lesz. Idejt sokan prbltk megjvendlni. Fountain Pitts, egy
tennesseebeli metodista 1857-ben szentbeszdet mondott a kongresszus
szkhzban. Neki nem okozott gondot az idpont: az egyetlen hasznos
mrtket, a szimbolikus napot alkalmazta (amelyet gy lehetett alaktani,
hogy a Jelensek knyvnek szmai beleillettek brmilyen elmletbe). Az
apokalipszis - a trtnelem vge - mr elrkezett, mondta Pitts: Midn
az Egyeslt llamok ltrejtt, Jeruzslem pusztulstl szmtva ppen
1290 szimbolikus nap telt el. . . ez az idszakasz a Szently felgyjtstl,
vagyis az r 68-ik esztendejnek 189-ik napjtl i776. jlius 4-ig tartott.
A napi ldozattl szmtva, amely napkeltekor trtnt - a csillagszat sze-
ARMAGEDDON ELLENTMONDSA

Armageddon nagy
fenevadjnak s az t ksr
rdgknek a vzija egy
tizentdik szzadi francia
kdexbl, amely a Bodleian
Libraryben tallhat.

rint hrom perccel hajnali t ra utn a Templom felgyjtsnak napjn-,


az 1290 nap i776. jlius 4-n hromnegyed hromkor telik le; s a legmeg
bzhatbb forrsok szerint a Dicssges Negyediknek pp ezen rjban
ttetett kzz a Fggetlensgi Nyilatkozat."
Kevesen lltjk, hogy az emberi mag trostlsa az utols tletben mr
meg is trtnt, csak senki sem vette szre. A legtbben heves vlsgokkal
azonostjk azt a napot, amikor sor kerl az dvzlk s a krhozatra jfi
tk sztvlasztsra. 1666-ban, a londoni nagy tzvsz vben minden
mennydrgsrl azt hittk, az utols tlet harsonja. Az Egyeslt lla
mokban a hideghbor idejn voltak rk, melyek gy adtk meg az idt,
hogy egy rval kzelebb az r visszatrshez", s azta tbb mint
ngyszz knyv, drma vagy film foglalkozott a vilg vgvel. 1988-ban a
Gallup kzvlemnykutatsa szerint tz amerikaibl nyolc szentl hitte,

39
A V RNKBEN VAN

hogy az tletnapon megjelenik az r szne eltt. A kzeli vg elrzete


azokban volt a legersebb, akik a pusztt fegyvereket ptettk, melyeknek
jvoltbl, ha netn bevetnk ket, valban tz hullna az gbl (Az ele
mek megolvadnak a forrsgban, valamint a fld is, s minden rajta lv a
lngok martalka lesz") . A Texas llambeli Amarillban a Pantex atom
bombazem csaknem minden munksa gy vlte, hogy az r msodik el
jvetelnek elkszleteiben vesz rszt.
Most is vannak vszjsl eljelei a kzelg megsemmislsnek. Cserno
bil azt jelenti, rm": a vgtlet napjra megjvendlt csillag taln kele
ten kel fl. Az is vigasztalsul szolgl az apokalipszis megjvendlinek,
hogy Szaddm Huszein Bagdadja rendkvl kzel van az si helyhez, ahol
Babilon llt. De azon mg lehet vitatkozni, hogy ki fog tmenni a vgs
vizsgn. Az alabamai baptistk (Bill Clinton is ehhez az egyhzhoz tarto
zik) a legkorszerbb eljrsokkal szmtottk ki, hogy az Egyeslt llamok
npessgnek 46,1 szzalka pokolra jut. Msok vitatjk ezt a szmot.
Brmikor jn el a vilg vge, s brmi trtnjk, amikor eljn, egy pr
fcia vilgos: mindenki egybegylik Armageddon sksgn. Hnyan lesz
nek? Jellt van bven, semmi ktsg. Csak Angliban a halotti anyakny
vek vezetsnek megkezdse, vagyis 1837 ta eltelt rvid idszakban nyolc
vanmilli ember halt meg. Tudomnyos mdszerekkel nyilvn meglla
pthat, hnyan sorakoznak fel majd tletrt a vilg kezdettl a vgig.
Minden igazi hv biztos abban, hogy sei kiszllnak srjukbl az tlet
napon. Ez a szerny felttelezs fljogost bennnket egy egyszer, m ag
gaszt szmts elvgzsre. Tegyk fel, hogy a vgtlet trombitja taln
2000-ben harsan fl, amint a millenaristk lltjk. A szmzets Megid
dbl 722-ben trtnt. Ez azt jelenti, hogy krlbell 2700 ven - mintegy
szzharminc emberltn - t sokasodtak az sk, akik majd egybeseregle
nek Armageddonnl. A ktivar szaporods alapszablya, hogy kt egyed
szksges egy jabb ltrehozshoz. Mindenkinek kt szlje, ngy nagy
szlje, nyolc ddszlje van, s gy tovbb visszafel a trtnelemben.
A nemisg azt jelenti, hogy a leszrmazsi tblzatban szerepl egynek
szma minden nemzedkben megktszerezdik. Kvetkezskpp minden
nemi lnynek hihetetlenl sok se van.
Ha a nemisg trvnyt sz szerint rtelmezzk, s meg akarjuk hat
rozni egy armageddoni csaldi tallkoz rsztvevinek szmt, elszr is a
kettt meg kell szoroznunk nmagval szzharmincszor; ehhez hozz kell

TLOLDALT: Armageddon: a holtak kiszllnak srjukbl az utols tletre. Csekly tredk az


egybeseregl roppant sokasgbl Hans Memling i472-bl szrmaz oltrkpn Gdari.skban.

40
41
A VRNKBEN VAN

adnunk a csaldfa minden szerepljt az l hv s az imnt meghat


rozott hatalmas gylekezet kztt. A szm tzezerbilliszor billiszor billi
- a tz utn negyven nulla ll. Az utols tlet flttbb tumultuzus alka
lom lesz.
Csakhogy van itt egy problma. A szm jval nagyobb, mint a vilg n
pessge. Az igazat megvallva jval nagyobb, mint azoknak a szma, akik
valaha ltek a Fldn. A londoni Npszmllsi Hivatal anyaknyvi iratt
rnak vezetje egyszer kiszmtGtta, hogy hatvanmillird ember halt meg
Kr. e. 40 ooo-tl Kr. u. i983-ig, ami maga is elg zsfoltt tenn Armaged
dont - de nem kptelenl; nmi igyekezettel mind befrnnek Skciba.
Csakhogy az sk sokszorozdsnak egyszer trvnye a feltmadt holt
testeknek a Fldnl is nagyobb tmeg golybist gri. Ez Armageddon
nagy ellentmondsa - egyszeren nem lesz elg a hely az egybeseregl h
vknek.
A megolds egyszer, de az skrl, rokonsgrl s gnekrl alkotott
hiedelmek lnyegbe vg. Amikor Megiddt utoljra ptettk jj, szz
millinl kevesebb ember lt a Fldn - nem az a szmllatlan millird,
aki ahhoz kellene, hogy minden ma l szemly visszavezethesse kln le
szrmazsi gt a mltba. Amibl azt az egyszer s elkerlhetetlen kvet
keztetst kell levonnunk, hogy a modern vilg minden lakja egyenes gi
leszrmazottja valakinek, aki Megiddo idejn lt s utdokat nemzett. Ter
mszetesen az akkor lk kzl soknak nincsenek ivadkai, mert k ma
guk vagy utdaik gyerektelenek voltak. De azok, akiknek csaldja fennma
radt a szksges hromezer ven t, brkik voltak s brhol ltek is, meg
szaktatlan rokonsgban vannak mindenkivel (vagy csaknem mindenki
vel), aki ma l. Kvetkezskpp mindegyiknknek kzs sei vannak min
denki mssal; rokonok vagyunk mindannyian. Ha elg messzire visszave
zetjk brmelyik csald szrmazst, egybeolvad az sszes tbbivel egyet
len kzs leszrmazsi folyamban, amely meglepen kzeli mltbl ered.
Az els Armageddon idejn csak ktfle ember ltezett: azok, akik min
denkinek sei, s azok, akik senkinek sem sei, mert nem hagytak utdo
kat. Nhny tvoli npcsoport egy j-guineai vlgyben vagy afrikai dzsun
gelben taln kimaradhat ebbl a rokonsgi hlbl; de egy arab keresked
vagy eurpai felfedez egyetlen, nhny vszzaddal ezeltti flrelpse
napjainkra ksi rkseinek ezreit fonja bele.
A keresztnysg minden vltozatnak fontosabb volt, hogy eldntse,
ki lesz a Vlasztottak kzt, mint hogy kiszmtsa, hny jellt sorakozik
majd fel a vizsgra. Kezdettl fogva lelkes trit munkt folytattak, hogy
ilyen mdon nveljk azoknak a szmt, akik majd tmennek a vizsgn.

42
ARMAGEDDON ELLENTMONDSA

Az evanglistk ma is szorgosan hirdetik az igt a vilg hatmillird lakos


nak. De csak egyetlen egyhznak jutott eszbe - holott annak, aki hisz a
feltmadsban, logikus -, hogy a holtak tzszer nagyobb sokasgnak pr
dikljon. Ha az lk megkeresztelhetik seiket, hihetetlenl megnvekszik
azoknak a szma, akik tmennek az tletnapi vizsgn, hisz minden ma l
hv minden se ott lesz a kivlasztottak kztt. A visszamenleges meg
vlts a vilg leggyorsabban nvekv vallsnak, Jzus Krisztus tletnapi
szentjei egyhznak, a mormonoknak a tanttele.
Hitvallsuk klns mdon egyesti a modern tudomnyt s a miszti
kus hiedelmeket. Ennek ksznhet, hogy a mormon egyhz a vilg egyik
nagy genetikai laboratriumv lett. Igyekezetkben, hogy hveket tobo
rozzanak, flrajzoljk az emberi faj csaldfjt. Rokonsgi hlt sznek,
amelyrl azt remlik, hogy egybefonja egyhzukat a rgen elhunytak soka
sgval. Ekzben feltrkpeztk a mltba vezet sajt genetikai svnyei
ket, s - akaratlanul - dnt szerepet jtszottak a biolgusok erfesztsei
ben, hogy trkpet rajzoljanak napjaink genetikai llomnyrl.
A mormon valls egyetlen ember, Joseph Smith prfciibl ntt ki.
Nmelyik amerikai mindig is gy tallta, hogy a Bibliban van egy rthe
tetlen hinyossg: egyetlen esemnye sem trtnik az Egyeslt llamok
ban. Joseph Smith, az jvilg els prftja minden tle telhett megtett,
hogy ezt a csorbt kikszrlje. i805-ben szletett Vermontban. Az orszg
a vallsi forrongs llapotban lt. Joseph Smithnek tizenngy ves kor
ban jelent meg az Atyaisten s a Fiisten, hogy mindketten va intsk t a
hamis prftktl.
A kincskeres Smith buzgn sott az indin dombokon. Nem tudta el
hinni, hogy ezeket a megvetett rzbrek ptettk. Hamarosan megis
merkedett egy angyallal, Moronival, aki t vlasztotta ki, hogy kezbe ad
jon egy klns dokumentumot, amelyet ismeretlen rssal aranyleme
zekre vstek s az egyik halomba temettek. Mellette hromsark gymn
tokbl kszlt mgikus szemvegek ( leskvek") voltak. A hitetlenekre
hallt hozott, ha a tblkra pillantottak, de a kivlasztottak a szemvegek
segtsgvel le tudtk fordtani az zenetet. Joseph Smith hossz jszak
kon t diktlta a tblk tartalmt elkpedt csaldjnak.
Moroni elhozta a Biblia hinyz ktett, A mormon knyvt, amely kul
csot adott az amerikaiak szrmazsnak rejtlyhez. Szmzttek voltak
az gret Fldjrl; idtlen idkkel ezeltt keltek t az Atlanti-cenon, s
az idk vgn majd egybesereglenek a sajt kln Armageddonjuknl.
Lehi prfta Kr. e. 600-ban hajzott t Jeruzslembl Amerikba fiaival,
Nefivel s Lamannal.

43
A VRNKBEN VAN

Arnold Friberg mormon stlusban


megfestett oltrkpe, amely
Lehit s npt brzolja, amint
megrkeznek Amerikba.

Az jvilgban egyhzszakads tmadt. Az ellentt Smith New York l


lambeli, palmyrai otthonnak kzelben jutott tetfokra. Kr. u. 420-ban a
felek sszecsaptak a Cumorah hegyn (amelyet Smith egy helybeli indin
halommal azonostott). Laman kveti gyztek, de kegyvesztettek lettek
Istennl. Brk megsttedett, s leszrmazottaik indinokknt ltek to
vbb. Smith tallt nhny egyiptomi feliratot, melyeken azt olvasta, hogy
maga Krisztus is elltogatott az jvilgba, ezt rkti meg Ketzalcoatl, a
Tollaskgy trtnete.
Az igazsg a halmokkal kapcsolatban jval przaibb. Fldmvesek p
tettk ket. Az egyiknek, Cahokinak, amely ma St. Louis nyomorsgos
klvrosa, hszezer lakosa volt. A Londonnl nagyobb vroshoz foghat
nem akadt szak-Amerikban, amg Philadelphia a tizennyolcadik sz
zadban nvekedsnek nem indult. Cahokia halmnak tmege nagyobb,
mint a Kheopsz-piramis. ptit elvittk a betegsgek, melyeket a fehr
ember hurcolt be a kontinensre. Az Armageddonjuknl nem fegyverek
puszttottak, hanem a ragly.

44
ARMAGEDDON ELLENTMONDSA

A maguk idejn nem szmtottak kivtelesnek Smith kinyilatkoztatsai,


st oda vezettek, hogy 1830-ban megalaptotta Jzus Krisztus tletnapi
Szentjeinek Egyhzt. New England tele volt szektkkal. Az adventistk,
akiknek egyhzt szintn Smith otthona kzelben alaptottk, elkvettk
azt a taktikai hibt, hogy a msodik eljvetel idpontjul 1843 mrciust
jelltk meg, ami az adott v prilisra knos helyzetbe hozta ket. Ebben a
lgkrben az emberek komolyan vettk Moroni trtnett. Mg Angli
ban is a levegben volt a miszticizmus. A szocialista Robert Owen ksz
netet mondott Viktria kirlyn apja, Edward kenti herceg szellemnek,
aki tudtomra adta, hogy a spiritulis szfrban, ahov belpett, nincse
nek cmek s rangok". A mormon misszionriusok lnk tevkenysget
folytattak Walesben s Liverpoolban - ahol lapot is kiadtak Millenial Star
cmmel -, s ezrvel vettk r az embereket, hogy jjjenek Amerikba, le
gyenek rszesei az j Utpinak. Az Indiana llambeli New Harmonyban
Robert Owen mr felptette a sajtjt: a trsadalmat, amelyben mindenki
egyenl fizetst kapott. De a vros nem virgzott.
Amg a mormonok vrtk az amerikai Messis eljvetelt, a hatsgok
egyre nyugtalanabbul figyeltk vallsuk trhdtst. A szekta elkltztt
az Illinois llambeli Nauvooba, a Mississippi partjra, s itt templomot
ptett. A hitk ellen intzett szmtalan tmads kzl az els - Philastus
Hurlbut A mormonizmus leleplezse cm knyve - alapos ellensgeskedst
vltott ki. A mormonok lassan gy reztk, nincs jvjk az Egyeslt lla
mokban. Megprbltak elszakadni Illinoistl, terveket forraltak mg Texas
megszllsra is. A botrny egyre ntt, fkpp a tbbnejsg miatt. Smith,
akinek negyvenkilenc felesge volt, bujklt. Vgl elfogtk, meglincseltk
s fbe lttk.
1846-ban egy egsz np kerekedett fl: Brigham Young vezetse alatt
megindultak nyugatra. Ezrek vndoroltak t a hegyeken, sokan kzikocsin
hztk maguk utn ingsgaikat. Vgl egy folyvlgybe rtek; Jordnnak
neveztk el a folyt, amely nvadjhoz hasonlan egy desviz tbl ss
vizbe ramlott. Salt Lake Cityben a mormonok gyarapodtak, s a ma is
mert hatalmas szervezett fejldtek - tzmilli hvet szmll egyhzz,
amelynek ltszma harminc v alatt hatszorosra ntt, s vi jvedelme
tzmillird dollr.
Akrcsak az testamentum npe, a mormonok is megszllottai az
sknek, s akr az jtestamentum, a tlvilgnak. Szertartsaik nagy r
sze a hvket kti ssze rokonaikkal s seikkel - vagyis megpecsteli
kapcsolatukat". A mormon menyasszonyt bonyolult szertartssal ktik
frjhez, amelynek sorn tlp egy ftyolon a jelkpes msvilgba. lete

45
A VRNKBEN VAN

htralv rszben fehr alsnemt visel (rssel a hzastrsi lt megkve


telte helyen) annak a kntsnek a jelkpeknt, melyet Isten adott vnak.
Akiknek kapcsolatt megpecsteltk, azok klnleges kzfogssal dvz
lik egymst - a szg biztos jelvel". Nhny vvel ezeltt mg volt egy
gesztus, amely a torokelmetszst jelezte, azoknak a bntetst, akik elrul
tk a szertarts titkait.
1847-ben a utahi mormon kzssg Brigham Youngbl s ktezer kve
tjbl llt. Hrom ven t>ell szmuk tszrsre ntt, s 1870-re majd
nem szzezer mormon lt az llamban. Sokan Anglibl s Skandinvi
bl vndoroltak be, de a legtbben a mr jonnan alaptott Jeruzslemk
ben szlettek. A tizenkilencedik szzad vgn egy mormon nnek tlag
nyolc gyereke szletett. A npessg gyarapodott. Az els telepesek kzl
nmelyiknek tizenktezer leszrmazottja l ma. Ehhez a tbbnejsg is
hozzjrult: csak Brigham Youngnak (akirl egy korabeli humorista azt
mondta: Utahban a csinos lnyok rendszerint Younghoz mennek feles
gl") tvenhrom gyereke volt huszonht felesge kzl tizenkilenctl -
egy emlkezetes hten kilencen szltek. A hagyomny azrt alakult ki,
mert a korai mormon kzssgben sokkal tbb volt a n. Ma mr a
mormonok kzt sem szoks a tbbnejsg, br nhny szakadr szekta
mai napig ragaszkodik ehhez a joghoz.

Utah, az gret Fldje:


az testamentum s az jvilg
prhuzamai. A plaktot a Rio
Grandc Nyugati Vasttrsasg
adta ki, hogy mormon telepeseket
toborozzon Salt Lake Citybe.
ARMAGEDDON ELLENTMONDSA

Legi felvtel Salt Lake


Cityrl. Eltrben
a mormon templom

tetejn Moroni angyal


aranyszobrval),
mgtte a mormon
szentsghz, a krus
otthona. A tvolban
lthat ftvonal
vgigfut a Jordn foly
vlgyn a Nagy-sst
fel.

Brmilyenek voltak is a hzassgi szoksaik, a mormonok kezdettl fog


va gondos feljegyzseket ksztettek a csaldrl. Sokan rokonok ezreit tart
jk szmon. Gyakran rendeznek csaldi tallkozkat, nha kibrelnek egy
sportcsarnokot, hogy mindenki elfrjen, akinek ott a helye. Klnsen ar
ra bszkk, ha vissza tudjk vezetni csaldfjukat az els telepesekig, akik
nyugatra vndoroltak s tkeltek a Wasatch-hegyeken a Jordn vlgybe.
Akiknek ez a leszrmaztats sikerl, azok szolgltatjk a nyersanyagot a
nagyszabs munkhoz, melynek kezdemnyezit nem annyira lelki, mint
inkbb tudomnyos okokbl rdekli a leszrmazs.
A utahi egyetem a mormon templomra nz hegyek lbnl ll. A haj
dan jelentktelen, isten uralmi" mlt llami egyetem ma a vilg humTh
genetikai kutatkzpontja. Sikert a mormonoknak s az emberi rkls
re vonatkoz knyveiknek ksznheti. Az genealgiai feljegyzseiknek
s Utah llam orvosi nyilvntartsainak egyestsvel hozta ltre az egye
tem a Utahi Npessg Adatbzist, amely tzezer korai mormon telepes
msfl milli l leszrmazottjnak adatait tartalmazza, kztk a vilg n
hny legnpesebb csaldjt.

47
A VRNKBEN VAN

Mormon csald az 1870-es vekben. A frjnek, kt felesgnek s kilenc gyereknek ma mr ta


ln tzezer leszrmazottja is l.

Az ilyen rokonsgok hasznosak a genetikai trvnyszersgek felfedez


snl. Pldul meg lehet vizsglni, vannak-e betegsgek, melyek gyakoriak
egy-egy rokonsgi csoporton bell. Ha igen, felttelezhet, hogy genetikai
okaik vannak. A mormonoknl a hererk s a fehrvrsg elssorban bi
zonyos csaldokon bell fordul el. Tagjaik taln sose tallkoztak, s igen
klnbz letmdot folytatnak, de sokan mr magukban hordozzk a
hallukat, mert kzs stl szrmaznak. A hlyag- s mjrk nem jelent
kezik ilyen csoportosan, ezeknek a kialakulsban valsznleg nem jt
szanak olyan fontos szerepet a gnek. Figyelemre mltbb a dohnyzs s a
vegyszerek hatsa.
A mormonok mg alapvetbb mdon is hozzjrulnak a genetikai ku
tatsokhoz. Amikor a jv vezred elejn elkszl az emberi DNS teljes fel
trkpezse, amelyen most dolgoznak az Emberi Genom Programban
rszt vev kutatk, ez nagymrtkben a mormon gnen alapul majd. Az
egyhz szmos hve adott vrt a gnkutatknak: gyerekek, szlk s nagy
szlk. A vr Prizsba kerl, a kisemberek Panteonjba, a Centre des
tudes des Polyrnorphismes Humaines hatalmas mlyhtjbe.
A francik gy trkpezik fel az emberi gnek rendszert, mint annak

......
ARMAGEDDON ELLENTMONDSA

idejn az angolok a Fldet. A vilg fldrajznak horgonyzsi pontja


Greenwich, de a gnek szilrd alapja Prizsban lesz. A biolgiai trkp el
ksztst az egynek kzti rkltt klnbsgek teszik lehetv.
Az emberek kitnen meg tudnak klnbztetni mindenkit mindenki
mstl, olyannyira, hogy az egyformasg - az ikrek - zavarja ket. Az arc
nemcsak a szemlyazonossgot rulja el, hanem a csaldi hovatartozsnak
is nyomra vezet. Ugyanez a helyzet a gnekkel. Az emberi testben krl
bell hatvanezer mkd gn van. Kzlk taln szz teszi olyan vlto
zatoss a kls megjelenst, hogy mindenki felismer mindenkit. Az em
beri sokflesg messze fellmlja az arcon megmutatkoz vonsokat.
A DNS-szerkezet aprbb eltrseinek megllaptsra szolgl nhny
technikai eljrssal ki lehet mutatni, hogy genetikai rtelemben mindenki
egyedlll.
A klnbsgek felmrse az els lps a gnek felkutatsa sorn. A fran
cik risi erfesztssel lttak hozz minden trkpkszt alapveten
unalmas, de nlklzhetetlen feladathoz: kijellik a pontokat, melyekhez
a tereptrgyak helyt viszonythatjk.
A mormonokat hasznljk arra, hogy felvigyk a genetikai trkpre a
trkphlzatot. Az DNS-ket vizsgljk a klnbz vltozatok helyze
tnek felmrshez. Millinyi vltozat van, nmelyikben csak egyetlen
DNS-szakasz fr el, de legtbbjk a ngybets genetikai bcnek csak kt
DNS-bzisn, a C s A betn alapul. A genetikai anyagban sztszrtan CA
ismtldsek tallhatk; nha kevs, nha sok. Ezek a gnrendszerben val
utazs mrfldkvei. Segtenek kijellni a genetikai llomny rdekesebb
rszeinek helyt.
A CA-ismtldseken s ms mrfldkveken alapul vonatkoztatsi
pontok ezreit jelltk ki mr az emberi gnrendszer hromezermillird
DNS-betje mentn. Ezekre pl a genetikai anyagnak a DNS-betk
rendjn alapul fizikai trkpe". Ha egy adott CA-ismtlds gyakran
elfordul egy bizonyos mkd gnnel egytt, a kett nyilvn kzel van
egymshoz.
A vilg trkptl eltren a gnek trkpe vltozik az idk folyamn.
Egy gyerek DNS-llomnynak fele apjtl, fele pedig anyjtl szrmazik,
teht a szlk gnjei nemzedkrl nemzedkre keverednek gyermekeik
ben. Ezzel megvltoztatjk a genetikai zenetet hordoz szakaszok trsu
lsait. A szli gnek gy keverednek az utdokban, mint a krtyban a le
osztott lapok; ez a folyamat a rekombinci. Ha kt gn (vagy kt CA is
mtldsi sor) elg kzel van egymshoz a DNS mentn, kisebb a valsz
nsge, hogy a szlkhz kpest a gyerekekben trendezdik. Ha a kett

49
DNS-SZAKASZ KIVGSA S BEILLESZTSE

Egy hastenzim - a DNS kivgsra szolgl molekulris oll - rntgen


krisztallogrfiai kpe a DNS-lnc vgrl (lent kzpen) nzve; a fehrje
lncok (ezen a szmtgpes modellen sznes szalagok s rugk brzoljk
ket) ppen felismernek egy jellegzetes, hat DNS-betbl ll szakaszt, s
rtapadnak. A fehrjekarok bekeldnek a DNS barzdiba, kszen arra,
hogy tvgjk. A hastenzim olyan pontosan illeszkedik a szakaszhoz, hogy
ha ennek hat betjbl egy megvltozik, milliszor kevesebb az sszetapa
ds. Tbb szz klnfle hastenzim ltezik, amelyek szmos klnbz
DNS-szakaszt ismernek fel. A kapcsolds pontossga kvetkeztben a cl
szakasz elhelyezkedsnek egynenknti eltrse ms s ms rajzolatot
eredmnyez a DNS metszetben. A hastenzimek mutattk meg elsknt a
DNS rendkvli vltozatossgt. Ezek az enzimek fontos szerepet jtszanak
a gygyszatban is. Egy meghatrozott betegsg gnje (amelynek a helyt
esetleg mg nem is sikerlt megllaptani) rkldhet nemzedkeken t egy
kzeli szakaszvltozattal egytt, amelynek jelenlte a DNS-metszet kpnek
eltrse alapjn leplezhet le. Ez aztn felhasznlhat a diagnzishoz.

Bakterilis ereden hasten=im s:erke::ete ht11l11=etbe1L A: enzim .olljt" kpez, kt egy


msba kulcsold fehrjespirl sznezse zld s lila; maga a DNS a kpe11 narancssrga.

50
ARMAGEDDON ELLENTMONDSA
,_

tvol van egymstl, megtrik kztk a DNS-lnc, gyakran jraegyesl, s


minden generciban j meg j elrendezs alakul ki.
gy ha a gyerekek gnjeinek vagy DNS-szakaszainak rendjt sszevetjk
a szlkvel, jabb trkpfajthoz jutunk: ennek nem a kmiai szerkezet
az alapja, hanem a genetikai folyamat. Felrajzolsa sorn kis gncsoportok
rekombincijnak mrtkt vetik ssze. Az ecetmuslickon mr j ideje
elvgeztk az eljrst, de az emberekre vonatkozan alig kezdtk el. A mo
dern genetika legmeglepbb felfedezse, hogy a fizikai s biolgiai trkp
igen klnbz, mert a DNS nagy rsznek nincs lthat feladata, csupn
elvlasztja egymstl a mkd gneket. Jelenltt a rekombinci alapjn
megrajzolt trkpen szinte szre sem venni, a fizikai trkp tjait azonban
jrszt ez a tbblet-DNS tlti ki.
A mormon csaldok hasznosak mindktfajta trkp elksztsnl,
mert igen npesek. Szmtalan rokon kapcsoldik ssze cskken hasonl
sg nemzetsgg, vagy klnl el, ahogy egyre tbb lehetsg addik a
genetikai krtyk jrakeversre a hm ivarsejtek vagy a petesejtek kpz
dse sorn.
Elfordul, hogy a mormon csaldban rkltt betegsg van. Ha az ezrt
felels gn vletlenl kzel helyezkedik el valamelyik feltrkpezett ter
lethez, akkor nagy a valsznsge, hogy nemzedkeken keresztl elksri a
csaldot. Ha a terlet a krosodott gnhez nagyon kzel van (vagy azon
bell), majdnem minden betegben ott a megfelel mrfldk. Ha tvo
labb van (s rendszerint ez a helyzet), a rekombinci rvn megszakadhat
a kapcsolat a gn s a hozz kzel es feltrkpezett pont kzt. gy akad
hatnak betegek, akikben nem mutathat ki a feltrkpezett szakasz. De ha
elg beteget vizsglunk, gy is nyilvnvalv vlik kztk a kapcsolat. Hogy
a gn hozzvetleges helyt megtalljuk, csak azt kell ltnunk, vajon a be
tegek esetben msokhoz kpest nagyobb-e annak a valsznsge, hogy
hordozzk a vltozatot. Akik a francia trkpet hasznljk, azoknak nem
kell vakon keresglnik a DNS hatalmas tjkpn, hanem elegend a tr
kprcshoz viszonytaniuk a srlt gneket. Ez a megolds mr eddig is
hozott nhny genetikai sikert.
Az emlrk szmos esetben korai hallhoz vezet. Rendszerint szrv
nyosan bukkan fel, s ritkn fordul el ismt egy adott csaldon bell. Sok
rkbetegsghez hasonlan nem egyetlen rendellenessg, hanem betegsg
csoport. De van rkltt formja is. Azok, akiknek anyjt megtmadta a
betegsg, maguk is veszlyeztetettek, ha rkltk a srlt gnt. Egy hsz
ves nnl, aki a megvltozott gn letkpes formjt hordozza, szzszoros
az emlrk kockzata.

51
GNTRKPEZS:
EGY ISMERETLEN FLD ATLASZA

A DNS trkpe sokkal gyorsabban kszl, mint br kulris biolgia kutatja ezt a dnt mondatot -
ki vrta volna. A hromszzmilli emberi DNS And is this blood then frmed but to be shed?" -
egysgbl (vagy a ngy bzis - Adenin, Guanin, taln gy bontan fel, hogy rszleges kezelssel sza
Citozin s Timin - alkotta prokbl) ll teljes so kaszokra szabdalja mindentt, ahol a H bet el
rozat rviddel 2000 utn feltehetleg a kutatk ren fordul. fgy klnbz tredkeket kapunk.
delkezsre ll. Mindenfle technikai trkkt igny
1) A N D I S T (6)
be vettek. Sok eljrs a hastenzimeket hasznlja HIS BLOOD THEN FORMED BUT TO BE S (26)
fel, hogy meghatrozott pontokon vgja el a DNS-t. ED (3)

Elszr egy emberi DNS-darabot illesztenek be 1) AND I S THIS BLOOD T (15)

egy vrusba, baktriumba vagy lesztbe, amely HEN FORMED BUTTO BE S (17)
HED(3)
nvekeds kzben ezt megsokszorozza. Nha ehe
1) AND IS T (6)
lyett vegyi ton lltanak el nagyszm msola
HIS BLOOD THEN FORMED BUT TO BE SHED (29)
tot. Azutn hastenzimmel egy meghatrozott
1) AND IS THIS BLOOD T (15)
helyen elvgjk a DNS-t. Ha ez elg gyorsan trt HEN FORMED BUT TO BE SHED (20)
nik egy kmcsben, amely sok pldnyban tartal
mazza ugyanazt a DNS-darabot, az enzimnek csak Ha hosszsg szerint klnvlasztank ket (a be
arra van ideje, hogy mindegyiket nhny helyen tk szma mindegyiknl zrjelben szerepel), s
hastsa el: ez a rszleges kezels. A vgs helye min fllrl lefel elolvasnk, a fentiekbl elektrofor
den darabon ms s ms, gyhogy a DNS egy sor zis utn kialakul sma egyenknt az albbi lenne:

HOSSZSG KEZELS
klnbz mret, egymst tfed metszetre da

BETKBEN
raboldik. Ezek elklnthetk elektroforzissel
(olyan mdon, hogy a DNS-t elektromos ertrrel 2 3 4
szrik meg). Ha a szakaszokat mret szerint sorba 3
rakjuk, egy szmtgp ki tudja keresni az egymst 6
tfed mintkat, s ebbl megllapthat, mikpp
rendezdtek el az eredeti molekuladarabban. 15
Vajon a vronts elkerlhetetlen.rsze az emberi . 17
llapotnak? - krdezte Byron, akit nagyon rdekelt 20

a nemisg s a sors. Don Juan cm verst sokat 26


boncolgattk az irodalomelmlet tudsai. A mole- 29

, J 1 1
... 1 1 1 1 11 1 1 t 1 l t ' t J 1 ' - 11 1 t l 1
J

GCTCTl:TT GC G G TG G G a: c GGGC T G G <.. T G C T G


150 70 80 90 100 1 10

52
Ha a szakaszokat nem is rtjk, a rsz Homocystinuria due to MTHFR defldency
Ehle<sDanlos syndtome, typt VI
letek akkor is sorba rakhatk olyan uroblastoma

f-!;;1="'--l"harcoH.4arle-Tooth dlsease. 11
EIHptocytosiS1
mdon, hogy egyms utn kvetkez H pophosphatasia, 1nl1n11le

s egymst tfed tredkeket kere n y


J----iJ K
: = :wm::flcie e
snk. Csak megfelel elrendezs utn
jn ltre a szakaszoknak az elektrofore
tikus glen lthat kombincija. p

Amikor a kezelhet rszeket ilyen


mdon sorba raktuk, a kvetkez lps
az, hogy leolvassuk az egyes betGket.
A DNS-bc ngy betje leolvashat
pldul gy, hogy mindegyikhez kmi
ai cmkt kapcsolunk, s levgjuk a t
redkrl. Manapsg ezt gpekkel vg
Gaucher disease
zik. Az eredmny egy adtt bet (A, G, Pk detideney hemotytlc anaemlli
Nemaline mylhy
q
C vagy T) jelenltt egy sznes grbe CharcotMarie>oth dsuse. type 1::1
OejenneSonas disease
cscsaiknt brzolja. Az itt bemuta Glaueoma, juven1le-onset
FactorV deficiency

sea
tott rszlet egy DNS-darab kinyomta Antithrombin lll defieleney
Chronic granulomatous dl se due to NCF2 deticiency
tott kpe, amely a csontkinvses ke Epidefmotysis bullon, Herhtz junctlonal type
ardtomyopathy,famtllll hypertrophc. 2
mnyeds nev betegsg gnjnek k Hypokalemlc pe<1odlc parolysls
FactorXlllS defbency
zelben helyezkedik el.
Ezeknek s ms mdszereknek az
alkalmazsval lehetv vlt az emberi
betegsgekrt felels gnek szzainak
feltrkpezse. Az 1-es kromoszma
pldul a Gaucher-szindrma (a mj, a
lp s az idegrendszer betegsge), a
Usher-szindrma (egyfajta sket-vak
sg) s az Ehlers-Danlos-szindrma
p
(a ktszvet betegsge, amely nyl
kony brhz" vezet) gnjeinek hordo
zja. A 10-es kromoszmban van tb
bek kztt az izomsorvads, az rk
Sideroblastic anemla
ltt szemdaganat s a vrzkenysg 11.+===:::!=:====rl Aarskog.Scott syndrome
K deficiency hemotylic: anemia
gnje. CharcotMarieTooth ctisuse
2 Chotoideremla
Az bra nhny gn elhelyezkedst q Cteh palate, Xlmktcl
S,,.sbe parapl-. Xlnkod. 2
mutatja a huszonhrombl mindssze Oeafness with stapes fixat;on
PRPSrelated gout
kt kromoszma mentn. Az inform
ci legnagyobb rsze nem vonatkozik
ismert funkcij gnekre: ritka, mint a
fehr holl az olyan gn, amelynek fel A szerz ltal
adatt mr pontosan meghatroztk. sszelltott gntrkp
sy ome
Colourb'indness (several fonns)
Oyskeratosls congenita
TKCR syndrome

EmeryOrettuss muscular dystrophy


Diabetes ln$1pidus, nephrogenN:. X-ltnked
Myotubular myopa:hy, X.finktd
0Wpola1odog'1al synd<ome. !ype 1

53
A VRNKBEN VAN

A csaldi emlrk legtbb esetrt felels gnt a Utahi Egyetem egyik


kutatcsoportja fedezte fel. A helyzetre utal els jelzssel egy mormon
csald vizsglata szolglt, ahol nagy szmban fordultak el megtmadott
egynek. Ez felhvta a figyelmet a kapcsolatra a betegsg s egy rkltt va
rici kzt, amelyet mr feltrkpeztek egy bizonyos, a tizenhetes szm
kromoszmban. Nhny hnapon bell megtalltk magt a gnt is. Ve
szlyeztetett nk esetben egy megfelel vizsglat ma mr jval az els t
netek megjelense eltt kimutatja, rkltk-e a betegsget vagy sem.
A vizsglat s a kezels kiltsa azt jelenti: a veszlyeztetett mormonok
nak hasznra vlt, hogy sszefggst kerestek a jelen megprbltatsai s a
mlt rksge kzt. Csakhogy a mormonok igyekezete, hogy kapcsolatot
teremtsenek a halottakkal, nem ll meg az rkltt betegsgek tanulm
nyozsnl.
Salt Lake City alaptsnak vben adta kzre Nyikolaj Gogol az egyik
legnagyobb orosz regnyt, a Holt lelkeket. A knyv cselekmnye igen t
letes. Egy gtlstalan kalandor, Csicsikov miniszteri tancsos beutazza
Oroszorszgot, s megvsrolja a fldbirtokosoktl az utols adkivets
ta elhunyt jobbgyok nevt. rtkesek voltak, mert fel lehetett hasznlni
ket biztostkknt az l jobbgyok vsrlsakor - a cmben szerepl
holt lelkek" szavatoltk l vsrljuk e vilgi sorst.
Joseph Smith is felismerte a holt lelkek gyakorlati rtkt, s Csicsikov
miniszteri tancsoshoz hasonlan arra hasznlta fel, hogy kielgtse term
szetes vgyt sajt nyjnak nvelsre. Az tlet Szt. Pl egybknt rejtlyes
kijelentsbl szrmazott: Klnben mit cselekesznek azok, a kik a halotta
krt keresztelkednek meg, ha halottak teljessggel nem tmadnak fel? Mirt
is keresztelkednek meg a halottakrt?" Jzus az elhunytaknak prdiklt, mg
a srban volt, mirt ne jrhatnnak el gy azok is, akik az jkori szentek egy
hznak akarnak hveket toborozni? Smith egyik legfontosabb felfedezse
a halottak megkeresztelse volt. Emberek millirdjai - rg halottak- estek t
a megpecstelsi szertartson. Posztumusz befogadsukhoz az egyhzba
Smith ltomsa adta meg a kulcsot a meghatalmazott tjn trtn szer
tartsokrl"; milliszm toborozhattk a lelkeket, ha azokat is befogadtk,
akik a mormon valls szletse eltt haltak meg. Smith lelemnyes eljrsa
tudtn kvl j ismeretekhez vezetett az emberi rklds termszetrl.

TLOLDALT: Egy dszesebb dokumentum azok kzl, amelyeket a mormonok felhasznltak a


megmentendk kivlasztshoz. A lancashire-i Ruffordbl szrmaz Heskethek csaldfj
nak tizenhatodik szzadi rszn a csaldtagok arckpe lthat. A dokumentum szzadunk
elejig folytatdik, mr arckpek nlkl.

54
55
EMLRK

Az emlrk sajnlatosan gyakori betegsg, Angli a teljes npessg szrsre, rszben a mutcik
ban vente mintegy harmincezer j megbetegeds nagy szmbl add technikai problmk miatt,
jelentkezik. Kialakulsban rendszerint nincs sze rszben azrt, mert ugyanennek a gnnek vannak
repe rkltt hajlamnak. Kt gn azonban - a rtalmatlan mdosulatai is. Az askenzi zsidk k
BRCAl a i7-es kromoszmn s a BRCA2 a i3-ason zl minden szzadik egyetlen BRCAl mutcinak a
- hajlamoss tesz a betegsg rkld formjra. hordozja (ez lehet az oka minden hatodik eml
Azoknl a nknl, akik a kt emlrkgn vala rkesetnek az tven ven aluli zsid nknl). Ez az
melyiknek mutcijt hordozzk, nagyobb a pe egyetlen mutci gyakoribb az askenzik kztt,
tefszekrk veszlye is. Ezenkvl azoknl a frfiak mint a tbbi hatszz egyttvve az ssznpessg
nl s nknl, akikben megvan a BRCA1 gn, ben, s taln a leggyakoribb komoly pratlan gn,
ngyszeres a vastagblrk kockzata. A BRCA1 amelyet brmely npessgben eddig felfedeztek.
gnt hordoz csaldok kzl sokat tanulmnyoz Br ez a krosods a kzs szrmazs tovbbi bizo
tak, nmelyikk igen npes, s akad kztk j n nytka, nem vilgos, hogyan lehet felhasznlni ezt
hny mormon nemzetsg. Csaknem mindegyik az informcit. Legfeljebb a szrs sorn nhnyan
nek megvan a maga jellegzetes DNS-elvltozsa. megtudnk, hogy nagymrtkben veszlyeztetet
Szznl tbb klnfle mutci ismeretes, leg tek, de jelenleg alig van ms kezels, mint a tnetek
tbbjk megmarad egyetlen csaldon bell; ms megjelense eltti emleltvolts, s mg nem is
szval a betegsget hordoz csald tagjai rokonok meretes, hogy ez hatsos-e.
ugyan, de nincs genetikai kapcsolatuk a tbbi
rintett csald nagy rszvel. A legtbb mutci
megakadlyozza, hogy a gn elllitsa termkt, A BRCAl eml6rkgn mutcii. A gnt tbb mint
egy bizonyos fehrjt. Ez azt jelenti, hogy norm hsz mkd6 szakaszra bontottk, s teljes hossz
)is, nem mutcis formjban a BRCAl taln tu ban mutcikat talltak. Nmelyik (zlddel jellve)
morgtl gn", amelynek feladata a rosszkor be ritka, csak egyetlen csaldban fordul el. Msok (pi
kvetkez sejtosztds lelltsa. Meghibsodsa rossal jellve) elterjedtebbek. A gyakori zsid mut
esetn a sejtek ellenrzs nlkl szaporodnak, s ci a gn msodik mkd6 szakaszban tallhat.
daganat alakul ki. A klnbz6formjjelek alakja klnfle mutci
Taln tszzbl egy ember - vagyis Angliban kat brzol, nmelyikMl hinyzik egyetlen amino
tvenezer n- rkli a BRCAl gn valamelyik mu sav (a fehrjelnc pt6kve), msokban az egyik
tcijt. Esetkben nagy az emlrk kialakuls aminosav helyett msik szerepel, megint msokban
nak veszlye, a gn ugyanis tz kzl nyolc hordo mdosul a fehrjemolekula klnbz6 rszeinek
zjnl betegsget okoz. Egyelre nincseneKtervek kapcsoldsi mdja.

20 21

1 3 10

56
' . t

FENT: Emberi kromoszmt- ebben az esetben

a tizenhetest-felhasogattak, s a szakaszokat egy


rcson rendeztk el. A rcson tbb mint hszezer
klnll, szrpaprra helyezett DNS-szakasz
tallhat. Ekkor a rcson tramoltatnak
radioaktvan feldmkzett" ismert DNS-szakaszokat,
ezek hozzktdnek azokhoz az egysgekhez, ahol
megtalljk kiegszt prjukat. Mint afenti kpen
i lthat, a rntgen/emezen feketefoltok jelennek
s

meg, s megmutatjk, hol helyezkednek el az adott


gnek - tbbek kztt az emlrk gnje.

BALRA: Emlrk, korai szakaszban.

57
A VRNKBEN VAN

Szent emberek a knai Jnan tartomnybl. Mindegyik fel tudja sorolni seit tbb mint ezer
vre visszamenleg.

A"halottak a szellemvilgban vannak. Br magukv tehetik a mormon


zenetet, szemlyesen nem rszeslhetnek a szertartsokban. Ezrt rvid
idre flveszi a nevket egy l mormon, s kpviseli ket a megpecstel
si szertartson. Nhny lelkes jkori szentnek szmtalan szemlyazonos
sga volt lete sorn, flvette ket, s elhagyta, amint eredeti tulajdonosai
kat soraiba fogadta az egyhz.
Az eljrs nem azon alapul, hogy ltalnossgban tudomsul veszik az
lk s halottak szoros kcsolatt, hanem nagyon alapos genealgiai ku
tatson, amely igyekszik minden hajdanvolt emberi lnyt kapcsolatba
hozni egy ma l meghatrozott szemllyel. Mivel sok mormonnak alig
van biztos adata a sajt szrmazsrl, a kutats mindenkire kiterjed: zsi
dkra, keresztnyekre s pognyokra. k csak lehetsget adnak a dnts
re, lltja az egyhz. Aki akarja, elutasthatja az ajnlatot. gy nem kell attl
tartaniuk, hogy ms vallsok szt emelnek seik posztumusz elrablsa el
len. A mormonok mr nem gyzik a szent munkt. venknt hatvanmilli
ember hal meg, de alig tmilli rszesl a holta utni keresztsgben.
A halottak kzti misszijuk rszeknt a mormonok gyjtttk ssze a
vilg leggazdagabb anyaknyv-bejegyzsi gyjtemnyt. Irattrukban
csaknem tzmillird ember neve szerepel, legtbbjk i500 utn szletett.

58
ARMAGEDDON ELLENTMONDSA

Mita az ember - s a nyelv - vagy szzezer vvel ezeltt kialakult, tbb


mint hatvanmillird egyn kapott visszamenleg sajt nevet. Ezeknek a
neveknek egyhatoda mr ott van a mormon pncltermekben. Elbb
vagy utbb minden hajdani viseljknek felajnljk a tagsgot az jkori
szentek kzt.
Az adatok jelents rsze npszmllsi listkbl s szletsi meg halotti
anyaknyvekbl szrmazik. Az egyhz dollrtzmillikat klttt mikrofil
mekre. Levllrukban mr hrom kilomternyi van bellk, s minden
vben tovbbi tvenmilli felvtel kszl. A bizonytkok egy rsze szj
hagyomnybl ered. A Kna dlnyugati rszn, J nan tartomnyban l
hanik lltlag tvennyolc nemzedkre visszamenleg fel tudjk sorolni
seiket.
Ez is lenygz, de a rgi trsadalmak mg alaposabbak voltak. Egy
Kr. e. 664-bl val thbai sr azt hirdeti, hogy lakja, Aba egy ktezer vvel
korbbi msik Aba leszrmazottja. Akihito japn csszr csaknem ugyan
ilyen messzire tudja visszavezetni a csaldfjt, a Kr. u. 3. szzadig, szzhu
szont nemzedk megszaktatlan sorn t. A mormon kutatk a vilg leg
tvolabbi rszeibe is elutaznak, hogy felkutassk a kihalflben lv szr
mazsi hagyomnyokat.
Nmelyik nyilvntartsra pp idben talltak r. A ceyloni anyaknyve
ket mr rgtk a frgek, amikor filmre vettk ket. Nha elkstek. A Dl
nyugat-Anglibl szrmaz adatok megsemmisltek a hbor alatt az
exeteri katedrlis bombzsa sorn. Most, hogy a kommunizmus ssze-

A mormon levltr
a Grnit-hegy belsejben.

A nyilvnossg - s a vilg
vge idejn esedkes
vzzn - ell rejtve itt
rzik a tbb szz milli
nv csekly tredkt.

59
A VRNKBEN VAN

omlott, lzas kutatmunka folyik Kelet-Eurpban. Hozzfrhetv teszi


az anyaknyveket Oroszorszg s Kna is.
A mormon genealgiai tevkenysgnek hatalmas pnclterem ad ott
hont a Grnit-hegy mlyn, harminc kilomterre Salt Lake Citytl. Bej
rathoz - egy sziklba illesztett, bombabiztos aclajt hoz - mellkt vezet,
amelyet csak egy sor szigor Behajtani tilos" tbla klnbztet meg a
tbbitl.
Az ajtk magasan a vlgy fltt helyezkednek el, hogy megmeneklje
nek az utols napokra jvendlt vzzntl. Lent a sksgon, Salt Lake Ci
tyben - amelyet ktsgtelenl elnt az r, ha elrkezik az apokalipszis - ott
a Csaldtrtneti Knyvtr hatalmas trkpgyjtemnyvel s genealgiai
knyvtrval, valamint mikrofilmre vitt anyaknyvekkel s dokumentu
mokkal. Minden informcit szmtgpre vittek International Genealo
gical Index nven, s j rszket sszektttk egy hatalmas leszrmazsi
tblzattal, amely sk Fjlja nven ismeretes.
Mikrofilmolvask hossz sora ll azok rendelkezsre, akik seiket ke
resik a rgi npszmllsi jegyzknyvekben, katonai nyilvntartsokban
s hajk utaslistin. Ha megtalltk ket, utnanzhetnek a rokonsgnak a
kzeli Keres Kzpont szmtgpein. Az egsz rendszer alapja a vilg
ilyesfajta kzpontjait sszekt szmtgp-hlzat, affle Holtak Inter
netje. vente tzezrek veszik ignybe a rendszert.
A hajdani Utah Szllban, amelyet eredeti formjban lltottak helyre,
s Joseph Smith Memorial Buildingnek neveztek el, oll lnek a keresk a
kpernyk eltt, s kapcsolatba lpnek a mlttal. Elbb-utbb a legtbben
rbukkannak egy-egy elfelejtett sre. Az n nevem, a Jones, s anym csa
ldj, a Morgan olyan gyakori, hogy az ember sose tudhatja biztosan, va-
lban rokona-e brmelyik Jones vagy Morgan, akr halott, akr nem.

Mgis rakadtam egyik k-k-kapmra, David Morganre, akit i759-ben


kereszteltek meg a cardiganshire-i Llanfiliangel genau'r Glynben, alig
nyolc kilomterre az n szlhelyemtl. A mormonok megelztek.
i977-ben, jval a halla utn az jkori szentek soraiba fogadtk Utahban.
Hogy magv tette-e a holta utn alaptott egyhz hittteleit, azt senki
sem tudja.
Elveszett sre tallni magban is jles rzs, de az igazi rm az, ha ki
derl, hogy az ember rokonsgban van egy trtnelmi szemlyisggel. So
kan elkpedve ltjk, ki bukkan el a csaldfjukon. A Csaldkutat Kz
pont egy-egy tipikus napja olyan ltogatkkal dicsekedhet, akik felfedez
tk, hogy rokonai George Washingtonnak, I. Henrik angol kirlynak vagy
- hogy is lehetne mskpp - magnak dmnak. Rgi amerikai hagyo-

60
ARMAGEDDON ELLENTMONDSA

sm, David
Morgan srkve;
1817-ben temettk el
Cardiganshire-ben,
s 1977-ben keresz
teltk meg a Utah
llambeli Provban.

mnyt kvetnek, akik bszkk eurpai nemes seikre. Huckleberry Finn


tutajn Mark Twain szerint ott volt Bridgewater jog szerinti hercege" s
a szegny, szenved Dauphin, Tizenhetedik Lajos". Twain kornak egyik
ltalnos hbortja fltt gnyoldik. Az anyja is gett a vgytl, hogy fia
nevben bejelenthesse ignyt Durham grfjnak cmre.
Kell, hogy a felfedez szeme eltt valamilyen cl lebegjen, ha mgoly r
telmetlen is. Aki flfel vergdik a folyn, nyilvnvalan a forrshoz igyek
szik, oda, ahonnan a foly ered. Nincs mskpp azokkal sem, akik boldo
gan fedezik fel, hogy a mlt valamelyik nemes alakjtl szrmaznak. Mint
Speke, amikor felfedeztra indult flfel a Nluson, azt hiszik, utazsuk
vget r, amint rtallnak a nagyszer forrsra, ahonnan vrk ered. Gyak
ran a msoknl klnb arisztokratikus szrmazs remnye hajtja ket.
De ha jobban meggondoljuk, rjvnk, hogy a folyk nem egyetlen
helyrl erednek, hanem millinyirl. Az, amelyet trtnetesen forrsuk
nak neveznek, csak egy a sok kzl - amint Speke is megtapasztalta, ami
kor dbbenten kerlt szembe msok vlemnyvel a Nlus eredetrl.
A geogrfusok pedig azon vitatkoztak egy idben, hogy ki fedezte fel a
Mississippi forrst, a folyt, amelyen Twain egy angol herceget s egy
el nem ismert francia kirlyt sztatott. Most azt lltjk, az Itasca-tbl
ered ( [ Ver] itas Ca[put] , az Igazi F); azt a krdst gyesen megkerlik,
hogy mi mlik az Itascba, s hogy a sokezernyi egyb helyi t vizt vajon
milyen foly vezeti el, ha nem a Mississippi. Hasonl hibt kvet el,
aki klnlegesnek tartja szrmazst, mert vissza tudja vezetni valami je
lents szemlyisgre; is egyetlen gon megy flfel a folyn, holott mil
linyi van.

61
A VRNKBEN VAN

Az arisztokratk imdjk az ilyesfajta nltatst. Angliban krlbell


hromszz csald bszklkedik azzal, hogy egyenes gon vissza tudja ve
zetni a szrmazst Hdt Vilmosig. Valjban csak abban klnbznek
msoktl, hogy k megriztk a dokumentumokat; ms angolok is szz
ezerszm vezethetnk vissza a csaldfjukat Vilmosig, ha kpesek lenn
nek tvgni magukat a napjainktl 1066-ig vezet genetikai tvesztn.
Nemesi st tallni nagy meglepets s rm, de ha az ember elg
messzire megy vissza a mltba, szinte szksgszer. A mlt tartomnyba
sokflekppen eljuthatunk. Az elkel szrmazs a genetika egyszer igaz
sgaibl kvetkezik. A Utah Szllban minden kutat az sforrst kutatja;
a DNS-nek a trtnelmen tzuhog ramlatt. A biolgia nagy feladata,
hogy tjt nyomon kvesse. Sok mellkga van. Minden hzassgktsnl
beletorkollik egy. Minl messzebbre jutunk flfel, annl feltrkpezetle
nebb a foly. Mint minden utazt, a Csaldkutat Kzpont ltogatit is el
lenllhatatlanul vonzzk a mr feltrkpezett mellkfolyk. Rvidesen
azon az gon talljk magukat - akrhonnan indultak s akrkik legyenek
is -, amely egy kirlyntl vagy kirlytl ered.
A kirlyi csaldok ltnek rtelmhez hozztartozik, hogy naplt vezet
nek utazsaikrl a mlton t. Feltrkpeztk a gnek tjt mr jval a ge
netika kezdete eltt. Kroly herceg hromezer kln gon tudja visszave
zetni szrmazst III. Edwardig (aki 1312 s 1377 kzt lt). Egyenes gi le
szrmazottja Mohamednek III. Edward fia, a Fekete Herceg, vagyis
Edward walesi herceg rvn, akinek anyja ereiben mr vr is csrgedezett.
Ha Kroly hercegnek hromezer rokoni kapcsolata van egy tizennegyedik
szzadi angol kirllyal, nem csoda, hogy legalbb egyet tall szinte min
denki, aki bestl a Csaldtrtneti Kzpontba, s veszi a fradsgot, hogy
elssa az iratokat.
A nhny vszzadra visszavezetett csaldfkban egyszer csak valsz
ntlen trtnelmi alak jelennek meg pusztn azrt, mert msutt nincs
helyk. Ha brmelyik leszrmazsi gat elg messzire kvetjk nyomon a
mltba, elkerlhetetlenl egybeolvad az sszes tbbivel. Nemsokra kide
rl, hogy egyik ga az egyetemes csaldfnak, mely egyetlen npes csald
ba gyjt mindenkit - Hdt Vilmost, Tutanhamont, Konfuciuszt vagy
brmely si szentet, ahny csak esznkbe jut. Elg egy rvid utazs a fo
lyn flfel, s szinte biztosan elkerl valami fnyes s. A nyugati vilg
ban nagyjbl mindenki Nr csszrtl szrmazik, valamivel kevesebben
Hdt Vilmostl, s alig pr szzezren George Washingtontl.
Ez persze azt jelenti, hogy mindenki rokona mindenkinek. Kt vletlen
szeren kivlasztott ember kzs se lehet akr Nr vagy Hdt Vilmos

62
ARMAGEDDON ELLENTMONDSA

is, de valsznbb, hogy olyasvalaki, akirl nem tud a trtnetrs. Nmi


kutats meglep rokoni kapcsolatokat hoz napfnyre kevsb jelents sze
mlyek kzt is. Margaret Thatcher s John Major miniszterelnk egyarnt
leszrmazottja bizonyos John s Elizabeth Crustnak, akik a Bostonhoz k
zeli Leake-ben, Lincolnshire-ben mveltk a farmjukat a tizennyolcadik
szzadban. td-unokatestvrek, egygenercinyi klnbsggel. Ugyan
ennek a csaldnak az egyenes gi utda, a jelenlegi Mr. Crust sok hzass
got ltott, sok tetovlssal kes tengersz. Country- s westerndalokat r.
Felgettem minden hidat a hazafel nem vezet ton" cm dala az ame
rikai npszersgi listkra is flkerlt.
Csndes beletrdssel fogadta a hrt, hogy kt miniszterelnk is vrro
kona. Bosszsgt enyhti taln, ha kiszmtja, hogy rokonuk mg vagy
szzezer angol, csak nem tudnak rla.
Ha kt ember ugyanattl az egyntl szrmazik, akr Crustnak hvjk
az illett, akr nem, megvan az esly, hogy ugyanazokat a gneket rkli.
Amennyiben sszehzasodnak (br ez az adott esetben valszntlennek
ltszik), elfordulhat, hogy gyerekk ugyanabbl a gnbl kt pldnyt
rkl szlei kzs stl. A pldnyok - hogy szakkifejezssel ljnk -
szrmazs rvn azonosak. Vilmos hercegben, Anglia leend kirlyban
nyilvn sok ilyen akad. Szleinek szmos kzs genetikai svnyk van a
trtnelem folyamn. Kroly herceg mintegy hromezer klnfle vona
lon ksrheti nyomon szrmazst III. Edward ta; csakhogy volt felesg
nek, Diana hercegnnek (aki els pillantsra nem tnik klnsebben k-

Geoffrey Crust, aki


Margaret Thatcherrel
s John Majorrel
egytt John s
Elizabeth Crust
tizennyolcadik
szzadi lincolnshire-i
farmerhzaspr
leszrmazottja:
a rokonsg igen
kiterjedt.
A VRNKBEN VAN

zeli rokonnak) magnak is mintegy ngyezer klnbz szrmazsi ga


van ugyanattl a szemlytl. Vilmos herceg s ccse ktsgtelenl rklt
kt pldnyt III. Edward nhny gnjbl, amelyek ms-ms utat jrtak be
a nemzedkeken t.
A szrmazs rvn val azonossg nem az uralkodk kivltsga; vonat
kozik mindenki msra is. A mormon sk Fjlja azt bizonytja, hogy ha
elg messzire visszamegynk, elbb-utbb minden csaldfa egybeolvad s
tallkozik egy kzs sben. Akkor pedig ugyanannak a gnnek kt pld
nya rkldik tovbb klnbz utakon attl a kzs stl, brmilyen r
gen lt. s elkerlhetetlen, hogy nhny kzlk tallkozzk egy ma l
nben vagy frfiban.
Ennek rendszerint nincs kedveztlen hatsa, s megllapthatatlan, mi
lyen gnekrl van sz. Br a Vaslady bizonyos rszecski azonosak az utna
kvetkez miniszterelnkivel, hisz mindketten John Crust leszrmazot
tai, nem lehet megmondani, mi a kzs bennk. Nha azonban nagyon is
egyrtelmek a kzs szrmazs bizonytkai. Sok genetikai betegsg
azoknl jelentkezik, akik kt pldnyt rkltek ugyanabbl a gnbl. Ha
egy hzaspr kzs se egyetlen pldnyban hordozta, mindkettjknl
fennll a veszly, hogy rklt egy sajt pldnyt. Kvetkezskpp a roko
nok gyerekeinl az tlagosnl nagyobb az esly, hogy kt pldnyt rkl
nek a kzs gnbl, s genetikai betegsggel szletnek. Minl kzelebbi
mltban lt a kzs s, annl rvidebb az t a ma l gyermekig - s annl
kevesebb annak a valsznsge, hogy a gn kiveszett az rklsi sorbl.
A genetika eltt a rokonsgkutatk csak az egyhzi vagy llami iratok
ban kvethettk nyomon a szrmazst - ezt ismertk fel a mormonok. Ma
mr gy is fel lehet kutatni a rokoni kapcsolatokat, hogy egyenesen a szr
mazs biolgiai dokumentumait, a gneket veszik szemgyre. Kt ember
nek, aki azonos mdon krosodott DNS-darabot hordoz, szinte biztosan
volt egy kzs se, akitID mindketten rkltk. Nha ez vezet rokonsguk
nyomra.
A vilg egyetlen helyn tanulmnyoztk olyan alapossggal az okm
nyokat s a gneket, hogy ssze tudtk vetni a bennk megrt trtnelmet.
Finnorszgban az evanglikus egyhz hromszz ve szinte folyamatosan
szmon tartja a szletseket, hzassgokat s hallozsokat. Br az orsz
got hbor s hnsg sjtotta, npe hsges maradt gykereihez: sok csa
ld szzadokon t egy helyben maradt. Kvetkezskpp a gnek vilgosab
ban mutatjk a rokoni ktelkeket, mint szinte brhol msutt.
Mivel az orszgot nyelve is, Eurpa tbbi rsztl val tvolsga is elszi
geteli, a finneknek megvannak a sajt genetikai betegsgeik. Krlbell
ARMAGEDDON ELLENTMONDSA

harminc betegsg kizrlag Finnorszgban fordul el, vagy indokolatlanul


gyakori. Nhnyat csak egy-kt kzsgben jegyeztek fl. Egyikknek,
amely a vltoz ks gyermekkori idegi ceroid lipofuscosis" (vagy
vLINCL) nvvel dicsekedhet, az orszg nyugati rszben, Lapua vros kr
nykn van a gca. Lappang gn okozza: a betegsg elidzshez kt pl
dny szksges, mindkt szltl egy-egy. Igen slyos kr. A megtmadott
gyerekek letk els nhny vben lomha mozgsak, ksbb rohamokat
kapnak, megvakulnak s megbnulnak. Rendszerint fiatalon meghalnak.
Tizennyolc csaldbl huszonegy betegnl llaptottk meg; a betegsgnek
szinte egyik esetben sem volt ismert elzmnye a csaldban, s a szlket
mlyen megdbbentette a diagnzis.
Az egyhzi anyaknyvekbl (amelyek krlbell 1600-ig mennek
vissza) kiderlt, hogy a harminchat szlbl, akiknek a gyerekt megt
madta a betegsg, huszonngyen tudtukon kvl rokonok; nhnyan
tbbszrsen is. A legrgibb nyilvntartsba vett sk Kauhajoki faluban
lt a tizenhetedik szzad elejn - tizenhrom emberltvel a mai, megt
madott utdok szletse eltt. A gn csaknem ngyszz vig rkldtt
egszsges embereken t, akik csupn egyetlen pldnyt hordoztak, s fo
galmuk sem volt a ltezsrl. Vgl azonban kt DNS-ramlat tallkozott
egy beteg gyermekben, s megmutatta, hogy szlei valjban rokonok.
Nem minden anyaknyvileg nyilvntartott szrmazsi g fut ssze
egyetlen sben. Semmi ktsg, ez a szemly ltezett, de az egyhzi anya
knyvek nem mennek vissza elgg ahhoz, hogy kiltt meg lehessen lla
ptani. A vLINCL rokonsgi gak ngy csoportjnak nincs kapcsolata egy
mssal. Mivel azonban mindegyiknl szinte azonos elrendezsek a DNS
rcs vonatkoztatsi pontjai a srlt gn krl (amelyet mg nem sikerlt
megtallni), csaknem biztos, hogy mindannyian ugyanazt a gnt rkl
tk ugyanattl a szemlytl. Az illet valsznleg hatszz vvel ezeltt lt.
Ez a betegsg vilgosan mutatja, hogyan gazhatnak el a csaldfk - az
rintettek tudtn kvl - egy tvoli stl, hogy a ma lkben ismt tall
kozzanak. Ez a csaldfa csak Finnorszg fljegyzett trtnetnek kezdetig
kvethet. Ms szrmazsi gak elterjedtebb betegsgek rvn ktik a fin
neket sokkal rgebbi kzs skhz. Megmutatjk, milyen nagy hatssal
lehet a vrrokonsg olyan emberek sorsra, akik szzadokkal a csald k
lnbz gainak sztvlsa utn szlettek.
A kzs gnek nem maradnak meg egy nemzeten bell: rokoni kapcso
latok hljt szhetik egymstl tbb ezer kilomternyire l emberek k
ztt. Eurpban a leggyakoribb rkltt betegsg a ciszts fibrzis. Krl
bell minden ktezer-tszzadik gyerek szletik vele (s nagyjbl min-
A VRNKBEN VAN

Finn kisfi, aki a vLINCL


nev slyos genetikai
betegsgben szenved,
mely az idegsejteket
tmadja meg, s csak
azon a krnyken
gyakori, ahol l
anyjval s hgval.
A gyerek mindkt
szlje a gn egy-egy
pldnynak hordozja,
s - tudtukon kvl -
ugyanannak az ember
nek a leszrmazottai,
aki tbb mint hromszz
vvel ezeltt lt
a kzsgben.

den huszontdik ember hordozza gnjnek egy pldnyt). Igen kelle


metlen kvetkezmnyekkel jr. A tdt s ms szveteket eltmi a nylka,
s br a kezels ma mr eredmnyesebb, a legtbb beteg fiatalon meghal.
A gn nagymret, s sokflekppen krosodhat. Tbb ezer beteg DNS-t
vizsgltk, s ngyszznl tbb klnfle genetikai elvltozst talltak. Mi
vel mindegyikk ms, teht klnbz sktl kell szrmazniuk. A ciszts
fibrzisban szenved betegek nem mind rokonok.
De a mkd gnnek csaknem minden krosodott vltozata ritka.
A betegsg tz nyugat-eurpai esete kzl hetet egyetlen mutci okoz,
amely hrom DNS-bzist tvolt el. A legtbb ciszts fibrzisban szenved
gyerek valban rokona emsnak, s leszrmazottja annak a rgen halott
szemlynek, akitl a kzs mutci ered. Mivel a gn ennyire elterjedt, s
ma mr tbb milli pldnya ltezik, az illet nyilvn nagyon rgen lt; az
egyik becsls szerint tvenezer ve, jval az utols jgkorszak eltt. Az si
gn kt pldnynak megjelense egy mai gyerekben fjdalmas jele annak,
hogy szlei egyetlen hihetetlenl npes csald tagjai.
A ciszts fibrzis elfordul Kelet-Eurpban s a Kzp-Keleten is, de
ott egszen ms mutci gyakori. Hordozi nem nyugat-eurpai esetek
eldjtl szrmaznak, hanem egy msik stl. gy a betegsg angliai s
franciaorszgi hordozinak kiszrsre alkalmazott vizsglat Grgor
szgban s Trkorszgban nem hoz eredmnyt.

66
ELFELEDETT ROKONSG FINNORSZGBAN

A finn trtnelem a dokumentumok szerint ezer Msok azonban elvesztek: Finnorszgban nincs
vvel nylik vissza a mltban. Az els emberek ciszts fibrzis, taln azrt, mert vletlenl egyet
csak az Eurpban igen megksett utols jgkor len hordozja sem lte tl a finn trtnelem em
szak vgn kerltek ide; a fldmvels pedig csak berprbl idszakait.
ktezer vvel Krisztus eltt kezddtt. A finnek Tbb mint harminc genetikai betegsg kizr
mindig kevesen voltak, s a legtbben egy vagy n lag Finnorszgban fordul el, vagy indokolatlanul
hny csaldbl ll elszigetelt kzssgekben l gyakori. Egyik-msik nem terjed tl egy kis ter
tek. A hbork, melyeket Svdorszg s Oroszor lelen: a vLlNCL az orszg nyugati rszn tallhat
szg folytatott terleLkrt, s a hideg nyarak meg Ostrobothnin, egy amyloidosis nev betegsg az
a sok ven t tart rossz terms megtizedeltk a la orszg dli s egy rkltt szembetegsg a dlnyu
kossgot: az orszg npessge az hezs veiben" gatirszn. A tloldalon lthat fi, Yussi Heik
az 1690-es hatszzezerrl negyven v alatt negyed kila albbi csaldfja azt brzolja, milyen utat
millira cskkent. A katasztrfa sok falut szinle ki jrt be a mltban kt srlt gnjnek egy-egy pl
halsra tlt. A mai tmilli finn kevs stl szr dnya, mieltt benne tallkozott. Mindegyik csa
mazik. Ms szval nhny npes csaldbl ll. Az ldfa kzs szrmazst - rokoni kapcsolatot - bi
alaptkban meglv genetikai mutcik kzl zonyt, amely egyre messzebbre nylik visa a
nhny mra a vletlen folytn gyakoribb vlt. trtnelemben.

,,,.. -

{\"'-.f(
Gustaf Yll-Renga
szl. 1757. Xl. 26., Kauhava

Gustaf Renga Anna Renga


sz. 1792
(
'\
sz. 1788

)
Liisa Renko
sz.1816 Katarina Albenina
sz. 1823
t .>--.
( ( -
Maria Rantala
sz. 1838
Anna Haapoja
<
\ '.
\,'.
t
sz. 1849 1
Johan Rantala
y
1:.
sz. 1858
Mina Pahkajarvl
sz. 1884

. :,. \
Juha Heikklla

sz. 1891


,)
\_
Paavo Alapassi
Manii Heikkila sz. 1914
sz. 1929
'\_,
) ;
,


I
Hannu Heikkila Sisko Helkkila
-

/
, 1

.. ./ -
Yussi Tulli v,._
-:f
,

Heikkila Heikkila
: - - _',
A VRNKBEN VAN

)osiah Wedgwood Erasmus Danvin Samuel Galton

George Butler

Robert Violetta

Charles Francis
Darwin Galton

Tbb gyermek Gyermektelen

Beltenyszetrl rulkod csaldfa:


Charles Darwinnak, az evolcis biolgia
megalaptjnak (balra) rokoni kapcsolata
Francis Galtonnal, a humngenetika
svel (jobbra).

Teht korbban ismeretlen rokoni kapcsolatokra vilgt r, ha egy meg


tmadott gyermekben a srlt gnek kt pldnyban jelentkeznek, amikor
sszefutnak a szrmazsi gak. gy ha megvizsgljuk az olyan szlk gyere
keinek genetikai egszsgt, akiknek rokonsgi foka mr ismert, felmr
hetjk, hny ilyen gn lli.et rejtve vrvonalukban. Minl kzelebbi mlt
bl val a hzaspr kzs se, annl valsznbb, hogy mindketten .rk
lik ugyanazt a gnt. A szablyok egyszerek. Egy fivr s nvr gnjeinek
fele azonos, mert kzsek a szleik. Ha gyerekeik szletnek (ami elfordul
nha), a vrfertzsbl szrmaz utdok gnjeinek negyede (flszer fl)
lesz szrmazs rvn azonos. Unokatestvrek hzassga esetn nem a sz
lk kzsek, csak kt nagyszl. A kzs gnek szma egyre cskken, s az
utols kzs s a mlt kdbe vsz.
Elfordulhat, hogy az unokatestvrek kt kzs nagyszlje kzl az
egyik rtalmas lappang gn hordozja volt. Mindegyik gyereknek egy a
ketthz az eslye, hogy rkli; mindegyik unoknak - az unokatestvrek-

68
A RM AGEDDON ELLENTMOND S A

nek, akik elhatrozzk, hogy sszehzasodnak- ngy az egyhez. Teht egy


tizenhatod (egynegyedszer egynegyed) az esly, hogy az unokatestvrek
hzassgban mindkt hzasfl rkl nagyszlje srlt gnjbl egy pl
dnyt, amely a kzs szrmazs rvn azonos.
Ha mindkt unokatestvr hordoz, akkor a genetika egyszer trvnyei
alapjn egy a ngyhez az esly, hogy gyermekk kt pldnyt rkl a s
rlt gnbl, s rkltt betegsggel szletik. Ezrt az unokatestvrek gye
rekei a vrakozsnak megfelelen kevsb egszsgesek, mint azoknak az
utdai, akik a csaldon kvl keresnek hzastrsat. Minl tbb srlt gn
rejtzik a npessgben, annl slyosabb kvetkezmnyekkel jr az unoka
testvrek hzassga.

A Lloyd of Stockton csald


cmere; a rokonsg s
kzs szrmazs trtnete.
A hromszzhuszonht ngyzet
minden darabja egy-egy csaldi
kapcsolatot brzol. Sok
szimblum tbbszr is
megjelenik: a hrom korona
tbb mint tvenszer. A cmer
tulajdonosa tbb gon rklte
tulajdonsgait ugyanabbl
a forrsbl: ms szval
a szimblumok azonosak
az rkldssel. Brmilyen
bszke a cmerre Lloyd of
Stockton, valjban olyan
dokumentumot tett kzz,
amely bcltenyszetrl
rulkodik. Mi tagads,
komoly kpzeltehetsgrl is:
a modern heraldika sok
kapcsolatot vitathatnak tall.
A VRNKBEN VAN

A kzeli rokonok gyermekei valban az tlagnl kevsb erteljesek. Az


arisztokratk hrhedtek (vagy azok voltak) rokonhzassgaikrl. Ez nha
nyomot hagy rajtuk; Bagehot szerint azt mondtk, br nem volt igaz, de
taln egszen alaptalan sem, hogy aki 1802-ben rkltt jogon lt a tr
non, mind rlt volt". A trpe francia fest, Henri de Toulouse-Lautrec
kt nagyanyja testvr volt, szlei unokatestvrek. Anyjnak btyja sajt ap
jnak hgt vette felesgl. Ngy gyerekk rkltt csontrendszeri beteg
sgben szenvedett. Maga Toulouse-Lautrec az arisztokratk rokonhzass
gait okolta sajt llapotrt. Mveinek nagy rsze elrulja, milyen meg
szllottan rdekldtt a torzulsok irnt. Alig harmincht vesen halt
meg, valsznleg alkoholmrgezsben.
A kzeli rokonok hzassga nem egyformn gyakori a klnbz vid
keken. Annak az eslye, hogy az utdok kt, rkls rvn azonos gnpl
dnyt rklnek ugyanattl az stl kt klnbz szrmazsi gon, a ro
konhzassgok arnytl fgg. Ezt tbbflekppen ki lehet szmtani. Az
egyik a hzasprok csaldfjnak vizsglata s annak a megllaptsa, mi
lyen kzeli mltban ltek a kzs sk. Kevsb eredmnyes (de gyorsabb)
mdszer utnanzni, hny hzassgra kerlt sor azonos vezetknev sze
mlyek kztt. Mivel a nevet valsznleg kt klnbz gon rkltk
kzs sktl, ez is jelzs lehet a beltenyszet fokrl.
A mozgkony nyugati trsadalmakban az emberek ritkn hzasodnak
kzeli rokonaikkal. Nha alig ismerik ket. A mai Franciaorszgban a frjek
s felesgek tlagban krlbell hatodunokatestvrek, csak egy kzs k
k-nagyapjuk van. Mondanunk sem kell, legtbbjk mit sem tud az seirl

Toulouse-Lautrec karikatrja
nmagrl: a fest gnyt z
sajt termszetellenesen rvid
vgtagjaibl s borvirgos orrbl.

70
1 920-as vek

A franciaorszgi
rokonhzassgok szmnak
cskkenst brzol trkpek.
Az rnykols mlysge mutatja
a hzastrsak kzelmltban lt
kzs seinek az unokatestvr
hzassgok gyakorisga
alapjn megllaptott szmt.
A kzssgen kvli hzassgok
szmnak az 1920-as
s i950-cs vekben tapasztalhat
nvekedse napjainkban
felgyorsult.

1 950-es vek

D Alacsony
D
D


:.s:'l Magas

vagy errl a rokonsgrl. Annak az eslye, hogy egy francia gyerek kt pl


dnyt rkl egy bizonyos, szlei kzs szrmazsa rvn azonos gnbl,
kevesebb mint egy a ktezerhez. Fl vszzaddal ezeltt Bretagne vagy az
Aveyron-fennsk eldugott zugaiban sokkal gyakoribbak voltak a rokonh
zassgok. Mita kipltek az aututak, mindentt ritkasgszmba mennek.

71
A VRNKBEN VAN

Az angol trsadalom mindig is vltozkonyabb volt a francinl, kisebb


helyhez kttt parasztsggal, itt teht mg ritkbb volt a rokonhzassg.
Az orszg tvolinak s eldugottnak tartott rszei sem igazn elszigeteltek.
A legkisebb norfolki falvakban sem maradnak fenn egy szzadnl tovbb
az egyes vezetknevek, ami azt mutatja, hogy az emberek - s gnek - so
kat vndoroltak ezeken az lltlag isten hta mgtti helyeken is.
Nyugaton jszerivel jelentsgket vesztettk a rokoni kapcsolatok. Az
individualista szellem trsadalom mr rgta rossz szemmel nzi a ro
konhzassgokat. Az si rmai jog mg a msod-unokatestvrek hzass
gt is tiltotta. A rmai katolikus egyhz is nagy slyt helyezett arra, hogy
rokonok ne hzasodjanak egymssal. A trvnyek egyre szigorodtak. Kr. u.
597-ben Szt. goston megkrte Gergely ppt, hogy szablyozza trvny
ben a hzassgot. A ppa azt vlaszolta: Szent trvny tiltja, hogy egy frfi
felfedje rokona szemrmt. Az igazhv teht legfeljebb harmad- vagy ne
gyedfok rokonval hzasodhat" - ms szval msod- vagy harmad-uno
katestvrvel. A tizenegyedik szzadra a tilalmat mg a hetedfok rokonok
hzassgra is kiterjesztettk. Igen sokan - mg a hatod-unokatestvrek is,
akiknek csak egy kzs k-k-nagyszljk volt - csak egyhzi diszpenz
cival hzasodhattak. Ha John Majorben s Margaret Thatcherben gyen
gd rzelmek tmadtak volna egyms irnt, pspki jvhagysrt kellett
volna folyamodniuk, mivel mindketten a szletsk eltt ktszz vvel el
hunyt John Crusttl szrmaznak.
Nem tudjuk, mirt tiltotta az egyhz ilyen szigoran a rokonhzassgo
kat. A kzeli rokonok frigybl satnya utdok szletnek, hangoztatta Ger
gely ppa; csakhogy erre aligha szolgltattak bizonytkot a tvoli unoka
testvrek gyerekei. A lehetsges hzastrsak krnek drasztikus szktse
sokakat clibtusra knyszertett - s a valls fel terelt. Eurpa bizonyos
rszeiben a npessg egyhatoda halt meg gy, hogy sose kttt hzassgot
(innen ered a monds, hogy Mg az rdg is rossz szemmel nzi a fajta
lankodst, kivve Elzszban"). Utdok hjn sokszor knytelenek voltak
vagyonukat az egyhzra hagyni. A hzassgok ellenrzse hatalmat adott
az egyhznak, amely ezt habozs nlkl kihasznlta.
szak-Skciban a tizenhatodik szzadban az egyhz szembekerlt a
klnokkal. Maga a kln nagyjbl megfelel egy nemzetsgnek (br az ala
pt atya vr szerinti leszrmazottai nem rklik felttlenl a vagyont is).
A Mackay kln nemzetsgfi igyekeztek ms nemesi csaldokkal rokon
sgba kerlni, de ez sem vdte meg ket a tiltott fokon belli hzassgok
tl. Mivel tvoli birtokaikon az egyhznak vajmi kevs hatalma volt, fittyet
hnytak a szablyokra. Rosszul tettk. i551-ben Orkney pspke rvnyte-

72
ARMAGEDDON ELLENTMOND SA

Rszlet egy sznes inicilkkal


dsztett kdexbl: azokat
a rokoni kapcsolatokat
brzolja, amelyek esetben
az egyhz tiltja a hzassgot.

lennek nyilvntotta a trvnyes rks, Aodh Mackay nagyszleinek h


zassgt mint tlsgosan kzeli rokonokt. A birtokot teht nem rkl
hette Aodh, hisz apja trvnytelennek minslt. Fldje az egyhzra szllt.
A trtnet rdekes fordulata, hogy visszavsrolhattk a pspktl risi
sszegrt, ngyezer skt mrkrt. Nha igen kifizetd az uralom a roko
ni kapcsolatok felett.
Angliban nhny vvel korbban VIII. Henrik trtelmezte a hzassg
fogalmt. Els prblkozsa sorn arra hivatkozott, hogy a Bibliban az
ll: a felesg egy test, egy vr a frjvel. Azon az alapon krte Aragniai Ka
talinnal kttt hzassga rvnytelentst, hogy ez a frigy vrfertz,
mert Katalin korbban Henrik btyjnak, az i502-ben fiatalon elhunyt Ar-

73
A VRNKBEN VAN

thur hercegnek a felesge volt. A ppa elutast vlasza vezetett a reform


cihoz s a hzassgi tilalmak szmnak cskkenshez: Henrik mg az
unokatestvrek frigyt is engedlyezte.
Am a kzvlemny vltozatlanul eltlte a rokonhzassgot. Amikor az
Amerikai Tuds Trsasg 1855-ben gylst tartott a Rhode Island llambe
li Providence-ben, Charles Brooke a krds haladktalan tudomnyos
vizsglatt kvetelte: a trsadalom biztonsga s felemelkedse" forog
kockn, hangoztatta. Nyolc llam trvnyhozsa rvidesen bncselek
mnynek, tovbbi harminc pedig kihgsnak minstette az unokatestv
rek hzassgt. Manapsg az Egyeslt llamokban ktszz hzassg kzl
alig egy ilyen. Eurpa nagy rszben sem gyakoribb. A mai Angliban az
jszltteknek csaknem egyharmada hzassgon kvl szletik, vagyis a
szexulis viselkeds kicsszott az llam ellenrzse all.
Msutt a rokonhzassg jelentsge nem cskkent. A rokonok kzti
frigy a szably. Ezen a tren az si egyiptomiak mentek a legmesszebb. Ke
vs volt a fld, s frfiak is, nk is rklhettk. Hogy a csaldban marad
jon, ltalnosak voltak a testvrhzassgok. A szoks zisz s Ozirisz frigy
vel kezddtt. II. Ptolemaiosz felesge a sajt hga, Arszino volt (aki fl is
vette a Philadelphus, vagyis fivr-szeret nevet). Egyiptom kvetkez ti
zenegy uralkodja kzl ht a hgval lt hzassgban. A rmai idkben
egy rvid idszakban az egyiptomi hzassgok jelents kisebbsge jtt lt
re fivrek s lnytestvrek (vagy fltestvrek) kztt. sztnzte a gyakor
latot a nk trsadalmi rangja s a drga menyegzi ajndkok szoksa is.
Br az incestus (vrfertzs) kifejezs az incasta (tiszttalan) szbl szr
mazik, s Freud a trsadalmi rend alapjnak tartotta a tilalmt, bizonyos
krlmnyek kztt igen gyakori.
Az Egyiptombl val menekls sorn Mzes meghatrozta a hzassgi
trvnyeket, melyekben utlat trgya az egyiptomi szoks (jllehet maga
egy frfinak sajt nagynrf1vel val hzassgbl szletett). A ksbbi zsi
d trvnykezs azonban kedvezett a rokonhzassgoknak. Bizonyos he
lyeken szinte szably volt az unokatestvrek hzassga. Nem lehetetlen,
hogy Jzsef s Mria is unokatestvrek voltak (br gyermekk szokatlan
genetikai kapcsolatban llt e vilgi szleivel). Nmetorszgban mg az
1920-as vekben is minden tdik hzassgban voltak a hzasfeleknek k
zs nagyszlei.
A finnekhez hasonlan a zsidknak is megvannak a sajt rkld be
tegsgeik. Klnsen gyakoriak az agyi s idegrendszeri krosodsok. Az
askenzi (kelet-eurpai szrmazs) zsidk krben gyakran elfordul
rkltt rendellenessgek kzl tizenegybl nyolc ilyen. Az esetek szma

74
ARMAGEDDON ELLENTMONDSA

szksgszeren magasabb a kzeli rokonok leszrmazottai esetben. A zsi


dk egy csoportja j s tletes mdszert dolgozott ki a megtmadott gye
rekek szmnak cskkentsre. Genetikai vizsglatokat vezettek be, nem
azrt, hogy megszaktsk a terhessget, hanem hogy elkerljk az azonos
srlt gnt hordoz rokonok hzassgt.
A Tay-Sachs-kr a kzponti idegrendszer rkltt rendellenessge. El
puszttja szmos idegsejt szigetel vdburkt, s egyre slyosbod moz
gskrosodst, majd korai hallt okoz.
A belegsg klnsen gyakori az askenzi zsidk krben. A finnorszgi
esethez hasonlan a Tay-Sachs-mutci legtbb hordozja is - tudtn k
vl - rokonsgban van egymssal: azonos srlt gnpldny hordozi,
mert egyetlen, rgen lt kzs stl szrmaznak. Sok zsid hzassg jn
ltre olyanok kzt, akik tudjk magukrl, hogy rokonok: de a betegsg ta
nbizonysga szerint szmos tovbbi esetben a hzasfelek tudtukon kvl
vannak rokoni kapcsolatban egymssal.
Nemrg megtalltk a gnt, s vgre ltezik olyan vizsglat, amellyel ki
lehet szrni a hordozkat. Nhny zsid ignybe is vette, s megvizsgltat
ta a magzatt, hogy szksg esetn megszakttassk a terhessget. Az orto
dox kzssg azonban mlysgesen ellenzi az abortuszt: vlemnyk sze
rint Isten eltt minden gyerek egyformn rtkes, akrmilyen csaps sjt
ja, s mindegyiknek joga van megszletni.
Joseph Ekstein rabbi a New York-i lubavicsi ortodox zsid kzssg tag
ja. Legismertebb kzpontjuk a brooklyni Crown Heights-i, de sok tagjuk
van Londonban s msutt is. A lubavicsiek nagy tiszteletben tartjk alap
tjuk, az i994-ben elhunyt Schneerson rabbi emlkt. Annak az ortodox
hagyomnynak a kveti, amely szerint a hzassgok nemcsak egynek,
hanem csaldok kztt is kttetnek. A prokat gyakran hzassgkzvett
hozza ssze, aki a frigy elksztse sorn figyelembe veszi a csald vagyo
nt, rdekeit, hagyomnyait s - dnt mrtkben - egszsgt. Ha a csa
ldban rkld betegsgek vannak, elmaradhat a hzassgkts. A gene
tika csak slyosbtja a problmt: ha egy fiatal frfirl vagy nrl mr kide
rlt, hogy rtalmas gn hordozja, nem lehet rossz nven venni, ha msok
felhasznljk ezt az rteslst egy j csaldtag kivlasztsnl. Sok lehets
ges hzassgbl ilyen vagy olyan krosods miatt nem lesz semmi, s azok,
akik egybknt hzastrsak lehettek volna, egyms ltezsrl sem szerez
nek tudomst.
A Crown Heights-i kzssgben minden tizenhatodik ember hordozja
a Tay-Sachs-gn egy pldnynak, mg az amerikai ssznpessgben csak
minden hromszzadik. Ekstein rabbi csaldjt ldzte ez a kr. Ngy gye-

75
A VRNKBEN VAN

Egy idegsejt keresztmetszete: jl lthat az egszsges idegeket krlvev velshvely, amely


a Tay-Sachs-kr esetn elpusztul.

rekt vitte el, s szvbemarkolan beszl arrl, micsoda gytrelem vgig


nzni, hogyan sorvad el egy egszsges csecsem. A betegsg jellege miatt,
s mert a kzssg legtbb tagja sokat tud a genetikrl, fivrei s nvrei
nehezen tallnak lettrsat.
Amikor a gnt felfedeztk, nhny lubavicsi fiatal nem volt hajland
alvetni magt a vizsglatnak. Senki sem szereti, ha rstik a blyeget,
hogy eddig nem sejtett betegsg hordozja, s a lehetsges hzastrsak me
neklnek elle. Ekstein rabbinak egyszer, de ragyog tlete tmadt. Ha a
vizsglatokat nvtelenl vgzik el, s amennyiben mindkt fl hordozza a
betegsget, kzlik a szlkkel, hogy az adott frigy nemkvnatos, gy csak
nhny lehetsges hzassg hisul meg: azok, amelyekben mindketten
hordozzk a betegsget. Az okot egyik flnek sem kell megtudnia; elg ja
vasolni a szlknek, hogy ne szorgalmazzk a hzassgot (br akadhatnak,
akik nem rik be ennyivel). Az esetek nagy rszben, amikor a leend h
zastrsak kzl csak az egyik hordoz, a msik mentes a Tay-Sachs-gntl,
nem ll fenn a veszly, hogy beteg gyerek szletik, s a hzassgnak nincs
akadlya. A hordoznak nem is kell tudomst szereznie sajt genetikai l-
ARMAGEDDON ELLENTMONDSA

lapotrl. 1983-ban Ekstein rabbi megalaptotta a Dor Yeshorimot, a Sz


vetsg a Szlegyenes Nemzedkrt nev szervezetet. A serdlkor fiatalo
kon - nkntes alapon - elvgzik a vizsglatot az iskolban, mieltt elr
nk a hzasuland kort. Mindegyikk kap egy szmot. A vizsglat eredm
nyt nem mondjk meg nekik: azt csak a Szvetsg tudja. A szm s a k
ln nyilvntartott vizsglati eredmny - hordoz vagy nem hordoz - sz
mtgpre kerl New Yorkban. A hzassg tervezsekor elg egy telefon,
hogy sszevessk a megfelel szmokat a nyilvntartssal. Ha mindkt fl
hordoz, lemondanak a hzassgi tervrl.
A Szvetsg valjban a vrfrisstst segti el, mert megakadlyozza a
rok.onok hzassgt - akik a Tay-Sachs-gnt hordoz kzeli vagy tvoli
kzs stl szrmaznak -, s tmogatja azokt, akikben nincs meg a k
zs gn. Az eljrs igen eredmnyesnek bizonyult. Tzezrvel vgeztk el a
vizsgMatokat a zsid kzssgekben vilgszerte, gy elkerltek sok beteg
sghordoz kzti hzassgot. Megakadlyoztk legalbb hsz krosodott
gyerek vilgra jttt. gy megvltozott az utdnemzs szerkezete, csk
kent a Tay-Sachs-kros gyerekek szletsnek szma, mgsem kellett
abortuszhoz folyamodni. Ekstein rabbi vlemnye szerint az eljrst nem
zsidk is alkalmazhatnk, s ms betegsgek is kimutathatk vele. Kzs
sge mr most is felhasznlja a mdszert a ciszts fibrzis gnjnek kisz
rsre.
Br a Dor Yeshorim eljrsa igen tletes, s lehet, hogy szlesebb krben
is alkalmazni fogjk, az vszzadok alatt kialakult hzassgi szoksokon
aligha fog vltoztatni. A vilg nagy rszben ma is mindennapos a kzeli
rokonok hzassga. A dl-indiai Tamil Naduban pldul a legtbben els
unokatestvrk lnyt veszik felesgl. Sok gyerek mg kzelebbi rokonok
hzassgbl szletik, hisz gyakran elfordul, hogy a nagybcsi az unoka
hgt veszi el.
Az ilyen vidkekrl szrmaz adatokbl kiszmthat a rokonhzass
gok hatsa az egszsgi llapotra, mert megmutatja a rejtett genetikai k
rosods mrtkt. Ha ez elenyszen csekly, az unokatestvrek hzassg
nak kvetkezmnye elhanyagolhat; nem szmt, hogy a gyerekeknek sok
szrmazs rvn azonos kzs gnjk van, mert kevs kztk az rtalmas.
Ha a npessg tele van srlt gnekkel - amelyek egy pldnyban rtalmat
lanok, de amikor a gyerek mindkt szljtl rkl egyet, megmutatko
zik a hatsuk-, akkor az unokatestvrek gyermeke magas rat fizet.
A mormonoktl szrmazott az els tbaigazts a kvetkezmnyek
nagysgra vonatkozan. Csaldfjuk szmtalan kapcsolatot mutat a tbb
szzezer g kzt, mivel kzeli rokonok hzasodtak egymssal. A mlt sz-

77
A VRNKBEN VAN

Az agy nvekedsvel kapcsolatok jnnek ltre az idegsejtek kztt. Sok ideget vastag vels
hvely- (mielinburok-) rteg vesz krl, amely ezeken a (szletskor, hat hnapos, tves s

zadban (amikor a gyermekhalandsg sokkal nagyobb volt a jelenleginl)


az els unokatestvrek hzassgbl szletett gyerekek kzl minden t
dik meghalt tizenhat ves kora eltt, mg a mormon npessg egszben
csak minden nyolcadik. tven vig tartott, hogy megllaptsk, volt-e az
atombombnak genetikai hatsa Hirosima s Nagaszaki npessgre; az
unokatestvr-hzassgoknl azonban sokkal hamarabb megmutatkozott
az eredmny. Mindkt rosban krlbell kt httel ksbb kezdtek jrni
- s beszlni - az unokatestvrek gyerekei, mint a nem rokon szlki, s ez
rvilgtott, hogy lteznek olyan gnek, amelyek lasstjk a nvekedst, ha
ktszeres mennyisgben rklik ket.
Angliban a legzrtabb kzssg a pakisztni. Az sszes hzassgnak
tbb mint a felt unokatestvrek ktik, s ez a szm a jelek szerint nem
cskken. A csecsemk mintegy kt szzalka - vagyis az orszgos tlagnak
krlbell ktszerese - halva szletik, vagy egyves kora eltt meghal. Eb
ben rsze lehet a szegnysgnek is, valamint a bizalmatlansgnak a nyugati
orvostudomnnyal szemben, de a rokonhzassgok szerepe sem elhanya
golhat. Ezeknek megszntvel felre cskkenne a csecsemhalandsg a
pakisztni szrmazs britek kztt.
ARMAGEDDON ELLENTMONDSA

felnttkorban kszlt) felvteleken fehr sznben jelenik meg. Bizonyos betegsgeknl, ami
lyen a Tay-Sachs-kr, a mielinburok rtegei nem alakulnak ki megfelelen.

A hats vilgszerte ugyanaz. A tz ven aluliak elhallozsi adatai (vala


mint a halvaszletsek s vetlsek szma) alapjn szmtott gyermekha
landsg nagy eltrseket mutat, Japnban minden harmincadik, Brazli
ban minden harmadik gyerek hal meg, mieltt kamaszkorba jutna. De az
unokatestvrek gyermekeinl ez az arny mindig krlbell ngy szza
lkkal magasabb, mg az olyan, egymstl eltr orszgokban is, mint Ja
pn, Brazlia, Franciaorszg, India vagy Nagy-Britannia. A nagybcsi-uno
kahg hzassgokbl szrmaz gyerekeknl (ahol a hzasfeleknek ktszer
annyi kzs gnjk van, mint az unokatestvreknek) az elhallozs vesz
lye tz szzalkkal nagyobb, mint a nem rokon szlk esetben.
Nem nehz kiszmtani, hogy az unokatestvrek gyermekeinek hallo
zsi arnya csak akkor lehet ennyivel magasabb, ha mindegyik nagyszl
jk egy vagy kt gn hallos megfeleljt" hordozta; egy vagy kt pl
dnyt a klnfle lappang gnekbl, amelyek ktszeres mennyisgben
mr hallukat okozhatjk. Valsznleg minden ma l embernl ez a
helyzet.
Amint visszafel haladunk a genetika svnyn, azt ltjuk, hogy az em
berisg tele van genetikai krosodssal. Az sk utni kutatsok nem a re-

79
A VRNKBEN VAN

mlt tisz.ta s elkel csaldfkat hozzk napvilgra, hanem a tkletlen


sgeknek a trtnelmen tzuhog radatt, amely a jelenkori betegsgek
ben mutatkozik meg. Senki sem tudja, mirt lappang a mlyben lthatatla
nul annyi rtalmas gn. Nhnyuk taln a kzelmltban keletkezett vala
milyen genetikai hiba rvn, s rvidesen eltnik; msok azonban olyan
elterjedtek, hogy taln valami ismeretlen elnnyel jrnak hordozikra
nzve.
A grg apokalipszis sz bet szerinti rtelme: annak leleplezse, ami
rejtve volt. Ktezer ven t prbltk magyarzni, mit rejt a vilg vgrl
szl bibliai jslat. Sir Isaac Newton veken t tprengett rajta (Newton
azrt rta meg szvegmagyarzatt a Jelensek knyvrl, hogy megvi
gasztalja az emberisget, amirt ms tekintetben oly magasan fltte ll",
jegyezte meg Voltaire) . A hiszkenysg s lokoskods (nagyrszt a Fene
vad szma, a 666 alapjn, amely nlkl senki se vehetett, se el nem adhatott
semmit) az Antikrisztust a stn gynkeinek tekintett szemlyekkel azo
nostotta - st magval Mefisztval.
Tolsztoj a Hbor s bkben rmutat, hogy ha azA=1, B=2 stb. szablyt
alkalmazzuk, a L' empereur Napoleon" kiadja a mgikus szmot. A ppa
elnevezse (Rmischer Pabst") ugyancsak. Gondos elemzssel kimutat
hat, hogy Oliver Cromwell is megfelel a kvnalomnak: Rex Oliver; Lord
Protector (mindssze az L-t kell kihagyni a Lord" -bl). Nem lehet vlet
len, hogy az Apollo-8 holdutazs legnysgben mindenkinek hatbets
neve volt: Lovell, Anders s Berman. John F. Kennedy 666 szavazatot ka
pott a Demokratikus Konvencitl, amely elnknek jellte. Ronald
Reagan (valjban Ronald Wilson Reagan - csupa hatbets nv; mondta
egyszer: Megvan a jel, hogy kzeleg Armageddon napja . . . Minden a he
lyre kerl, s mr nincs messze az id") a biztonsg kedvrt 666-rl 668-
ra vltoztatta a hzszmt. s persze ha a VI rmai szmokkal hat, a grg
S hasonlt a hatosra, valamint lehetsges", hogy a babiloni A bet hatot is
jelentett: egytt kiadjk a hitelkrtya nevt - VISA -, amely nlkl szinte
senki se vehet semmit.
A valdi genetikai apokalipszis - annak a leleplezse, ami a DNS-ben
rejtve van - mr szinte teljes. Feltrulnak a genetikai gpezet mkd
snek titkai. s legfkppen megmutatkozik, mi lesz az utols tlet ered
mnye.

TLOLDALT: II. Erzsbet angol kirlyn s Dvid kirly lltlagos rokoni kapcsolatnak tr
kpe a szmtalan csaldfa kzl. sszellti azt akartk bizonytani, hogy a kirlyn Isten
akaratbl uralkodik a vilg legnagyobb rsze fltt.

80
1 JDA
1 2 ZERKH t- 2 FRES

.....
ESROM
ETHN ARM
MAHOL AMINOB
NASSON

1 3 KLKL SLMN

GAOHOL
BOZ
OBEO
ESAU
fSAJ
SCAU
3 DVID
HBERSCOT Lukcs 3:23-33
BOAMHAIN
4 Salamon
AVBAIM.HAlN 8 NTN
TAIT Robom
Man.ita
AGHENOIN Abija
Mainn
As
LAMH FK)NN Elikim
HBER Josalt

b
JnOn
Jzscl
ADHNOIN Jrm

FABHlAGlAS -
Jda
NEINNUAIL Jo
Simeon
Lvi
AUOIO AmAsia

EAACHAOA Uzzl.1s
Mant
OEAGFATHA Jo
Jrim

r"'
BRATHA ....,
.,
Elizer
Ezkls
BREOGAN J e
BILLE Manasse

GALLAM mon
Elmodm
Jsi.as
Hosm
1 4 EOCHAIDH
Addi
JohM Melki
Nagy Ugaine Nri
6 J KNIS Salthlel
Termkeny Angus
Rhsa
Salthlel
Joanna
r kirlyok Skt kirlyok Zorobabel Jda
SI
Abiud
Enna
MI
Labhrdluire Elijkjm Nasigal
Biathachla
., Esli

f
Esamhuin Fiachra
Naum
lvoos
Roonein t . Fergus Sdok

A "m
ElnTocha Manius
Malthatias
Fmn Dornadil
JZS(l'f
Eliud

n
Eoch<'l1dh Feidloch Reulher

rimTh n
Btias Fitleanlhuas Eders Janna

1
Elezr Mctlki
LuohaKt Reibdeary Nagy Conaire

rt>rod
Ma hn Lvi
C a n l.Corbled

n ll)
Mana
Fearadach 1 . Co Jkb Hli
lualthal Te3Chtmor Modha Lamha
100 csati l1on Conn II. Conaire 7 JZSEF M a e 9 MRIA
- Penardim ___ _
J,.Oott Barn
Saraid ,_
_ __ 15 JZUS KRISZTUS

Calbred Dalriada
Caradoc Lukcs 1 :31-33
Eochaid
Alhirco
.s ... szlszfial. s nevezed

d
az nevt Jzusnak. Ez nagy
Oaudla Unus Findaehiar
Thtinkland
lszen, s a Magassgos Finak

ura od
hNattatik; s nki a ja az r Isten
FlnCormach

a Dvidnak. az atyjnak kirlyi


Aaomaich

szkt; s lk ik a Jkb
Anous
Heli Eochadh
(lzrl} hzn mindrkk, s az 6
E"
kirlysgnak vge nem lszen.
Nagy FerglJS
Oangard L mg M<1t25:31 s Lukcs 22.-30
Golll'ah
Aydan
Eugene
Donald
Eltiaci>
E1hndre
EthaHIOd
Eths
a
Alpln
Kenneth McAlpin
Konstantin
IV. Oonald
E1hus
Malcotm
111_ Konstantin
U. Kennetn
IV_Komtantin 11 Mak:olm

IV. Kenneth Beahix


Ouncan
Bancho
Malcolm
F!eance Dvid

Gwa!ter Henrik
Dvid
Gwalter
ISObei
Alexander Rbt
Jnos R6ben
Robert Bruce

Walter Stuart Marjory

:: ::: o(f.-----,,_J"oha_n_n-1,
Er z
sbet
1 _
f""""
11 Jakob
111.Jakab
- Kirlyi g Frestl Dvidon t

Margit 1. IV. Jakab Jzusig


V.J(lkab
M:iriasktkirlyOO
rks kirlyi g, amint Isten
VI. s 1. Jakab

va1:mt6f.1. Stuart Erzsbet meggrte Dvidnak, Salamontl


Zsfia Sdkisig s Tea Tephiig
l. Gytgy
H.GyOlr;t
Fflgyes walesi herceg - Kirlyi g Zerkhtl Eochaidh r
Ill. Gyrgy kirlyig
Edward kenti herceg _

Albert r. Viktria _

""'----
Alexandra 1. VII. Edward Kirlyi g Dvidtl Jzsefig,
Mria kirlyn t. V. Gyrgy Mria frjig
VI. Gyrgy 1. Bowes-Ly Erzsbet

II. Erzsbet
A VRNKBEN VAN

Elszr is mindenki megtallja a helyt, egyszeren szrmazsa rvn.


Knny gnyt zni a kirlyi csaldfkbl, melyek II. Erzsbet kirlynt
kapcsolatba hozzk az testamentummal olyan valszntlen figurk
kzvettse rvn, mint Szz Csatt Ltott Conn, Lear kirly, Termkeny
Angus', s a bibliai idkben mc, Jsft s r. Ezeket a csaldfkat a kp
zelet rajzolja fel, amely nlkl nem lehet meg az amatr genealgus. De az
mr egyszer mrtani tny, hogy br a trtnelmen tvezet t ismeretlen,
Erzsbet csaknem bizonyosan egyenes gi leszrmazottja minden kirlyok
legnagyobbiknak, Dvidnak s megiddi seinek. Mindannyian oszto
zunk ebben a dicssgben; magunkban hordozzuk az rksget az elpusz
ttott vros si npbl, amelynek vgya, hogy utdaik ismt egybegylje
nek tlethozatalra, Armageddon gondolathoz vezetett.
Csakhogy a megvltsban remnykedk gylekezetben nem a tkle
tesek tallkoznak majd, hanem az egyetemesen hibsak. A gnekben rejl
apokalipszis mindannyiunkat egyest, de csak azrt, hogy egytt utazzunk
a trtnelmen traml kzs tkletlensg folyamn.

* A szerelem istene a kelta mitolgiban (a ford.)

82
II. FEJEZET

Nemek s adk

Az rksg gondolata mindig elzi vagy


legalbbis csillaptja az rksk fjdalmt,
amit szvkben a haldokl sorsa kelt."

CERVANTES: DON QUIJOTE*

A GENETIKBAN CSAK AZ RKLS SZMT, az rklsben azonban kornt


sem csak a genetika. Hiszen az embereket leginkbb rdekl szablyokat -
amelyek kimondjk, hogyan rkldik egyik nemzedkrl a msikra a va
gyon - mr jval Mendel eltt megszvegeztk. Ezektl a szablyoktl fgg
az ket ltrehoz trsadalom tovbbi fejldse; az, hogy nhny ember kez
ben sszpontosul-e a gazdagsg, vagy mindenki rszesl belle. A politikai
rendszerek kzdelme gykerben az rklds trvnyrl folytatott vita.
Ki rszesljn a mltbeli munka gymlcseibl, a sokasg vagy a kevesek?
A politikai vita nem ll tvol azoktl a nzeteltrsektl, melyek a szr
mazsrl alakultak ki a trsadalom kezdete ta. Mindegyik a nemisg k
rl forog, amely a legalacsonyabb rangakat is bekapcsolja a mindenki
mssal kzs csaldfba. A nemisg minden nemzedkben kt ember bio
lgiai tkjnek egyestshez s gyermekeik kzt val sztosztshoz ve
zet. Nem a hall, hanem a nemisg tesz mindenkit egyenlv.
Az adztats megprblja lefaragni a vagyoni klnbsgeket s ki
egyenlteni a jvedelmeket. Sztosztja az egynek javait a npessg egsz
ben. Bizonyos rtelemben azt akarja elrni, hogy a pnz gy viselkedjk,
mint a nemisg. A folyamatot a gazdasgban jraelosztsnak, a genetik
ban rekombincinak nevezzk.
A legtbben termszetesen nem rlnek a javak egyenl elosztsnak,
ha nem gnekrl, hanem pnzrl van sz. Az adztats mvszete abban
ll, mondta Colbert, hogy kopasztskor minl tbb tollat tpjnk ki a lib
bl minl kevesebb sziszegs rn. Aki megtollasodik, szvesebben tartana
meg mindent magnak vagy legalbb kzvetlen utdainak. Ebben segt az
aszexulis reprodukci - a gnek vagy a pnz -, amelynek rvn az utd

* j Magyar Knyvkiad, 1955. Gyry Vilmos fordtst tdolgozta Szsz Bla


MIT JELENT VALJBAN A NEMISG

A nemisg egyrtelm dolognak ltszik. Mitl fgg, hogy ilyen vagy olyan
nem lnny fejldik egy embri? Mint a biolgiban ltalban, a vlasz
egyszernek tnik, de tulajdonkppen bonyolult. Az egyszer magyarzat
az, hogy egy Y-kromoszmt hordoz ondsejt hm embrit hoz ltre. De
hogy mikppen, az mr vltoz. Az ecetmuslica a nemi s egyb kromo
szmk szmnak egyenslya alapjn hatrozza meg, hm vagy nstny le
gyen-e az llat. Az embereknl kevsb bonyolult a mdszer. Egyetlen gn
az Y-on a frfiassg svnyre tereli a fejld embrit. A gn igen nagy ha
ts. Elfordul, hogy egy gyerek nyolc X- s egyetlen Y-kromoszmval
szletik. Slyos testi s lelki tnetek jelentkeznek nla - de fi lesz.
A kritikus gnt 1990-ben fedeztk fel olyan betegekben, akik frfiak vol
tak - de nem talltak bennk Y-t. Valjban az Y-nak egy apr rszecskje
tapadt egy X-hez: ez volt az els jelzs, hogy hol keressk a frfi.meghatro
z gnt. Mra megtalltk, s ha beinjekciztk vele az egerek petesejtjt, a
genetikai nstnyek hmekk fejldtek. A fehrje, amelyet a dnt gn lt
rehoz, meghatrozott helyeken hozzkapcsoldik a DNS-hez s elgrbti.
Taln ez szablyozza a tbbi gn viselkedst, s ez okozza, hogy az embri
frfiv fejldik.
Hogy a jrulkos gnek pontosan micsodk, az nem vilgos. Nmelyik
nek a hibja rkot okoz (teht normlis krlmnyek kzt valsznleg a
sejtosztdst szablyozza), msok rendellenes nemi fejldshez vezet.
Egyikk felgyorstja a hm embrik fejldst a niekhez kpest - ezrt
magasabbak a frfiak, mint a nk. De a fejlds ksbbi szakaszban to
vbbi gnek is mkdsbe lpnek, gy kialaktjk a frfiak s nk klnb
z nemi jegyeit. Nmelyik gn ms feladatot lt el a kt nemnl. Az, ame
lyik a frfiaknl kopaszodst okoz, a nknl slyosabb kvetkezmnyekkel
jr: hordoziban megvan a hajlam a ciszts petefszek kialakulsra (ez
kevsb alkalmas a petesejtkpzsre, s kellemetlen tnetekkel jrhat).
MIT JELENT VALJBAN A NEMISG

Frfikromoszma.
Fluoreszkl festkkel
kezeltk, amely csak
az Y-kromoszmhoz
ktdik. !gy a kromo
szma, amely afejld
embritfrfiv alakt
kritikus gnt hordozza,
kitnik a tbbi kzl.

LENT: A frfiassg kdja. A vonallal krlhatrolt betsor a korai szakaszban lv embri frfiv

fejldst beindt DNS-darabot mutatja ngy bzisval'; az A, G, C s T betkkel. A ksr be


tsor (D, R, Vs gy tovbb) brzolja az aminosavakat, a fehrje ptkveit: valjban ez a fe
hrje indtja el a magzatburokfejldst, nem a petefszek. Akik szeretik ajelentsgteljes vletle
neket, azok nyilvn rmmelfedezik majd fel, hogy a vonallal krlhatrolt rsz msodik sor
ban szerepl aminosavak kzl ngy kiadja aMALE (azazhm") szt.

GAATATTCCCGCTCTCGGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTA 537
N P A L P R S S S F L C T E S C N S

AGTATCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCA GATAGAGTGAAGCGAC ( 597


K y a e E T G E N s K G N v Q D R v K R

CCATGAACGCATTCATCGTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAAATC 657
P M N A F I V W S R D Q R R K M A L E N

CCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTG 717
P R M R N S E I S K Q L G Y Q W K M L T

777

d
AAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGA
E a E a E

1
E A K w p F F A K L Q A M H R

AATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGAT CTGCCGAAGAATTG 837


K Y P N Y K Y R P R R K A K M L P K N C

N T R S D L V G R R R C C R R A
A VRNKBEN VAN

rintetlenl rkli a szl biolgiai vagy anyagi tkjt. Az erforrsok


megmaradnak egy rklsi gon bell, anyrl lnyra szllnak s gy to
vbb, nem oszlanak szt egy csoport kzvettsvel. A szexulis jraterme
ls sorn jraeloszts trtnik. A kapitalizmus s szocializmus kzdelme
teht lnyegben a nemisgrl folytatott vita. Br a kt rklsi md ellen
tte kevsb les a pnz, mint a gnek esetben, igen ers az emberben a
ksztets, hogy a kszpnzt megvja a szexulis jratermelstl.
A vagyon s hatalom aszxulis trktsn alapul trsadalmakban
trvnyszeren kialakul az egyenltlensg, s ez idvel politikai felfordu
lshoz vezet. Az amerikai forradalom, amelynek az adzssal kapcsolatos
elgedetlensg volt az alapja, azt akarta elrni, hogy mindenki osztozzk a
hatalomban (br a tkben nem). Minden rklsen alapul kormny
forma termszetbl addan zsarnoki . . . Aki a kormnyzst rkli, rk
li a npet is, akr egy nyjat vagy csordt" - mondta Tom Paine. Ironikus
mdon ma ppen az Egyeslt llamokban egyesl leginkbb a gnek, a va
gyon s a hatalom rklsi rendje. Mghozz olyan okokbl, amelyek a
forradalom eszmire s ezek trsadalmi elzmnyeire nylnak vissza.
Minden modern llam megprblja kisebb-nagyobb mrtkben csk
kenteni a vagyon felhalmozst adztatssal. A politika kzponti krdse,
hogy milyen szinten szabjk meg az adkat, s kinek kell fizetnie ket.
A nemisg s az ad ltalban jobban rnehezedik a gazdagokra (akik tb
bet fizetnek az egyikbl s drgbban fizetnek a msikrt). Sok politikus
szerint knnyteni kellene terheiken (legalbbis az adk tekintetben).
Az uralkodk eleinte azokkal fizettettk meg az adkat, akik legkevsb
kerlhettk meg ket - innen a sad s a fejad, amely gazdagra s sze
gnyre egyarnt vonatkozott, de az arnyokat tekintve sokkal tbbet vett el
az utbbitl. Az rksdsi adt jval a jvedelemad eltt vezettk be
Angliban. Mivel a birtokot nehz titokban tartani, egy ideig eredmnyes
mdszer volt arra, hogy pnzforrsokat vonjanak el a gazdagoktl. Mra
azonban megvltozott a helyzet. A kormny bevteleinek alig fl szzalka
szrmazik az rksdsi adbl, s a jelenlegi kormny megvlasztsakor
egyrtelm, br hatrid nlkli gretet tett, hogy ezt teljes egszben eltr
li. De sszessgben nvekedett az adbl befoly nemzeti jvedelem ar
nya (harmincngy szzalkrl harminchtre) a konzervatv kormnyzs
i979-tl i995-ig tart tizenhat ve alatt, amikor a npessg legszegnyebb
tdnek adterhe felszktt, a leggazdagabb td pedig cskkent.
A nemisg, akr az adk, kltsges gy. Vget nem r vitk folynak ar
rl, mirt alakult ki, s (ismt, akr az adknl) ki mvelje, milyen gyakran
s mikor. A nemisg azrt drga dolog, mert egy egsz osztly kell hozz,

86
NEMEK S ADK

amely gyakorlatilag improduktv. A hmek nemcsak hogy maguk nem


tudnak utdot szlni, radsul knyszertik a termel osztlyt, a nstnye
ket, hogy msoljk a hm gneket, br kzvetlen elnyk nem szrmazik
belle. Gazdasgi problmval llunk szemben. Mirt hajlandk a nst
nyek erforrsokat befektetni a hmek termelsbe? A nemisg nlkli sza
porods kzvetlen elnyei - hogy valaki teljes biolgiai tkjt csorbtatla
nul s hgtatlanul tadhatja utdjnak - prhuzamba llthatk a clok
kal, melyek a legtbb csald szeme eltt lebegnek, mikor gazdasgi tkjt
ilyen mdon szeretn trkteni utdaira.
Ha a vagyon - akr a gnek - megoszlik minden lehetsges rks kzt
(ami egy szexulis rendszerben azt jelenti, hogy hossz tvon sztszrdik
a teljes npessgben), akkor idvel kialakul az egyenlsg; mindenki tb
b-kevsb egyformn rszesl belle. Ha azonban aszexulisan rkldik
tovbb, bontatlan egysgknt egyetlen leszrmazsi gon, akkor nhnyan
risi vagyonra tesznek szert, msok szinte nincstelenek maradnak. Egy
szer matematikai trvny. i873-ban egy brazil milliomos, Domingo Faus
tino Correa meghagyta, hogy birto.kt egyenl arnyban osszk szt szz
vvel a halla utn l leszrmazottai kzt. Az gyet a mai napig sem sike
rlt lezrni. Csaknem tezren jelentkeztek a rszkrt, s br ktsgtelenl
rmmel fogadjk majd az rksget, egyikk sem fog meggazdagodni.
Egyetlen frfigi rks esetn rintetlenl megrzdtt volna a vagyon,
s az illet ma dsgazdag lenne.
A kt rklsi md kzti klnbsgre mr rgen felfigyeltek azok, akik
szletsk jogn klnleges helyet ignyelnek a trsadalomban. Ha elg
messzire kvetjk nyomon a genetikai svnyeket a mltba, mindenki ne
mesi szrmazssal bszklkedhet, mert tall egy kkvr st; de csak a ne
misg jvoltbl. Ha a csaldfa minden kitrjvel s kanyarval, frfiakon
s nkn t nyomon kvethet, idvel ktsgtelenl elvezet akrmelyik
elkel shz, aki csak esznkbe jut. Mint ahogy brmelyik arisztokrata
sei kzt is felttlenl akad a nemzedkek folyamn risi szm kzem
ber. Hogy kivltsgos helyzett biztostsa, az arisztokrcia j rklsi tr
vnyt tallt ki: csak egyetlen t szmt a trtnelmen t.
Angliban a legtbb cm aszexulisan.rkldik. Csak frfigon: a tl'
vnyesen fogant frfi rksk" rvn. A skt rendszer engedkenyebb,
megengedi a cm ngon trtn rklst is: brmelyik frfi rks
rl" beszl. A hromszz angol csald kzl, amely Hdt Vilmosig tudja
visszavezetni a szrmazst, csak egy kapcsoldik a kirlyhoz a kivlasztott
(s aszexulis) frfigon. Csupn a Bassett csald szrmazsa vezethet
vissza az apai gon - fitl apig, nagyapig s gy tovbb - a Hdtig.
..
- !

l
,... " . :

".l l.'-'

1
1
A NEMISG ..
, :

S A HABSBURGOK

A Habsburg-ajak a legrgebbre visszanyl jelleg


zetes csaldi vonsok kz tartozik. A jelensg
(hogy az als llkapocs elreugrik, gy az als fog
sor a felsn kvl zrul) elgg ltalnos. Az rk

r lsi sor rendszerint nem egyenes. De van egy igen


npes csald, amelyben a jelek szerint egyetlen gn
okozza a jelensget. A csaldfn huszonhrom
nemzedk s ngyszzkilenc ember tallhat. So
kukrl kszlt portr, gy a jellegzetessg tszz
vvel az illet halla utn is megllapthat. Az
rklsi md egyszer: dominns gnrl lvn
sz, hatsa megmutatkozik mindenkin, ak egyet
len pldnyt hordoz belle.
Az ajak s a cm rkldse kzti klnbsge
ken nyomon kvethetk a szexulis s aszexulis
szaporods klnbsgei. A jellegzetes ajak eljutott
- frfiak s nk kzvettsvel, hisz mindkettn
megmutatkozhat - szmos leszrmazottig, s h
zassg rvn ms csaldokba is. A Habsburg cm
egyetlen frfigon rkldtt.
Az els Habsburg urasg Werner pspk volt,
aki 1096-ban halt meg. A cm egyetlen gon szllt
aprl fira; rkltk Ausztria s Spanyolorszg,
Olaszorszg s egyes holland terletek uralkodi.

- l- i -... --
*

:;. 1:
::
. :; .
- !' :1.:..
.J
?...

-+-----+--'!"-

.,
,_,_..,

V. Kroly (lsoo-1558),
olasz iskola
r --9. j. w
;!. ,!

;1 r.
- -

G!},_., ::;_
l\c((o !lCl'llllt n(ii.
h11'.(ttio jdix, null e

1 p.! l ;i! ;,! 15-


i:

lr!ie

-!--1.,-t.., tn4 tc-:


r--t== I-- ::::'.,.}-..
; r .:

Sq:n WJrl U"pob

:::.;

__: -i=- 6--:_<:) ; :. -


- ;
lofl.'J i
e
0.1c .
-
l'Jab:- -
=
1

: ar
. _
., .

' -'

J .?y.=:._,::-,-"::."::
' , ,.
-

-=t"


.-:. !"..,. 1 j'.'.' r
'-- " / ;_',-" : .!,.:: ::--
4
::

.
-

;:';;;; t;;::s;s;; l ,:jrl


t --

=J -,;b.
--.-L.---i- - -. .

-r.- -lj "i;,:- ' Bkbern:;d'


o'j. }- }. 1! j_-;;1: - ( . ,1515!!:/ lthatk a jellegze?e5!!.,bsbu.g-vosk .
. .

J J
. : t
:. i
. .

.C:
-
-

. f ...__ &-,.1t. .- }..,....


.!,
;
::-
I --
.
/v
.
.


.

t
,o;;;""" - .
--

.
-
-
-- , t., ...
.
.
J.
>

:;:;:i:::: ::: :c:.


.
A jellegzetes ajak rkldsvel merben ms a helyzet.

:p.y9,_; ,:::
u'"'

::::5
"' "'

- %1:
tl, s elsodrdott

t.:. 0-;_;-,- 0

-;=
.'.L. r:F"--00
i -
;: -T' -'"'
.
,

.: . .:
.;;.. :::
::- r
.:s ,..,_,... .::: ...
;;::: ,. :.::"" ...
u e
Az rvels szimmetrija szempontjbl sajnlatos m-

" .:_ (:
I -:_ '"'-

don ausztriai Habsburgok kzvetlen frfiga kihalt


? -
.r
...._ az
- _ ___ __

!:[
!u
1 .....

-- .: ::-"
:Z u s.
Jf" 1740-ben N. Krollyal, aki fi rks nlkl hunyt el. Ezrt

0 meghirdette a Pragmatica Sanctit (a ngi rklst). Ez


::;:: , az eszkz a genetika tudsainak nem ll rendelkezsre, s

1- ,,,!
= - a,,.,.i..9 . a maga idejn nagy felhborodst vltott ki, vgl az oszt-
_

[ rk rksdsi hborhoz vezetett. A mdostott trvny


.9, : o rtelmben N. Kroly lnya, Mria Terzia rklhette a
-... "'
4 ... a ....

cmet majd azt Jef fia szletsekor visszaszrmaztatta
ismt a frfigra.
;.,..
,,.
A Habsburgok eurpai nagyhatalmi rangjt 1. Miksa
11 alapozta meg. Fit, a kpen fiatalon lthat L Flpt -,

,.,

..,.,, akin jl megfigyelhetk a jellegzetes csaldi vonsok .J
sszehzastotta rlt Johannval, s a hzassggal egsz
Spanyolorszgot elnyerte. Fiuk, V. Kroly nmet-rmai
csszr - megjelenstl fggetlenl - egy idben az eur
pai trtnelem leghatalmasabb uralkodja volt.

)}

"
A VRNKBEN VAN

A nemesi szrmazsra olyan bszke tovbbi ktszzkilencvenkilenc csa


ld genetikai tja vad trtnelmi cikcakkokat rt le apktl anykig s
vissza, hogy kialakuljon a kapcsolat.
Sokkal knnyebb utat tallni a ranghoz, ha nem zrjk ki a nemisget.
A szexulis rklds teremt kapcsolatot John Crust, John Major s
Margaret Thatcher kztt; s ez magyarzza, mirt nincs Crust nev ki
emelked politikus. John Crust vezetkneve, gnjeitl eltren, aszexulis
mdon rkldtt: csak a frfiakon t. Kvetkezskpp sokkal kevesebb
Crust van, mint ahny td-un.okatestvre Mrs. Thatchernek. John Crust
nevnek s biolgiai rksgnek elszakadsa az rklds egyik alapigaz
sgra vilgt r.
A nemisg demokratikus folyamat, amelybe mindenki bekapcsoldhat.
Az aszexulis szaporods viszont kirekeszt; olyannyira, hogy gyors kiha
lsra tl csaknem mindenkit, aki ragaszkodik hozz. Ha egy arisztokrat
nak nincs fia, cme is elenyszik. A romantikus nev Glin lovag, Desmond
John Villiers FitzGerald, a Limerick grfsgbeli Glin-kastly ura e dszes
rang huszonkilencedik rkse. s sajnlatos mdon az utols is, mert
mindhrom gyermeke lny. A cm kihal vele.
Teht a nemesi nevek szma trvnyszeren cskken nemzedkrl nem
zedkre: ha egy hzassgbl nem szletik fi, a cm odavsz. A kzpkorban
adomnyozott nemesi cmek tlaga alig hrom nemzedken t maradt
fenn. A Domesday Book lapjain szerepl tezer feudlis lovagi cmbl m
ra egy sem maradt fenn. Az egyetlen leszrmazsi gon trtn rkls
minden nemesi nevet - s minden gnt - a gyors hall veszlynek tesz ki.
Az emberi gnllomny kt apr rszecskje mutatja, milyen kockzat
tal jr, ha valaki ilyen kirekeszt utat akar bejrni a trtnelmen t. Az Y
kromoszma - akr egy nemesi cm - aprl fira szll. Y-jt minden fi
apjtl, nagyapjtl s gy tovbb rkli. Minden Bassett frfi hordozza
(ha a trvnytelen szletsek veszlyt figyelmen kvl hagyjuk) Hdt
Vilmos Y-kromoszmjt. A mitokondrium gnjeit csak a petesejt adhatja
t - vagyis a nk. Az anyk trktik mitokondrilis gnjeiket lnyaikra s
fiaikra egyarnt, de csak a lnyok tovbbtjk. A mitokondrium s az Y
kromoszmk csak a genetikai foly kt mellkga, s mindssze az a k
lnlegessgk, hogy nem mlenek egymsba, amg el nem rik a ma l
emberek tengert.
Sorsukat knny nyomon kvetni, legalbbis elvben. Azok kzl,
akik mondjuk Hdt Vilmos idejn ltek, hny embernek van kzvet-

* Anglia els orszgos fldbirtokknyve 1086-bl.

' 90
-
MIKOR TALLKOZOTT );':
DM VVAL?

A lenti brn lthat tz ma l frfi


szrmazsa frfigon s (lent jobbra)
tz ma l n ni gon. A frfiaknl
nagyok a klnbsgek az utdok
szmban, nmelyiknek sok gyereke
van, msoknak egy sem. A nknl az
utdok szma nagyjbl azonos. lgy
az utols kzs frfi s jval az utol
s kzs ni s utn lt. Hiba k
szlt szmtalan kp a Paradicsom
bl val kizetsrl (az itt lthat
Giovanni Boccaccio egyik mvnek
1465-bl szrmaz illusztr!L francia
fordtsbl val), csaknem biztos,
hogy dm sose tallkozott vval.

va

dm

H i 1 j l Ri=J
f1l1 ffl 1 1

91
A V RNKBEN VAN

len kapcsolata fiai rvn egy ma l frfival; s hny nnek van ugyanilyen
kapcsolta lnyai rvn egy ma l nvel (vagy frfival, aki hordozja,
de nem tovbbtja a mitokondrilis gnnek)? Nincsenek elg megbzhat
rsos feljegyzsek - s mivel a frfiak hajlamosak r, hogy hzassgon k
vl is nemzzenek gyermeket, az rott s a genetikai trtnelem hamarosan
eltrne egymstl akkor is, ha mindenrl volna anyaknyvi adat. A nket
s mitokondrilis gnjeiket illeten jobb a helyzet, mert az anyaknyvben
lefektetett anya-gyermek kapcsolat ltalban megfelel a valsgnak.
A francik i6o8-ban kezdtk benpesteni Qubecet. A felfedez Samuel
de Champlair - aki egyszer azt javasolta Franciaorszg kirlynak, hogy
ptsen csatornt a Panama-szoroson t - j gyarmatot alaptott Stada
condban (a ksbbi Qubec vrost), amely az els hsz vben mind
ssze huszonht bevndorlt vonzott. De hamarosan felkeltette Richelieu
bboros rdekldst, aki kereskedelmi vllalkozst ltestett nagy gazda
sgok, uradalmak" ltrehozsra a Szent Lrinc-foly mentn, gazdag
vevknek. De a kegyetlen ghajlat kvetkeztben, s mert a legjobb flde
ken addigra mr rkld csaldi birtokok alakultak ki, a krlbell har
mincezer francia bevndorlbl csak tzezren maradtak ott, sokan tovbb
kltztek a tartomny tvolibb rszeibe, pldul a Saguenay vlgybe.
i760-ban, amikor a terlet angol irnyts al kerlt, a bevndorls abba
maradt.
A Saguenay-vlgyben tallhat a vilg egyik legjobb csaldi levltra. Itt
betekintst nyerhetnk az aszexulisan rkld gnek sorsba. A mai n
pessgben az 1950 eltt (ltalban sokkal elbb) odakltztt hszezer n
mindssze egynegyednek mitokondrilis rksge van jelen. Az utbbi
hromszz vben - alig tizent nemzedknyi id alatt - ide kerlt tbbi
mitokondrilis g mra kihalt, akr a Domesday Bookban szerepl feud
lis lovagi cmek. Az eredeti anyk kzl nhnyan pusztn annak a vlet
lennek a jvoltbl tudtk tovbbrkteni mitokondrilis gnjeiket, hogy
olyan csaldot alaptottak, amelyben sok lny szletett. Egyikknek tszz
leszrmazottja van a ni gon, holott ni kortrsai hromnegyede utn
egy sem maradt.
Ktsgtelenl ez a helyzet az odakltztt frfiak szmos Y-kromosz
mjval is. St azokbl valsznleg mg kevesebb maradt fenn. A frfiak
gyerekeinek szma sokkal nagyobb eltrseket mutat, mint a nk. Egyik
frfi kedveli az alkalmi kapcsolatokat, a msik egyltaln nem tall mag
nak trsat. A saguenayi alapt atyk kzl nhnyan igen sok utdot
hagytak htra, kvetkezskpp sokkal tbb utn nem maradt egy sem, az
Y-kromoszmik teht nyomtalanul eltntek.

92
MITOKONDRILIS BETEGSG:
GENETIKA EGY SZLVEL

A mitokondrium a sejt kohja: itt g el az oxign


s a tpllk, hogy energit termeljen. A sejt leg
tbb alkotrsztl eltren a mitokondriumok
nak megvannak a sajt DNS-darabjaik (amelyek a
sejtmagtl eltren a DNS-bzisok kis zrt lnct
alkotjk). A hm ivarsejt nem tovbbt mitokond
riumokat, teht ez a fajta DNS csak a petesejt r
vn rkldik: a fik s a lnyok egyarnt anyjuk FENT: Mitokondrilis gnbe kdolt ideg- s izombe
tl rklik, de csak a lnyok adjk tovbb. tegsg rkldse. Lthat, hogy frfiakat s nket
Tbb ritka betegsg szrmazik a mitokond egyarnt megtmadhat, de a hibs gnt minden
rilis DNS hibibl. Nha csak egyetlen DNS-b megtmadott gyerek az anyjtl rklte.
zis mdosul; gyakrabban egy egsz szakasz hiny
zik. A betegsgek kzl egyesek vaksgot okoznak
a ltideg krosodsa rvn; msok izomsorva
dst idznek el. Van, amelyik klnfle agykro LENT: A sejten belli mitokondrium metszete (vrs
sodst eredmnyez. Mindegyik ritka, de mind ovlis folt). A keresztirny hrtykban zajlik a sejt
egyikre jellemz, hogy ngon rkldik. energiatermelsnek nagy rsze.

93
A VRNKBEN VAN

Mindez alig hrom vszzaddal ezeltt trtnt. A2 idk folyamn, ha


minden gy ment volna tovbb, s Saguenay elszigetelt marad, egyre tbb
tnik el az aszexulis rkldsi gakbl. Elbb vagy utbb eljtt volna az
id, amikor mr csak egy mitokondrilis s egy Y-kromoszma marad
fenn. Akkor pedig a trsgben mindenki egyetlen nre s egyetlen apra
vezethette volna vissza a csaldfjt, aki valaha lt Saguenayban.
Ennek a folyamatnak a vilgmret megfeleljbl ntt ki a legsibb
arisztokratk eszmje, a mitokondrilis v s felttelezett trs, az Y
kromoszms dm. Akiktl mindannyian szrmazunk. Valamifle sta
tisztikai rtelemben ktsgtelenl lteztek. De nincs okunk felttelezni,
hogy dm tallkozott vval; vagyis azok az egynek, akikben a mito
kondrilis, illetve az Y-kromoszms szrmazsi gak visszafel sszefut
nak, ugyanott vagy akr ugyanakkor ltek. St szinte biztos, hogy va
meghalt jval dm eltt. Egyszeren azrt, mert sok frfi nem tall trsat,
s - mint a 9i. oldalon lthat bra mutatja - az Y-kromoszmk sokkal
hamarabb kihalnak, mint a mitokondriumok. Radsul akrhol (s akr
mikor) lt va s dm, voltak krlttk ms frfiak s nk is, akrcsak a
tizenhetedik szzadi Saguenayban. Csupn abban klnbznek a tbbiek
tl, hogy - mint a Bassettek meg az fennen hirdetett egyenes frfi.gi
szrmazsuk Hdt Vilmostl - az szrmazsi guk fennmaradt, trsai
k pedig nem.
Mint utdaik gnjeibl kiderl, dmnak s vnak nem llhatott
mdjban, hogy kegyvesztett vljon, amirt elmerlt az els s eredend,
m korntsem eredeti bnben. A vilg Y-kromoszmi feltnen hason
lk: a vltozatok szma alig egy szzada a tbbi kromoszmnak. A mito
kondriumok viszont igen vltozatosak. Abbl, hogy a frfi rklsi gakon
ilyen csekly az eltrs, megllapthat, hogy kzs sk a kzeli mltban
- az egyik becsls szerint mindssze huszonhtezer vvel ezeltt - lt, gy
az utdok Y-kromoszminak nem volt idejk klnbsgeket felhalmoz
ni. A2 utols kzs mitokondrilis s - va - taln tbb tzezer vvel meg
elzte dmot, az utols kzs sapt. Furcsa mdon az afrikai Y-kromo
szmkban klnsen kevs a vltozat. Taln a legtbb nt kevs frfi saj
ttotta ki, s csak k tudtk tovbbrkteni gnjeiket. A tbbiek genetikai
rksge semmiv lett.
A frfigon rkld anyagi s trsadalmi rksgre ugyanez a sors vr.
A kihalt angol nemesi cmek visszaszllnak a koronra. Ha ragaszkodn
nak a szablyokhoz, vgl mindssze egyetlen arisztokrata maradna, mi
vel egyms utn halna ki a fi rks nlkli csaldok cme. Ez csak azrt
nem kvetkezik be, mert a nemessget j tagokkal bvtik. Ez az arisztok-

....

94
NEMEK S ADK

rcia tragdija: zrtkr, de nem tarts. Mind kzt a legjelentsebb arisz


tokratk ezt gy kerlik el, hogy mdostjk a szablyokat; ezrt uralkodik
Angliban kirlyn. Ha a birtok kvetn a nemesi cmet, egy id mlva az
uralkod lenne minden. II. Erzsbet kirlynt tbb milli font rtk va
gyonval valban az orszg leggazdagabb szemlynek mondtk ki. A ki
rlyi hz azzal a kiss vitathat ellenvetssel lt, hogy ez a nemzet vagyona,
amely csak megrzsre van az uralkodnl; de ha ez gy megy tovbb, a ne
messg is, a gazdagsg is egy jvend uralkod kivltsga lesz.
Az amerikai forradalom clja ppen az volt, hogy megtrje ezt a mono
pliumot. A nemzet trtnelmnek hajnaln alig sikerlt megmenteni a
demokrcit egy Lordok Hztl, vagyis a fldbirtokos arisztokrcia
rkltt hatalmon alapul gylekezettl. A fggetlensgi hbor gyztes
tbornokai folyamodvnyt intztek George Washingtonhoz, hogy enged
lyezze a kivltsgos osztly, a Cincinnati Trsasg ltrehozst. Tagjai le
hettek volna maguk a tbornokok s - akr a brit frendeknl - elsszltt
fi utdjuk az idk vgezetig. Washington ezt megtiltotta, mert felismer
te a veszlyt, hogy az rkletes arisztokrcia rvn a pnz s hatalom n
hny csald kezben sszpontosulhat.
A fejld llam mgis a magntulajdon elvre plt, s arra a meggy
zdsre, hogy az egyenltlensg szksgszer. Jval azeltt az amerikai
trsadalom a kztulajdon alapjn llt. Az jvilg szinte a korai szocia
lizmus lettemnyese volt. Montaigne a kanniblokrl rott esszjben be
szmol nhny tupinamba firl, akiket 1562-ben vittek Amerikbl Fran
ciaorszgba. Amikor IX. Kroly megkrdezte ket, mi volt rjuk a leg
nagyobb hatssal Prizsban, azt feleltk, hogy lttk, mint habzsolnak
egyesek, midn a tbbiek hezstl s nsgtl sorvadozvn koldulnak aj
tajuknl. Nem rtettk, mikpp trhetik az nsget szenvedk ezen igaz
talansgot, mirt nem ragadjk torkon a dzslket, avagy gyjtjk fejk
re a hzat."
Az indinok mg az eurpai eszmk meghonosodsa utn is virgz
trsadalmakat tartottak fenn a kzs tulajdon elve alapjn. Nhnyan
egyenl flknt trgyaltak a behatolkkal. Amikor a cserokik elszr tall
koztak eurpaiakkal, egy hercegn volt az uralkodjuk, Kofitacsikvi hl...,
gye. A trzs ht nemzetsgre oszlott, az odatartozs aszexulisan rkl
dtt, ni gon. Minden gyermeknek anyja nemzetsgn kvl kellett h
zastrsat keresnie. 1730-ra a cseroki nemzet harmincezer fnyi volt, s ak
kora terlet llt az ellenrzse alatt, mint Nagy-Britannia. Egy Attakulla
kulla, vagyis a Kis cs nev fiatalember eljtt Londonba (ahol Hogarth
megfestette az arckpt). Dszltzetben Windsorba ltogatott, s meges-

95
A VRNKBEN VAN

A cseroki trzsbl szrmaz


Sequoyah, s egy okmny
nyolcvant bets sajt
bcjnek rsjeleivel;
nmelyik bet az arab rson
alapul, s az angoltl eltr
hangokat jell.

kdtt, hogy a nagy Gyrgy kirly ellensgei a mi ellensgeink lesznek; az


npe s a mink egy lesz rkre". Viszonzsul bartsgi fogadalmat ka
pott, ami rvnyben marad, amg csak lesznek hegyek s folyk, amg
csak st a nap".
A tizenkilencedik szzadban a cserokik ttrtek a fldmvelsre. 1825-
ben mr majdnem mindegyikk tudott olvasni; sokkal tbben, mint
akr a fehr kzssgben. 1850-re voltak rokkik, ekik, lnyiskolik, mg
jsgjuk is, amelyet egyedlll rssal adtak kzre: minden arab bet
mst jelentett, mint az angolban. Mindez szinte teljes egszben kztulaj
don volt.
Az individualista szemllet fiatal Egyeslt llamok ezt igen rossz
szemmel nzte. Henry Dawes massachusettsi szentor csodlta a cseroki
kzssgi trsadalmat, de zskutcnak tartotta: A rendszer fogyatkoss
ga nyilvnval. Lehetsgeik vgre jutottak, mert a fld kzssgi tulaj
donban van . . . Hinyzik az nzs, holott az a civilizci mozgatja."
Nzeteinek megfelelen munkhoz ltott, s elfogadtatta az 1877-es
Dawes Szemlyi Tulajdon Trvnyt, amely felosztotta a trzs fldjt csal
donknt szztizenkt holdas tagokra. Szerencsre sok fld maradt, amit
aztn eurpai telepeseknek adtak el igen olcsn.
De voltak radiklisabb amerikaiak, akik azt remltk, hogy mskpp
fejldik majd az j kztrsasg. Nekik tetszett az indinok egyenlsgen
alapul letmdja. A tulajdon s az eslyek egyenlsgt, az egyttmk-
NEMEK S ADK

dsen alapul rendszert sokan mintnak tekintettk, s gy vltk, ilyenn


kell vlnia az Egyeslt llamoknak is. Ha egy indin meghalt, a tbbiek
nagyjbl egyenl arnyban osztoztak minden tulajdonn. A Tammany
Trsasgot munksemberek alaptottk, s arrl a delavr fnkrl nevez
tk el, aki William Pennt fogadta i682-ben. Kimondtk, hogy mjus elseje
Tammany nap, indin fejdszeket viseltek, s Szt. Tammanyt vdszentjk
nek nyilvntottk. A rviddel a forradalom utn alaptott Vrsbrek
Nemestett Rendje mr szocialistbb jelleg volt. Indin mintra meghir
dette a vagyon kztulajdont. Tagjai lemondtak az alkoholrl. A trsasg
megbukott, akrcsak a tammanistk (akiknek neve ksbb egy csoport
korrupt New York-i politikushoz tapadt).
lltlag a pnz az egyetlen, ami megklnbzteti az embert az llattl;
de egyik nemzedkrl a msikra rktsnek szablyai azonosak a biol
giai tke rkldsnek trvnyeivel. Ki kapja meg azt, amit egyik korszak
birtokolt, kszpnzben vagy gnekben, amikor a kvetkezre szll? Az in
dinok s az Egyeslt llamok tizenkilencedik szzadi vitja rvilgt a
ktfle rklsi md kzti klnbsgre. A cseroki indinok minden alka
lommal sztosztottk vagyonukat, ahnyszor csak tszrmaztattk az ut
dokra. A Cincinnati Trsasg s szellemi utdai azonban azt remltk,
hogy biztosthatjk aszexulis trktst, melynek sorn a tke a csald
ban marad.

Henry L. Dawes (1816-1903),


Massachusetts llambeli
republiknus szentor, akinek
az j amerikai letformba
vetett szent hite nagy csaps
volt azoknak az indinoknak,
akik a rgi mdon ltek.

97
A VRNKBEN VAN

A fldbirtokos kznemessg ltrehozsval a cincinnatiak si hazjuk


hagyomnyait szerettk volna kvetni. Nem vletlen, hogy az si angol ne
mesi cmek viseli kzl sokan gazdagok, hiszen a cm is, a vagyon is
aszexulisan rkldik. Az i870-es vekben az elhallozott milliomosok
hromnegyede a Lordok Hznak tagja volt. Gyakran pnzen lehet nemes
sget vsrolni. A tizenkilencedik szzad nagy srfzi mind fnemesek
lettek, ezrt mondja Dickens egyik hse a Szp remnyekben: Nem tu
dom, mi elkelsg van a serfzsben, de ktsgtelen, ha kenyrstssel
foglalkozol, nem lehetsz elkel, viszont ha serfzst zl, afell mg bz
vst elkel maradhatsz. . A srarisztokrcia vagyona, az Allsopp, Bass s
Guinness srfzk (a jelenlegi Hinlip, Burton s Iveagh lordok) egytt
rkldtt nemesi cmkkel.
A cm s vagyon egyetlen gon trtn rklse fenntartja az egyenlt
lensgeket. A hatalmas angliai birtokok tanstjk, mennyire eredmnye
sen. Gyakran olyan rgi csaldok kezben vannak, amelyek nemzedkeken
t riztk meg rintetlenl minden vagyonukat. 1883-ban a ngy legna
gyobb angol birtok hercegek tulajdonban volt, a tz negyvenktezer hold
nl nagyobb pedig egytl egyig fnemesekben. Az 1870-es vekben
Devonshire hercegnek ht kastlya volt a derbyshire-i Chatsworth House
s Harwick Hall, az szak-lancashire-i Holker Hall, a yorkshire-i Bolton
Abbey, a sussexi Compton Place, a londoni Devonshire House s Chiswick
House, a newmarketi Beaufort House s az rorszgi Lismore House. A leg
tbb - vagy az eladsbl szrmaz tke - ma is utda tulajdonban van.
Sokszor nyltan megfogalmazdik a vagyon aszexulis trktsnek
knyszere. Nhny nemesi birtok csak frfigon rkldik. Ha a csaldban
nincs fi rks, a vagyon tmegy egy tvoli rokon tulajdonba, akinl a
dnt jelentsg frfigi leszrmazs bizonythat. A tizennyolcadik sz
zadban a cumberlandi Lowthersek egsz rokonsgban mindssze egyet
len frfigi rks akadt. gy 1802-ben minden birtokuk tszllt egy tvoli
unokatestvrre, aki csak egy 1637-ben elhunyt kapa rvn volt kapcsolat
ban velk.
Csak t kell lpni az angol-walesi hatrt, s mris nyilvnval, milyen
fontosak az rksdsi szablyok. A kzpkori Walesben az jraeloszts
volt a trvny. Az arisztokrata minden fia rszeslt apja vagyonbl, s ne
mesi nevet kapott. Hamarosan a npessg hromnegyede bonbeddig"
volt, si nemesi cm tulajdonosa, csakhogy ennek az arisztokrcinak a
nagy rsze paraszti kisbirtokokon hezett. Nyugat-Wales mindmig apr

Eurpa, 1959. Bartos Tibor fordtsa


NEMEK S ADK

fldek kirakjtka, melyet egy vszzadokkal ezeltt ki.halt rkJsi rend


hagyott rnk. Az egyik szablyrendszer olyasmit hoz ltre, mint a szocializ
mus - a termeleszkzk egyenl birtoklst -, mg a msiknak szksg
szer kvetkezmnye, hogy az anyagi eszkzk kevesek kezben maradnak.
Br a biolgiai rtelemben vett aszexulis szaporodsra mg a gazdagok
sem kpesek, sokan igyekeznek cskkenteni a vlogats nlkli prkapcso
latok rvn a dinasztiba jut idegen gnek szmt. Mghozz gy, hogy
rokonaikkal hzasodnak, vagyis olyan emberekkel, akikkel kzsek a gn
jeik. A Rothschildok a tizenkilencedik szzad elejn kezdtk felhalmozni a
vagyonukat. A dinasztiaalapt Meyer Amschel Rothschild kt legidsebb
fia megnslt, mieltt a csald meggazdagodott volna. k tlagos zsid
csaldokbl vlasztottak felesget, amelyekkel nem lltak rokonsgban.
A kt kvetkez fi a leggazdagabb angol s nmet zsid csaldokbl n
slt. A Rothschildok hamarosan egyedlllan hatalmas vagyonra tettek
szert. Meyer Rothschild legkisebb fia a sajt unokahgt vette el, s a k
vetkez nemzedkben tizenkt fibl tz az els unokatestvrvel hzaso
dott ssze. A hat lnybl t szintn rokonhoz ment felesgl. Igen ers a
ksztets a vagyon jraelosztsnak s a gnek szexulis szaporodsbl
add rekombincijnak korltozsra.
A msodik vilghbor ta eltelt veket a kapitalizmus gy tekinti, mint
sajt diadalnak tanbizonysgt. A vllalkozi kultra", az nerejbl
rvnyesl ember vtizedeiknt szoktk emlegetni az elmlt idszakot.
A gazdagsg mltnyos - mondjk -, mert brmennyire igazsgtalannak
ltszik, kemny munka jutalma. Ha nincs anyagi gyarapods, nem fejld
het a gazdasg. A bsg kzepette a szegnysg taln igazsgtalan, de szk
sgszer, hiszen a gazdagok s a szegnyek trsadalmi hozzjrulsnak
mrtkt tkrzi.
Csakhogy a legtbb gazdag - s csaknem minden dsgazdag - rkls
rvn jutott vagyonhoz. Az i920-as vekben az angol npessg egy szza
lknak tulajdonban volt a teljes magnkzben lv vagyon hatvan szza
lka. i990-re ez lecskkent, a fels egy szzalk - flmilli ember - mr
csak az sszvagyon tizennyolc szzalk.t birtokolja. Ezzel azonban az
egyenlsg nem aratott olyan diadalt, mint gondolnnk. Angliban mg
mindig a leggazdagabb tmilli ember, vagyis tz szzalk mondhatja ma
gnak a nemzeti vagyon felt. Az jraeloszts fleg a kptelenl gazdagok
s a csupn jmdak kztt trtnt. A trsadalmi rangltra alacsonyabb
fokain mg mindig risiak az egyenltlensgek; s akik oda szorulnak,
azokat nyilvn kevss vigasztalja, hogy a pnzes osztlyokon bell mr
skldtek a klnbsgek.

99
A VRNKBEN VAN

Nagy-Britanniban jelenleg tvenezer milliomos l. Alig egyharmaduk


rklte a vagyont. Termszetesen az igazn pnzeseknek egymilli font
semmisg. A leggazdagabbak mg mindig a korbbi nemzedkek agya
frtsgnak ksznhetik a vagyonukat. Amerikban valamivel igazsgo
sabban mennek a dolgok. A leggazdagabb emberek kzl nhnyan - pl
dul a Microsoft Corporation feje, Bill Gates - sajt munkjukkal (meg
persze az alkalmazottaik munkjval) szereztk a vagyonukat. De mg az
amerikai plutokrcinak is csak elenysz tredke kereste kt kezvel a
milliit.
Nmelyik vagyon semmiv lesz pusztn az emberi gyarlsg miatt.
Angliban a gazdag csaldok fiainak krlbell a fele tkozol": keveseb
bet hagy rkl, mint amennyit kapott, egyszeren mert elklti. Kln
sen a kzps szinteken van mozgs: egyes csaldok flemelkednek, m
sok lecssznak. 1995-ben Caithness lord - egy 1455-bl szrmaz grfi cm
huszadik rkse - elszegdtt ingatlangynknek; a trtnelem a lp
csn felfel dbrg szges bakancsok s lefel suhan selyemtopnok za
jtl visszhangzik" - mondta Voltaire.
Akrhogyan alakultak is az adk, az ipari forradalom ta jelentsen
cskkentek a vagyonklnbsgek Nagy-Britanniban. Ez nagyrszt nem
az rklsnek, hanem a gazdasg fejldsnek ksznhet. Nvekedtek az
egyni jvedelmek, s szmos j vagyon jtt ltre. gy az anyagi siker mr
nem fgg annyira a javadalmaktl, mint a statikusabb trsadalmakban. De
mieltt lelkesen nnepelnnk a kapitalizmus gyzelmt, rdemes meg
gondolnunk, hogy egyetlen gazdasg sem nvekedhet korltlanul. Ha lell
a fejlds, azonnal visszanyeri jelentsgt az rkltt vagyon. A term
szetben is tallunk erre prhuzamot. Szmtalan llny - pldul a levl
tetvek - j idkben, tavasszal felhagynak az ivaros szaporodssal, ttrnek
az ivartalan mdszerre, s hihetetlenl megnvekszik a szmuk. Mg a ge
netikailag leggyngbbek is boldogulnak. A tl belltval azonban nvek
szik a verseny, s a npessg nem n tovbb. Visszall az ivaros szaporods,
s nhny szrmazsi g tmegesen kihal, mert kevs bizonyul alkalmas
nak a fennmaradsra.
A vagyon rklsrl akkor kaphatjuk a legtisztbb kpet, ha genetiku
sok mdjra gondolkodunk: sszehasonltjuk egy adott nemzedk javait
az eltte s utna kvetkezkvel. A szksges informcit a vgrendeletek
tartalmazzk. Ha sszevetjk, mit hagyomnyoztak utdaikra a szlk s
mit a gyermekeik, megllapthatjuk, milyen mrtkben befolysoljk a
trsadalmon belli vagyoni vltozsokat az egynek rkltt javai kzti
klnbsgek. A vgrendeletek kes tanbizonysgai annak, hogyan zu-

100
NEMEK S ADK

hog t a nemzedkeken" (John Major miniszterelnk szavaival) egy nem


zet gazdagsga. Semmi ktsg, valban zuhog: hsz vvel ezeltt azoknl,
akik flmilli fontot hagytak htra (ami akkor jelents sszegnek szm
tott), ktszztvenszer nagyobb volt a valsznsge, hogy apjuk gazdag
rksgt adtk tovbb, mint az angol npessg tlagnl.
Nmelyik vagyon bns forrsbl szrmazik. A bristoli szkhely W. D.
s H. 0. Wills dohnyvllalat attl a Wills csaldtl kapta nevt, melynek
gazdagsgt Henry Overton Wills dohnyimportr alapozta meg. Hat
nemzedket s msfl vszzadot lel fel (1960-as rtken megadott font
ban) vagyonuk krnikja.
Mikor Henry Overton Wills 1826-ban meghalt, hetvenktezer fontja
volt. A vagyon alaposan megntt 1911-re, amikor Sir William Henry Wills,
vagyis Lord Winterstoke tzmilli fontos rksget hagyott htra; fia, IV.
William Overton Wills, aki nhny httel apja utn hunyt el, huszonegy
milli fontot. Az els Henry Overton Wills sok kzvetlen leszrmazottja
(szmuk akkor mr meghaladta a szzat) halt meg a kvetkez negyedsz
zadban. Jmdak voltak mind; de korntsem egyenl mrtkben. Az
1900 s 1950 kzt elhallozottak kzl tzen tbb mint ktmillit hagytak
htra, a tbbiek kzt viszont akadt j nhny, akinek a gyerekei alig szzez
ret rkltek. A Wills csald elg eredmnyesen vdte meg tkjt az jra
eloszts kvetkezmnyeitl.
Ennek genetikai megfelelje, a rekombinci tbb-kevsb ltalnos
rvny marad. A jelensg okt ismerik a kzgazdszok is. Szexulis sza
porods nlkl kevesebb az esly a megjulsra, az j gnkeverkekre,
amelyek eredmnyesebben birkzhatnak meg a vltoz krnyezettel.
Ha verseny alakul ki, a nemisg fontos szerephez jut. Az a versenytrs,
amelyik gyorsabban fejldik a konkurenseinl, elbb vagy utbb legyzi
ket. Ha a nemisg megindul, utna mr nfenntart. A gyors fejldsre
kpes szexulis lnyekkel szemben kevs aszexulis rklsi g marad fenn
sokig. Az aszexualits egyetlen gncsoportot hoz ltre, amely kisajttja a
npessget, de llandan fenyegeti a sorvads s hanyatls veszlye.
A rekombinci szabadkereskedelmi rendszert" indt be, mely folya
matosan j gnkszleteket termel. Ezek az evolcis folyamat nyersanya
gai, melynek sorn az egyedek alkalmazkodnak a vltoz krlmnyek
hez. Legtbbjk nem vlik be, de nmelyik jobb lesz minden eddiginl, s
gy a npessg alkalmass vlik arra, hogy j feladatokkal birkzzk meg.
Adam Smith boldog lett volna, ha tudja.
Lelkes hvei a szabadpiacot tartjk a legmozgkonyabb s leggyorsabban
fejld gazdasgi rendszernek, mert - akr egy fejld nvny vagy llat -

101
A REKOMBINCI RME,
AVAGY A MEZTELEN CSIGK SZAPORODSA

A Helix nemora/is - a jobboldalt lthat csiga - nyilvnval


an szexulis lny. A csigahznak ezerfle mintzata lehet.
Alig egy tucatnyi klnfle gn mdostja a hz sznt vagy
cskozst; de a nemisg olyan gyakran trendezi ezeket,
hogy bizonyos lhelyeken minden egyes csiga ms s ms.
A fekete hzatlan csiga, az Arion ater viszont ktrtelm
lny, vagyis hmns. Az egyedeknek egyarnt vannak hm s
ni ivarszervei. Dl-Eurpban (lent) ugyanolyan ivarosan
J. oirkm n.,r ':ar. a11 . ./'. :7=. szaporod vltozatos lny, mint csigahzas unokatestvre;
tinrmt'l!!I:. J. /laf' ::'1:stt11.
szakon azonban nmegtermkenytst folytat, felhagy a
nemisggel, s - idvel - egyetlen genetikailag azonos po
pulcit alakt ki fekete hzatlan csigk tzmilliival (balra).

..:.. -- t:f-r ,1r. p;'uu..-,a. "' 1; ' -


= . .-L .
a:,r -:dr .<:tc ,i1ll.:n. /'- 12
<::. _! us:n'I. C. 11. /l:',-,:.r 1:..
.
_,-<tlr f:1:t'tic1:. f- (;_ -1/i:n.-.

6. _!riN: a:tr :nr. . Li. 1."a:od.i. f. tZS.


Gr,_,_;;,ti(i nt"<1r l-1:.-r.,f(IJ:, ;,;_ L s.
i cr /',:l:-


.&JP/
.
Jiii
//jjj) ),Uff
.., .
--
-.
__.:...
iii1ifiJ
iiif
- -
-. ':
. :"
1p
fiiITTiij

Xl}r:I: CitT. /11'y. . !. l.;. .
-
...,.

( :,,:n. _:'. 1Z7


..;ril'Jt 11.lcT sui--:.rr. /r:t11nt1;/;:.
:l . 11"..-.

102
--------------
-

llEL l.Y _\-E.1/0R_-J /JS L

l/!ix utmf';a.'i.c I.inn.


l"rurv. /. ii. Jnma.

H. 1u11:,,r,z.":"s v. ut.-:.r. Pit..-:1.rcl. ii. 1:01:.11w:.:s ,. 1,.f('tr Fbutlvn.


rakn:..-1l ls."c11:d. 1-:. c,,iiic-r. A
. "11,1l:f;:_;.,::. J. l.11rJul,s.

il. 1:(11:ttrn.::::i. \ . iifd::1hz Ri!-.'JO. ii. 1:,11:,1rt:i.:S ,._ /.:a-:,<>:ir,sec1:,,,


Pic.
/ "ttio::.-n. F.. c,,f{.,r. J;rfs:,1:. )/:ss 1-l"k.

1:11:,,,-.
: 1... ,ii;,ut'1z Rj,..,, ii. 1:r1:1i1r(1iis ,-. cas!1111f.a Picn1.
Liu:,-r:c.:-:-. r:. C..1.ii.,-. 1::".::::"1:. .11:s,,, i-1.:.

ii. 1:c1111u-"::s v. ci."1i1:l''J:1t!lt Ck.i. .-;. 1u1;:, 11,1..:s ,._ 1!) t1ic:,u:a/a T::i.rlor. !{. l.'c'/Jlo'1;li_.-s v. .'n!r'r,;:ia U.& .\J.
Carr:'ci..:i'1:. 1::. <.",."::,._ c..1rr:c;;,1.:n , f.'. (.,,i:r. /:icc.;.d1: J/;$S H,-:,.

ii. 11onl'r11.i:S ,.. iftsri.:.'i-a Pic::i.rJ. h'. Jt1'1J/Ntl:0:"s:-. ,. uu\:a 1:. L


\;, I!.
B11n:s."c;._ 1f. 1::. Bnufr. J!,rr:'"i. J>r. i:c::Ct::.

ii. 1:u::ctraiis ,._ 1-.s,,1(aifa:a Koi . h'. 1!am1r.ciis ::-.\". :o::tis L::mJ.on.
Ha::. J/iss if1:c. E1:1:.:s::11:1..'I:: l-'. !/. Gn1rs111:.

103
A VRNKBEN VAN

pillanatnyi megtorpanst sem engedhet meg magnak. Csakhogy van egy


bels ellentmonds, amely a nemisgre s a piacra egyarnt jellemz: m
kdsk magas fenntartsi kltsge. Mindig ers a ksrts, hogy fladjuk
az egszet, s rbzzuk magunkat a szerencsre. Sok llat (s majdnem
annyi vllalat) engedett is a ksrtsnek.
Nha bevlik. Sok llny nem vllalja a nemisg kltsgeit. Az egyik t
a hermafroditizmus. Nhny nvny s llat egyedein him s ni ivarszer
vek egyarnt vannak. Az evolcis kpzeletnek csak egy kis ugrs kell,
hogy szabad folyst engedjen az nmegtermkenytsnek, melyben az
egyed a legkzelebbi rokonval - nmagval kzsl. Szmos nemzedk
utn minden utdnak kzsek lesznek a gnjei; lnyegben egypetj ik
rek lesznek mind.
A clibtusnak klnbz formi vannak. Magas hegyekben vagy hi
deg ghajlat alatt knnyebb megszabadulni a hmektl, mint a trpuso
kon. A meztelen csigk hermafroditk. Ha az ember pr szz mtert megy
flfel a Winnat-hgn Derbyshire-ben, azt tapasztalja, hogy a helyi mez
telen csigk - a nagy, hsos jszgok - lemondtak a nemisgrl. A vlgy
lbnl gazdag sznekben pompznak, szexulis lnyek, s nincs kt egy
forma kzttk. Odafnt mind feketk, s genetikailag nagyjbl azono
sak a tlk msfl ezer kilomternyire, az szaki sarkkrn tl l fekete
meztelen csigkkal. Ugyanis akr a Rothschildok, az elrhet legkzelebbi
rokonnal ktnek hzassgot - akire egy nmegtermkenyt lny igazn
knnyen rtall.
Az aszexualits akkor vlik be a leginkbb, mikor az ellenfl - rossz id
vagy sovny talaj - kiszmthat. Mint versenytrs nlkli stratgia, fant
zitlansgban is sikeres lehet. Ahogy a nagy vagyonok is fkpp ott hal
mozdnak fel, ahol politikai biztonsg van. A kzgazdszok termszetes
monopliumrl" beszlnek, amikor egy vllalat azrt rvnyesl, mert
versenytrsai nem tudnak betrni a piacra. Ha egy kis faluban mindssze
napi egy buszjratra van szksg, valsznleg nehezen boldogul, aki indt
egy msodikat, mert nem tud annyi jegyet eladni, hogy haszonra tegyen
szert. Csak akkor gyzhet, ha j tlettel ll el - pldul kisebb buszt jrat.
Ez a helyzet az aszexulis szaporods rvn ltrejtt termszetes genetikai
monopliumokkal is; az erforrsok stabil rendszert biztosan kzben
tartjk.
De mivel megszabadultak a nemisgtl, llandan az a veszly fenyegeti
ket, hogy nem tudnak megbirkzni egy olyan versenytrssal, aki j stra
tgit alkalmaz. Az aszexulis lnyek olyan kis s specializlt feladatok el
vgzsre szorulhatnak vissza, hogy vgl esetleg munka nlkl marad-

104
NEMEK S ADK

A cseroki indinok tszz kilomteres erltetett menete 1838-ban. A Knnyek tjn hszezer
ember vonult nyugatra az Indin Terletre (jelenleg Oklahoma). Ngyezren odavesztek, s a
tllkre jabb megprbltatsok vrtak.

nak. Br a nemisg feladsnak - akr a monopolkapitalizmusnak - lehet


nek rvid tv elnyei, ezeknl sokkal jelentsebb a hossz tv kockzat.
Az aszexulis llnyek csaknem minden esetben szexulis sktl szr
maznak, de - hiba a ltszlagos elny, hogy sajt gnjeik jratermelse
megktszerezdik - maguk nem hoznak ltre sikeres rksket. A nemi
sgrl val lemonds nem vezet sehov!
Mr Dawes szentor megmondta az indin letformrl, hogy pusztul
nia kell, mert nem elg nz. Az Egyeslt llamokban a kapitalizmus ma
radktalanabb gyzelmet aratott, mint brhol a vilgon. Egyetemes a ver
seny, s a trvny lecsap a monopliumokra, alighogy megjelennek. Itt volt
a legdzabb a kztulajdon s az egyni kapzsisg csatja, s a jelek szerint

gyztt a kapzsisg.
m egyszer csak vratlanul kijult az ellentt az nrdeken alapul sza
blyozs meg az indin szablyok s a kzs vagyon ltomsa kzt. A mai
indinok mindenki msnl jobban rzik az ellenttet a gnek s a pnz
rklsi rendje kzt.
szak-Amerikban sose volt egyrtelm a bennszlttek s bevndor
lk viszonya. Az indinokat nha csodlat, nha megvets vezte. De min-

105
A VRNKBEN VAN

dig kizskmnyoltk ket. Az Egyeslt llamok kis hjn pusztulsra tlte


az slakkat. Trzseket, amelyek valamikor hatalmas fldterletek urai
voltak, szk rezervtumokba knyszertettek, gyakran tbb szz kilom
ternyire otthonuktl. A cseroki indinokat elztk fldjeikrl, s ezrek
pusztultak el a Knnyek tjn, a Mississippitl nyugatra.
Davy Crockettet, a vadnyugat kirlyt" hsnek tartjk, holott speku
lns volt, aki rszt vett a cseroki indinok nyugatra zsben. Azzal dicse
"kedett, hogy legjobb falatja az a krumpli volt, mely egy kigett hz pincj
bl kerlt el s elevenen meggetett indinok zsrjban slt. Sok gyereket
intzetbe dugtak s szolgasgra neveltek mg akkor is, amikor mr nem
vadsztak az indinokra. Br az indin npek s az Egyeslt llamok kzti
megllapods rszletei trzsenknt vltoztak, lnyegt tekintve a legtbb
egyforma volt. Az indinok tengedtk a fldet, cserbe megrizhettek bi
zonyos jogokat a terleten. Pldul a vadszati, halszati s fakitermelsi
jogot, s az utbbi idben jogukban ll admentes zemanyagot s cigaret
tt rulni a rezervtumban. A jogok a trzset illettk meg, nem az egyes
embereket. A kzs vagyonhoz tartoztak.
Az Indin gyek Hivatala hossz veken t gyarmatost hatalomknt
lpett fel az indinokkal szemben: megszervezte az letket, de megtagad
ta tlk a kpviseleti jogot. A szerzdseket egyre kevsb tartottk be.
Csakhogy az i960-as vekben az indinok kezdtk a jogaikat kvetelni. Ez

Indin gyerekek az Oklahoma llambeli Anadarko vrosnak Riverside Indin Iskoljban


1901-bcn: megtanuljk, hol a helyk az amerikai trsadalomban.

106
NEMEK S ADK

hamarosan zavargsokhoz vezetett. Minnesotban sszetzs tmadt a


halszok s az indinok kzt. New York llam szaki rszben gyilkossgo
kat kvettek el az olcs cigaretta rustsa miatt. Az llamok nagy nehezen
belttk, hogy- akr tetszik, akr nem - egyszer megegyeztek az indinok
kal, s ehhez kell tartaniuk magukat.
Sok indin lt eljogval, amelyrl szinte nem is tudta, hogy rendelke
zik vele: hogy fldjn szerencsejtkot zhet, brmit mondjon is errl
egyik vagy msik llam. George Washington azt tartotta a szerencsejtk
rl, hogy a kapzsisg gyermeke, a romlottsg destestvre s a gonoszsg
apja" (br ez nem akadlyozta abban, hogy sorsjtkokat indtson, amikor
az anyagi forrsok kimerltek). A szerencsejtkoknak ma nagyobb a for
galma az Egyeslt llamokban, mint a filmnek, knyvnek s zennek
egyttvve; krlbell vi hatszzmillird dollr. 1978-ban Nevada volt az
egyetlen llam, ahol a szerencsejtkot nem tiltotta trvny. 1995-re f
kpp az indinok jvoltbl negyven tovbbi csatlakozott hozz. Akad n
hny furcsa joghzag is. A Mississippivel hatros llamok valamikor csak
folyami hajkon engedlyeztk a szerencsejtkot, hogy a jtkosok Mark
Twain-i dszletek kzt hgjanak a pnzk nyakra. A jelenlegi hajk a vr
rokban", vagyis a csatornk vizn sz kaszink mr csak a trvny bet
jnek felelnek meg. A szerencsejtk millinyi llst teremt, s vi msfl
millird dollrt jvedelmez llami s helyi adban - de a vele jr bnzs
s szocilis kltsgek hromszor ennyit visznek el.
A szerencsejtk remnyt nyjt azoknak, akik egybknt nem szmt
hatnak boldogulsra. s mindenekfltt kitn mdszer, hogy a szeg
nyek pnze a gazdagok zsebbe vndoroljon. A vilg legnagyobb kaszinja
nem Las Vegasban van, mint hinnnk, hanem New York s Boston kztt
(br Vegas azt tervezi, hogy visszavg a New York, New York" nev kaszi
nval, amely Manhattan gre rajzold sziluettjnek egyharmados kicsi
nytett msa lesz). Connecticut llam, amelynek terletn a rekordot javt
kaszin ll, valamikor ellenezte a szerencsejtkot, rszben erklcsi okok
bl, rszben mert flt a vele jr korrupcitl s erszaktl. De vgl kny
telen volt engedlyezni egy nagyszabs vllalkozst.
A kaszin neve Foxwoods, azaz Rkaerd"; a szeld nv a tulajdono
sok, a mashantucketi pequot trzs klns mltjnak summzata. A pe
quotok rkanpnek" nevezik magukat. Mashantucket" azt jelenti er
ds vidk" - a kaszint most is erdk vezik, mert amikor az els telepesek
nyugatra vndoroltak, elhagyott farmjaikat bentte a rengeteg. Ngy v
szzaddal ezeltt tzezer pequot vadszott, halszott s mvelte a fldet a
Thames foly mentn, illetve Connecticut partjain.

107
A VRNKBEN VAN

A:z ostrom al vett pequot indinok erdjkben, melyet az angolok s indin szvetsgeseik
az i637-es mystici csata sorn a flddel tettek egyenlv.

A fldrt vvott hborban az angol katonasg John Underhill szzados


veznylete alatt htszz pequotot mszrolt le Mystic tengeri kiktjben
1637-ben. Benngtek az erdben szmosan, frfiak, nk s gyerekek.
A tbbieket csapatostul hajtottk ki . . . hszasval-harmincasval; katon
ink mr vrtk ket, s kardjuk lvel kedveskedtek nekik . . . akik a mi ke
znkbl kicssztak, azokkal a mgttnk halad indinok bntak el"- je
gyezte fl napljban a szzados.
Az letben maradott pequotok egy csoportjt rabszolgaknt megkaptk
az angolokkal szvetsges narragansett s mohegan trzsbeliek. Msok az
1638-as Hartfordi Egyezmny rtelmben a Bermudkra kerltek rabszol
gnak, s eltntek a trtnelem lapjairl. Britanniban j hasznukat vehet
tk volna, de ott nem kellettek, mert Erzsbet kirlyn nhny vvel ko
rbban kiztt Anglibl minden ngert s szerecsent''.

108
NEMEK S ADK

1666-ban a hatsgok nagy nehezen tudomsul vettk ltezsket, s a


megmaradt mintegy ktezer pequotnak juttattak fejenknt vagy fl hektr
fldet Mashantucketben. Az vek sorn a pequot rezervtum alig nyolc
vanht hektrra zsugorodott, s 1970-ben mr csak kt idsebb fltestvr,
Elizabeth George Plouffe s Martha Langevin Ellal lt itt nyomorsgos
krlmnyek kzt egy rozzant lakkocsiban. Halluk utn az llam rte
hette volna a kezt a fldre, s parkosthatta volna az egszet.
Elizabeth George unokja, Richard Hayward gyerekkorban megfor
dult a rezervtumban, s bszke volt az rksgre. i974-ben kutatni kez
dett a pequotok leszrmazottai utn, s si fldjn jjszervezte a trzset.
Az 1980-as vek elejre huszonkilenc trsa lt ott, s azzal kereste a kenyert,
hogy tzift, saltt s juharszrpt rult.
1976-ban egyszerre megvltoztak kiltsaik. A Floridban l szemino
lk egyik trzsfnke, James Billie kihasznlt egy legfelsbb brsgi hat
rozatot, hogy az indin rezervtumok bizonyos rtelemben szuvern
nemzetek'', amelyek dacolhatnak az llam trvnyeivel, s jtktermeket
nyithatnak. Hayward odautazott krlnzni. Tallt egy joghzagot a con
necticuti trvnyekben, s hozzltott, hogy jtktermeket ltestsen sajt
rezervtuma terletn. Mondani sem kell, Connecticut llam felhboro
dssal fogadta a tervet. Sok pequot sem rlt neki. Nmelyek Jehova tani
voltak, msok baptistk. Mindegyik erklcsi alapon ellenezte a szerencse
jtkot. Hayward rendthetetlenl kitartott; az Arab-American Bankhoz
fordult pnzrt. A joghzag ismeretben a bank csak egy felttelt szabott:
Hayward krjen nagyobb klcsnt.
Alig ktszzhuszont kilomternyire New Yorktl a pequotok vllalko
zsa csak sikeres lehetett. 1992-ben megnyitottk a kaszint bingval, ru
lettel, pkerrel, huszoneggyel s kockajtkkal; mindegyik magas ttre
ment (egy bingjtszmba legalbb 350 dollrral kell beszllni). Egy ven
bell jabb bombazlet addott. Foxwoods engedlyt kapott jtkauto
matk belltsra, amennyiben Connecticut llamnak (amely ltva, hogy
mst gysem tehet, sutba dobta erklcsi agglyait) befizeti a haszon egyne
gyedt vagy venknt negyedmilli dollrt, attl fggen, melyik a maga
sabb sszeg. i993-ban (amikor htmilli szerencsejtkos fordult meg a'
termekben) mr javban zajlott a kaszin negyedmillird dollros bvt
se. Ennek eredmnyeknt a vilg legnagyobb kaszinja lesz, s megnyitja
az utat a pequotok eltt a hihetetlen gazdagsg fel. 1995-ben a trzs mr
arra kszlt, hogy kaszinkat nyisson az llam ms rszein, s rajnlato
kat tettek, hogy teljes egszben ellenrzsk al vonjk a szerencsejtkot
Connecticutban.

109
A MASHANTUCKETI PEQUOT KASZIN

Foxwoodsban nemcsak jtkautomatk, hanem hatalmas szobra is. Az Escsinlt fehr akrilbl
mrgez lgfrisstktl illatos hatalmas szlloda is formztk (ebbl a manyagbl frdkdakat is
vrja a ltogatkat: ennek szomszdsgban ptik ksztenek), s forg talapzaton ll a jtkterem
fel a pequot indinok a vilg els nemdohnyz bejrata eltt. Amikor t az ra, sas rikolt, dobok
jtktermt. Van itt kozmetikai szalon; mkrm, peregnek, magnfelvtelrl mennydrgs db
akril, veggyapot s gl; krmlakkozs 10 dollr rg, s az indin lzersugr nylvesszt rpt az g
tl, ajakfnyezs 6 dollrtl. A szrakoztatkz be. A trzs tagjainak egyhang neke mellett es
pont, amelyet Frank Sinatra nyitott meg, a ltszat ztatja a harcos fl borul manyag tlgyfaleve
valsg segtsgvel knl utazst a pequotok vil leket. Aztn ismt kist a nap, s a tmegek bevo
gba. A trzs mltjt rkti meg a dlceg pequot nulnak a kaszinba.

Richard A. Hayward kapitny';


a mashantucketi pequot indinok
trzsi tancsnak elnke,
aki ltrehozta a kaszint meg
az j kelet trzsi vagyont.

JOBBRA: Az Escsinl
a mashantucketi pequot kaszinban
minden kerek rban kilvi lzer
nyilt az gbe, hogy megjjjn az es.

110
NEMEK S ADK

Jvedelmk nagy rszt a trzs javra fordtjk. Flvsroljk a hzakat


s fldeket a rezervtum krl, s mr pomps kzssgi hzat ltestettek.
Gondoskodnak rla, hogy minden pequot gyerek megfelel nevelst s
minden felntt munkt kapjon. Az els idben sok volt a vegyes hzassg
fekete rabszolgkkal, gy sok pequotnak stt a bre; a trzs pnzt klnt
el a helyi kzssg kisebbsgi csoportjainak, s tmogatjk a kzeli vro
sok szegnynegyedeinek iskolit.
Sikerkn felbuzdulva mr jelentkeznek a versenytrsak. Kaszint
akarnak ltesteni rgi ellensgeik, a moheganok is egy elhagyott gyr te
rletn, melyben valamikor atomtengeralattjr-reaktorokat lltottak
ssze. Most majd egy fauxstone-i" jtkterem lesz ott, mely fltt Squan
nit any, a trzset vd mank, a makiawiusugok fnke rkdik. Szvet
sgeseik az 1637-es mszrlsban, a narragansettek szintn azt tervezik,
hogy jtktermeket nyitnak sajt rezervtumukban.
A pequotok hatalmas zletgg tereblyesed vllalkozs rszesei. Mr
szzharminc indin kaszin sorakozik egyik tengerparttl a msikig. 1998-
ra az indinok kezben lesz a szerencsejtk zletg egytizede. Sok indin
nagy vagyonra tesz szert, a trtnelem folyamn elszr. A sakopi dakota
trzsnek mr mind a szzharminc tagja milliomos, mindegyikk vi jve
delme legalbb flmilli dollr. Ez maga a beteljeslt amerikai lom!" -
mondja az egyik trzs szvivje. m a dakota lmot is elhomlyostja az
Idaho llambeli Cour d'Alen-i indinok, akik Orszgos Indin Sorsj
tkot akarnak indtani ingyenes telefonvonalakkal - s garantlt ktszz
millis fnyeremnnyel venknt hrom szerencss jtkosnak. Az in
dinok kzt az a trfa jrja, hogy nemsokra visszavsrolhatjk Manhat
tant, amelyet 1626-ban krlbell hsz dollrrt vettek meg tlk a hol
landok. Annyira felledt az indinok nbizalma, hogy 1995-ben mg Lone
Ranger hajdani pajtsa, Tonto is fldhz teremtette trst, mondvn:
Nem vagyok a te indinod . . . n senkinek az indinja sem vagyok, n
Tonto vagyok!"
Mindez j nyomatkot ad kt rgi krdsnek - mindkett trsadalmi s
genetikai vonatkozsokban gazdag. Ki a trzs rksge; ki tartozik a
trzshz? A szerencsejtkok megindulsa eltt indinnak lenni legfeljebb
nrzet dolga volt, vagy annyit jelentett, hogy az embernek joga van rossz
fldn szegnysgben lni. De most az indin szrmazs dollrmillikhoz
nyithat ajtt. Az alkalmazott biolgiai trvnyektl fgg, hogy ki lphet
be rajta. Jogilag nem szablyoztk, hogy ki minsl indinnak; brki an
nak vallhatja magt, jllehet ez nem biztost neki klnsebb jogokat.
A valdi indinok persze nem nzik j szemmel, ha valaki ezt mondja ma-

111
A VRNKBEN VAN

grl, mert felttelezik, hogy ilyen alapon akar rszeslni a trzs kivlts
gaibl. A kztulajdonon alapul trsadalom sebezhet a betolakodkkal
szemben.
Vannak, akik szeretnnek indinok lenni, annak is rzik magukat, br
Amerika slakival nincs semmifle genetikai kapcsolatuk. Az Egyeslt
llamok npszmllsi rlapjn az ember bejellheti brmelyik etnikai
csoportot", amellyel azonosul. 1960 s 1990 kztt flmillirl ktmillira
" ntt azoknak a szma, akik az amerikai indint" vlasztottk. Amikor
megkrdeztk ket, egynegyedk bevallotta, hogy egyltaln nincsenek
indin sei. k a wannabee" (akarlenni") trzs. Az indinosdi egyids
az Egyeslt llamokkal. Viktria kirlyn szemrehnyst tett egy vadnyu
gati msor szerepljnek, Fekete Jvorszarvasnak: Tncoltunk s nekel
tnk. . . ott, Anglia Any szeme eltt. Kicsi volt s kvr . . . Hatvanht ves
vagyok. Lttam mindenfle npet szerte a vilgban, de ilyen derk, szp
szl embereket mg soha. Volntok csak az n alattvalim, nem engednm,
hogy gy mutogassanak benneteket, azt mondta."
Longfellow Hiawathja s Fenimore Cooper Az utols mohiknja ran
got klcsnztt a mozgalomnak. Hamarosan indinok lelke szllta meg a
szlhmosokat, kvkereket s az antialkoholizmus szszlit. A jtk egy
re nagyobb teret hdtott, megjelentek az indinok a dohnyhirdetsek
ben s a sportegyttesek nevben: Harcosok, Vrsbrek, Szeminolk,
Apacsok. A hippik fejpntot, gyngyket s rojtos zubbonyt viseltek. Egy
spiritualista csoport trzsknt akarta bejegyeztetni magt mint jogi sze
mlyt. Annak, hogy az ember indin, valami varzsa van (annak, hogy
fekete, szemmel lthatlag nincs) , aminek az amerikaiak nem tudnak el
lenllni.
Nha gondosan elksztik a szemlyazonossg mdostst. A hawaii
ak a 2000-dik vi npszmllsnl t akarnak kerlni az zsiai/csendes
ceni szigeti" rovatbl az amerikai indin/alaszkai slakos" rovatba.
Aminek termszetesen semmi kze ahhoz, hogy a hawaiiaktl megtagad
tk a szerencsejtkok jogt.
Miutn a cseroki indinokat fldjk nagy rsztl megfosztottk az
Egyni Tulajdon Trvnyvel, a maradk terleten olajat talltak. jabb
trvnnyel ktelezv tettk a trzsnek juttatott ingatlan bejegyeztetst.
Egyszerre megrohantk a vidket a fehr telepesek, akik lelkiismeretlen
gyvdek segtsgvel indin sket hazudtak, feliratkoztak a trzsbe, s
megkaparintottk a fldet. 1905-ben ezek a fehr indinok" ellltak a
kvetelssel, hogy llamisgot akarnak. A valdi indinok hiba krtek sa
jt llamot (Sequoyah" -t), amely megvdheti jogaikat, krsket elutas-

112
INDINOSDI A RENGETEGBEN
NMETORSZG NYUGATI FELN

Nem az amerikaiak az indin lt legbuzgbb hvei. ni, lasszt vetni s indin mdra nekelni. k kez
A tizenkilencedik szzadi Nmetorszgban az in demnyeztk a nmet hobbiindin" -mozgalmat.
dinok a szabadsg jelkpei voltak. Az indin k Minden vben nyri tborozsra indulnak, in
zelebb ll a nmetekhez, mint brmely ms eur din strakkal s tbb ezer indin kosztms
paihoz. Taln mert a mi szvnknek mindig kedves rsztvevvel. Nmet gyrtmny indin kzm
volt, ami termszetkzeli" - llaptotta meg Buf vestrgyakat rulnak (tbbek kzt gynyr, mik
falo Child Long Lance trzsfnk knyvnek for romterrel ellenrztt gyngyhmzseket). A t
dtja. borozk igyekeznek minl szigorbban betartani
Krlek, segts rajtam, kldj valami olvasniva az indin trzsi szoksokat, s a Nagy Varzsl
lt a remnytelensg rira. Coopertl mr olvas Szertartsokra vneket hvnak meg az Egyeslt l
tam Az utols mohiknt, A kmet, A rvkalauzt s lamokbl.
Az ittrol<et. Ha neked ms knyved is van tle, Klnsen Kelet-Nmetorszgban volt ers a
knyrgk, add le nevemre Madame von Bogner hobbiindin-mozgalom. Az llam is tmogatta,
nl a kvhzban" - rta egyik bartjnak Franz hadd emlkeztesse a tmegeket az Egyeslt lla
Schubert 1828-ban, egy httel a halla eltt. mok imperialista mltjra; az emberek viszont
May Kroly nmet r kzreadott egy kaland azrt csatlakoztak hozz, mert szabadsgrzetet
regny-sorozatot, melynek fszereplje a prriva nyjtott egy fojtogat rendszerben. Nhnyan fj
dsz Old Shatterhand. A knyveknek mg ma is dalmas irnit fedeznek fel abban, hogy az szak
nagy a keletjk. 1890-ben megrkezett Eurpba amerikai indinok jabban igazolvnyt akarnak
Buffalo Bill egy csapat indinnal, s nagy szenz kapni vrk sszettelrl. Tlsgosan kzeli a
cit keltett. A drezdaiak lelkesen tanultak lovagol- prhuzam a nci Nmetorszggal.

Ted Aston lete nagy


rszben hobbiindin volt.
Gyerekkorban egy lpst
sem tehetetetl a zsid
szrmazst bizonyt
szemlyazonossgi igazolvny
nlkl. Erklcsi ktelyei
vannak azt illeten, hogy
most taln Amerika slaki
kapnak effle paprokat.

113
A SZIBRIAI KOLUMBUSZ
S AMERIKA BENPESTSE

989-ben a skandinv Vrs Erik gyarmatot alaptott Grnland nyugati


partjn. Fia, Szerencss Leif tovbbhajzott Newfoundlandra (ma is meg
tallhatk teleplsnek romjai). A helybliekkel - skraelingeknek nevez
tk ket - kereskedni kezdtek, de aztn tovbblltak, mert az j gyarmat
nak, Vinlandnak nem jsoltak nagy jvt. Ezutn tszz vig kellett vrni,
hogy a kvetkez eurpai tallkozzon egy bennszltt amerikaival.
Persze az amerikaiak akkor mr rgen ott voltak. Az els Kolumbusz ke
letrl rkezett, Szibribl. Br egyesek szerint Kaliforniban taln szzt
venezer ves si teleplsek is akadnak, az ltalnos felfogs szerint az els
emberi lnyek krlbell huszontezer vvel ezeltt keltek t a Bering
szoroson, amelynek amerikai partja akkor mamutokban s rnszarvasok
ban gazdag, hatalmas, jeges sztyeppe volt. Maga az tkels tbb ezer vig
tartott, de az szaki terletrl az amerikai kontinens dli cscskig mr tz
ezer ven bell eljutottak.
Kalandozsukat nyomon kvethetjk a gnekben. Sok genetikai vlto
zat kizrlag az szak-amerikaikra jellemz (van, amelyik csak egyetlen
trzsben tallhat meg), s valsznleg mutci rvn alakult ki a leg
utbbi huszontezer vben. Msok szorosan sszekapcsoljk az ameri
kaiakat a mai szak-zsiaiakkal, klnsen a szibriaiakkal. Br az adatok
hinyosak, gy sok a vitathat pont, Amerika trtnetnek kulcsa ott rejlik
a mitokondrilis DNS-ben ( a genetikai informci ni gon rkld r
szben) .
Sok indinnl (s sok kelet-zsiainl) a molekula egy rszben van egy
kis kiess. Egy szak-amerikai csaldfnak ngy ga van, elg kzeli rokon
sgban egymssal. Hrom kzlk Szibriban is megtallhat. Lehet,
hogy ez a klnbz idszakok elvndorlsi hullmainak maradvnya; az
alaszkai s yukon indinok mitokondriuma valban jobban hasonlt szi
briai seikhez, mint a tbbiek, ami arra utal, hogy k ksbb rkeztek.
Az alaszkai partokon l tlingit s haida indinok genetikai ga vilgosan
megklnbztethet az amerikai fldrsz dlebbi rszein l indinok
tl. Egszen ms a kultrjuk s mvszetk is (tbbek kztt a totemosz
lopok). Ennek alapjn valsznleg ksbb rkeztek az jvilgba, taln az
eurpai trtnetrs kezdetn, tezer vvel ezeltt. Nhny csoportnak
(pldul a nsanult indinoknak Vancouver szigetn) sajt megklnbz
tet genetikai jegyeik vannak, k teht felteheten kln s taln mg k
sbb jutottak t az cenon.

114
115
A VRNKBEN VAN

A kpen Pocahontas divatos


londoni ltzetben. A feliraton
valdi indin neve (Mataoka)
s keresztny neve (Rebecca)
szerepel. Frjhezmenetele
az amerikai slakk s eurpai
gyarmatostk vegyes
hzassgainak hossz sort
nyitotta meg.

tottk, s ltrejtt Oklahoma llam. Megalaptsakor Theodore Roosevelt


elnklt Mr. Oklahoma" s Miss Indin Terlet" csfos hzassgnl.
Mondani sem kell, a menyegzi ajndkot ezttal a menyasszony fizette.
Az llam alapjt az indin vagyon megkaparintsra szolgl hamis szr
mazsi adatok szolgltattk.
Mivel vannak ilyen hamis ignyek, az indinok knytelenek kiktni,
hogy csak azok rszeslhetnek a vagyonbl, akik bizonyos vr szerinti kap
csolatban vannak egymssal. A trzseknek teht meg kell hatrozniuk a
genetikai hovatartozs szablyait. Ezektl fgg, hogy mi lesz a trzsbl.
A legtbb trzsnl igazolni kell a biolgiai kapcsolatot egy meghatrozott
si indin csoporttal (legtbb esetben az eredeti szerzdsek alrival
vagy a Dawes szentor trzsi nvsoraiban szereplkkel) . Br a bizonytott
indin szrmazs mg nem biztost indin jogokat, elengedhetetlen felt
tele annak, hogy valaki egy trzsi csoport tagja lehessen.
Mint mindenkinek, az szak-amerikai indinoknak is megvannak a sa
jtos genetikai ismertetjegyeik. Az indinok s eurpaiak kzt olyan sok
az eltrs a vrcsoportokban, fehrjkben s a DNS-sorrendben, hogy ki
vlan meg lehet klnbztetni ket.

116
NEMEK S ADK

Amerika slaki majdnem mind a 0-s vrcsoporthoz tartoznak.


A DNS-szint eltrsek is olyan jelentsek, hogy az FBI-nak rdemes kln
indin adatbzist fenntartania a trvnyszki orvostani munkhoz. Sok in
dinnl szlelhet jellegzetes kiess a mitokondrilis DNS egy rvid szaka
szban. A vilg npessgnek nagy rsznl ez krlbell tizenhatezer b
zisbl ll zrt egysg; a kiess egy szakaszt eltvolt belle, ami bizonyt
kul szolgl arra, hogy az indinok mind egy asszony leszrmazottai, aki
tbb mint hszezer vvel ezeltt kelt t a Bering-szoroson Szibribl
Alaszkba. Azt hinn az ember, knny megllaptani, ki szak-amerikai
indin s ki nem az; kinek van legalbb kiltsa arra, hogy osztozhat j ke
let gazdagsgukban. Akinek fehr a bre, az A vagy B vrcsoporthoz tarto
zik s megszaktatlan a mitokondrilis gnje, az szmtsba sem jhet. Br
megesik, hogy egy indin vilgos br, vagy A vrcsoport, vagy nincs meg
benne a mitokondrilis trls, a hrom egytt szinte egyetlen bennszltt
szrmazsnl sem fordul el. Minl tbb gn kerl az egyenletbe, annl
egyszerbb lesz megklnbztetni az amerikai slakosokat a bevndorlk
tl, s annl knnyebben kifejleszthet egy vizsglati mdszer a szrmazs
megllaptsra, ha valaki csatlakozni szeretne az indin csaldfhoz.
Csakhogy ha a gnek alapjn akarjk eldnteni, ki tarthat ignyt az in
din rksgre, furcsa gond addik. A nemisg mindent sszezavart. Na
gyon sok volt a kevereds indinok s nem indinok kztt. Egyik trzs
korbban, a msik ksbb kerlt kapcsolatba az eurpaiakkal, de bizonyos
mrtkig mind keveredett velk. A kezdet kezdetn Pwhattan virginiai
trzsfnk lnya, a jtkos Pocahontas lltlag (legalbbis a drma msik
szereplje szerint) megmentette John Smith szzados lett, mert karjba
vette a fejt, amikor hallra akartk botozni. Ksbb, 1614-ben felesgl
ment az angol John Rolfe-hoz - aki mint dohnymgns a Wills csald
eldje volt -, s gyereket szlt neki. Egy vvel ksbb Angliban elvitte a
himl; ma sokan valljk sknek (tbbek kztt a burmai Mountbatten
grfn).
A cserokiknl is korai pldk vannak a vegyes hzassgra. A francik r
akartk venni Attakullakulla vetlytrst, Okonosztott (Tengerimalac
kolbsz"), hogy npt a kirly ellen fordtsa, ezrt a Tennessee vlgybe
angol helyrsget kldtek. Sok katona cseroki nt vett felesgl. Az 1760-as
vekben a koront kt skt, Alexander Cameron s John McDonald kpvi
selte ezen a fldn. Mindketten indin nt vettek felesgl, ksbb
McDonald unokja, John Ross lett a trzsfnk.
Ms trzsek befogadtk a csatban foglyul ejtett katonkat. A foglyok
gyakran lveztk a rabsgot. Amikor brmely nembli fehrek ifjan esnek

117
A VRNKBEN VAN

az indinok fogsgba, rvid id alatt elundorodnak a mi letmdunk


tl. . . s tbb nem lehet visszatrteni ket" - jegyezte meg Benjamin
Franklin. 1802-ben Thomas Jefferson mr tmogatta a vegyes hzassgo
kat, legalbbis szavakban. Egy napon nk eggy lesznek velnk, belp
nek testleteinkbe, s egy nemzett forrnak velnk, amerikaiak lesznk
mindannyian; hzassgokban s a vr kzssgben egyeslnk majd, s
sokasodvn betltjk mind e hatalmas szigetet" - jvendlte egy fogad
son, melyet az indin vezetk tiszteletre adtak.
Az ilyen gnkevereds hamarosan azonossgi gondokat vetett fel. Ki tar
tozik az indin csaldfhoz? Ezzel a krdssel szembe kellett nznie a sz
vetsgi kormnynak is, a trzseknek is. Minden azon mlt, mifle geneti
kai szablyokat alkalmaznak. Nmi csrs-csavarssal szinte tetszs szerint
gyarapthattk vagy zsugorthattk az indin csaldot.
A kormny az 1887-es ltalnos Helykijellsi Trvnnyel prblta
meghatrozni mindenkinek a hovatartozst. A vrhnyad" genetikai jel
leg fogalmt alkalmazta. Az minslt indinnak, aki egy tiszta vr indi
n s egy eurpai vagy kt hromnegyed vr indin hzassgbl szr
mazik, vagy brmilyen vrkeveredsbl, amelynek rvn legalbb flvr
indin. 1918-ban a vrhnyadot egynegyedre cskkentettk. Akik megfelel
tek a vrvizsgn, Szvetsgi Indin Igazolvnyt kaphattak. A gondolat mg
mindig szerepel a faji trvnyben. 1990-ben az Indin Npmvszet Fej
lesztsi Trvnye egymilli dollros pnzbntetssel s tizent vi brtn
nel bntethet bncselekmnynek minstette, ha valaki kereskedelmi
forgalomba hoz brmely cikket. . . amely azt a ltszatot kelti, hogy indin
termk", amennyiben a mvsz nem bizonythatan . egynegyed rsz
ben vagy azt meghalad mrtkben vr szerinti indin".
A trvny bet szerinti rtelmben mg az is csak flvrnek szmt, aki
kt klnbz trzsbl szrmaz tiszta vr indin hzassgbl szletett.
Kiss groteszk, hogy bizonyos jogokat a gnekhez kt egy nemzet, amely
nek alapelve, hogy mindenki egyenl a trvny eltt.
Nhny trzs elfogadta a vrhnyadot, de alacsonyabb szinten llaptot
ta meg. A pequotoknl elg egytizenhatod indin vr: egy kapa vagy ka
nya a szzadforduln nyilvntartsba vett mintegy tven pequot nvsor
bl. Ms trzsek bertk egyetlen indin ssel - egyetlen csepp indin vr
rel; az eurpai gnek indin gnekkel val egyetlen rekombincija meg
nyitotta az utat kzjk. A vrhnyad jellegnl fogva tudomsul veszi,
hogy az indin szrmazs szexulisan rkldik: a rekombinci elterjesz
ti olyanok kzt is, akiknek nem minden se indin.
Ez magban hordozza a veszlyt, hogy a meghatrozs rvn semmiv

' 118
A VRNKBEN VAN

Mivel a trzshz tartozst az rkls szabja meg, genetikai vizsglatokkal


lehet dnteni felle; sok plyz al is veti magt a vizsglatnak. Az egyetlen
csepp" szably beri egyetlen indin gnnel. Bizonyos jellegzetes indin
DNS-vltozatok soha nem voltak kimutathatk egyetlen tiszta vr eurpa
inl sem. De csaknem minden amerikai slakos hordoz egyet vagy tbbet
kzlk. Akiben megvannak ezek a rvid DNS-szakaszok, annak indin
snek is kellett lennie, brmilyen a klseje. Ms gnek kisebb-nagyobb
mrtkben eltrst mutatnak az indinok s az eurpaiak kztt. Ha eleget
megvizsglunk, ssze lehet lltani mindenkinek a genotpust (gnkszle
tt), s gy meghatrozhat indin rksgnek hnyada is. Br nhny
trzsnl bonyoltja a helyzetet, hogy bizonytani kell a kapcsolatot a szerz
dst alr kis csoporttal, ilyen mdon legalbb a vrhnyadt megllapt
tathatn mindenki, aki szeretn indin szrmazsnak nyilvnttatni magt.
A konfliktus az rkls biolgiai trvnyei s annak a jogi szablyozsa
kzt, hogy ki osztozhat a trzs vagyonban, a nemisg dilemmjt pldz
za. A pequotok j kelet vagyonukkal alaposan fennakadtak rajta. Szab
lyaik rtelmben a plyz akkor rszeslhet szerencsejtkon szerzett va
gyonbl, ha legalbb egytizenhatod rszben egy kis csoport pequottl
szrmazik, aki 1900-ban lt. Ez magban is ignyjogosultak szzaival b
vtheti a trzset. Az 1900 eltti hzassgktsek kvetkezmnyeknt ennek
sokszorosa hordozhat pequot vrt az ereiben. Elizabeth George Plouffe s
Martha Langevin Ellal (akik szinte az utols pequotok voltak) klsre
ppolyan volt, mint Connecticut tbbi szltte. Richard Hayward sikeres
zletember, semmiben sem klnbzik egy New York-i tzsdegynktl.
Ms pequotoknak stt a brk, mert seik helybeli fekete rabszolgkkal
hzasodtak. Elnyomott kisebbsg volt mindkett, ltalnos volt a kevere
ds. A fggetlensgi hbor els ldozata, egy bizonyos Crispus Attucks, aki
az 1770-es bostoni mszrlsnl esett el, afrikai-indin volt. Martin Luther
Kingnek is akadtak indin (s fehr) sei. Hromszz v rekombincija
sorn az eredeti pequotgnek gy sztszrdtak s felhgultak, hogy rk
lsknek mr nincs lthat jele. Semmi ktsg, vannak indin gnek a
pequotokban, de - egyelre - senkinek sem sikerlt kimutatnia ket.
A pequot nemzetnek komoly gondot okoz, hogy eldntse, ki rszesl
jn a vagyonbl. Hromszzan bizonytottan a trzshz tartoznak, de ez
rek szeretnnek csatlakozni hozzjuk. Egy televzis riport nyomn, amely
kzztette, hogy keresik eltnt rokonaikat - s hogy esly van a gyors meg
gazdagodsra -, znlttek az ignybejelentsek. Ktsgtelenl sok kohol
mny is rkezett, de nmelyiknek volt valsgalapja. Sokat gnyoldtak
egy nyugat-indiain, aki azt bizonygatta, hogy a peacock" ( pva") indi-

. 120
NEMEK S ADK
'

A pequot tagsgra plyz


Joe Melius a rczervtumhoz
kzeli otthonban. gy vli,
sikerlt rokoni kapcsolatot
tallnia valakivel, aki
szerepel a szzad eleji trzsi
nvsorban.

noktl szrmazik. Ez nevetsgesen hangzott, hiszen a frfi fekete. Csak


hogy a mystici csata utn sok pequotot vittek a Bermudkra. A szmztt
indinok a helybeliekkel hzasodtak, s leszrmazottaik idvel beolvadtak
az afro-karibi npessgbe.
A meggazdagodott indinok egyszer vlaszts el kerlnek. Minden a
szexulis s aszexulis reprodukci klnbsgn mlik. Ha a vagyont szt
osztjk mindazok kztt, akiknek az ereiben indin vr folyik (mg akkor
is, ha nknyesen megllaptanak egy hatrrtket), akkor a trzs szmra
elvsz. Ha viszont megtartjk egyes csaldokon bell, mint a nyugatiak,
akkor nem sok rtelme marad a trzs ltezsnek.
A cserokik igen korn szembekerltek a vlasztssal. Szvesen befogad
tk az eurpaiakat, rendszerint fehr frfiakat, akik az asszonyaikkal h
zasodtak. Az ilyen hzassgokbl szrmaz utdoknl egyetlen indin s -
egy csepp vr - elg volt a trzshz tartozshoz. Amikor a tizenkilencedik
szzadban a trzs gazdagodott, a bevndorlk egyre jobban ragaszkodtak
hozz, hogy vagyonuk - trzshz tartozsuk viszont mr nem - aszexu
lisan rkldjk, az eurpai szablyok szerint. Az zletek s hzak a csa-

121
A VRNKBEN VAN

ldban maradtak; hamar kialakult az osztlyrendszer. Nhny cseroki in


din vagyonos rabszolgatart lett, mg msok a fldeken verejtkeztek.
Sok mai indinnak ugyanezzel a dilemmval kell megbirkznia. A tr
zset a hazrdjtkok joga (a halszat, az admentes benzin elads) illeti
meg. Az eredmny, az elkpzelhetetlen gazdagsg, mr nem. Nhny trzs
kszpnzben fizetett a tagjainak hatalmas sszegeket, msok letti pnz
alapokat hoztak ltre. Ez nyilvnvalan mind megmarad egy-egy csaldon

bell. A ktfle rklsi rendszer ellentmond egymsnak. A megolds az
indin kzssgi tudat kipusztulshoz vezet.
New York llam szaki rszben a mohawk rezervtum tnylik az
Egyeslt llamokbl Kanadba (a hatrt az 1812-es hbor utn jelltk
ki, amikor nem sokat trdtek az indinokkal). Vannak szerencsejtkok,
s trtntek eredmnytelen ksrletek kaszink megnyitsra is. Sok pnzt
hoz a cigarettacsempszet az Egyeslt llamok s Kanada kzt: gyors jra
t motorcsnakok szlltjk az rut a rezervtumot tszel Szt. Lrinc-fo
ly egyik partjrl a msikra. A mohawkok jogot formlnak a hatrforga-

A fiatal mohawk harciasan ll


egy felfordtott jrrkocsin
a rendrsg i990-es
eredmnytelen ksrlete utn,
hogy a rezervtumban
eltvoltsa az takadlyokat.

122
NEMEK S ADK
...

lom ellenrzsre, s titokban vmmentes cigarettt szlltanak a krnye


z kzssgekbe, hogy aztn risi haszonnal adjk el.
Ez sszetkzshez vezetett, zendlsekkel, gyilkossgokkal s barik
dokkal a hatrtkelhely hdjn. Az Egyeslt llamokhoz tartoz rszen a
szvetsgi gynkk razzit tartottak a kaszinkban, s letartztattk a ci
garettacsempszeket. A trzs nem egysges, sok mohawk ugyanis egylta
ln nem rl a szerencsejtkokkal s szeszcsempszettel egytt jr b
nzsi, erszak- s kbtszer-hullmnak. A haszon nagy rsze, mondjk,
kevesek zsebbe vndorol, nem az egsz trzs javt szolglja. Msok rmu
tatnak: csak az j kelet jvedelemnek ksznhet, hogy a mohawkoknak
vgre tisztessges iskolik vannak. A trzs nhny tagja risi kaszin p
tst tervezi; msok viszont elmentek, s j kzssget alaptottak, hogy
fenntartsk a kzs rtkeket, amelyek valaha mindenki mstl megk
lnbztettk az indinokat.
A mohawk konfliktusban az az ellentmonds rejlik, hogy a halads ra a
kapzsisg - a nemisg fladsa rvid tv elnyket gr a hossz tv ht
rnyok ellenben. A kzgazdasgban rendszerint gyz az nrdek. Adam
Smith A nemzetek gazdagsga cm munkjban (amely a Fggetlensgi
Nyilatkozat vben ltott napvilgot) nyltan beszlt: Nem a mszros, a
serfz vagy a pk jindulattl vrjuk az ebdnket, hanem attl, hogy
szem eltt tartja sajt rdekeit. Nem jsgukra, hanem nzskre apell
lunk. . . Minden egyn . . . csak a maga hasznt nzi, s e tekintetben, mint
sok msban is, egy lthatatlan kz vezrli, hogy olyan clt szolgljon, amely
egyltaln nem szerepelt szndkai kztt. Midn sajt rdeke szerint jr
el, gyakran eredmnyesebben szolglja a trsadalom javt, mint amikor
valban azt akarja szolglni."
Ha tudta volna Adam Smith, hogy a nemisgrl beszl! A termszetben
valban minden egyed csak a maga hasznt nzi, vagy legalbbis a gn
jeit. Az nzetlensg mindig alulmarad az nrdekkel szemben; a nemisg
kialakulsval egytt jr sokflesg s versengs rendszere az a lthatatlan
kz, amely a biolgiai fejldshez vezet. Hogy az indinok jl jrtak-e, mi
kor olyan lelkesen magukv tettk Henry Dawes tantst - az nzs a
civilizci mozgatja" -, azt mr nekik kell eldntenik.

123
I I I . FEJEZET

Az elveszett trzsek

Ezt mondja az r Isten: !m, n flveszem



Izrel fiait a pognyok kzl, a kik kz
mentek, s egybegyjtm ket mindenfell,
s beviszem ket az fldjkre. s egy npp
teszem ket azon a fldn, lzrelnek hegyein . . . "

EZKIEL 37, 21-22

A HAMVASZTS BNNEK SZMTOTT Angliban mg egy vszzaddal ez


eltt is. Hogyan szllhatnnak ki srjaikbl a hvk az utols tlet krtsza
vra, ha nem hagytak bellk mst, csak egy mark hamut? Br az rvels
nmi kishitsget rul el az isteni tallkonysgot illeten, szilrdan meg
rizte egyeduralmt 1884-ig, amikor egy dr. William Price nev (akkor
nyolcvanngy ves) walesi frfi nneplyesen lngra lobbantotta kisfia,
Jzus Krisztus testt a Llantrisant falura nz hegyoldalon. A felhboro
dott tmeg rtmadt, elragadtk a holttestet a lngokbl, s dr. Price-t vd
al helyeztk. A vdlott Wales fdruidjnak dszltzkben jelent meg a
brsg eltt vdbeszdnek megtartsra: rkabrbl kszlt sapkban,
piros szarvasbr mellnyben, zld nadrgban, skt kocks kpenyben s
zokni nlkl (mert az gtolja a lb megfelel levegzst"). William
Price-t nem talltk bnsnek, mivel nem nyert bizonytst, hogy a ham
vaszts trvnybe tkzik. Kilenc vvel (s mg kt gyerekkel) ksbb t
magt is elhamvasztottk, hatalmas tmeg eltt, egy hsz mter magas r
don fnyl rz flhold alatt. Nagy-Britanniban most elszr hangzott el
egy temetsen: tzbe vettetik"; s 1896-ban megnylt Wokingban az els
krematrium. Angliban jelenleg minden tz holttest kzl hetet elham
vasztanak.
Dr. Price egy tzezer vvel ezeltt lt walesi, egy kelta pap reinkarnci
jnak vallotta magt. A szz vvel a halla eltt alaptott druida rend tbbi
tagjval egytt jj akarta leszteni e szigetek eredeti lakinak elkpzelt
letmdjt. Szerinte vegetrinusok voltak, szerettek meztelenl napozni,
s nyitott hzassgban ltek. m Britannia nagy rszbl brutlisan kiszo-

124
AZ ELVESZETT TRZSEK

A Llantrisantbl
szrmaz dr. William
Price druida
dszltzetben,
kezben fklyval,
hogy meggyjtsa
a halotti mglyt.
A kpen lthat elgit
az eredeti walesi nyelv
egyni vltozatval rta.

Dr. Price elhamvasztsa i893-ban.


Holttestt tlyuggatott aclkoporsban,
petrleummal titatott fbl rakott
mglyn gettk el.

125
A VRNKBEN VAN

rtottk ket a betr angolszszok. Az druidi azoknak a papoknak az


utdai, akik Britannia szent ligeteit npestettk be jval az angolok, sz
szok s jtk odarkezse eltt. Szt. Beda Venerabilisnl olvashat, hogy a
kimberek - nagyjbl a mai walesiek - si keleti np, amely az znvz
utn vndorolt el a Biblia fldjrl a Brit-szigetekre. Gmer, No unokja
volt az els brit.
Valaha szles krben elterjedt ez a naiv szemllet, amely a trtnelmet a
behatol tmadk ismtld hullmainak fogta fel. Az embertan hossz
veken t csak az ilyen vagy olyan fajta elveszett trzsek utn kutatott. Bi
zonyos rtelemben ma is ket keresi, csak ms eszkzkkel. A leigzott n
pet meghdtotta egy felsbbrend faj, amely magval hozta kultrjt.
Idvel a behatol tovbbvonult vagy elkorcsosult, s csak romokat hagyott
maga utn. Beninben a bronzszobrok - pomps, klasszikus stlus afrikai
szobrok - lltlag egy elveszett eurpai np alkotsai. Thor Heyerdahl
utazsai sorn annak a napimd npnek az tjait akarta ismt bejrni,
amely Kzp-Keletrl jtt, s eljutott a Fld legtvolabbi vidkeire is.
Amerre jrtak, kveket hagytak maguk utn: piramisokat, krket vagy
szobrokat. S a kvek fennmaradtak, hogy az alantasabb npek mg akkor
is csodljk ket, amikor a mesteri kmvesek rg elenysztek.
Ezek a hiedelmek mind a szrmazsrl, a mlt s jelen meg a vilg npei
kztti kapcsolatrl kialaktott elmletek. Teht mindegyik ellenrizhet
a gnek vizsglata rvn. A legtbb nemzet bizonyos mrtkig a vrrokon
sg alapjn hatrozza meg magt mg akkor is, ha ezt tagadja. Magukban
hordjk annak a kzs szrmazsnak a nyomait, amely az ket megelz
trzseket s nemzetsgeket sszetartotta.
A vilg gntrkprl gyorsan tnnek el a fehr foltok. Nemsokra fl
lehet rajzolni az emberi faj csaldfjt. Az emberi gnllomny sokfles
gvel foglalkoz kutatsi program ( Human Genome Diversity Project)
eredetileg mdszeres mintavtellel akart dolgozni: pr szz kilomteren
knt akartak begyjteni egy-egy gnmintt. De az eljrs igen kltsges
nek bizonyult, gy le kellett llniuk vele, s most az a cl, hogy sszegyjt
sk a vilg mintegy tezer etnikai csoportjbl" tszznak a DNS-t.
A kutatkat fkpp a trzsi npek rdekeltk. Ez hiba volt. Br az exped
cikban orvosok is rszt vettek, akik gygytottk a helybelieket, risi
(olykor mestersgesen sztott) felhborodst vltott ki, hogy az els vilg
kihasznlja a harmadikat. Az rintettek klnsen azt srelmeztk, hogy
megjelentek a gygyszervllalatok, amelyek cukorbetegsgre hajlamost
gneket kerestek, valamint a trzsi npektl vett szmos sejtet szabadal
maztattak.

126
AZ ELVESZETT TRZSEK

A kutatsi programot ezrt visszafogtk, s taln soha nem fejezik be.


De azrt a tudomny- a gygyszati jelentsg gnkutats velejrjaknt
- tovbb keresi a nemzetek kzti rejtett sszefggseket. Biolgiai kapcso
latot teremt egy-egy orszg jelenlegi laki s esetleges tvoli szlfldjk
kztt.
Fld s np kapcsolata egyetlen nemzetnl sem olyan egyrtelm, mint
Izrael llamban. A zsid np nagy rsze csaknem egsz trtnelme folya
mn szmzetsben lt. A vilgban sztszrt, vndorl zsidk hatalmas,
szerencstlen sokasga heves, tretlen s legyzhetetlen vgyat rez, hogy
sajt hazja legyen" - mondta Winston Churchill az angol parlament als
hzban i939-ben, a zsidk megprbltatsainak legsttebb pillanat
ban. Magnak Izrael llamnak a gondolata is azon alapul, hogy egy np
nek, melyet vr s tapasztalat egysgbe fon, joga van a sajt hazhoz. Csak
nem minden zsid egyetlen stl szrmaztatja magt, jelkpes vagy ms
rtelemben: brahm ptrirktl, aki ktszz nemzedkkel ezeltt lt.
A Krnika I. knyvben a nemz . . . " hossz felsorolshoz lltlag ki
lencszz teverakomnyra val magyarzat fzdik. Kt s fl ezer vvel k
sbb, i994-ben a judaizmus trtnelmrl rott knyv els fejezetben ez
olvashat: Zsid az a szemly, akinek zsid anyja van . . . A dnt krit
rium nem a vallsi meggyzds, hanem a biolgiai szrmazs." A judaiz
mus a leggenetikusabb valls.
Hogy ezt a szrmazst jelkpesen vagy sz szerint rtelmezik, az lnye
gben megszabja, hogy mit jelent zsidnak lenni. Br vannak korai pldk
a kikzstsre (pldul Esdrs kveteli, hogy akinek nem zsid felesge
van, bocsssa el), az si szvegekben nem sok sz esik a vrvonal jelents
grl vagy arrl, hogy a szrmazs elbbre val a meggyzdsnl. A zsi
dsg kezdetben igyekezett msokat is sajt hitre trteni, s hatrai elg
g tjrhatk voltak. De az ldztets s kirekeszts, melyben trtnelme
sorn rsze volt, azta sokkal zrtabb vallss tette a judaizmust. j rtel
met kapott a gondolat, hogy a zsidsg egyetlen nagy csald.
Egy csaldfa szrevtlenl talakulhat egy nemzet eredetnek trtnet
v. Ha a szrmazstl fgg, hogy valaki zsid-e, akkor a gnek elruljk,
hogy ki tartozik kzjk s ki nem. Izraelben virgzik a biolgia tudom-
nya, s nagy az rdeklds az ember genetikai rksge irnt. Elssorban a
genetikai eredet betegsgrl akarnak minl tbbet megtudni, de az az
igny is dolgozik a kutatkban, hogy kidertsk a vilg zsidsgnak rokoni
kapcsolatait. A kzs szrmazs s kzs hit rendszert kvnjk nyomon
kvetni a nemzet trtnelmnek legkorbbi szakaszig. De egyre inkbb be
kell ltniuk, hogy a gnek tansga szerint a kett kzt ellentmonds van.

127
A PTRIRKK SRJA

A Ptrirkk srja - Makpla barlangja vagy az brahm-mecset, attl fg


gen, hogy ki beszl rla - egyarnt jelkpes hely a judaizmus s az iszlm
szmra. A hagyomny szerint itt nyugszik brahm, felesge Sra, Izsk,
Rebeka, Lea s Jkob. Mzes L knyvben olvashat, hogyan vette meg
brahm ezt a fldet. Hebron ma az izraeli megszlls alatt ll nyugati
parton van, s hromezer ves trtnelme sorn az plet volt mr zsid
szently, zsinagga, keresztny templom, mecset, ismt keresztny temp
lom s ismt mecset. Hebronban koronztk meg Dvid kirlyt; politikai
megrzkdtatsok hossz sora fz dik a helyhez, legutbb i994-ben
Baruch Goldstein amerikai zsid fundamentalista mszrolt itt le egy cso
port imdkoz arabot, mieltt t is agyonlttk. Hebronban mg mindig
rezhet a zsid jelenlt, br az arabok kis hjn elsprtk ket az i929-es
mszrlskor. Elfordult, hogy zsidkat a sr kzelbe sem engedtek:
a tizenharmadik szzadban csak az plethez vezet lpcs felig mehet
tek, ott kellett becssztatniuk krseiket Istenhez a i8o cm vastag kbe vjt
lyukon.
Az lltlagos sr valjban alighanem egy si vztrol, m ez mit sem
cskkenti szimbolikus jelentsgt.

A Ptrirkk srja vagy Ibrahim mecsetje; lltlag itt van brahmnak, a bibliai trzsek snek
srja.

128
AZ ELVESZETT TRZSEK

Rszlet a rmai Titus-diadalvbl, amelyet Jeruzslem Kr. u. 70-ben trtnt lerombolsa al


kalmbl emeltek. Rmai katonk lthatk rajta a templombl elhurcolt zskmnyukkal
(tbbek kztt egy menrval, a htg gyertyatartval). A diadalvet a gyztes hadvezr
btyja, Titus Flavius Sabinus Vespasianus emelte, aki ksbb csszr lett, s felpttette a Co
losseumot.

A sztszrattats, az jraegyesls s a kzs szrmazs ltomsa a ju


daizmus kezdeteire nylik vissza. Armageddon trtnethez fzdik, az
elveszett trzsekhez, ahhoz, hogy Izrael npe sztszrattatott ellensgei ke
ztl. Megiddo pusztulsval kezddik a trtnet, Kr. e. 722-ben. Az assz
rok krrvenden megrktettk egy emlktbln, hogy az szaki kirly
sgbl 27 280 embert hurcoltak el. Legtbbjknek nyoma veszett. A Dli
kirlysg, Jdea fnnmaradt. Ott lt Jda s Benjmin trzse. Minden
trzs Jkob tizenkt fitl szrmazott. Rbn, Simeon, Izakar, Zebulon,
Manasse, Efraim, Dn, Naftli, Gd s sr dinasztii elvesztek szem ell.
A trzsek szmzetse csak a kezdet volt. Kr. e. 586-ban Jdet is megh'
dtottk, ezttal a babiloniak. Salamon templomt leromboltk. tven vvel
ksbb a babiloniakat igzta le a perzsa Krosz. Nhny zsid visszatrt Pa
lesztinba, de legtbbjk nekivgott a vilgnak, diaszpra lett bellk. Kr. u.
70-ben kitrt a hbor a palesztinai zsidk s rmai elnyomik kzt, s en
nek nyomn ismt zsidk tmegei vltak hontalann. Ilyen vesztesgekre
nem volt tbb plda egszen a holocaust mindent fellml borzalrnig.

129
'

Jkob s tizenkt fia - Izrael


trzseinek eldei - Francisco
dc Zurbarn tizenhetedik szzadi
spanyol fest kpn.

131
A SZAMARITNUSOK

Izrael nhny lakosa vissza tudja vezetni biolgiai . ll szentlykbl beltni a vrost; Nagy Sndor
s vallsi rksgt egszen a trzsi idkig. Nekik tl kaptak engedlyt, hogy itt ptsenek templo
nincs szksgk a Visszatrsi Trvnyre, hiszen mot. Br a falak mr rg nem llnak, mg mindig
legtbbjk el se ment. k bizonytjk/mutatjk, zarndoklatok indulnak a hegyre. Nhny szama
milyen nehz beilleszkedni egy trsadalomba, ritnus a mai napig Nablusban l, de ahogy ntt a
melyne meghatrozja a szrmazs. politikai feszltsg, jl rztt telepls plt a Ge
Az fuzaki kirlysgnak nem minden lakost rizimen, biztonsgban a palesztin tmadsoktl.
szmztk. Szamaria vrost s krnykt megk A legnagyobb nnepsget a zsid hsvt idejn
mltk. Az ott lk a judaizmus sajtos formjt tartjk. Bonyolult szertarts szerint imdkoznak,
gyakoroltk. A kvetkez hromezer vben szl levgjk a brnyokat, s elmondjk az Egyiptom
fldjket kzrl kzre adtk a babiloniak, rmai bl val kivonuls trtnett. A szamaritnusok
ak, keresztnyek s mohamednok. Lakosai, a sza minden se a Szentfldn lt: senki msnak nincs
maritnusok ragaszkodtak hitkhz. A mai napig ilyen egyrtelm kapcsolata Izrael fldjvel. Azt
is azt tartjk, hogy k a tbbi zsidnl hvebben mondjk, k Efrim s Manasse trzsnek egyenes
kvetik Mzes tantsait. J rszk ott maradt sz gi leszrmazottai. A tizenhetedik szzadban f
lhelyn, s a vget nem r tmadsokkal dacolva papjuk mg vissza tudta vezetni seit frfigon
megrizte vallsossgt. A trk uralom sszeom egyenesen ronig. Ekkor egy ptrirknak nem
lsnak veiben - a szzadforduln - szmuk a szletett fia. A szamaritnusok komolyan vettk a
hajdani hromszzezerrl mr szznegyvenhatra trvnyeiket, gy a papsg tkerlt egy lvita csa
cskkent. ldhoz, amely frfigon a Templom szolginak
Leszrmazottaik nagy rsze a nyugati parti csaldjtl szrmazik.
Nablus krnykn l, egy msik csoport pedig Tel A kutatsi eredmnyek azt mutatjk, hogy a
Aviv elvrosban, Holonban. A Gerizim-hegyen szamaritnusok kln genetikai csoportot alkot-

A szamaritnusok fpapja
Gerizim-hegyi otthonban,
a zsid hsvt nnepi
szertartsa eltt.

132
A SZAMARITNUSOK
'

Kilts Nablusra a Gerizim-hegyrl, a szamaritnusok si templomnak helyrl.

nak. Zrt kzssgben ltek, egyms kzt hza ritnusok s zsidk kztt, mert nem rtettek
sodtak, gy ez a npessg a gnjeiben is, trtnel egyet abban, hogy hny parancsolat van, hny
mben is az testamentum nphez kapcsoldik. knyv alkotja a Biblit, s hny szent napot kell
Olyan szigoran betartottk a hzassgi szokso szmon tartani. Ezrt ktezer vig megtagadjk t
kat, hogy mg a csoporton bell is vannak geneti lk a jogokat, melyek szrmazsuknl fogva meg
kailag elklnl csaldi gak, amelyek vszza illettk volna ket. Az jtestamentum irgalmas
dokon t nem hzasodtak egymssal. Az ilyesfajta szamaritnusa egy megvetett kisebbsghez tarto
elszigeteltsg s kzs szrmazs szksgszer k zott. Amikor a Kairba s Damaszkuszba szm
vetkezmnye, hogy az rtalmas lappang gnek ztt szamaritnusok a tizenkilencedik szzadban
elbb-utbb megmutatkoznak - mint az eldu az iszlm ldztetssel dacolva egyms utn szk
gott finn falvakban -, amint a kzs sktl szr tek Izraelbe, a legtbb zsid nem ltta ket szve
maz emberek sszekerlnek s gyerekeik szlet sen. Sokan csak a keresztny kolostorokban ta
nek. A szamaritnusok kztt viszonylag gyakori a lltak menedket. Nem volt elg, ha valaki az si
sket-vaksgnak egy rkltt formja. Mr hosz Izraelbl szrmazik; azokhoz kellett tartoznia,
sz ideje nyilvntartjk, de gnjt csak most tall akik pontosan rgztett szablyok szerint gyo-
tk meg. roljk a vallst. \
Br a szamaritnusok ma az izraeli nemzet
megbecslt polgrai, akiknek ragaszkodst az si
lakhelyhez mindenki csodlja, ez a szemllet j
kelet. Az sidkben hitszakads tmadt a szarna-

133
A VRNKBEN VAN

LE VRA J PORTR AlT DU JlJ1P--ERll\T

A bolyg zsid egyetemes eurpai mtosznak egyik francia vltozata; az a zsid, aki a
monda szerint nem engedte, hogy ajtajnl megpihenjen Jzus a kereszttel tban a Klvri
ra, gy arra tltetett, hogy Jzus msodik eljvetelig bolyongjon a vilgban. A mtosz az an
tiszemitizmus knny mentsge lett, s akik hirdettk, nem vettk szre, milyen groteszk vd
egy szlfldjrl elztt np ellen, hogy sajt bne miatt lett fldnfut.

Claudius csszr Kr. u. 48-ban megtartott npszmllsa szerint nyolc


milli zsid lt a birodalomban, kzlk kt s fl milli Palesztinban. Ta
ln tlbecsltk a szmukat; mindenesetre egy vtizeddel ksbb a paleszti
nai zsidk szma mr jval alatta maradt az egymillinak, s Kr. u. 400-ban
mr valsznleg az egsz Rmai Birodalomban nem voltak egymillinl

'- 1 34
AZ ELVESZETT TRZSEK

tbben. A vilgon ma l tizenngymilli zsid nagy rsze a Rmval val


sszecsaps tllitl szrmaztatja magt. Trtnelmi s genetikai tjuk
nyomon kvethet szmtalan kitrjvel egytt a modern idkig. Izraelnek
csak kevs lakosa (kztk szmos szamaritnus") maradt szlfldjn, s
rizte meg egyrtelm kapcsolatt az si kirlysggal. De vannak kztk,
akiket ksbb megtagadtak az gret Fldjre visszatr szmztt zsidk.
A bibliai prfcia szerint a Messis csak akkor jhet el, ha mr teljes a
diaszpra - a zsidk sztszrdtak az egsz Fldn. Rszben a ltoms be
teljestsnek remnye vezetett a modern Izrael ltrejtthez, s meglep
mdon trsadalmi vltozsokat idzett el a vilg ms rszeiben is. Egy iz
raeli politikai csoport nyltan hangoztatja politikjnak bibliai alapjait: az
agudah vallsi prt szerint a vilgot Izraelrt teremtettk. . . a vilg ltnek
rtelme nem ms, mint hogy a Tra megszlessen Izrael fldjn".
Az lom nha ott bukkan fel, ahol a legkevsb vrnnk. A brit munks
prt kongresszusn minden vben ktelez jelleggel s kiss szgyenlsen
elneklik a Vrs zszl" -t, aztn jval lelkesebben rzendtenek a Jeru
zslem" cm himnuszra. William Blake szvege csodlatos; minden brit
gyerek emlkszik az aranynylra" mg az iskolbl. Jeruzslem, amelyet
Blake ltott flllni a zld s nyjas Anglin", a himnuszt neklk szemben
az j trsadalom jelkpe, amely a rginek a hamvaibl tmad egy napon.
Csakhogy Blake ezeket a szavakat nem pldabeszdnek sznta, hanem
egyszer tnymegllaptsnak. Sok kortrshoz hasonlan is gy vlte,
hogy Britannia az a Jeruzslem, ahol a vlasztottak majd sszesereglenek
Jzus msodik eljvetelekor. A britek (az igazhvk szerint Brit-Ish, vagyis
a Szvetsg Emberei) nemes faj, Izrael egyik eltnt trzsnek maradvnya.
Hossz s meglehetsen olvashatatlan Jeruzslem, az ris Albion eman
cija cm versben Blake gondosan megrajzolt szellemi trkpet ad Bri
tannirl mint az gret Fldjrl. Bizonyos rszei valszntlenl hangza
nak- Islington s Marybone mezeje, / Kankalindomb, Szentjnoserdeje !
Arany oszlopokkal plt tele, / Itt llt Jeruzslem oszlopserege' - de a
mondanival egyrtelm. Britannia azrt hatalmas, mert Isten kivlasz
totta: sorsa eleve elrendeltetett. Amikor a vilg nagy rszt uralma al hajt
ja, csak beteljesti a prfcit. A ti seitek szrmazsukat brahmtl
Hbertl, Smtl s Notl vezetik le, akik druidk voltak: miknt azt a
druida templomok (vagyis patriarchlis oszlopok s tlgyligetek) tanst
jk az egsz Fldn mind a mai napig" - szl a zsidkhoz a klt.

* Weres Sndor fordtsa (William Blake: Versek s prfcik; Eurpa Knyvkiad, Buda
pest, 1959)

135
A VRNKBEN VAN

A gondolat, hogy Britannia maga Izrael, egytt tereblyesedett a biroda


lommal. 1878-ban megalakult a Fvrosi Angol-Izraeli Trsasg, melynek
elnksgi tagja volt Rangoon pspke is. A trsasg vi kzgylsein az
1930-as vekben mr hszezer ember vett rszt, kztk sok arisztokrata.
A tagnvsorban kt hercegn, egy mrkin, kt grf, hrom br, tizenh
rom brn, kilenc baronet s szmtalan lovag, admirlis s tbornok sze
repel. Mindannyian szentl hittk, hogy a britek az egyik elveszett trzs,
mely arra rendeltetett, hogy uralma al hajtsa a vilgot.
Dr. Price, William Blake s a brit izraelitk rgi hagyomnyt kvettek:
korbban is sok trtnet jrta, hogy bibliai alakok fordultak meg a Brit
szigeteken. Glastonburyben Arimateai Jzsef ltette el a szent csipkebok
rot; az angol kirlyok koronzsi trnja alatt rztt Scone-k hajdan J
zsef prnja volt Bethelben (Beth-El) . Ksbb Egyiptomba kerlt, Izrael
gyermekei Antrimba vittk, tjutott a skciai Scone-ba, innen vitte Lon
donba i291-ben I. Edward. Az 1950-es vekben rvid s dicstelen ltogatst
tett ismt Skciban: ellopta egy csapat skt nacionalista, hogy politikai
szenzcit keltsen.
Az elveszett trzsek trtnethez fzdik a zsidk angliai visszatrse is.
Kt vszzaddal Blake eltt az angol puritnok szentl hittk, hogy ksz
bn ll Jzus msodik eljvetele. gy gondoltk, csak akkor trtnhet
meg, ha a zsidk visszajutnak szlfldjkre, amint a Biblia jvendli.
A puritnok tlk telhetleg testamentumi letet ltek. A Chauncy csa
ld Izsknak, Ishabdnak, Srnak, Barnabsnak, Ntnielnek s Izrelnek
keresztelte gyermekeit. Thomas Tamy kinyilatkoztatst kapott, hogy
Rben trzsbl val zsid". Komolyan vette. Krlmetltette magt, az
tn elbb Anglia, majd Rma trnjt kvetelte. Mivel egyiket sem kapta
meg, botrnyos jelenetet rendezett a parlament alshzban. Az utols r
la szl feljegyzsek szerint Szent hborra fel!" kiltssal egy maga k
sztette csnakban elhajzott a La Manche csatornn.
1650-ben Menasseh ben Israel Spes Israeli cm rpiratban azt krte,
hogy a ngyszz vvel korbban elztt zsidsgot engedjk vissza Angli
ba, mert csak gy lesz teljes a diaszpra - Izrael npnek sztszratsa -,
mire a Messis megjelenik. A Biblia szerint az r sztszr titeket minden
npek kztt a vilg egyik vgtl a msikig". Manasseh vlekedse szerint
e sziget a vilg vgnek tekinthet".

TLOLDALT: Egy oldal William Blake 1804 s 1820 kztt keletkezett Jeruzslem, az ris Al
bion emancija cm munkjbl. Az ris Albion komoran mereng a tenger fltt Jeruzs
lemrl, az elveszett trzsekrl s a druidk templomairl.

.....
136
'

1 37
A VRNKBEN VAN

1941-ben kiadott prfcia.


A mltbeli ngy vilg
birodalom s az tdik
(elpusztthatatlan)
Sziklabirodalom, ahogyan
a brit izraelitk elkpzeltk.

Ez lzba hozta az angol millenriusokat. A Dl-Amerikt megjrt uta


zk arrl szmoltak be, hogy a napgette br indinok zsid szertart
sokat znek, valsznleg Rben elveszett trzsnek leszrmazottai. Csak
Angliban nem voltak zsidk: ezen vltoztatni kellett, hogy az rs szerint
a Messis eljhessen. Az llamtancs meghvta Londonba az Amszter
damban l Menasseht, de a ltogatsra nem kerlt sor, mert Anglia s
Hollandia hadban llt. Cromwell azonban nem hagyott fel az elkpzels
sel, gy megkezddtt a zsidk visszateleplse, amely heves vitt vltott
ki. Az a hr jrta, hogy meg akarjk vsrolni a Szt. Pl-szkesegyhzat, st
mg a Bodleian Knyvtrt is; taln maga Cromwell is zsid. Mgis enge
dlyt kaptak a visszatrsre. Elszr csak azok a zsidk vettk ignybe az
j lehetsget, akik titokban addig is Angliban ltek, de hitket csak
most mertk megvallani; nemsokra azonban msok is rkeztek a tenge
ren tlrl.
AZ ELVESZETT TRZSEK

Az igazhvk - kztk William Blake - nem rtk be a diaszpra kitelje


stsvel. Mindenron keresztny hitre akartk trteni a zsidkat s az
esetleg mg meglv elveszett trzseket. Ktszz vig fradoztak rajta.
Lord Shaftesbury tizenkilencedik szzadi miniszterelnk zsajs prfci
jnak beteljeslseknt" dvzlte, hogy Jeruzslem anglikn pspke
egy kikeresztelkedett zsid lett (jllehet gylekezete mindssze nyolc t
trt hvbl llt). Prtfogolta a zsid haza gondolatt: A nemzetnek szk
sge van hazra. Az si Fld, az si Np. Nem mestersges ksrlet ez, ha
nem maga a termszet, maga a trtnelem." Egy bizonyos Kitchener f
hadnagy ( a ksbbi omdurmani hs) elksztette Palesztina trkpt, s
mint vrhat volt, bejellte rajta a trzsek terlett.
felsge kormnya tmogatja a zsid np hazjnak magalaptst
Palesztinban" - szgezte le az i917-es balfouri nyilatkozat. lgy szletett
meg a mai Izrael gondolata, melynek egyik gykere az volt, hogy az ango
lokat mindig is foglalkoztatta a Szentfld. A most szban forg helynevek
sokkal ismersebbek, mint a nyugati frontiak, jegyezte meg Lloyd George,
amikor i914-ben tallkozott Chaim Weizmann-nal, hogy Palesztinrl tr
gyaljanak. Az els vilghbor befejezsvel alakult ki a relis lehetsg a
szlfldre val visszatrs jslatnak beteljestsre. s a msodik vilg
hbor katasztrfi vezettek vgl Izrael llam megalaptshoz.
1950-ben szvegeztk meg a Visszatrsi Trvnyt, amely hivatalosan
kinyilvntja a kzs rksgen alapul izraeli nemzet ltezst. Egyrtel
men leszgezi: minden zsidnak joga van hozz, hogy letelepedjen Iz
raelben. 1952-ben kiszlestettk a trvny rvnyessgi terlett, s enge
dlyeztk, hogy annak, akinek egyetlen zsid nagyszlje van, mg a h
zastrsa is llampolgrsgot kapjon. Annak a meghatrozsra, hogy mit
rtenek zsid alatt, csak az 1970-es trvnymdosts sorn trtnt ksr
let. Az a szemly, aki zsid anytl szletett, vagy ttrt a judaizmusra s
nem tagja ms egyhznak." De mg mindig maradt egy tisztzatlan kr
ds. Mi a zsid anya meghatrozsa?
Izrael az egyetlen orszg a vilgon, amely minden bevndorlt szvesen
lt korra, egszsgi llapotra, vagyoni helyzetre vagy politikai meggy
zdsre val tekintet nlkl, ha szrmazsa jogn odatartozik. Tbb min't
ktmilli ember znltt az orszgba a Visszatrsi Trvny rtelmben.
Csakhogy tbb krds is felvetdik. Mi a dnt szempont, ha valaki l
lampolgrsgrt folyamodik? Elgsgesek a zsid gnek? Szmtanak
egyltaln? Taln a valls a fontos. Esetleg a kett egytt. Izrael megtestes
ti mindazokat a gondokat, melyek a biolgia s a hit tkzsbl erednek.
Vannak bevndorlk, akik megkaptk az llampolgrsgot, holott nincs

13 9
A VRNKBEN VAN

1909-ben megalaptjk Tel-Avivot (a Forrs hegyt) egy homokdombon az akkor mg arab


Yafo vrostl szakra; a beteljeslt lom az lgret Fldjre val visszatrsrl.

vr szerinti kapcsolatuk az gret Fldjvel. Pldul egy csoport fekete


amerikai, akik vallsos zsidkknt lnek Tel-Avivban. Msok - az i985 ta
bevndorolt orosz zsidk kzl taln szzezer is - zsid szrmazsnak
valljk magukat (gyakran bizonytk nlkl), de vallsi ktdsk nincs.
Mg mindig sokan szeretnnek Izraelbe teleplni. Ignyket meglehet
sen sovny bizonytkok alapjn a szrmazsra, a vallsra vagy mindkett
re alapozzk.
A DNS-en kvl mindenki rkl egy kultrt, egy kzs trtnelmet
is: legfkppen a zsidsg esetben, hiszen a sztszrt np nazonossg
nak egyetlen ismrve a rendthetetlen ragaszkods volt a kzs letform
hoz. A mai Izrael - s azok, akik szeretnnek oda visszatrni - minden
msnl vilgosabban mutatja a szrmazson alapul trsadalom probl
mit. Vajon a beteleplknek a trzsekig, a Jdeai kirlysgig kell vissza
vezetnik szrmazsukat, vagy elg egy ksbbi s? Fontos-e egyltaln a
szrmazs?
Hov mentek az elveszett trzsek az asszrok gyzelme utn, s hol le
hetnek most? Kezdetben szmzetsben ltek a Szambation folyn tl:
Hses kilencedik vben Asszria kirlya elfoglalta Szamarit, elhurcolta
Izrael npt Asszriba, s Halahba vitte ket s a Haboron, Gozan folyjn
Medesz vrosba"; ezek a helyek a mai Szria s Irak terletn vannak.
Magt a folyt knnyen fel kellene ismernnk. Az idsebb Plinius sze
rint szombaton megpihent. A Trzsek azrt nem tudtak tgzolni rajta,

140
A GENETIKAI BETEGSG:
VLETLEN VAGY SZKSGSZER?

Minden npcsoportnak megvannak a jellegzetes ben a csoportban. Nhnyan arra kvetkeztetnek


rkltt betegsgei (br akadnak rkletes krok belle, hogy a betegsgekrt felels gnek egyetlen
- pldul a ciszts fibrzis -, amelyek klnbz pldnynak hordozi valamilyen elnyt lveznek.
helyeken l emberek milliit rintik). Semmi kt Valamifle intellektulis (s szaporodsi) flnyhez
sg, ezek a betegsgek nha mutci rvn jnnek jutnak azokkal szemben, akik a normlis gn kt
ltre, aztn eltnnek. Vagy azonnal elpuszttanak pldnyt hordozzk, hisz a kzssgen bell nagy
mindenkit, aki rkli ket (mint szmos uralkod szerepe van a tanulsnak, s igen nagy tisztelet ve
gn esetben), vagy soknemzedknyi lappang r zi azokat, akik hajlandk letket a valls tanulm
talmatlan rejtzs utn a gn kt pldnya tallko nyozsnak szentelni. Mrpedig akkor nagy az es
zik, s slyos krosodst okoz egy utdban. Ilyen lye a srlt gn elterjedsnek, s ez idvel geneti
kor a gn gyakorisga csak a mutci keletkezs kailag krosodott gyerekek szletshez vezet.
nek s az rkl egyedek halla rvn trtn elt Mi tagads, ez mer spekulci. De tkrzi a
nsnek egyenslytl fgg. Szmos ritka betegsg humngenetiknak azt a felttelezst, hogy sok
esetn valsznleg ez a helyzet. mai rkltt betegsgnek taln ellenslyoz szere
Bizonyos genetikai betegsgek azonban olyan pe van. Akik az sidkben a ciszts fibrzis gnj
gyakoriak, hogy feltehetleg valamilyen okbl nek egyetlen pldnyt hordoztk, ellenllbbak
megrzdnek a npessgben. Ennek a hres pld lehettek a kolerval szemben, azok pedig, akikben
ja, hogy akik a vr festkanyagban - a hemoglo megvannak a cukorbetegsgre hajlamoss tev g
binban - bizonyos vltozatoknak (pldul a sar nek, knnyebben elviselik az hezst a szklkd
lsejtes" gnnek) egyetlen pldnyt hordozzk, trsadalmakban. Egyelre mindez nagyrszt felte
ellenllk a malrival szemben; azok pedig, akik vs, de ha megerstst nyer, taln megvltoztatja
kt pldnyt hordoznak belle, slyos betegek. legalbb az evolcis biolgival foglalkoz kuta
Nehz ellenllni a ksrtsnek, hogy bizonyos be tk felfogst az rkltt betegsgekrl.
tegsgek helyi gcait ilyen mechanizmusoknak tu
lajdontsuk, s ne a termszet vletlen jtknak,
]osefEkstein rabbi, az egyik askenzi, aki csak akkor
ami sokszor egy adott betegsg kutatinak a vgy
szerzett tudomst sajt genetikai llapotrl, mikor
lma. Nha azonban a megbetegedsek elfordu
gyermeke rkltt betegsggel, Tay-Sachs-krral sz
lsa arra utal, hogy a folyamatban a genetikai hi
letett.
bk megjelensnek s kikszblsnek egyens
lyn kvl valami ms is szerephez jut.
Az askenzi zsidk kzt viszonylag gyakori n
hny rkltt betegsg. A Tay-Sachs-kr mellett
- amely tbbek kztt Ekstein rabbinak (a Dor
Yeshorim mozgalom megalaptjnak) a csaldj
ban fordult el - ilyen a Gaucher-szindrma, a
Niemann-Pick-kr s az idegszvet fejldsvel
kapcsolatos nhny egyb betegsg. A DNS vizsg
lata sorn gyakran kiderl, hogy csak egyszer vagy
kevs esetben keletkezett mutci, de azta elg
gyakori az askenzik kztt.
Taln nem puszta vletlen az agyi s idegrend
szeri betegsgek ltszlagos szokatlan srsge eb-
A VRNKBEN VAN

hogy visszajussanak Izraelbe, mert a ht hat napjn nem lehetett tkelni a


sebes folys vzen, az nnepnapon pedig a zsidk nem utazhattak. Egyes
vltozatokban a foly nem is vizet, hanem homokot s kveket sodort. Egy
Indiba tart zsid utaz beszmolt rla, hogy ktnapi jrfldre is hallot
ta morajt. Huszonht kilomter szles volt, s hzmagassgba rptette
fl a sziklkat. Ha homokjt vegbe zrjk, htkznapokon kavarog,
szombaton pedig lelepszik, rta.
De hiba az tbaigazts, a Szambationt s a rajta tl elterl fldet
nem sikerlt azonostani. Szriban vagy Irakban ma semmi nyoma az el
veszett trzseknek. Minden jel szerint tovbbvndoroltak. Mivel a bibliai
prfcia nem teljeslhet be, amg a trzsek nem egyeslnek ismt, az rs
bet szerinti rtelmezi elszeretettel ismertek rjuk mindentt: Jzsef
fiai jra s jra megjelentek, amikor csak szksg volt rjuk. Az l-Messi
s, Sabbetai Zevi idejn az a hr jrta, hogy a trzsek elrenyomulnak,
elbb megverekszenek a trkkel, aztn Eurpra trnek. A szbeszd
hatsra i665-ben a tuniszi mohamednok lemondtk a mekkai zarn
doklatot.
Sokan szeretnnek a Visszatrsi Trvny rtelmben Izraelbe telepl
ni. A szmztt trzsek legendjbl mertenek biztatst; ignyjogosult
nak valljk magukat, mert lltlag az eltnt sk leszrmazottai. Vannak
kztk csoportok Afrikbl, Eurpbl, zsibl s az jvilgbl. A v
lasztott np hatsos eszmjre olyanok is hivatkoztak, akiknek - a jelek
szerint - vitathat a kapcsolatuk az si izraeli kirlysggal. Nhnyan k
zlk letelepedtek Izraelben, s vallsos zsidknt lnek. Sokan csodljk
hitbuzgalmukat, de msok nem nzik j szemmel, hogy azok is polgrjo
got kapnak, akiknek nyilvnvalan kevs kzk van a szlfldhz. k a
genetikai s szellemi rokonsg szorosabb egysgt kvetelik. Az elveszett
trzsek - legalbbis kpletesen - ma is ksrtenek a fldn, amelyrl elz
tk ket.
Tbbek kztt Izrael msodik elnke, Yitzhak Ben-Zvi is igyekezett fel
kutatni a bibliai szmzttek ma l leszrmazottait. Akadnak komolyta
lan letelepedsi ignyek. Az 1990-es vek egyik bevndorlsi minisztere,
amikor a legenda indiai hvinek szervezete, a Bene Israel azzal fordult
hozz, hogy trsaiknak joguk van bevndorolni Izraelbe, mert Manasse
trzsnek leszrmazottai, azt vlaszolta, hogy jhetnek, de csak ha a Messi
s is megjelenik a fogadsukra.
A mai patanok az egyik trzs leszrmazottainak valljk magukat, sz
mos afgnhoz s burmaihoz hasonlan. Az eszme mg a japnok kzt is
szerzett hveket, akik lltjk magukrl, hogy Zebulon trzsnek utdai.
AZ ELVESZETT TRZSEK

Akik a hbor utn szeret


tek volna visszatrni Izrael
be, rthet mdon ignybe
vettk a propagandt is.
A nmetorszgi tborokbl
meneklt zsidkkal megra
kott Exodus (egy hajdani
amerikai folyami haj) a ha
tsgi tilalom ellenre Pa
lesztinba indult. A cionis
tknak gondjuk volt r,
hogy a rdi kzvettse a
meglltsra rkez angol
tengerszek tmadst.
A hajnak vissza kellett tr
nie egy francia kiktbe, de
a ngyezer-tszz zsid utas
nem volt hajland partra
szllni - ott maradtak az
sz Auschwitz" fedlze
tn. Miutn a cionista terro
ristk kt angol rmestert
flakasztottak (s holttest
ket robbantltettel aggat
tk tele), az angolok ervel
beraktk a meneklteket a
Nmetorszgba visszaindu
l szlltmnyokba. Az ezzel
jr propagandaveresgnek
is rsze volt abban, hogy
Anglia beltta: fl kell adnia
Izraelben vllalt szerept.

Nhny zsid a nci idkben az elnyoms ell Japnba meneklt, ahol sz


'
vesen lttk ket, br ldzikkel politikai szvetsgben voltak. A makujo
szekta ma is hirdeti a judaizmussal val kapcsolatt. A sinto szentlyek
(pldul a mijadzsimai) szerintk valsznleg a jeruzslemi Msodik
Szently msai. A leghresebbiken, az Isze-szentlyen ott a Dvid-csillag,
vagy legalbbis egy hozz meglepen hasonl jel. St a japn kirlyi jelv
nyek kzt, amelyeket a klvilg sose lt, lltlag van egy tkr, amelybe a
Jehova szt vstk.

143
AZ ELVESZETT TRZSEK

JOBBRA: A tizenhatodik szzadi trkp


feltnteti a Vrs-tengert, a Nlust s
Jnos pap orszgt is, amely lltlag
Izrael egyik elveszett trzsnek hazja volt.

TLOLDALT: Izrael trzsei a Stortemplom


krl tboroznak a sivatagban. Metszet
egy latin biblibl, Genf, 1557.

Klnsen hatsos az a trtnet, mely az elveszett trzseket kapcsolatba


hozza Jnos pap orszgval, amely lltlag egy afrikai kirlysg, az arany
ban mrhetetlenl gazdag Ofir bibliai fldje volt. n, Jose da Silvestra, h
sgtl haldokolva rom e sorokat az rnak 1590-ik esztendejben knt
sm rongyaira egy csontszilnkkal s vrem tintjval, a tenyrnyi, htl
vdett barlangban a legdlibb hegyen azok kzt, melyeket n Sba kebl
nek neveztem, a mellbimb szaki oldaln. Sajt szememmel lttam he
gyekben llni a szmllhatatlan gymntot Salamon kincseskamrjban, a
Fehr Hall mgtt . . . " - olvassuk egy kzpszer regny nagyszer be
kezdsben. Rider Haggard igen jl ismerte olvasi hitvilgt, amikor
1885-ben megrta Kelet-Afrika hegyei kzt jtszd regnyt, a Salamon '
kirly kincst.
Knyvben transvaali gyarmati tisztviselknt szerzett tapasztalataira
tmaszkodott. A cselekmnyt egy alig pr vvel korbbi klns rgszeti
lelet sugallta. Akkor fedeztk fel a ksbbi Rhodesiban telepesek elkpe
dsre - akik ehhez foghatt mg sose lttak Afrikban - egy elhagyott v
ros, Nagy-Zimbabwe romjait.

145
A VRNKBEN VAN

Az satsok terlete Nagy-Zimbabwban, a Hill Fort alatti sksgon. Fallal krlvett vros,
palota, szently vagy rabszolgatbor; hogy milyen clt szolglt az ptmny, valjban senki
sem tudja.

Cecil Rhodes azonnal tudta, kik ptettk - nem afrikaiak, az biz


tos. Zimbabye si fnciai telepls - rta -, s minden jel arra mutat,
hogy innen szrmazik Hiram aranya; a bibliai peacock [pva] sz ol
vashat parrots-nak [papagj] is, s Zimbabye kdsztmnyei kztt
vannak zld papagjok, melyek arrafel gyakoriak; s temrdek az arany
meg elefntcsont, tovbb Zimbabye egybertt kvekbl, malter nlkl
plt."
Rhodes egyszeren nem hitte el, hogy az afrikaiak segtsg nlkl ilyen
pomps ptmnyt tudtak ltrehozni. A:z testamentumban kereste a zse
nilis kalandorokat, akik a hatalmas vrost ptettk. A tizenkilencedik
szzadban megkezddtek az satsok. Sok krt okoztak, mert eltvoltot
tk a bennszltt" munkt, hogy felkutassk a smita alapokat, de hiba.
Ezt a megszentsgtelentst korszer memlkvdelmi eljrsnak" ne
veztk, amely eltvoltja a kaffer megszlls szennyt s gyalzatt".
A:z aranytrgyak nagy rszt beolvasztottk, hisz csak afrikaiak voltak.
Nhny cdrusforgcs nagy rdekldst vltott ki, mert lehetsgesnek tar
tottk, hogy Salamon szentlynek maradvnya.
A modern kutats, tbbek kztt a cdrusforgcsok" sznizotpos
kormeghatrozsa Nagy-Zimbabwe esetben a tizenharmadik szzadra
AZ ELVESZETT TRZSEK

utal. i450 tjn nptelenedett el ismeretlen okokbl. Mwene Mutapa - a


Nagy Fosztogat - birodalmnak kzpontja volt, mg Knval is kereske
dett. Az elveszett trzsek nem hozhatk vele kapcsolatba.
Rhodes utda, Ian Smith szerint a vrost nem pthette ms, csak egy
kihalt fehr br np. Kormnyzata megakadlyozta egy tiknyv kiad
st, amely clozni mert egybre. Van abban nmi irnia, hogy a Smith
kormny s a fehr kisebbsgi uralom buksakor az orszg nevt Rhodesi
rl Zimbabwra vltoztattk.
A mtosz hatsa elevenen l ma is, de most nem eurpai, hanem egy af
rikai np vallja magnak. A Dl-Afrika szaki partjain s Zimbabwe dli
rszn sztszrva l lembk azt lltjk, hogy k ptettk Nagy-Zimbab
wt. Van mg egy, ltszlag kevsb valszn hiedelmk: k Izrael egyik
trzse. A monda szerint Szena elveszett vrosbl jttek, s tvndoroltak
Afrikn, hogy j vrost ptsenek. tkzben egy hatalmas fadobot kvet
tek - taln magt a frigyldt. Mivel megszegtk Isten trvnyt s tisztta
lan teleket ettek, el kellett hagyniuk vrosukat, azta a zsidkhoz hason
lan sztszrtan lnek olyan npek krben, melyek hitkben nem osztoz
nak. A dl-afrikai trtnelem kezdetn Kruger elnk zsidinak neveztk
ket. Az els zsid, aki henteszletet nyitott szak-Transvaalban, csak
lemba mszrosokat alkalmazott - meglehet, ez is szrmazsukat s hith
sgket bizonytja.
Hitknek ma ktsgtelenl vannak zsid elemei. Nem esznek diszn
hst (innen a nevk: az elutasts npe"), krlmetlkednek, s gyakori
ak nluk a bibliai nevek, mint pldul a Salamon. lltlag van egy titkos
nyelvk, a hiberu. Minden otthonban ott a Dvid-csillag s Jda elefnt
ja". Szena fiaitl szrmaztatjk magukat, akiket az testamentum a Babi
lonbl visszatrt zsidk kztt nevez meg. Ktsgtelen, hogy Jemenben
van egy San' a nev vros, ahov sok zsidt szmztek, s amelynek neve a
lembk szerint feltnen hasonlt si otthonukhoz.
Az amerikai kontinens szolgltatta a legfantasztikusabb szereplket a
legendhoz. Az indinok megmeneklsket ksznhetik annak, hogy l
ltlag az egyik elveszett trzs utdai. Dl-Amerika felfedezse utn vita
folyt arrl, vajon emberi lnyek-e, vagy le lehet ldsni ket, mint a vada
kat. Csak az mentette meg ket a teljes kiirtstl, hogy Rben trzsnek
leszrmazottait vltk felfedezni bennk. De hogyan juthatott oda egy no
md csapat a Kzp-Keletrl ktezer vvel Kolumbusz eltt? Hogyan hi
hette el brki ezt a kptelensget? Az elveszett trzsek legendja mgis l s
hat az Egyeslt llamokban. Szmos amerikai kitartott mellette a jzan
sz vgs hatrig - vagy mg azon is tl.

147
A VRNKBEN VAN

Az i930-as vekbl val rhodesiai


idegenforgalmi plakton Sba
kirlynjnek szelleme lp el
a titokzatos nagy-zimbabwei
ktoronybl, s egy afrikai bennszltt
hdolattal adzik a hatalmas memlk
fehr br ptinek.

A gondolat trtnelmk kezdetig megy vissza. 1837-ben Mordechai


Manuel Noah kzreadta Az amerikai indinok Izrael Elveszett Trzseitl
val szrmazsnak tanbizonysgai cm munkjt. A szerz Arart n
ven zsid llamot akart alaptani New York llamban, Buffalo kzelben.
llambl semmi sem lett, mgis millik lett befolysolja az eszme,
hogy Armageddon szmztteinek tja Amerikba vezetett. Hisz ez volt
Joseph Smith ltomsnak s Maroni angyal kinyilatkoztatsnak lnyege.
Nefi knyve szerint egy vszzadnyi rabsg utn a tz trzs szakra me
neklt. tkeltek Asrareth ismeretlen vidkn, s tbb senki sem hallott
rluk. Jelenlegi tartzkodsi helykrl szmos elmlet szletett, nmelyik
nek nem sok kze van a valsghoz. Taln egy msik bolygn vannak
(mint Enoch vrosa, amely az gbe ragadtatott, vagyis elvitetett e fld
rl. . . s most az rnek valamely . . . eleddig fel nem trt . . . rszben vagy
helyn vrakozik az id eljvetelre . "). Philo Dibble megrizte Joseph
Smith prfta 1842-ben kszlt rajzt, melyen a Fldet keskeny tjr kti
ssze egy msik gmbbel, a trzsek otthonval. Az mr valamivel hihetbb
elkpzels, hogy a fld reges, s mlyben rejtznek a trzsek. Ez az elm-
AZ ELVESZETT TRZSEK

let a tizenkilencedik szzad elejn nagy npszersgnek rvendett, egy bi


zonyos Symmes szzados anyagi tmogatst is krt - br eredmnytelenl
- a kongresszustl s Oroszorszg kormnytl a bejrat felkutatshoz.
Ms mormonok hite szerint a trzsek sztszrattak a Fld npei kzt,
csak identitsuk veszett el, helyk megtallhat. Efraim fiai vadak s m
veletlenek, zaboltlanok s fegyelmezhetetlenek. Szilaj s elsznt llek la
kozik bennk; k az angolszsz faj" - vlte Brigham Young. A Saxon", az
az szsz" gyansan hasonlt az Isaacsonhoz, vagyis Izsk fihoz, s Young
jvoltbl szmos mormon Efraim trzshez tartoznak vallja magt. De
akrhol legyenek is a trzsek, Jzus msodik eljvetelekor visszatrnek a
Missouri llambeli Jackson megyben felptend j-Jeruzslembe.
A mormon egyhz abban a remnyben tanulmnyozza az aztkok s ma
jk memlkeit, hogy sikerl sszefggsbe hoznia ket lltlagos ptik
kel, a zsid npekkel. Jeruzslemben az egyhz fenntart egy Kzel-keleti Ku-

Nagy-Zimbabwe ma: a mtosz


tdolgozott kiadsa. Kt lemba reg,
M. Mathiva professzor s a hber
imaslas William Masala, mani
tiszteletes a nagy-zimbabwei satsok
terletn a Torony eltt, amely
szerintk lemba seik zsid hitnek
ldozati oltra volt.

1 49
A VRNKBEN VAN

tatkzpontot, ahol az sidk vilgnak npei s a mai mormonok kapcso


latait vizsglja. Mivel ez alapot szolgltathat a zsidk ttrtsre, az ortodox
zsidk felhborodsukban tntetseket szerveztek. A mormonok csak azzal
a felttellel maradhattak Jeruzslemben, hogy kerlnek minden vallsi vitt.
Az sk felkutatsa sokflekppen trtnhet. A mormonok felismertk,
hogy az anyaknyvek nha sszekthetik a ma l embert htott mltj
val. A gnek viszont ennl tbbre kpesek: rejtett kapcsolatokat hozhatnak
felsznre a mai npek - tbbek kztt a magukat zsidnak vall npek-,
valamint a rgi trzsek s hazk kztt. A zsidkat - akik mind kzs
sktl szrmaztatjk magukat - klnsen rdekli a csaldfjuk.
Van, akinek viszonylag knny a dolga. A rabbicsaldokban pldul
mindig gondosan szmon tartottk, hogyan kvette egyik rabbi a msikat.
Sok leszrmazsi g egyetlen szemlyhez megy vissza: Shelomoh ben
Yishaq rabbihoz (kzismerten Rashi), aki Troyes-ban szletett a tizen
egyedik szzadban. A krnika arrl is beszmol, hogy Rashi az si Izrael
bl szrmazik, gy utdai mind elmondhatjk magukrl, hogy Jkob fiai
nak egyenes gi leszrmazottai. Vannak Izraelben msok is, pldul a sza
maritnusok, akik bszkk si csaldfjukra, s knnyszerrel el tudnak
szmllni tucatnyi nemzedket. A legtbb zsid azonban hiba kutat az
anyaknyvekben, nem tall kapcsolatot a trzsekkel. Szerencsre a gnek
rajtuk is segtenek.
Az askenzik (akiktl az eurpai s amerikai zsidk nagy rsze szrma
zik) a kilencedik szzadban vndoroltak keletrl a Rajna-vidkre s onnan
Nmetorszg tbbi rszbe, Kelet-Eurpba, Ukrajnba s Oroszorszgba.
Tizenegymilli leszrmazottjuk csaldtrtnett szinte lehetetlen felkutat
ni, hisz legtbbjknek volt annyi esze, hogy ne anyaknyveztesse magt az
llammal, amely valsznleg ellene hasznlta volna fel az adatokat.
A kzpkori Eurpban az askenzik apjuk nevt vettk fel, mint a bib
liai idkben. A vezetkneveket (teht azokat, melyek a csaldhoz fzd
nek, nem az egynhez) csak a tizennyolcadik szzadtl hasznltk. Len
gyelorszgban csupn i844 utn. Teht a sok milli lengyel szrmazs zsi
d a dokumentumok alapjn msfl vszzadra tudja visszavezetni trt
nelmt. A nevk attl fggtt, mit tudott megfizetni a csald. A gazdagok
virg- vagy drgaknevet vsroltak (Rosenthal vagy Goldstein) , a kevsb
gazdagok aclt (Stahl) vagy vasat (Eisen). A legszegnyebbek gnyneveket
kaptak, mint Ochsenschwanz ( krfarok) vagy Wanzenknicker (Poloska
nyv) . Voltak az elveszett trzsekre utal nevek is. Naftalit a legenda
szarvassal trstja; innen a Hirsch, Herz}, Hertz, Herzog s Harz (amelybl
ksbb gyakran Harris lett) .

.,

150
AZ ELVESZETT TRZSEK

C F H A R z 0 G A E


TORZIS DISZTNIA

B D H A R z 0 G B e


TORZIS DISZTNIA

C B H R s e H A B

+-i--+---+--t----10 1 1
NORMLIS GN

Kt, torzis disztniban szenved beteg DNS-vezetkneve (vagy halotpija"), s egyikk


egszsges hzastrs. Magt a gnt kr brzolja (a mutnst fekete, a normlist fehr); a tz
vltoz helybl ll sort fggleges vonalak jelzik a DNS-lncon. Az adott esetben elfordu
l DNS-vltozat egy bett kapott (itt gy vlasztottk meg ket, hogy tnyleges vezetknevet
adjanak ki). A srlt gn kzelben mindegyik torzis disztniban szenved betegben olyan
egyforma DNS-vltozat-szakasz tallhat, amely klnbzik az egszsges szemlyektl.
Vagyis ennek a genetikai vezetknvnek" nem volt ideje felbomlani az egymst kvet nem
zedkek sorn, teht a mutci viszonylag rvid idvel ezeltt jtt ltre.

Csakhogy az askenziknak van egy msik nyilvntartsa is, melyet mind


gyakrabban vesznek ignybe a rokonaikat keres zsidk. Egyes gnjeik
ms npeknl szinte ismeretlenek, s ezek alapjn nyomon kvethet vn
dorlsuk a vilgon keresztl. Krlbell minden ngyezredik askenzinak
van egy torzis disztnia nev genetikus betegsge, amely fkezhetetlen
vonagl mozgst okoz. Elfordul, hogy nincs lthat jele, olykor enyhe'a
mozgs, alig szrevehet. De nhny beteg nyomork lesz tle.
A genetikai srls minden hordoznl azonos, s a DNS-nek ugyan
azon a helyn tallhat. Ez arra utal, hogy a mutci egyetlen forrsbl
szrmazik, mint az elz fejezetben trgyalt finn betegsgeknl. Csak
egyetlenegyszer alakult ki, teht aki ma ebben a betegsgben szenved, az
mind rokona egymsnak. Kzs szrmazsrl tanskodik a gn krli

151
A VRNKBEN VAN

DNS is, mert nem bomlott meg rekombinci rvn. Tegyk fel, hogy a
gn egy vezetknv egyik betje - pldul a". A mutci mondjuk a" -rl
e" -re vltoztatja. A teljes genetikai vezetknv" megfelel a DNS-betk
sornak a gn kt oldaln. A DNS-be rt vezetknv minden torzis diszt
nis betegnl ugyanaz. Ez is jelzi, hogy egyetlen szemlytl szrmaznak.
Minden utdban vltozatlanul maradt fenn a mutcis gn s a krltte
lv DNS-szakasz egyarnt.
A kzs vezetknvbl" azt is meg lehet llaptani, mikor jtt ltre va
ljban a mutci. Ez ugyanis a hm ivarsejt s a petesejt kpzdsekor a
genetikai rekombinci sorn alakulhatott ki. Az igazi nevek betitl elt
ren a genetikai zenet beti minden nemzedkben trendezdnek. Mi
nl tvolabb vannak egymstl a kromoszmn, annl messzebbre sod
rdnak. Kt egymstl tvol lv DNS-bet a gyerekekben sokszor szlei
ktl eltr elrendezdsben rkldik. Ahogy egy nemzedk - jra ke
vert krtyk mdjra - kveti az elzt, egyre nagyobb a valsznsge,
hogy felbomlik az eredeti sorrend.
A torzis disztnia mutcija vltozatlan formban illeszkedik egy
hossz DNS-varins sorozatba, teht olyan kevs nemzedk volt kzben,
hogy az eredeti sorrendnek nem volt ideje felbomlani. A tvolsg a gn s a
mellette lv DNS-vltozatok kzt - a vezetknv hossza - s az trende
zds sebessge egyarnt ismert. Egyszeren kiszmthat, hogy a torzis
disztnia mutcija mindssze tucatnyi emberltvel ezeltt jtt ltre. Ha
rgebbi, a sor mr felbomlott volna a rekombinci rvn.
Vagyis keletkezsnek idpontja krlbell 1650-re tehet. Akkor mint
egy szzezer askenzi lt Eurpban. A pogromok megtizedeltk ket:
Lengyelorszgban pldul a chmielnicki mszrls a npessg negyedt el
puszttotta. A tizennyolcadik szzadban azonban jelentsen nvekedett a
kzp- s kelet-eurpai zsidsg ltszma, fkpp azrt, mert megjavultak
letkrlmnyeik. Frankfurtban a zsidsg vrhat lettartama negyven
nyolc v volt, a nem zsidk harmincht v.
1800-ra a zsidsg ltszma ktmillira emelkedett, 1900-ra ht s fl
millira. Fkpp a gazdag csaldok nvekedtek: gyakran tz gyerek is
meglte a felnttkort. A szegnyek kevesebb utdot hagytak. Teht a leg
tbb mai askenzi az akkori zsid npessg kis hnyadtl szrmazik.
A torzis disztnia valsznleg azrt terjedt el, mert vletlenl igen n
pes csaldban keletkezett a mutci. Ma mr az egsz vilgon elfordul.
s brhol ljenek is hordozi, segtsgvel megtehetik az utat visszafel
egy hrom vszzaddal ezeltti lengyel vagy litvn falu egyetlen jmd
csaldjig.

15 2
AZ ELVESZETT TRZSEK
'

A betegsget okoz gnek ms zsidk trtnetnek kinyomozsban is


felhasznlhatk. Az eurpaiaknl a ciszts fibrzis a legelterjedtebb rk
letes betegsg, s ugyanilyen gyakori az askenziknl. Mindkt csoportban
vannak ciszts fibrzis mutcik, melyek rvn kimutathat a rokonsg.
A Fldkzi-tenger krnykrl vagy a Kzp-Keletrl szrmaz zsid csa
ldok krben a betegsg sokkal ritkbban jelentkezik. Az iraki zsidknl
az elfordulsok szma tzszer alacsonyabb, mint Eurpban. Az eurpai
nem zsidk krben tz megbetegedsbl hetet egy bizonyos mutci
okoz, amely zsid betegeknek mindssze egyharmadnl mutathat ki.
Minden zsid csoportnak megvan a jellegzetes ciszts fibrzis mutcis l
lomnya: a tunziaiaknl az esetek felt egyetlen mutci okozza, amely
csak ott s Iibiban fordul el. A klnbsgek azt mutatjk, hogy a csopor
tok hossz idvel ezeltt szakadtak el egymstl. Az askenzik jl megk
lnbztethetk fldkzi-tengeri s kzp-keleti hitsorsosaiktl a betegsg
gyakorisgt s a betegsget okoz mutci rvn.
A genetikai vltozatok brmilyen rendszere - vrcsoportok, enzimek
vagy a DNS szerkezetnek eltrse - alapjn nyomon kvethet a zsidsg
vagy brmely npcsoport tja vgig a fldkereksgen. A trkp, mely most
alakul ki a vilg gnjeirl, elssorban arra vilgt r, hogy az emberek lta
lban jobban hasonltanak a szomszdaikra, mint a tlk tvol lkre.
A genetikai s fldrajzi tvolsg egybeesik. Ez a kzhelyszer megllapts
nagyon megdbbenten egy rgebbi kor antropolgusait, akik a vilgot si
npvndorlsok szmtalanszor trt pergamenjnek lttk. Hitlernek nagy
csaldst okozna, hogy szke rji (akik lltlag egy tvoli fldrl trtek
be) kevss klnbznek a zsidktl, akiket olyan mlysgesen megvetett.
De azrt vannak finom eltrsek a gnekben, amelyek hordozik rejtett
trtnelmrl rulkodnak.
Az Eurpa klnbz rszeibl szrmaz zsidk genetikai csaldfja
azt mutatja, hogy nem alkotnak a krlttk l npektl biolgiailag el
tr, egyedlll csoportot. De azrt a kzs szrmazs bizonyos jelei r
vn legalbb rszben sajt azonossguk van. Rendszerint tfedsek mutat
koznak a zsid s a helybeli nem zsid npessg gnjei kzt. Csere folyt;
nha a kzelmltbeli, gyakrabban rgi kapcsolat rvn. Ez rrtegzdtt"
az askenzik genetikai rokonsgra. Bonyolult kplet alakult ki, de azrt az
eurpai zsidk nyilvnvalan klnbznek nem zsid szomszdaiktl.
Legtbbjket npes csaldd egyestik a gnek.
Nha a trtnelmi rszletek is nyomon kvethetk a gnekben. A trk
orszgi zsidk genetikailag kzelebb llnak a nem zsid spanyolokhoz,
mint a helybeli trkkhz. 1402-ben sok zsidt elztek Spanyolorszg-

153
A VRNKBEN VAN

bl, miutn egy vszzadon t ldztk ket tbbek kztt koholt vrv
dakkal s azzal a vddal, hogy a zsid varzslk pkokbl fznek mrget
(amit elszeretettel hirdetett a katolikus uralkodpr, Ferdinnd s Iza
bella). Mintegy huszontezren Konstantinpolyba s krnykre mene
kltek. Trkorszgban l leszrmazottaik ma is gnjeikben hordozzk
az elzetsk eltt nem zsidkkal kialakult kapcsolataikat.
A gnekbl kvetkeztetni lehet a klcsnhats jellegre is. A zsidk Y
kromoszmi - rthet mdon - nem egyformk; brahm fiainak gon
dolata jelkpes. Megllapthat, hogy az eurpai zsidsg gnjeihez sok
frfi jrult hozz, s nmelyik csak tvoli rokonsgban volt egymssal.
A legtbb zsid npessg nagyobb szrmazsi klnbsgeket mutat a frfi
gon, mint a nin (amelynek trtnete a mitokondrilis DNS-rl olvasha
t le). Vagyis a zsid gnllomnyba tbb nem zsid frfi gnjei jutottak
be, mint n. A balkni zsid frfiak Y-kromoszmi elgg klnbznek
a tbbi eurpai zsidtl, taln mert a vilgnak ebben a zrzavaros rsz
ben nagyobb volt a kevereds.
A zsidsg ni gon rkldik - csak az zsid, akinek az anyja zsid.
A gyakorlat azrt alakult ki, mert a bibliai idkben (s Mezopotmiban
egszen a kzpkorig) elfordult, hogy a tbbnej csaldban a zsid frfi
nak nem zsid felesge (vagy gyasa) is volt. A valls teht csak a zsid
anya rvn rkldhetett. Ksbb, a zrzavaros idkben brki volt is az
apa (nha nem lehetett pontosan tudni), az anya ismerte a gyermekeit, s
tadhatta nekik az rksget. A zsid gnllomnyban tallhat nagy
szm idegen Y-kromoszma tanstja ennek a hagyomnynak a jelent
sgt.
Az ttrsek is elmostk a zsidsg biolgiai hatrait. Rgta tudjuk,
hogy az emberek gyorsabban vltoztatjk a hovatartozsukat, mint a gn
jeiket. Tacitus rmai trtnetr felpanaszolta, milyen sok germn np
tnt el azok kzl, melyekrl Caesar alig szz vvel korbban beszlt. Az
indin trzseknek, amelyeket Lewis s Clark a tizenkilencedik szzad ele
jn szak-amerikai tja sorn szmba vett, szintn csaknem a fele eltnt a
szzad vgre. A germnok meg az indinok nem vltak levegv; egysze
ren megvltoztattk a hovatartozsukat. Ugyanez a helyzet a vallssal.
Egy egsz np szellemi arculatot vlthat egyetlen emberlt alatt.
A keresztnysg ltalban jobban igyekszik hveket toborozni a ms val
lsak kztt, mint a judaizmus. Rgen azonban a judaizmus is trt val
ls volt. Kr. u. 470-ben nyilvn ltalnos csodlkozst vltott ki, hogy a ka
zr fejedelem (aki j birodalmaknt meghdtotta a Krmet) ttrt a zsid
hitre, mely a trtnelem folyamn csak az birodalmban s Izraelben lett

154
AZ ELVESZETT TRZSEK

Jemeni zsidk, akik kzl egyik sem lt mg replgpen, 1950-ben hazatrnek a szmze
tsbl Izraelbe; a jvendls szerint sasszrnyakon".

llamvalls. A kazrok szzadokon t hith zsidk maradtak. Egyesek sze


rint k lehettek a modern askenzik sei - s nem Jdea npe -, hisz vn
dorlsaik utn eljutottak Ukrajnba, Lengyelorszgba s Litvniba. Ms
tmeges ttrsekrl is tudunk. Mieltt a zsidkat kiztk Ibribl, soku
kat rknyszertettk, hogy keresztnynek vallja magt. A tbbit kiutastot
tk, mert az inkvizci attl flt, hogy megfertzik az j katolikusokat.
Spanyolorszgban s Portugliban ma is akad nhny katolikus csald,
amelyben fennmaradtak a zsid szoksok, s a modern spanyol nemessg
egyharmada ttrt zsidktl szrmazik.
A npek mozgsa a vallsok kztt sszezavarja a biolgiai hatrokat,
mivel brmilyen vallsak legyenek is az utdok, fennmaradnak bennk
az eredeti hit sk gnjei. Egy-egy rgi ttrsnek genetikai s politikai
kvetkezmnyei lehetnek ma is.
1948 s 1951 kztt egy hith zsid kzssget Jemenbl teljes egszben
Izraelbe szlltottak lgi ton a Varzssznyeg Hadmvelet sorn. A Visz
szatrsi Trvnynek egyik els s legdrmaibb kinyilatkoztatsa volt ez.
A jemeniek a diaszpra jellegzetes pldinak tekintettk magukat, akiket
elztek szlfldjkrl, de k nem olvadtak be a krlttk l iszlm n
pekbe. Nyelvjrsuk s vallsi szoksaik kiss klnbznek a tbbi zsid-

155
A VRNKBEN VAN

tl. Bizonyos rtelemben az si zsid szoksok eleven kvletei. A tbbi


zsid megvltozott, de a jemeniek a rgiek maradtak, s llhatatosan kitar
tottak hitk mellett.
Szrmazsukat Salamon kirly idejig vezetik vissza, Krisztus eltt eze
rig, egy kis csoport zsidhoz, akik az Arab-flsziget dli cscskre rkeztek
- ppen Sana' a vrosba, amelyet jval ksbb a lembk vallottak hazjuk
nak. A zsidk valban tbb mint ktezer vvel ezeltt vndoroltak be oda.
De hamarosan jelents vltozsok trtntek. A negyedik szzadtl kezve
a helybeliek pogny hitt lassan kiszortotta egy valls, amelyben egy Isten
hatalmasabb volt a tbbinl. Kr. u. 500-ban mr az llam nagy rsze zsid
volt. m a judaizmus nem sokig virgzott ezen az idegen fldn. A trt
nelem egyik elfeledett vallsi viszlya sorn az Etipibl rkezett keresz
tny tmadk legyztk a jemenieket.
Nhnyan zsidk maradtak. Hogy kik, arrl nem beszl a trtnelem.
Taln k voltak az eredeti csoport - ahogy a mai jemeni zsidk vlik -,
amely vszzadokkal korbban vndorolt be Jemenbe. De az is lehet, hogy
nem voltak az izraeli bevndorlk kzvetlen leszrmazottai. A zsidk nyil
vn keveredtek a helybeliekkel, amikor a judaizmus llamvallss vlt. St
ttrtek is lehettek azok kzt, akik kitartottak zsidsguk mellett, amikor
Jemen behdolt a harcos keresztnysgnek, s biolgiai rtelemben nekik
semmi kzk nem volt Izraelhez.
A keresztny kirlysgot Kr. u. 628-ban legyztk a mohamednok. Mo
hamed egy vdelmi okiratban gy rendelkezett, hogy a megmaradt zsi
dknak nem kell ttrnik. Ezt a vallsi trelem jegyben tette, amely tr
tnelme nagy rszben jellemz volt az iszlmra. A nyolcadik szzadtl
kezdve a jemeni zsidk elszigeteldtek. Lassanknt csak a kevsb rangos
szakmk vrtak rjuk: kovcsok, takcsok s szemetesek lettek. Legtbb
hitsorsosuktl eltren nem ellenzik az alkoholfogyasztst, taln ezzel is el
akarjk hatrolni magukat iszlm szomszdaiktl (akik nem isznak alko
holt). Kzssgk rendthetetlenl kitartott az Ottomn Birodalom stt
veiben. 1948-ban mr teljes volt a zrzavar Jemenben. Hogy megmentsk
ket, a Zsid gynksg a teljes kzssget - amint Mzes msodik kny
ve megjvendli, sasszrnyakon" - trptette Izraelbe.
A jemenitk kzl sokan mg mindig eredeti teleplskn lnek, Tel
Aviv kzelben, Rosh Ha'ayinben, amely valamikor angol lgitmaszpont
volt. A tudsok szerint a judaizmus tiszta s eredeti formjt gyakoroljk,
amely a diaszpra ta fennmaradt. Sajt mltjukat egy elszigeteldtt,
ms hitekkel soha nem kevered csoport trtnelmnek ltjk, amely p
ratlanul szoros, megszaktatlan szlakkal fzdik Izrael kezdeteihez.
AZ ELVESZETT TRZSEK

A gnekbe rt trtnelem korntsem ilyen egyrtelm. Valjban a


jemenitk biolgiailag klnbznek a tbbi zsidtl. A nluk tallt ciszts
fibrzis mutcik kzl egy sincs meg hitsorsosaikban, s a vilg zsids
gnak kilenctizednl eredmnyes szrvizsglatok kzl egy sem hasz
nlhat nluk. St nhny vrcsoport s enzim gnje, amely a jemenitk
nl ltalnos, ms zsid csoportokban nem fordul el, viszont az arabok
nl gyakori. Bizonyos gnek az etipiaiakkal rokontjk ket; msok csak
rjuk jellemzk. Biolgiai rksgk nem azt tkrzi, hogy egyenes gi
leszrmazottai a Salamon-kori Izrael npnek, hanem vrkeveredsrl
rulkodik, rszben a vegyes hzassgok miatt, rszben azrt, mert egyesek
ttrtek a zsid hitre, amikor az rvid ideig llamvalls volt. Azok kzl,
akik sasszrnyakon trtek vissza a fldre, melyet shazjuknak vallottak,
nem egy valjban pp akkor indult szmzetsbe sei fldjrl. Ez a fel
fedezs elg knos volt, mg ma sem verik nagydobra a jemenita kzs
sgben.
A zsidsg fkpp azrt tudott ellenllni a ktezer ves ldztetsnek,
mert npes csaldnak tekintette magt. A zsidk s ms npek genetikai
keveredsrl jonnan szerzett ismeretek slyos dilemmt rejtenek. Ho
gyan hatrozzk meg a csaldot? A szrmazs szigoran vett trvnyei
alapjn, vagy beltva, hogy a zsidsg nemcsak gnek dolga? A hiten s a
Mendelen alapul rksg nem ugyanaz.
Sokan vannak, akiknek a judaizmussal val kapcsolata ktsges, mgis
helyet kvetelnek maguknak a Szentfldn. Legtbbjk zsid szrmazsa
mer illzi. Pldul a lembk elmlete, hogy szakrl jttek, s k ptet
tk Zimbabwt, aligha tbb ennl. Kedves jelkpk, a Dvid-csillag csak a
kzpkorban lett a zsidsg ltalnos szimbluma, gy nem vihettk Afri
kba ktezer vvel korbban. A hiberu, brhogyan hvjk, kzelebb ll az
afrikai sona nyelvhez, mint brmelyik kzp-keletihez. Jemenben ktsg
telenl ltezik egy Sana'a nev vros, de a mitikus Szenra vannak sokkal
valsznbb jelltek. A lembkat azzal is megvdoltk, hogy egyszeren
tvettk a tizenkilencedik szzadi eurpai rgeszmt Nagy-Zimbabwe zsi
d ptirl, s magukat mondtk ki az elveszett trzsnek, amely megp
tette; ez a dics mlt csak vgylom.
Mindebbl taln gy tnik, hogy merben alaptalanul valljk magukat
zsid sk utdainak; csakhogy a lembk szrmazsa meglepetssel szol
gl. Legtbb gnjk - vrcsoportok, enzimek s gy tovbb - a krlt
tk l afrikai trzsekvel rokon. De a lemba Y-kromoszmban lv g
nek (amelyek termszetesen frfigon rkldnek) mshonnan szrmaz
nak. A vilg frfi szrmazsi gainak csaldfjn a lembk nem az afrikai-

157
A VRNKBEN VAN

akhoz kapcsoldnak, hanem a kzp-keletiekhez. A lemba eredetmond


ban rejtett igazsg bjik meg. rksgk egy rsze valban kzs a Biblia
npvel.
A gnek Afrikba jutsnak trtnete sokkal przaibb, mint a szm
zttek, akik tverekszik magukat egy fldrszen, hogy hatalmas szen
tlyt ptsenek. A mozambiki Sayuna vrosa vszzadokon t kereskedel
mi kzpont volt, ott tallkoztak az arab kereskedk (akik kzl sokan
Sana'bl indultak) . Az afrikaiak - kztk a mai lembk sei is - adtk
vettk az rut, s eltanultk a mr szoksokat, pldul a krlmetlst meg
az llatok ritulis levgst. Az arabok a tengerparti trzsekbl nsltek.
Gyermekeiket az iszlm valls szerint neveltk. A tizenhatodik szzadban
Sayunt leromboltk a portuglok, s arab kultrja nyomtalanul eltnt.
A lembk azonban megriztk Salamon s Mzes emlkt, akik ugyan
olyan fontos szerepet jtszanak az iszlm vallsban, mint a zsidban.
Ahogy az etipiai falask judaizmusa valsznleg a korai keresztnysg
bl ntt ki, melyrl levlasztottk az jtestamentumi elemeket, a lembk
zsidsga rszben a mr-mr feledsbe merlt iszlm hitbl ered. Tulaj
donkppen szorosabb a kapcsolatuk Izraellel, mint a falasknak, akiket a
gnek (tbbek kzt az Y-kromoszmk is) a tbbi afrikaival egyestenek,
nem a Kzp-Kelettel.
A lembk vallsa s gnjei fontos zenetet kzvettenek azoknak, akik a
szrmazs alapjn akarjk meghatrozni a nemzetet. Sem kultrk, sem
gnek tadshoz nem kell az egyik npnek kiszortania a msikat. A lem
bknak nincs kzvetlen szellemi kapcsolatuk a j udaizmussal, hanem kz
vett rvn vettk t egyes elemeit. A trzs egyetlen tagjnak sincs meg
szaktatlan genetikai kapcsolata a Kzp-Kelettel: nem az egyik elveszett
trzs utdai, hanem bizonytottan fekete afrikaiak. De bizonyos gnjeik
kzp-keletiektl szrmaznak, akik valamikor Afrika partjain vlasztot
tak maguknak asszonyt. Azta az idegen Y-kromoszmk elterjedtek a
szrazfld belsejben, a tallkozs helytl sok ezer kilomternyire. Az
arabok nem sprtk el a lembkat, s a parti npek nem ztk el a sz
razfld belsejben lket. A gnek nemi kapcsolatok rvn jutottak el
egyik genercitl a msikig, egyik vidkrl a msikra. Az egyik np ma
gba olvasztotta a msik genetikai rksgnek egy rszt, de nem rezte,
hogy ez ltben fenyegeti: a gnek sokkal messzebbre eljutottak, mint az
egyes emberek.
A npessggenetika szempontjbl igen fontos, hogy a gnek s hordo
zik sorsa elklnl. Kezdetben az embertan csak egy mdot ltott a g
nek vagy kultrk vndorlsra: a fosztogat hordk tjt. A mltnak ez a
AZ ELVESZETT TRZSEK

klns, puritn szemllete figyelmen kvl hagyja azt az egyszer tnyt,


hogy a nemisg ellenllhatatlanabb er, mint a katonai hdts. Ahogy a
vallsok terjesztsre is alkalmasabb a hittrts, mint a kard, a gnek is t
adik tbb-kevsb nkntes kzremkdse rvn utazzk be a fldgo
lyt. A trtnelem legalbb annyira a szerelem, mint a hbork mesje.
Nincs szksg tmeges elvndorlsra sem az elveszett trzsek, sem msok
esetben.
Dr. William Price, Thor Heyerdahl s kvetik a gnek terjedst
megszaktatlan utazsnak fogtk fel. Mintha hordozik, akr egy exp
resszvonat, meglls nlkl vittk volna eredeti helykrl a clllomsig a
gneket, hogy elfoglaljk az slakosok gnjeinek helyt. Az igazsg fld
hzragadtabb. Egy DNS-darab lass s tekervnyes, ksedelmekkel s vl
tozsokkal teli utat tesz meg eredeti helytl. A jrm - az egyn -, amely
nek belsejben utazst megkezdi, sose jut el a vgllomsra; a gn azon
ban igen, msokkal egytt, amelyek ksbbi llomsokon szlltak fel.
A gnek az embereken t vndorolnak, nem egyszeren velk. A gn
fldrajz legtbb trkprl nem npvndorlsok vagy elveszett trzsek
olvashatk le, csak a DNS hossz veken t tart csereforgalma frfiak s
nk kzt.
A mai zsidsg j pldja annak, hogyan szivrognak a gnek egyik em
bertl a msikig hatalmas tvolsgokon keresztl. A mindig is megl
v csereforgalom kztk s szomszdaik kzt napjainkban felgyorsul. Sok
helyen a zsidk vegyes hzassgok rvn beleolvadnak a helyi nem zsid
npessgbe. i950-ben mg tz zsid kzl nyolc sajt hitsorsosval kttt
hzassgot. Negyven vvel ksbb az Egyeslt llamokban a npszmlls
adatai szerint a hzasul zsidk tvenkt szzalknak hzastrsa nem volt
zsid. Nmetorszgban a vegyes hzassgok arnya tzbl kilenc volt. gy a
magukat zsidnak vallk szma Izraelen kvl az 1948-as mintegy tizen
egymillihoz kpest krlbell hrommillival cskkent. 1939-ben tzmil
li zsid lt Eurpban. A hbor utn ngymilli. i996-ban ez a szm alig
felre cskkent. Lesznek zsid unokink? - tette fl a krdst knyve cm
ben az angliai frabbi. Minden oka megvan az aggodalomra, hiszen az an
gol zsidknak csaknem a fele ms vallsval kt hzassgot.
gy a hajdan jellegzetes zsid gnek (mint a torzis disztni) tsziv
rognak ms csoportokba is. Persze a folyamat nem egyirny. A zsidknl
alacsony a fenilketonuria (rkltt lelmiszer-lebontsi kptelensg,
amely mentlis krosodshoz vezethet); de ahogy folytatdnak a vegyes
hzassgok, idvel meg fog mutatkozni a hatsa a mai zsidk leszrmazot
tain is.

159
A VRNKBEN VAN

A zsidsg npsrsgi slypontja mr rgen kvl kerlt Izraelen.


A diaszpra ta mindig is tbb zsid lt az gret Fldjn kvl, mint azon
bell. i88o-ban mr a vilg zsidsgnak krlbell hromnegyede Eur
pban s Oroszorszgban volt tallhat. 1939-re egyharmaduk kivndo
rolt az Egyeslt llamokba, gy a slypont tovbb toldott nyugatra.
A holocaust csaknem ktharmadval cskkentette az eurpai zsidsg
ltszmt. A zsid trtnelem katasztrfi kzt ez volt a legslyosabb, s
eredmnyeknt a zsidsg zme mg inkbb nyugatra kerlt, egyre tvo
labb az shaztl.
A vndorls sorn mindjobban asszimilldtak a zsid gnek. A tizen
kilencedik szzadban a beolvads sokkal elbbre haladt Nyugat-Eurp
ban, mint Lengyelorszgban. Sok francia zsidt mlysgesen megdb
bentett az 1894-es Dreyfus-per (egy zsid katont hazaruls koholt vd
jval eltltek, s ez vad antiszemitizmust vltott ki). Hiszen akkor mr
igen sok volt Franciaorszgban a vegyes hzassg zsidk s nem zsidk
kztt. Angliban mg jobban elrehaladt a folyamat. Sokan asszimil
ldtak: Benjamin Disraelit (aki maga is rt egy regnyt az elveszett trzsek
visszatrsrl) azrt kereszteltk meg, mert apja sszetztt zsinaggja
elljrival.
Az Egyeslt llamokban az asszimilci ma mr szinte megllthatat
lan: a vegyes hzassgokbl szrmaz gyerekek hromnegyede nem nevel
kedik zsidknt, gy feltehetleg nem vlaszt zsid hzastrsat.
Az eurpai zsidsg trtnelmre az utbbi kt vszzadban az si kz
ponttl val elvndorls s a genetikai felhguls jellemz. A npessgn
vekeds elvndorlshoz vezetett, az elvndorlk gnjei keveredtek szom
szdaikval, s a nemzedkeken t tart folyamat sorn mind teljesebb vlt
az asszimilci.
Npcsoport-diffzinak" nevezik azt a folyamatot, melynek sorn az
egyik csoport genetikailag magba olvasztja a msikat. Hogy ki asszimill
kit, az a szmoktl fgg. Eurpban s Amerikban nyilvn a zsidsg ol
vad be az t krlvev nagyobb npessgbe. tven vvel ezeltt nyilvnva
lbbak voltak az eurpai zsidk genetikai sajtossgai, mint manapsg, s
tven v mlva mg kevsb lesznek szrevehetk; de ha a kulturlis haso
nuls nyomn semmi sem rulkodik mr arrl, hogy a npessg melyik r
sze volt valamikor zsid, a gnek akkor is bizonysgot tesznek rla.
A gnek minden dokumentumnl - mg az testamentum nagy becs
ben tartott szvegeinl is - messzebbre visznek bennnket egy nemzet
mltjban. A vilg gnjeinek j trkpe meglep tnyrl rulkodik: lehet
sges, hogy valban volt egy elveszett trzs, tbbmillinyi ember, aki a K-

160
A VRNKBEN VAN

A zsidsg npsrsgi slypontja mr rgen kvl kerlt Izraelen.


A diaszpra ta mindig is tbb zsid lt az gret Fldjn kvl, mint azon
bell. 1880-ban mr a vilg zsidsgnak krlbell hromnegyede Eur
pban s Oroszorszgban volt tallhat. 1939-re egyharmaduk kivndo
rolt az Egyeslt llamokba, gy a slypont tovbb toldott nyugatra.
A holocaust csaknem ktharmadval cskkentette az eurpai zsidsg
ltszmt. A zsid trtnelem katasztrfi kzt ez volt a legslyosabb, s
eredmnyeknt a zsidsg zme mg inkbb nyugatra kerlt, egyre tvo
labb az shaztl.
A vndorls sorn mindjobban asszimilldtak a zsid gnek. A tizen
kilencedik szzadban a beolvads sokkal elbbre haladt Nyugat-Eurp
ban, mint Lengyelorszgban. Sok francia zsidt mlysgesen megdb-
bentett az 1894-es Dreyfus-per (egy zsid katont hazaruls koholt vd
jval eltltek, s ez vad antiszemitizmust vltott ki). Hiszen akkor mr
igen sok volt Franciaorszgban a vegyes hzassg zsidk s nem zsidk
kztt. Angliban mg jobban elrehaladt a folyamat. Sokan asszimil
ldtak: Benjamin Disraelit (aki maga is rt egy regnyt az elveszett trzsek
visszatrsrl) azrt kereszteltk meg, mert apja sszetztt zsinaggja
elljrival.
Az Egyeslt llamokban az asszimilci ma mr szinte megllthatat
lan: a vegyes hzassgokbl szrmaz gyerekek hromnegyede nem nevel
kedik zsidknt, gy feltehetleg nem vlaszt zsid hzastrsat.
Az eurpai zsidsg trtnelmre az utbbi kt vszzadban az si kz
ponttl val elvndorls s a genetikai felhguls jellemz. A npessgn
vekeds elvndorlshoz vezetett, az elvndorlk gnjei keveredtek szom
szdaikval, s a nemzedkeken t tart folyamat sorn mind teljesebb vlt
az asszimilci.
Npcsoport-diffzinak" nevezik azt a folyamatot, melynek sorn az
egyik csoport genetikailag magba olvasztja a msikat. Hogy ki asszimill
kit, az a szmoktl fgg. Eurpban s Amerikban nyilvn a zsidsg ol
vad be az t krlvev nagyobb npessgbe. tven vvel ezeltt nyilvnva
lbbak voltak az eurpai zsidk genetikai sajtossgai, mint manapsg, s
tven v mlva mg kevsb lesznek szrevehetk; de ha a kulturlis haso
nuls nyomn semmi sem rulkodik mr arrl, hogy a npessg melyik r
sze volt valamikor zsid, a gnek akkor is bizonysgot tesznek rla.
A gnek minden dokumentumnl - mg az testamentum nagy becs
ben tartott szvegeinl is - messzebbre visznek bennnket egy nemzet
mltjban. A vilg gnjeinek j trkpe meglep tnyrl rulkodik: lehet
sges, hogy valban volt egy elveszett trzs, tbbmillinyi ember, aki a K-

160
AZ ELVESZETT TRZSEK

zp-Keletrl indult el, bejrta a fldkereksget, s kzben elvesztette kultu


rlis nazonossgt, ha a biolgiait nem is. A npek, melyeket ez a kzs
genetikai trtnelem egyest, az Atlanti-centl a Bengl-blig s az
szaki-sarktl Ceylonig mindentt megtallhatk.
Az els nyomra vezet a nyelv. A kzs szavakbl kialakthat a vilg
nyelveinek csaldfja. Vannak kzeli rokonok- mondjuk az angol s a n
met; msok tvolabbiak. Az angol s a szanszkrit - ezt a kihalt nyelvet vala
ha Keleten beszltk - egymstl igen tvolinak ltszik, de az angol
father" (apa) sz szanszkrit megfelelje pitah'', ami kzs elzmnyre
utal. Mindkett az indoeurpainak nevezett nagyobb csald tagja, mely
olyan klnbz nyelveket lel fel, mint a bengli, az albn s a walesi.
Ms nyelvek is csaldokba sorolhatk. Altaji nyelv pldul a trk s a
mongol, az urli csoportba tartozik a finn, a magyar s a szibriai szamo
jd. Vagyis a nyelvek - akr a gnek - fejldnek. Br a vltozs mechaniz
musa eltr kzttk, mindkett rzi a mlt emlkeit, s ezek alapjn ki
mutathatk a kapcsolataik.
Az nyilvnval, hogy az ember rokonsgban van a csimpnzzal; az
mr kevsb, hogy a gykkal is, s az egyltaln nem, hogy az lesztvel
ugyancsak. Mgis akadnak az lesztben a mieinkkel azonos gnek an
nak bizonysgul, hogy valamikor rgen az embernek s az lesztnek k
zs se volt. Ugyangy bizonyos szavak is lassan fejldnek, ezrt si erede
tk kinyomozhat. Egyetlen hatalmas nyelvcsoport - a nosztratikus -
egyesti a walesit s a szamojdet, a mongolt s a francit, a tibetit s a ber
bert. De mirt lehetsges, hogy olyan npek, amelyek ma sok ezer kilo
mternyi tvolsgra lnek egymstl, kzs forrsbl ered nyelveket be
szlnek?
A vlasz a gnekbe rt csaldfban rejlik. Ez elrulja, hogy az elveszett
trzsek legendja klns igazsgot hordoz, s j megvilgtsba helyezi a
Jordn menti shaza gondolatt.
Az egymstl tvol kerlt npek termszetesen ms-ms mdon fej
ldnek. Az elszigetelds is kedvez az talakulsnak: a gnekben - akr
csak a nyelvekben - vletlenszer mdosulsok jnnek ltre, gy a np-
csoportok jobban elklnlnek egymstl. Sokszor egyltaln nincsenek
'

kzs elemek a szavak s gnek fldrajzban. Afrikban pldul nincs


megfelels a kutya" vagy a tz" jelents szavak kzt Marokkban, Ni
griban s Kenyban, valamint hinyzik a klnbz vrcsoportok k
zs fldrajza is. A npcsoportok nem kerltek kapcsolatba egymssal a
fejlds sorn, gy a nyelvi s genetikai vltozsok kln-kln alakultak
ki mindegyikben.
A VRNKBEN VAN

A fldmvels kezdeti
idejbl: gipsszel bortott
koponya, a szemek helyn
porcelncsiga-kagylval.
Kilencezer ves jeriki
lelet az agyagmvessg
megjelense eltti korbl.

Azoknl viszont, akik a nosztratikus nyelveket beszlik, megtallhatk


a nyelv fejldst ksr genetikai vonulatok is. Mindkett a Kzp-Kelet
rl sugrzik ki szakra, nyugatra s keletre. Kvetkezetesen rvnyeslnek
tven vagy tbb gn esetben s szavak szzainl, teht a forrs kzs.
A jelensg azoknl a legnyilvnvalbb, akik az indoeurpai nyelveket be
szlik, de flfedezhet az altaji nyelvcsoportnl is. A jelek szerint csak a
Fldkzi-tenger afrikai partjn l npek nem illenek a rendszerbe: br
valamikor nosztratikus nyelvet beszltek, nluk nem rvnyeslnek ezek
a tendencik.
Mirt mutatnak ennyire klnbz npek kzs biolgiai s kulturlis
szrmazsi gai egyetlen kzpontra? Az egyik elmlet szerint a jelensg
oka az elveszett trzseket ht vezreddel megelz tmeges kivndorls.
A fldmvels mintegy tzezer vvel ezeltt Kzp-Keleten, a Jordn s az
Eufrtesz vlgyben kezddtt. Onnan terjedt tovbb, s krlbell tezer

162
,
AZ ELVESZETT TRZSEK

vvel ksbb jutott el Eurpa nyugati peremre, illetve nagyjbl ugyanak


kor a Tvol-Keletre.
A gazdagods - akrcsak Kzp-Eurpa zsidsga krben - az els
fldmvelknl is npessgrobbanshoz vezetett. Hamarosan megkezdtk
tlnpesedett hazjukbl az elvndorlst vadsz szomszdaik fldjre.
A vadszok kzl nhnyan ktsgtelenl sszehzasodtak a jvevnyek
kel; voltak, akik maguk is ttrtek a fldmvelsre. Az jonnan keveredett
npcsoportok s ivadkaik mg tovbb vonultak, s lassan eljutottak a
Fld minden rszre. Az egyik np beolvadt a msikba, a fldmvelk ma
gukba olvasztottk a vadszok gnjeit, akiknek fldjre bevndoroltak.
A folyamat mg ma is tart. Az afrikai npszaporulat ngyszerese az eur
painak. Ruandban az tlagos gyerekszm 8,5, Olaszorszgban 1,3. A ki
vndorls mr elkezddtt. Nem szmt, hogy a politikusok mit akarnak,
meg fog indulni a tmeges elvndorls dlrl szakra, s az eurpai gnek
elbb-utbb felszvdnak egy rszben afrikai szrmazs npessgben.
Minl messzebb kerltek a fldmvelk gnjei kiindulsi helyktl, an
nl jobban sszekeveredtek a befogad vadsznpekivel. Tbb ezer kilo
mterre attl a vidktl, ahonnan a fldmvelk tnak indultak, ksi
utdaikban (mint a lembkban) az Indiai- vagy Atlanti-cen partjain
mr csak nhny vons maradt, amely tvoli hazjukhoz kapcsolja ket.
A vrvonalak azrt sugroznak szt egyetlen kzpontbl, mert a Kzel
Kelet npei elvndoroltak, s magukba olvasztottk szomszdaik gnjeit.
Ez az elveszett trzsek rejtlynek megoldsa. Valjban nem is vesztek el:
tovbb lnek ezermilli ma l ember rksgben. A trzsek sose trhet
nek vissza, mert rksgk sztoszlott megszmllhatatlan ivadkuk k
ztt, akik mit sem tudnak a Kzp-Kelethez fzd trtnelmi kapcsola
tukrl.
Izrael azonban ma j genetikai visszatrs tanja, amely a fldmvelk
szlfldjrl val si elvndorls tkrkpe. A trsadalmi vltozsok - a
vegyes hzassgok s a kis csaldok -, amelyek hatsa all az Izraelen kvl
l zsidk n em vonhatjk ki magukat, a Szentfldre kevsb jellemzk.
Ott egyre tbben valljk magukat zsidnak, mg msutt egyre kevesebben.
Izraelben lassan a vilg zsidsgnak nagyobb hnyada l, mint hossz.
vek ta brmikor. Rszben mert a holocaust katasztrfja szrny puszt
tst vgzett Eurpa zsid npessgben; de fkpp a demogrfiai vltoz
sok miatt: Izraelben fennmaradt a rgi letforma, mg msutt a zsidk is a
mai vilg elvei szerint lnek. A zsidsg inkbb npessgnvekeds, mint
bevndorls rvn veszi ismt birtokba shazjt. A zsid gnek ugyangy
trnek vissza, ahogyan tzezer vvel ezeltt elmentek: nem a szmzttek
A VRNKBEN VAN

Genetikai hullmok Eurpban: klnll gnek tucatjaibl lltottk ssze ket a fldrszt t
szel vonulatok bemutatsra. Sok kzlk dlkeletrl szaknyugatfel terjed. Nhny genetikus
szerint a trkp a Kzel-Keletrl bevndorl fldmvelk gnjeinek trhdtst tkrzi az ere
deti vadsznpessg gnllomnyban. Csakhogy van nhny rejtlyes kivtel az ltalnos
irnyzat all, amely bizonyos (pldul a mitokondrilis) gnek esetben a jelek szerint egylta
ln nem rvnyes.
A GNEK KZS PIACA:
GENETIKAI VONULATOK EURPBAN

A gnekbl kiolvashat a trtnelem (br szksg van nmi tallgatsra is,


mint rendesen, ha kpet akarunk alkotni a mltrl) . Az sidkbl szrma
z kapcsolatoknak lehet nagyobb terletet tfog rendszere. A ciszts fib
rzis gn sokfle mutcijnak eloszlst brzol trkprl megllapt
hat, hogy az egyik szaknyugat-Eurpban elg gyakori, dl s kelet fel
haladva azonban egyre ritkbb. Az irnyzat nagyon hasonlt a korai fld
mvelknek a Kzel-Keletrl Eurpn t tart vndorlsra. Vagyis a be
tegsgnek ez a formja gyakori lehetett Eurpa fldmvels eltti npei
nl, de amikor a fldmvelk tzezer ve nyugat fel hzdtak, ugyanan
nak a gnnek a helyt ms mutcii vettk t.
Ha sok gn fldrajzi eloszlst egyszerre rajzoljuk fel, olyan trkpet ka
punk, melynek alapja nem egyetlen gn, hanem soknak az tlaga: sznek
kel jelljk ket, ahogy az iskolai trkp brzolja a hegyek magassgt s a
feltn tereptrgyak helyt. m egy atlasz mindssze a hosszsgi, a sz
lessgi fokot s a magassgot adja meg: a helymeghatrozshoz elg hrom
adat. Amikor szznl tbb klnfle gnrl van sz, a dolog valamivel bo
nyolultabb. Az adatok trkpre rajzolsnak egyik mdja, hogy a kzs vo
nulatokat piros, kk s zld sznnel brzoljuk. gy minden sznnek az ir
nya si npvndorlsokra s npcsoport-keveredsre utal.
Eurpban a felmrs nem knny, mert a npcsoportok hiba kl
nltek el mr rgen politikailag, a Kzs Piacra s szomszdaira az a legjel
lemzbb, hogy itt a legtbb ember nagyjbl egyforma. Sokkal kisebbek a
genetikai klnbsgek, mint pldul Afrikban. Nhny tendencia mgis
nyilvnval. Van a kzs hasonlsgnak egy szaknyugat-Eurpn thala
d, a trkpen pirossal jelzett hullma; a kzs szrmazs msik, zlddel
brzolt vonulata nyugat fel mutat a Fldkzi-tenger szaki partja men
tn. Ezek taln a Kzp-Keletrl kiznl s az eredeti vadsznpessgbe
behatol fldmvel csoport kt vonulsi irnyt jelzik. A narancsszn
hullm Kzp-Eurpban egy kln bevndorls emlke lehet, a sztyep
pkrl rkez nomdok. De egyik vonulat sem feltn, s Eurpa geneti
kai egynemsge ms rtelmezseket is lehetv tesz. Szardnia - amely
ezen a trkpen nem lthat - ismeretlen okbl nagyon klnbzik Eur
pa tbbi rsztl.
A VRNKBEN VAN

Rg halott fldmvelk nyomai: a trtnelem eltti parcellk hatrai rajzoldnak ki a felkel


nap ferde sugaraiban a yorkshire-i Grassington mai szntfldjei kztt. Az si fldek pp
gy beleolvadtak a jelenlegi tblkba, mint a gnek, hiszen a modern angolok ereiben taln
ott kering egy kevs a Kzp-Keletrl idekerlt si fldmvelk DNS-bl.

vndorl csapatban, hanem az idn s tren tvel utazsban, amelyet a


gnhordoz trsadalmak talakulsa (legfkppen a npessg nvekedsi
teme) szab meg.
De akkor mi legyen dr. Price hamvaival, mi legyen a ltnokkal, aki sze
rint a walesiek az gret Fldjnek szmztt npbl valk? Az Walese
klnleges hely volt: az j Jeruzslem sznhelye. Ma mr bizonythat,

166
AZ ELVESZETT TRZSEK

hogy valban pratlan hely, de egszen ms okbl. Eurpa-szerte a mito


kondrilis gnek alakulsnak trvnyszersgei nem kvetik a mindkt
nem rvn trkthet gnekt. Vagyis - mint a lembknl vagy az eur
pai zsidsgnl - a gnek nagy rszt az idegenbl jtt frfiak adtk t a
helybeli nknek. A nk kevesebbet vndoroltak, az gnjeik ott maradtak,
ahol voltak. De az eurpai mitokondrium csaldfja meglepetssel szolgl.
Wales kzepn van egy terlet, ahol a npessg szrmazsa eltr a tbbi
tl. Kevesebb kze van az Angliban vagy brhol Eurpban tallhat mi
tokondriumhoz, mint ppensggel a ppua j-guineaihoz. Taln ltezik
egy nkbl ll elveszett trzs (vagy legalbbis egy elveszett nemzetsg ni
ga) , amelyrl senki sem tudott, s amely ezekben a tvoli walesi vlgyek
ben l. Lehet, hogy egy olyan si np maradvnya, mely Eurpa ms rsze
in kipusztult; esetleg korai bevndorlk voltak Afrikbl, akiket msutt el
sprtek az ugyanonnan rkez ksbbi npvndorls hullmai.
Dr. Price druidi igen frfias npsg voltak: azt tekintettk az asszony
egyetlen feladatnak, hogy vilgra hozza a fpapok j nemzedkt. Akr
csak a trzsek, melyek Jkob fiairl kaptk nevket. Vajon hogyan fogadta
volna dr. Price vagy William Blake a felfedezst, hogy a legyztt kelta faj
misztikus htramaradottjai valjban nk voltak?

'
IV. FEJEZET

A br alatt a llek

Anym a vad dlen szlt engemet,


Brm koromszn, m lelkem fehr!
Angyalfehr az angol kisgyerek,
n koromszn, mint a fny nem jrta j.*
WILLIAM BLAKE: AZ RTATLANSG DALAI, 1789

EGY FELBONCOLT HOLTTEST arra emlkeztet bennnket, hogy a szpsg


olyan vkony, akr a br, s a felszn alatt mindannyian egyformk va
gyunk. A szpsges fiatal lny, a cserzett br reg s a nger, st, mi tbb,
az egsz emberisg egyforma, s egyarnt kevss tetszets a szemnek,
amint a br fels rtegt lehntjk rla" - llaptotta meg William
Hogarth 1750-ben A szpsg elemzse cm munkjban. Csak el kell men
ni egy anatmiai mzeumba, hogy lssuk, milyen igaza volt.
A prizsi orvosi egyetem mzeumban lthat a vilg egyik legrgibb s
legkitnbb gyjtemnye, amelynek szmos killtsi trgya igazi mal
kots. Az egyik egy alkotrszeire robban viaszkoponya. Kzelben egy
mj, amelybe folyadkot fecskendeztek, hogy az erek kirajzoldjanak, s
amely semmifle felismerhet emberi rszre nem hasonlt. Csak egy le
nyzott arcbr rzi emberi mivoltnak nmi nyomt valszntlenl zld
artriival.
A killts egy sor koponyval mutatja be a fekete, fehr, ausztrliai s
keleti csoportokba sorolt emberfajtkat. A koponykra halotti maszkok
nznek le egy polcrl: a guillotine kosarba hullott fejek msai. Mindegyi
ken ott a cmke a bns gaztettrl: apagyilkossg, gyilkossg vagy nemi
erszak. A legtbbnek bosszs az arca (nhny esetben elcsftja a hinyz
ll, mert az ldozat megprblta elhzni a fejt a lehull pallos all).
A koponyk s agyak rendszerint nvtelenek, pusztn faji tpusok. N
hnyon azonban ott ll a hajdani tulajdonos neve. Pldul a tizenkilence-

* Szab Magda fordtsa (William Blake: Versek sprfcik; Eurpa Knyvkiad, Budapest,
1959)

168
~---.....
"'
A VRNKBEN VAN

dik szzad legnagyobb anatmusai. Paul Broca s Joseph Arthur s Jo


seph de Gobineau agya is lthat a mzeumban. Broca jelents tuds volt;
a neurolgia megalaptja s annak a felfedezje, hogy az agy bizonyos r
sznek krosodsa meghatrozott kpessg (az adott esetben a beszd
kszsg) elvesztshez vezet. Gobineau grf trtnelmi jelentsge mr bi
zonytalanabb, t inkbb egzotikus tjakon jtszd sznpomps regnyek
rjaknt ismerik (legalbbis Franciaorszgban). Fkpp arrl hresek,
hogy k fektettk le az alapjait a tudomnyos fajelmletnek", vagyis an
nak az elgondolsnak, hogy az emberfajtk osztlyozhatk, s rtkk bio
lgiai alapon megtlhet.
Az utols kormny, amely ezt a felfogst rvnyestette, a dl-afrikai
volt, ahol az apartheid, a fajok (pontosabban a rasszok) szerinti elkln
ts az 1990-es vekig rvnyben maradt. A gondolat az llam alaptsig
megy vissza. 1652-ben Jan van Riebeeck letelepedett a Jremnysg fok
nl. A kzelben mintegy hszezer szan lt, az utols vadsz s gyjtget
np, meg tszr annyi koi-koi, birka- s tehnpsztor. Nyelvket a hollan
dok mer dadogsnak tartottk, ezrt hottentottknak" csfoltk ket.
Embertelen s rzketlen parasztok, akik felfedezvn, hogy korbbi kor
mnyuk szkhelytl ilyen tvol immron nem kell tartaniuk annak tekin
tlytl, a legfktelenebb s legbarbrabb korltlan hatalmat gyakoroljk e
szerencstlen nyomorultak fltt" - rta a brokrl John Barrow 1801-es

Paul Broca kivl francia anatmus


volt, az agykutats s az antropolgia
egyik megalaptja, akit a francia
szentus rks tagjnak is
megvlasztottak: ezt a tisztet i88o-ban
bekvetkezett hallig betlttte.

170
A BR ALATT A LLEK

Csordt terel
hottentottk egy
1986-ban elkerlt
tizenhetedik szzadi
rajzon.

Account of Travels into the Interior ofSouthern Africa (Beszmol a Dl-Af


rika belsejben tett utazsokrl) cm munkjban. A brok nem is vettk
emberszmba a bennszltteket, a hinyz lncszemnek tartottk ket az
ember s a majom kztt. Kzelebb llnak az alacsonyrend llatokhoz
a lersok szerint a nk klsejkre nzve mg a frfiaknl is visszatasztb
bak" - llaptotta meg egy anatmus. Beszdk llati hangok zagyvalka,
a majmok makogshoz hasonlatos". A holland telepesek klns kegyet
lensggel bntak a hottentottkkal; egy kvncsi holland lltlag lelt s
megkstolt egyet, hogy sszehasonltsa zt egy majomval.
A bennszlttek kizskmnyolsa hamar megkezddtt. 1809-tl a
Hottentotta Kdex eredmnyeknt rghz kttt vltak, csak gazdik en
gedlyvel kltzhettek. Szinte rabszolgkk lettek, ami ebben az idben
mr anomlinak szmtott, hiszen az emberkereskedelmet korbban be
tiltottk, s a reformerek kveteltk a rabszolgasg eltrlst is. gy a hot
tentottkat az elsk kztt szabadtottk fel formailag a birodalomban.
1828-ban rendelet mondta ki, hogy egyetlen hottentotta vagy egyb sznes
br szabad ember sem vethet al felsge ms alattvalira nzve nem
ktelez knyszer szolglatnak, sem semmifle akadlyoztatsnak, be-

171
A VRNKBEN VAN

avatkozsnak, brsgnak vagy brmely nven nevezend bntetsnek azon


rggyel, hogy az illet csavargsban vagy ms vtsgben bnsnek tall
tatott, amennyiben ezt nem bri tlet mondta ki". Annak a trvnynek az
elfutra volt ez, amely 1833-ban az egsz birodalomban eltrlte a rab
szolgasgot, s legalbbis elvben minden brit alattvalnak egyenl jogokat
adott, fajra val tekintet nlkl.
De brmilyen halad nzeteket vallottak az eurpaiak az egyenjogsg

rl, csaknem mind feltteleztk, hogy a vilg tbbi npe szellemileg alattuk
ll. Nem a prizsi anatmusok voltak az elsk, akik rendszereztk az rtel
met s a fejldst az alacsonyabbtl a magasabb rendig - az afrikaitl a
franciig, az apagyilkostl az akadmikusig. Linn, aki megalapozta az l
latok s nvnyek osztlyozst, maga is azt vallotta, hogy a fajok nem
egyenl mrtkben tehetsgesek. A fehr ember - a Homo Europaeus -

lnk, tallkony s szoksoktl vezrelt; a Homo Americanus kitart, bele


nyugv, lobbankony s megszokstl irnytott; a Homo Asiaticus hajlt
hatatlan, ggs, pnzsvr s vlemnytl vezetett; a Homo Afer (az afri
kai) pedig ravasz, lass, kzmbs, hanyag s szeszlyektl vezrelt.
A fajta (vagy rassz) ma sznt jelent. A Viktria-korban azonban tgabb
jelentse volt. A tvoli npek, pldul a hottentottk ms fajtnak min
sltek - s alacsonyabb rendnek-, de az alsbb nposztlyok is. Nem v
letlenl kerlt egyazon gyjtemnybe a kivgzett bnzk s az afrikaiak
koponyja. A trsadalmi rend alapja a hrom si osztly, amely mind egy
egy faji vltozat megfelelje; a nemessg, mely tbb-kevsb pontos tk
rzdse a hdt fajnak; a kevert faj polgrsg, mely kzel ll a vezet
fajhoz; s a kznp, amely szolgasgban l, vagy legalbb igen alacsony sor
ban. Az utbbi alacsonyabb rend faj, mely dlen a ngerekkel, szakon
pedig a finnekkel val kevereds ltal jtt ltre" - llaptotta meg Gobi
neau Tanulmny a fajok egyenltlensgrl cm munkjban. Senki sem
tudja, mirt volt ilyen rossz vlemnnyel a finnekrl.
Dl-Afrikban a fajta s az osztly eszmje szorosan sszefggtt. Ha az
els idkben faji ellenttekrl beszltek, nem az eurpaiak s afrikaiak, ha
nem a jmd angol szrmazs s a szegnyebb holland szrmazs fe
hrek sszetzseire gondoltak. A sznt csak a gazdasgi problmk emel
tk be az egyenletbe. 1922-ben a fehr bnyszok sztrjkba lptek, mert at
tl fltek, hogy feketket vesznek fl helyettk, gy elvesztik munkahely
ket. A johannesburgi menetben a tntetk Vilg proletrjai, egyesljetek
a fehr Dl-Afrikrt" feliratokat vittek. Politikai vezett kerestek, aki t
mogatja a fehr faj rdekrvnyestst a lenzett feketkkel szemben. Br
a sztrjk kudarcot vallott, elrtk, amit akartak. Hertzog miniszterelnk
A BR ALATT A LLEK

lassanknt elbocstotta a feketket a kormnyszolglatbl (ez volt az els


lps a teljes elklnts politikjhoz). A feketk nem hibztathatnak
bennnket, ha elszr a sajt osztlyunknak igyeksznk munkt biztosta
ni" - mondta.
A Viktria korabeliek is szentl hittek abban, hogy a szegnyek rdem
telenek; hogy ez az osztly gyarlnak szletik. Henry Mayhew A londoni
munksok s a londoni szegnyek cm munkjban leszgezte:

Ltezik - trsadalmi, erklcsi s taln mg fizikai tekintetben is - kt klnbz


s jellegzetes faj, nevezetesen a vndorok s a telepesek - a csavargk s a pol
grok - a nomdok s a civilizlt trzsek. A nomdot a civilizlt embertl az
klnbzteti meg, hogy heves ellenszenvvel viseltetik a rendszeres s folyamatos
munka irnt; kptelen felfogni az oly kvetkezmnyeket, melyek a legcseklyebb
mrtkben tl vannak a kzvetlen rzkels hatrain; rabja a bdt fveknek s
gykereknek, valamint, ha mdja van r, a rszegt italoknak nemklnben;
mrtktelenl rajong a szerencsejtkokrt, olykor egyetlen dobsrt szemlyes
szabadsgt kockztatja; kedveli a buja tncokat; rmt leli a hborskodsban
s a nyaktr sportokban; a tulajdonrl csak homlyos kpzetei vannak; asszo
nybl hinyzik a szemrem, s maga semmibe veszik a ni ernyt; s vgezetl,
vajmi keveset tud a vallsrl.

Nyelvezete elegnsabb a mainl, s a brszn nem jtszik szerepet ben


ne, de a mondanival ismers. A trsadalmi rang szletett adottsgok dol
ga: mindenki a biolgiai kpessgeinek megfelel gazdasgi szintre kerl.
A csavargk", a londoni munksosztly legalantasabb tagjai felismerhe
tk kiugr llukrl s arccsontjukrl", valamint szles, szgletes arcuk
rl", s mindez jellegzetes morlis s szellemi vonsokat" eredmnyez.
A trsadalmi klnbsgeketAmmon Trvnyben fogalmaztk meg: a v
rosiaknak - akik kellkppen vllalkoz szellemek voltak s otthagytk a
fldet- hosszksabb a fejk, mint a falusiaknak. Az arisztokratknak van
a legnyjtottabb koponyjuk. Br a csavarg meg a vrosi hasonlt egy
mshoz, brk alatt nagyon is klnbznek. Mayhew a trsadalmi egyen
ltlensgekrt a biolgit tette felelss.
Nagy mlt gondolat, hogy vannak termszettl alacsonyabb rend
osztlyok - mindegy, milyen a sznk-, melyeken nem segt a jtkonysg, '
sztnzs vagy szerencse. De szzadunk nagy rszben gy tnt, hogy a
trsadalomnak mr nem kell megvdenie senkit a tmegektl. Az i950-es
vekben a rgmlt lidrcnyomsnak szmtott a trvnyszegsre ksz, za
varg tmeg gondolata. Napjainkban megint feltmadt a bntl, kbt
szerektl s elidegenedstl val rmlet. gy ltszik, egyesek buksra
vannak beprogramozva. Nem lehet mst tenni, meg kell fkezni ket; a

1 73
t'/ 1

.
...

..
- .
. .
'

-----'-:---

.........

/ ' . \: ..
r

.- . '
)'
-.:
. _.. ,
).,'
.
A VRNKBEN VAN

ELZ OLDAL: Rszlet Charles Booth trkpbl, amely a londoni utck minsgt mutatja.
A tbb lapbl ll trkp London bels terletnek nagy rszre kiterjedt. Az itt lthat rszlet
a Euston vastlloms krli terletet brzolja; Somers Town nyomorsgos utcit keleten, a
pazar pletsort a Regent's Park krl (amely koronabirtok volt, a kirlyi csald tulajdona) s
az akkoriban szerny, kzposztlybeliek lakta Bloomsburyt, mely nhny vtizeddel ksbb a
vros szellemi letnek kzppontja lett. A trkp ksztse ta nem sok vltozs trtnt.

trsadalom knytelen visszatrni si feladathoz, hogy leigzza a beillesz


kedni nem akarkat.
A tizenkilencedik szzad vgn a reformer Charles Booth feltrkpezte
a londoni utck minsgt. rdeme szerint sznezte ki mindegyiket. Volt,
amelyikben a szellemi foglalkozsak laktak, msutt a tisztessges munk
sok. Sokban viszont a trsadalom legalantasabb rtegei. Akik ebben a ne
gyedben lnek- adtk hrl az egyik East End-i utcrl -, azok nem embe
rek, hanem vadllatok." Az ilyen krnyk meleggya volt a szegnysgnek,
bnzsnek s betegsgnek, amelyek brmikor tterjedhettek a vros tb
bi rszre is.
Ha az ember vgigmegy a mai Londonon, Booth utazsainak szinte
minden rszlett felidzheti. Br az pletek megvltoztak, az emberek ma
is ugyanazok. Bloomsburytl (Virginia Woolf otthontl, a British Mu
seumtl s a londoni egyetem plettl) szakra van egy tancsi lakte
lep, Somers Town. Booth idejben egyes rszeit a legalantasabb, erklcs
telen, bnz" krnykknt rtk le. Ma egy sor l-Bauhaus stlus, sivr, a
harmincas vekbl val lakplet van ott, amelyekben magas a kbt
szer-fogyaszts s bnzs arnya s remnytelen a szegnysg. Somers
Townban vannak a legelkeseredettebb faji ellenttek Londonban, a bang
ladesi kzssg s nhny helyi fehr kztt; a munkanlklisg csapdj
ban vergdnek, s egyms ellen fordulnak.
Egy vszzaddal ezeltt innen nyolcszz mternyire a Regent's Parkra
nz Nash-pletek gy oldottk meg a szomszdsg problmjt, hogy
Somers Townt elkertettk. Minden este bezrtk a kapukat, s megmotoz
tak minden belpt. Ha mr megrendszablyozni nem lehetett az alsbb
nposztlyt, legalbb tvol kellett tartani. Alig harminc vvel ezeltt bon
tottk le az utols falat az angol nposztlyok kztt: tbb mint kt mter
magas volt, tetejn tskkkel. Az i930-as vekben hztk fl keresztben egy
oxfordi utcn, hogy elvlasszk a nyomornegyedek lakinak ptett hza
kat azoktl, melyeket pnzes vevknek szntak. Ltezsnek ma nincs ms
nyoma, mint hogy az utca neve egyszer csak Aldrich Roadrl rthetetlen
mdon Wentworth Roadra vltozik.
Amerikban visszatrben vannak az ilyesfajta korltok, s ismersek
A BR ALATT A LLEK

az ptk problmi. Richard Herrnstein s Charles Murray The Bell Curve


(A haranggrbe) cm knyve i994-ben hnapokig szerepelt a New York
Times bestsellerlistjn. Kzponti megllaptsa Henry Mayhewtl szr
mazik, aki szerint az osztlyhelyzetet a biolgia szabja meg. Herrnstein vi
lgosan fogalmaz: A trsadalom azzal, hogy eltvoltotta a mestersges
korltokat az osztlyok kztt, a biolgiai korltok kialakulst segtette
el. Amikor mindenki elfoglalhatja termszetes helyt a trsadalomban, a
felsbb osztlyok a dolog termszetbl addan tbbre viszik az alsk
nl." A haranggrbe okfejtse rviden, m pontosan gy foglalhat ssze:
Akik a Harvardra jrtak, azoknak jobbak az IQ-tesztjeik; akiknek harvar
di diplomjuk van, jl keresnek, s a Harvardra kldik gyerekeiket." Nehz
ellenllni az okfejtsnek, hogy Amerika minden problmja biolgiai
okokbl ered.
Herrnstein s Murray megllaptsa, hogy a szegnyek maguk felelsek
keserves sorsukrt, a faj i gondolat kezdeteiig nylik vissza. Felfogsuk
Amerikrl, amely egyszeren hagyja, hogy a rossz minsg gnek le
sllyedjenek a fenkre, a Viktria korabeli londoni falak ptinek szeml
letvel azonos: A nemzet npessgnek jelents kisebbsge szmra az in
din rezervtumok technikailag fejlett s fnyzbb vltozatt javasoljuk,
hogy a tbbi amerikai nyugodtan tehesse a dolgt."
A haranggrbe szemllete tizenkilencedik szzadi, de a kzponti faji kr
dst egy Viktria korabeli lelksz tapintatval kerli meg. m az osztly s
a szn hamar egybemosdik. A spanyol arisztokratk vilgosabb brn t
tetszettek az erek. A sz legszorosabb rtelmben kkvrek voltak. Indi
ban a magasabb kasztok brszne vilgosabb az alacsonyabbaknl. Ame
rikban olyan szoros a kapcsolat a trsadalmi helyzet s a brszn kzt,
hogy a szegny" ma mr a fekete" kdszava, ahogy az antiszemitk hasz
nltk valamikor a nemzetkzi bankrt" a zsid" helyett. gy a faji mi
nstsek, amelyek leplezetlen formban kzfelhborodst vltannak ki,
a trsadalmi aggodalom larca mg rejthetk. A genetikailag alsbb ren
d rtegek gondolatnak faji vonatkozsa ma kevsb nyilvnval, mint
Broca napjaiban, de ktsgtelenl ltezik. Csak az a klnbsg az j jobb
oldal s eldei kzt, hogy akik ma hirdetik a biolgia sorsdnt szerept,
azoknak nincs btorsguk nyltan sznt vallani.
A br festkanyagnak az a legnyilvnvalbb szerepe, hogy egyfajta tr
sadalmi cmkt jelent. Csak a szn rkldik, de akiknek rossz gnek jut
nak, azok olyan krnyezetbe kerlnek, amelybl nincs menekvs. Akiknek
stt a brk, azok csaknem mindentt kevsb sikeresek, kevsb egsz
sgesek s - taln - kevsb elgedettek, mint vilgos br trsaik. i993-
A VRNKBEN VAN

ban az Egyeslt llamokban egy kzepes szint (teht a leggazdagabbak


tl a legszegnyebbekig terjed skla kzepe tjn elhelyezked) fekete
hztarts vi jvedelme 4418 dollr volt. A fehreknl ugyanez 45 450 dol
lr volt. Az anyagi klnbsgek nem maradnak meg egy-egy trsadalmi
osztlyon bell: a fekete gyvdek tlagosan fehr kollgik jvedelmnek
hromnegyedt keresik. Az amerikai feketk szocilis rtelemben is kln
nemzett vltak. A legtbb fekete csecsem hzassgon kvl szletik, az
egyedlll fekete nk nagy rsznek van gyereke, s a jellegzetes fekete
csaldban apa nlkl nnek fel a gyerekek.
A fehrek jl tudjk, milyen elnykkel jr a brk szne. Amikor az
amerikai dikokat megkrdeztk, mekkora krtrtst kvetelnnek, ha
egyik percrl a msikra megfeketedne a brk, az tlagos vlasz vi egy
milli dollr volt. A blyeget a hall sem trli le. Az Egyeslt llamokban
az egyves koruk eltt elhallozott gyerekek anyaknyvezsnl a fajtra
vonatkoz adat gyakran megvltozik. Ilyenkor tz eset kzl kilencben a
fekete gyerek tminsl fehrr. Van egy brazil monds, hogy a pnz fe
hrre mos". A gazdagsg fell tud kerekedni a brszn kvetkezmnyein;
akinek elg tetemes a bankszmlja, azt befogadjk brmilyen trsadalmi
osztlyba, akrmilyen stt a bre.
Amint Dl-Afrika s a Viktria kori London pldja mutatja, az ilyen
kilt jvedelemklnbsgek viszlyokhoz vezetnek. Mindazon vesze
delmek kzl, melyek az Uni jvjt veszlyeztetik, a legflelmetesebb a
terletn l fekete npessg jelenltbl fakad. A fehr s fekete lakossg
ellensgeskedsnek rme szntelenl ott ksrt az amerikaiak kpzelet
ben, akr egy lidrces lom" - llaptotta meg Alexis de Tocqueville tizen
kilencedik szzadi francia politikai r az Egyeslt llamokrl.
Br a feketk arnya akkoriban magasabb volt az USA-ban, mint manap
sg, a rossz lom egyesek szerint valra vlt. A szmok mindent elrulnak.
Tbb fekete frfi van brtnben, mint egyetemen. 1995-ben elszr tettk ki
a feketk a foglyoknak tbb mint a felt. Ha ez gy megy tovbb, a szzadfor
dulra a legtbb fekete frfi rcs mgtt l majd. Egy csoportban kln
sen magas a bnzs; az orszgban elfordul erszakos bncselekmnyek
egyharmada a npessg egy szzalkt kitev fiatal fekete frfiak szmljra
rhat. A feketk ldozatok is: egy feketnl htszer akkora a kockzat, hogy
gyilkossg ldozata lesz, mint egy fehrnl. A feketk lettartama tlag hat
vvel kevesebb a fehreknl, s egy harlemi kamasz finak annyi eslye
sincs, hogy megli a nyugdjkort, mint egy bangladesi llampolgrnak.
A ksrts, hogy mindezt a gyenge kpessgeknek tulajdontsk - hogy
az ldozatokra hrtsk a felelssget -, ppolyan ellenllhatatlan ma az
A DUFFY-VRCSOPORT S A MALRIA

Tulajdonkppen senki sem tudja, mire valk a vrcsoportok. De van egy


rendszer, amelybl sejthet, mikpp alakulhattak ki. A Duffy-rendszernek
kt vltozata ltezik. Az egyik, a Duffy-negatv Nyugat-Afrikban tallha
t, a msik a vilg tbbi rszben. Afrikban s msutt gyakori a malria
(s egyre gyakoribb vlik, ahogy kudarcot vallanak a megfkezsre ho
zott rendszablyok). A betegsg krokozja egysejt lskd, amelyet a
sznyogok terjesztenek. A sznyogon bell van neme; az lskdt a ns
tHy sznyog adja t az embernek, amikor a vrt szvja. letciklusuk sorn
elszr a mjat znlik el, ahol szmuk risrtkben megsokszoroz
dik; azutn a vrsvrsejteket tmadjk meg, s flemsztik ket.
A Duffy-pozitv vrcsoport azt a helyet jelli a vrsvrsejt felsznn,
ahov a malria lskdi odatapadnak, mieltt befrdnnak s elpusz
ttank a sejtet. A folyamatban rszt vev fehrje tbb mint hromszz
aminosavbl pl fel, s oda-vissza kgyzik a vrsvrsejt hrtyjn t.
Ltrejttnek mechanizmusa Nyugat-Afrikban genetikai vltozson
ment t. Az j kd a test legtbb szvetn lehetv teszi a fehrje termel
dst, de a vrsvrsejteken lelltja. A behatol lskdk nem tallnak
kapcsoldsi helyet a vrsvrsejten, gy nem tudnak behatolni, teht a
gn vdelmet nyjt hordozinak a malria ellen. Lehet, hogy ms vrcso
portok szintn gy jttek ltre, hogy az sidkben klnflekppen vla
szoltak egyes betegsgekre - de az is lehet, hogy nem.

A malria lskdive/
zsfolt, eltorzult
vrsvrsejt metszete.

179
A VRNKBEN VAN

Egyeslt llamokban, mint annak idejn Eurpban volt. Termszetesen a


gnekbe rt sors legelvakultabb szszli sem hangoztatjk mr, hogy az
alacsonyabb rend fajok - a feketk vagy a szegnyek - alapveten kln
bznek a felsbbrendektl. Kelletlenl bevalljkhogy azok is emberek.
Finomabban kzeltenek a krdshez. A faji klnbsgeknl nem azok a
gnek jtszanak kzre, amelyeket az anatmia vagy a molekulris biolgia
tanulmnyoz, hanem azok az egyelre ismeretlenek, amelyek a tehetsget
s a kpessget szablyozzk: vagyis ember voltunkat.
Paul Broca trsadalmi nzeteibl nem, de biolgiai munkssgbl ki
fejldtt egy tudomnyg: az antropolgia, mely azt kutatja, mit jelent
embernek lenni. Ez a terlet tudatban van a mltjnak, s nhny kve
tjt ppgy elvaktjk a liberlis eltletek, mint a szk ltkr eld
ket a maguk eltletei. A genetika vgre megszabadtotta az embertant a
mltjtl. Most elszr meg tudja vizsglni, mi rejlik a brnk alatt, s v
laszolni tud arra, vajon a rasszok, brhogyan hatrozzuk meg ket, kln
bznek-e alapveten, pldul az intelligencia tekintetben.
Semmi ktsg, a rasszok megklnbztethetk. Egy vrmintbl
knnyen meg lehet llaptani, hogy a donor fekete vagy fehr. Az afrikaiak
vrcsoportjai nem fordulnak el az eurpaiaknl, s sokkal vltozatosab
bak, mint a ms fldrszekrl szrmaz embereki. Egy lucatnyi vloga
tott gn vizsglata alapjn teljes bizonyossggal elklnthetk a vilg k
lnbz rszeirl szrmaz egynek. A Duffy nven ismert vrcsoport
rendszernek pldul van egy kizrlagos nyugat-afrikai vltozata. Akiben
kimutathat az afrikai forma, annak ktsgtelenl volt egy vagy tbb afri
kai se, brmilyen a brszne.
A tnyleges klnbsgek megllaptshoz mr nagyobb szm gn
minta kell. A mintkat tbbflekppen vlaszthatjuk ki: vizsglhatjuk a
gn termkeit - pldul a vrben tallhat fehrjket vagy az ket ltreho
z gnek DNS-t -, vagy azt az risi genetikai llomnyt, amelynek a jelek
szerint semmifle feladata nincs. A legjelentsebb felvilgostssal az or
vostudomny szolgl, ahol a faji klnbsgek feldertse nem politikai kr
ds, hanem let-hall dolga. Szervtltetsnl egyeztetni kell a gnek soka
sgt, amelyek a sejtek felletn az antigneket szablyozzk, mert ezektl
fgg, hogy a befogad immunrendszere tmadsba lendl-e. Minl kevs
b hasonltanak az antignek egymsra a donorban s a recipiensben, an
nl nagyobb a kockzat, hogy a szervezet kiveti a beltetett j szervet. Az
Egyeslt llamokban a szvetvizsglatok orszgos rendszere prostja a
szerveket a betegekkel, s szmtgppel vetik ssze a donor s recipiens
gnjeit abban a remnyben, hogy sszeegyeztethetk. Akkor a legjobbak a

180
A KILKDS BIOLGIJA: SZVETTLTETS
S A SZERVEK SSZEFRHETSGE

A msodik vilghbor fllendtette a sebszetet. ltets olyan, mintha - mondjuk - egy swknys
A krhzakat megtltttk awk a sebesltek, akik sktot egy tollbokrts olasz seregbe helyeznnek:
nek a harctrre val visszajuttatsa ppolyan fon semmi eslye sincs a beolvadsra.
tos volt, mint a lszerutnptls. Egyik-msik el Az immunzszlaljakban antitestek keringe
sznt sebsz brtltetssel prblta gygytani az nek, s klnleges sejtek, amelyek hegyes moleku
gsi sebeket. Szmtalanszor kudarcot vallottak, de lalndzskat vetnek a fertztt sejtre, s meglik
ltrejtt a biolgia s az orvostudomny j ga. {vagy rknyszertik, hogy ngyilkossgot kves
Amikor- mondjuk- egy katona lbrl ltettk sen el). Szntelen tevkenykednek. Ha megsrl
t a brt az arcra, a mtt rendszerint sikerlt. De ne mert az immunrendszert betegsg tmadja
amikor valaki msrl vittk t a brt egy betegre, meg (pldul az AIDS), a beteg elbb-utbb ldo
aki ol
yan slyos gsi sebeket szenvedett, hogy nem zatul esik valamilyen fertzsnek. A szervtltets
maradt elg sajt bre, a szervezet kivetette az tl hez hozztartozik, hogy a donort s a recipienst
tetett szvetet. Az egrksrletek azt mutattk, hogy minl gondosabban vlasszk ki, s az immun
a jelensget az ad s a kap kzti genetikai klnb rendszert gygyszerekkel elfojtsk. Az embriban
sgek okozzk. A folyamatban rszt vev n. hiszto tanulsi" folyamat megy vgbe, melynek sorn a
kompatibilitsi gneket alaposan tanulmnyoztk. test sajt antignjeit felismer T-sejtek elszapo
Az idegen tltetst (a transzplanttumot) k rodnak, a tbbiek elsorvadnak. Ha ezt a folyama
lnleges fehrvrsejtek, az n. T-sejtek tmadjk tot le lehetne msolni, elrhetnnk, hogy a szerve
meg. Azrt ismerik fel, mert a hisztokompatibilit zet befogadja az idegen tltetst. Ez a megolds
si gnek rvn beljk kdolt awnossgi jelek - az egyelre nem jrt sikerrel, de az immunrendszer
antignek- eltrnek a sajtjaiktl. Ezek a gnek na jobb megismerse remnnyel kecsegtet a jvben.
gyon vltozatosak: nmelyikk tbb mint szzfle
formban ltezik, s szemlyenknt eltr. Az egy Szaruhrtya a kilkcJds egyik szakaszban. A szem
petj ikreken kvl mindenkinl egyedlll ez a fellet ltalban viszonylag knnyen befogadja az
vdgnkszlet, s klnbzik mindenki mstl. tltetett szvetet, mert vrben szegny. Ennek a be
Mirt ltezik ennyi vltozat? Vgeredmnyben tegnek azonban nem volt szerencsje, s jabb ksr
a gnek jval azeltt fejldtek ki, hogy a szervtl letre van szksg, hogy megmentsk a ltst.
tets gondolata egyltaln felmerlt volna. Mai is
mereteink szerint a jelensgnek az az oka, hogy az
antignek rendszerint olyan sejtekre sszpontost
jk az immunrendszer vdekez mechanizmust,
amelyeket baktriumok vagy vrusok tmadtak
meg. Lektik a tmadkat, s ezzel elklntik a
fertztt sejtet a tbbitl. Mint egy kzpkori
hadsereg dszes uniformisa, a hisztokompatibilit
si gnek mindenkinek egyedlll genetikai azo
nossgot klcsnznek, amelyet a behatolk nem
tudnak egyknnyen lemsolni. Az idegenek ltal
megtmadott sejtnek viswnt megvltozik az uni
formisa, ezrt meglik. Az emberek kzti szervt-

181
GNEK TVOL AFRIKTL

Az emberi trzsfejlds kutatsa olyan, mintha Afrikban (a Klasies folynl s a Border-barlang


trtnelmet rnnk forrsmunkk nlkl. Csak ban, az orszg szaki rszn), Etipiban s Izrael
nhny skori lelet ll rendelkezsre, annak is leg ben a Krmel-hegy, valamint Nzret kzelben.
tbbje tredkes. Darwin gy vlte, az emberisg Knban a legrgibb lelet krlbell hatvanezer
Afrikbl szrmazik, de ezt sokan vitattk. Beszl ves, Ausztrliban nagyjbl tvenezer. Eurp
tek egy elveszett fldrszrl is, Lemurirl, amely ban szinte utoljra jelent meg a mai ember, kb. har
ma az Indiai-cen mlyn pihen. mincezer vvel ezeltt. Csak Amerikt s a Csen
Amikor flfedeztk Nmetorszgban a Nean des-cen vidkt hdtotta meg ennl ksbb.
der-vlgyi sembert, s bizonytottnak lttk, A gnek is az emberisg afrikai gykereire utal
hogy ennek a fajnak a helybe lpett a modern em nak. A DNS-vltozatok felhasznlsval elkszt
bertpus mintegy negyvenezer vvel ezeltt, nyil het a vilg klnbz rokonsgi fok npeinek
vnvalnak tnt, hogy fajtnk szlhelye Eurpa. csaldfja. Ez azt mutatja, hogy az afrikaiak gene
Hiszen a kultra Eurpban jutott a legmagasabb tikai rtelemben jobban eltrnek egymstl, mint
fokra; mirt ne lehetne ugyanez a helyzet az em a tbbiek, s hogy az emberi gnllomny legsibb
berrel is? Francia kutatk kvetkezetesen vgigvit szrmazsi gai errl a fldrszrl erednek.
tk a gondolatot: szerintk egy csontvz, amelyet a
Dordogne-ban talltak, olyan, mint a mai zsiaia
k, egy msik a rivirai Menton fltti dombokon BALRA LENT: Korai nem afrikai ember koponyja a
az afrikaiakhoz hasonlt. A cr-magnoni sem quafzehi satsokrl (a mai Izrael terletn). Alig n
ber (ugyancsak a Dordogne-bl) a mai eurpaiak hny tzezer wel els mai ember megjelense utn
az

ra emlkeztet. Az eredmny vilgos volt: Francia megkezddtt az elvndorls az sifldrszrl szerte


orszg a vilg npeinek szlhelye. a vilgba. A quafzehi koponya hasonlt a legkorbbi
Jelenleg a legtbb paleontolgus egyetrt abban, emberekhez -s nem sokban klnbzik a mienktl.
hogy a legsibb emberi maradvnyok Afrikbl
szrmaznak. Nhnyan azonban gy vlik, hogy JOBBRA LENT: Kpzelet szlte s tnyeken alapul el
legrgibb eldeink koponyja nagyjbl ezzel egy kpzelsek arrl, hogyan terjedt el a vilgon a mai
idben jelent meg a vilg ms rszein is. Alig szz ember. A trkpet Ernst Haeckel nmet zoolgus raj
ezer vvel ezeltt a maiakhoz hasonl emberi l zolta. Szmos rszletrl ma mr tudjuk, hogy helyt
nyek hagytk htra maradvnyaikat kt helyen Dl- ll. Msok afantzia mvei, mint Lemuria.
A BR ALATT A LLEK

kiltsok, amikor hat vagy tbb sejtfelleti antign kzs. A csoportok ge


netikai eltrsei- pldul a feketk s fehrek kztt - azonnal megmutat
koznak, mert cskken az egyik csoport alkalmassga a msiktl szrmaz
szerv befogadsra. 1gy a szvetegyeztet szmtgp szinte mellkesen
risi informcitmeget tartalmaz a rasszok kzti genetikai klnbs
gekrl.
Amerikban a legtbb tltethet szvet fehrektl szrmazik. A szm
tgp adatai szerint minden tizedik vesebetegnek hat klnbz gnje
van, amely egyeztethet a rendelkezsre ll szervllomnnyal. De csak
minden tvenedik fekete beteg ilyen szerencss. Ez magban is meggy
zen bizonytja a rasszok kzti genetikai eltrst, vagyis azt, hogy a feke
tkben s fehrekben rkltt eltrsek vannak a sajtjuktl eltr brsz
n donor szervnek befogadsra. m a szvetegyeztets rvilgt mg egy
fontos tnyre. A sajt fajtn bell is csak a mindenkori betegek kisebbsg
nl egyezik hat kulcsfontossg gn. Mghozz azrt, mert nagyok az
rkltt klnbsgek egy-egy rasszon bell is. Jval nagyobbak, mint a
rasszok kzti genetikai eltrsek, vagyis a fehrek s feketk egynenknt
annyira klnbzek genetikailag, hogy a legtbb szervtltetsi ksrlet
nl nincs meg a hat egyezs az ad s a fogad kzt.
Ilyenkor gygyszerekkel cskkentik a test kpessgt, hogy az idegen
szvetet felismerje. Az egyeztet szmtgp (s sok ms gn vizsglata)
kimutatja, hogy a feketk s fehrek tlagos genetikai klnbsge kisebb,
mint az azonos fajtj egynek. Mivel az egyes szemlyek kzti eltrsek
ennyivel nagyobbak a rasszok kzttieknl, csaknem minden beteg azonos
gygyszeres kezelsben rszesl, akr a sajtjval azonos brszn donor
tl szrmazik az j szerve, akr nem. Amikor let-hallrl van sz, el
enysznek a faji klnbsgek.
A szervtltets azt igazolja, hogy- mint ezt mr Hogarth is felismerte
- a fajok csak a felsznen klnbznek. A transzplantciknl szerepet jt
sz, de egyb gnek tansga szerint is a Homo sapiens nagyon is egynte
t faj a vilg klnbz rszein a tbbi emlshz kpest. Ktsgtelenl
azrt, mert evolcis szempontbl csak a kzelmltban fejldtt ki s ter
jedt el az egsz Fldn. Minket az eszmk, nem a DNS evolcija tesz em
berr.
De brmilyen klssges dolog a fajta, ostobasg tagadni a ltezst. Ha
a klnbz helyekrl szrmaz emberek rnzsre eltrnek egymstl,
akkor sszer kritriumok alapjn kategrikba lehet sorolni ket. rde
mes megrizni a fogalmat mg akkor is, ha sokszn csoportokat von egy
kalap al.
A VRNKBEN VAN

Hiba nincs bizonytk arra, hogy a fajtk jelentsen klnbznnek


egymstl, makacsul tartja magt a hiedelem, hogy a fekete brszn m
lyebben rejl evolcis klnbsgek jele. Az egyik kzismert nzet, hogy a
fekete br, akr Mayhew csavarginak" szgletes arca, csekly rtelemrl
rulkodik. A fekete amerikaiak teljestmnye valban alatta marad a feh
reknek az tlagos vagy szoksos intelligenciavizsglatoknl. Sokan ezt az
eltletekkel magyarzzk, s azzal, hogy nluk kisebbek a kvetelmnyek
s rosszak az iskolk. Msok azonban szletett s megvltoztathatatlan
adottsgokkal. Szerintk a brszn a fajtk alapvet klnbsgt jelzi,
amely nemcsak a szvettltetsnl nyilvnul meg, hanem az rtelmi k
pessgekben is.
A fehrek genetikai felsbbrendsgnek bajnokai azt bizonygatjk,
hogy az lltlagos klnbsgek oka az evolcis mltban keresend. An
nak az idnek a maradvnyai, amikor a feketk oiyan helyeken ltek, ahol
az let kegyetlen volt, komisz s rvid, s rdemes volt minl tbb gyereket
a vilgra hozni, mert a legtbbre gyors hall vrt. Ilyen krlmnyek kzt
az sznek nem volt rtke, hiszen a gondok nagy rsze elre lthatatlan s

Vizeskors, attikai stlusban,


valamikor Kr. e. 510 eltt kszlt.
A fekete s fehr embert brzol
trgyban a mclaninmozgalom
annak bizonytkt ltja, hogy
a fehrek vettk t a feketk
kultrjt, s nem fordtva.
A BR ALATT A LLEK

elkerlhetetlen volt. Jobban tettk, ha szaporodnak s meneklnek, akr a


kutyk; ha minl kevesebbet fektetnek be egy-egy utdba, de minl tbbet
hoznak a vilgra. Afrikban semmi rtelme nem volt a nagymret - s
sok rfordtst ignyl - agynak. Csak akkor vltozott meg a helyzet, ami
kor az emberek elvndoroltak a jeges szakra, s letk nehz, de kiszmt
hat lett. Az els eurpaiaknak, ha nem akartak elpusztulni, meg kellett
terveznik a jvt. A gyerekek csak akkor maradtak letben, ha gondjukat
viseltk. Sokkal tbb befektetst ignyeltek, teht nem lehetett bellk sok.
Akik magasabb intelligencit hordoztak a gnjeikben, knyebben letben
tudtk tartani utdaikat, br nemi teljestkpessgk cseklyebb volt. l
ltlag a fehreknek tbb az eszk s kisebb a pniszk (jllehet rdekes
mdon egyikre sincs semmi bizonytk); ebben a felfogsban pompsan
egyesl a kt hagyomnyos rgeszme, egyrszt a feketk nemisgrl, ms
rszt a feketk ostobasgrl.
Az evolcis elmlet hatrtalanul rugalmas. Ltrehozta a fajok trtnel
mnek egy msik vltozatt is, mellyel sok fekete egyetrt. Szerintk a fe
hrek elszr Afrikban bukkantak fel, s azrt hagytk el szlfldjket,
mert fekete szleik nem akartak tudni rluk, gy neki kellett vgniuk a vi
lgnak. Spadt brk nem brta a nap hevt s melegt, gy vgl Eurp
ba kerltek, ahol a kegyetlen krnyezetben nyomorsgosan ltek s egy
ms kzt hzasodtak. A fehrek a jg emberei", hidegek, nzk s csak
magukkal trdnek. A feketk viszont, a nap emberei, megriztk nylt, se
gtksz s szvlyes termszetket, amely afrikai szlfldjk bsgben
alakult ki.
A valsgban a feketk egyltaln nem ostobk, ppen hogy tehetsge
sebbek a fehreknl. A civilizci a fekete egyiptomiakkal kezddtt, nem
a grgkkel (akik tjra bocstottk a mtoszt, hogy csak a fehrek kpe
sek kultrateremtsre). A Nlus menti npeknek vitorlz replik voltak
[a kairi mzeumban lthat egy modell - a szerk. ] s villany akkumul
toraik [taln a bagdadi elemrl van sz - a szerk. ] ; ismertk a kvantumme
chanikt, s megelztk Darwint. A feketk mr Kolumbusz eltt felfedez
tk Amerikt, s voltak afrikai sei Freudnak, Jungnak, st taln mg Bee
thovennek is, hiba tagadjk.
Mindezt a fekete amerikaiak melaninmozgalma hirdeti, amely jrar
telmezi az evolcit, s kveteli, hogy a feketk kapjk meg az ket megil
let helyet a trsadalomban. Csak egyvalamiben rtenek egyet a fehr f
lny hveivel: hogy a fekete brfestknek, a melaninnak a gnjeiben rejlik a
magyarzat egyesek sikereire s msok kudarcaira. j tudomnyukat az is
kolkban tantjk, tudatostani akarjk a dikokban Amerika afrikai gy-

185
A MELANINMOZGALOM POLITIKJA

A melaninnal kapcsolatos vita kzppontja a New York-i City College,


amelyet annak idejn a vros lakinak egyetemeknt alaptottak. Hossz
veken t az Amerikba znl zsidk gyerekei tanultak itt. A Harlem pe
remn ll, gy ma szmos hallgatja fekete. Kevs a pnzk, s az lltlagos
sznvonalcskkens szntelen vitk forrsa.
A Fekete Tudomnyok Tanszknek vezetje Leonard Jeffries. Neki is az
a vlemnye, hogy a fehr civilizci a fekete Egyiptombl indult ki, s a
melanin egyedlll kpessgekkel gazdagtja a feketket. Szemlye - az
intzmny mltjt figyelembe vve - elkesert vita kzppontjba kerlt,
mita kijelentette, hogy a fekete amerikaiak elleni sszeeskvs mgtt a
zsidk llnak, akik valamikor a rabszolga-kereskedelembl is alaposan ki
vettk a rszket. A horogkereszt afrikai szimblum, mondja, amelyet a
ncik csak kisajttottak, s senkinek nem lehet kifogsa az ellen, ha is
mt hasznlja valaki. Kijelentsei risi felhborodst vltottak ki. A City
College-ban les vita folyt arrl, megengedhet-e egyltaln, hogy ilyesmit
hangoztasson. Ma mr testrkkel veszi krl magt. A melaninmozga
lomnak angol hvei is vannak. Pldul az a lemezlovas, aki a DNS nevet
vette fl (korbban Sowetnak nevezte magt), s egy manchesteri kalz
rdiban fennen hirdeti a melanintudomny rdemeit mindenkinek, aki
csak meghallgatja.
A feketk nbecslsnek mozgalma irnti lelkesedsn mit sem csk
kent az a tny, hogy mindkt szlje fehr.

A manchesteri lemezlovas,
aki a DNS nevet vette fl,
s a melanintudomny
odaad hve.

186
A BR ALATT A LLEK

kereit (pldul nluk az afrikai szreti nnep, a Kvanza veszi t a hlaads


napjnak helyt). A mozgalom az Oregon llambeli Portlandbl indult,
ahol i987-ben egy Tanulmny az afrikai-amerikai alapokrl cm, szles
krben terjesztett rpirattal igyekeztek mlyebb ismereteket nyjtani a
gyerekeknek a trsadalomrl, amelyben lnek. A detroiti ifjsg krben
mr rdimsorok npszerstik a melaninelmletet, s New Yorkban az
iskolabizottsg nhny tagja is tmogatja. Tbb melaninkonferencin"
hirdettk, mi mindenre kpes a csodatv anyag. Angol hvei is vannak az
elmletnek. Egy manchesteri kalzrdi lemezlovasa (aki a DNS" nevet
vette fl) msorban gyakran ismerteti a melanintudomnyt, amely ko
molyan foglalkoztatja a fekete kzssget.
A biolgusok eddig azrt nem foglalkoztak a melao,innal, mert nehz
elemezni, s feladata els pillantsra nyilvnvalnak ltszik. Mindenfle
llnyben effordul, s szmos vltozata ltezik. A szarvasbogarakban
meg a tlrett bannban egyarnt nagy mennyisgben tallhat. A legtbb
stt szr emlsnek - pldul a fekete prducnak - a szrben van mela
nin, de a bre vilgos. A jegesmedvnek viszont a bre fekete s a szre fe
hr. Az anyag vegyileg igen stabil, egyszer lerajzoltk egy szztvenmilli
ves tintahal kpt a maradvnyaibl kivont tintval - tiszta melaninnal.
Lehet, hogy a melanin kmiailag semleges anyag, de trsadalmi s poli
tikai rtelemben robbankony. Azoknak a feketknek az rvei, akik nem a
gyengesg, hanem az er jelkpnek tekintik, nemrgen knyv alakban is
napvilgot lttak. Carol Bates Melanin, a feketk nagysgnak kmiai kul
csa cm munkja - br nem kerlt a bestsellerlistk lre - figyelemre
mlt rs. Mr-mr csodatv tulajdonsgokkal ruhzza fel a melanint.
Azt lltja, hogy pigmentjk a feketket szellemi s lelki adomnyokkal
gazdagtja. A melanin beissza s tudss alaktja a fnyt. Fogkonny tesz a
zenre, gy szletett a dzsessz. Amikor ritmus s melanin tallkozik, a test
endorfin hormont termel, amely kzismerten boldog, kielglt rzst
okoz. A melanin szupravezet s mikrokomputer, amely fokozza az intelli
gencit s az emlkeztehetsget. Az idegrendszer tele van ezzel az anyag
gal, teht akik bvben vannak, felttlenl rtelmesebbek. De megkti a
narkotikumokat, ezrt a feketk knnyebben lesznek a kbtszer rabjai,
ami htrnyos helyzetbe hozza ket a pnzhes fehr trsadalomban.
A br pigmentjnek genetikja egyszer. A feketket s fehreket mind
ssze egyetlen gn klnbzteti meg, amely kt formban ltezik. Az egyik
termel pigmentet, a msik nem. A fehreket egy genetikai baleset hozta lt
re, melyet hatezer vvel ezeltt okozott az afrikai gnllomnyban egy
Jakub nev fekete tuds. Mivel a fajtk keveredsbl fekete gyermek sz-
A VRNKBEN VAN

Amon istent brzol domborm az


egyiptomi Szakkara zisz-templomrl
(Kr. e. 7. sz.). Az istensgnek afrikai
vonsai vannak, s gyakran hivatkozik
r a modern melaninmozgalom,
amelynek kzponti tmja a fekete
kultra trtnelmi szerepe s a melanin
misztikus hatsa az si egyiptomiak
gondolkodsmdjra.

letik, gy a fehrek rettegnek a fekete nemisgtl: A fekete hmeknek min


den genetikai lehetsgk megvan a fehrek megsemmistsre. Ezrt a fe
hrek genetikai fenntartsra ltrehozott hatalmi rendszerben a fekete fr
fiakat meg kell tmadni s el kell puszttani. A fehrek genetikai fennmara
dsnak parancsra ma nem gzkamrkban vetik be a vegyszereket, ha
nem az utckon - kokain, extasy, PCP s heroin formjban. Az AIDS
olyan fegyver, melyet laboratriumokban fejlesztettek ki azok, akik fehr
nek valljk magukat."
Frances Cress Welsing, a melaninelmlet egyik megteremtje, aki ezeket
a mondatokat rta, mg tovbb megy. A melanin rvn a feketk fl tudjk
venni a nvnyek kibocstotta energil, llaptja meg. St a melanin jvol
tbl szleltk a nyugat-afrikai dogonok mr tezer vvel ezeltt a Szriusz
szabad szemmel lthatatlan ketts csillagt. Csak a hue-man'', a sznes a
valdi ember, a tbbi csak tkletlen vltozat. A br pigmentjt, mondja,
az agyban a tobozmirigy szablyozza. Ezt a misztikusok hossz ideig a
harmadik szemnek" - Hrusz szemnek" - tartottk, amelyen t a tudat

188
A FAJ FELSZNI SZEMLLETE:
MELANIN A BRBEN

A br nll szerv. A kls vdrteg hmsejtjei sgben viszont a vererek a meleg vrt egyenesen a
elhaltak, s teltve vannak a keratin nev fehrjvel felsznre vezetik, hogy lehljn.
(a hajnak is ez az anyaga). Redibl, az ujjlenyo Ezenkvl a brben vitamin is kszl, tovbb
matokbl (s a hasonlan jellegzetes redkbl az faggymirigyek vannak benne, amelyek nedvesen
ajkon s msutt) megllapthat a szemlyazonos tartjk, s az immunrendszer fontos rszeknt
sg. A bels, l irhartegnek szmtalan feladata megkzdenek a fertzssel. A fekete (lent jobbra)
van. Ez a hfelvtel, a fjdalom s a tapints szerve. s fehr (lent balra) br metszetn lthat, milyen
Egyttal szablyozza a hmrskletet az izzads nagy a klnbsg melanintartalmukban. Az anyag
rvn (a verejtk prolgsakor a test ht veszt), s egy rtegben tmrl a hm- s irharteg hatrn.
olyan mdon is, hogy a klvilg hmrsklettl A melanocitk szma azonos a feketkben s a fe
fggen a mlyebben fekv vagy a felszni erekbe hrekben, de a fekete brben ezek a sejtek sokkal
irnytja a vrt. Hidegben a meleg artris vrt aktvabbak. Mivel a melaninszemcsk a sejtmag
olyan erekbe vezeti, amelyek a felsznrl visszatr krl csoportosulnak, valsznleg szerepk van a
hideg vns vrt szlltkkal prhuzamosan fut DNS-nek az ibolyntli sugarak kros hatsa elle
nak, gy a meleg a test belsejben marad. Nagy h- ni vdelmben.

Melannszemcsk eloszlsa klnbz emberfajtk br


metszetn.
A VRNKBEN VAN

befogadja a kvlrl rkez rezgseket. A fehreket elmeszesedett, megk


vesedett tobozmirigyk elzrja a szellemi vilgtl.
Mindennek nagy rsze zagyvasg, vagy legjobb esetben ltudomny
(br semmivel sem rosszabb, mint a fehr flny hveinek klns elgon
dolsai a fekete meg fehr evolcirl). Csakhogy mra kialakult a br
pigmentjvel foglalkoz valdi tudomny, amelynek nhny felfedezse
meglepen kzel ll a melaninmozgalom tteleihez (br mondanunk sem
kell, a kutatk sokkal krltekintbben bnnak felfedezseikkel, mint a
hitvitzk, brmilyen szn a brk).
Amikor megprbltk kivonni a melanint, sr anyagot kaptak, mely
nek vegyi sszettele nehezen elemezhet. Hogy vdelmet nyjt a nap el
len, olyan nyilvnval, hogy nem is szorul bizonytsra. Nhny vvel ez
eltt mg a r vonatkoz kutatsokat nagyrszt a prizsi Anatmiai M
zeum hagyomnya jellemezte: egyszeren megadtk, hol tallhat, a m
kdse mr nem nagyon rdekelt senkit.
Most azonban gy ltszik, hogy br a molekula nehezen adja meg magt,
figyelemre mlt s meglep tulajdonsgai vannak. Taln nem a feketk
nagysgnak kulcsa, de hatsa sokkal jelentsebb, mint valaha gondoltk.
Annak a hossz biokmiai tnak a vgn van, melynek sorn az idegrendsze
ri folyamatokban szerepet jtsz vegyi anyagok termeldnek. A melanoci
tknak nevezett klnleges sejtekben kpzdik. Ezek az embri dclc nev
rszn keletkeznek, amelynek legfbb feladata az idegszvetek ltrehozsa.
A melanocitk csak az embri tizenkt hetes kora krl lpnek be a br
be. Elvndorolnak a szivrvnyhrtyba, a recehrtyba, a bels flbe, to
vbb a szj belsejt bort, valamint az agyat s gerincet vd hrtykba.
Az agy bizonyos rszei mlyfeketk, akrcsak a fl s a szem, mert ott igen
sok van bellk. Az tlagos frfinak mintegy ktmilli melanocitja van,
legsrbben az arcon, a mellbimbn s a nemi szerveken. Egyttes slyuk
nem tbb egy grammnl - ennyit nyom egy tollpihe -, teht elg kevs, ha
meggondoljuk, milyen mlyrehat trsadalmi kvetkezmnyeket idz el
ez a szvet. Mindegyik melanocita apr szemcsket - melanoszmkat -
termel, amelyek bejutnak a br tbbi sejtjbe. A feketknek sincs tbb
melanocitjuk a fehreknl, de az vik sokkal aktvabbak.
Mi a melanin feladata? Els pillantsra gy ltszik, az evolci hibzott.
A tbbi llatra vonatkoz szablyok rtelmben az eurpaiaknak kellene
feketknek lennik s az afrikaiaknak fehreknek. A legtbb forr, napf
nyes helyrl szrmaz llny nem stt, hanem vilgos, abbl az egyszer
okbl, hogy a fekete trgyak jobban elnyelik a napfnyt. Egy fekete ember a
napon egyharmaddal tbb napenergit szv magba, mint egy fehr br.
A BR ALATT A LLEK

Klnll sejtek egy rosszindu


lat melanmbl, a brrkbl,
amely hallos is lehet, ha nem
kezelik idejben. A betegsg
sokkal gyakoribb a fehrek kzt,
mint a feketknl, s feltehetleg
sszefggsben van azzal, hogy
az ibolyntli sugrzs (amely
a fehr brn knnyebben
thatol) krostja a DNS-t.

Az ember trpusi eredet, ezrt jr rendszerint ruhban. Akr az egyen


ltrl jtt valaki, akr a sarkvidkrl, ugyanolyan hfokra lltja be a kz
ponti ftst. A hideg veszlyes. A vr besrsdik, az erek sszeszklnek,
s emelkedik a vrnyoms. Mindez tbb munkt ad a szvnek. Hidegben
drmaian megn a szvbetegsgekbl s agyvrzsbl add hallesetek
szma - minden hromfoknyi hmrsklet-cskkensnl egytizeddel.
Angliban a tl kzepn ktszer annyi agyvrzs fordul el, mint nyron.
Mg a kellemesnl hidegebb nappali szoba is nveli a hall kockzatt.
Ezrt is nvekszik ktszer olyan mrtkben a tli hallesetek szma a sze
gnyek, mint a gazdagok krben. Evolcis elnyt kellene lveznie mind
ennek, ami a hideg ghajlaton segt a flmelegedsben (tbbek kztt a fe
kete brnek).

19 1
A VRNKBEN VAN

Ms tulajdonsgok kifejldst ktsgtelenl befolysolta a hideg. Az


ausztrliai bennszlttek fagyos jszakkon meztelenl alszanak a szabad
ban, mg krlttk az elpuhult birkanyrk hlzskban is dideregnek.
A test felptse is alkalmazkodik az alacsony hmrsklethez: a sarki em
berek (kevs kivtellel) alacsonyabbak s zmkebbek a trpusiaknl, gy
kisebb felleten vesztenek ht.
Fzni kellemetlen, de ltalban lehet rla tenni, s ha mgsem, akkor is
tllheti az ember a testhmrsklet cskkenst Ha azonban tlsgosan
meleg van, az vgzetes. Sok llat hmrskleti ktltncot jr: rnykba vo
nul, aztn vissza a napra, hogy megfelel hmrskleten maradjon. A spa
nyol bikaviadaloknl a lelt rnykos helyei ktszer annyiba kerlnek, mint
a napos oldal, ilyen nagy az rtke a megfelel napstsnek. Ha nem j az
arny s tl nagy a felmelegeds, a szervezetnek van egy biokmiai tzolt
osztaga, amely vdpokrcokkal rkezik: a hsokkfehrjkkel. Ezek a fehr
jk (amelyeket nha hzelgen rzknek neveznek) a sejt sebezhet rszei
kr gylnek, mintegy vdpajzsot alkotva. A szibriaiak sokkal alacsonyabb
hmrskleten mozgstjk rziket, mint a melegebb ghajlatrl szrma
zk, teht a novoszibirszkiek hamarabb tzbe jnnek, mint a npolyiak.
Annl klnsebb, hogy a trpusi npek feketk, gy tbb napenergit
nyelnek el. Csakhogy jobb, ha az ember hvs marad, mint ha elkerli a
meleget. A nedves trpusokon a feketk, ha fraszt munkt vgeznek a
napon, sokkal tovbb brjk, mint a fehrek. k ugyanis - ma mg nem
nagyon ismert okokbl - jobban izzadnak, mint a fehrek. Az izzads - a
test leghatsosabb htrendszere - tbb haszonnal jr, mint amennyi krt
a brszn okoz. A fekete br taln mgis mrskli a felmelegedst, mert ki
tnen vd a legs ellen (amely cskkenti az izzadsi kpessget). Azok
ban a trzsi trsadalmakban, ahol a vadsznak egsz nap a szabadban kell
tartzkodnia, s trnie a meleget meg a napot, hezs vrna az lelemszer
zre l"'gy a gyermekeire, ha a legstl mozgsa lelassulna.
Aki mr vgignzte, hogyan fakulnak ki sznyegei, jl tudja, mekkora
ereje van az ibolyntli sugrzsnak. A melanin viszont kivl vdelmet
nyjt ellene. Akiknek kevs a melaninjuk, azokat komolyan fenyegeti a
brrk veszlye. A betegsg gyakorisgt illeten rorszg a harmadik he
lyen ll (Ausztrlia s Dl-Afrika utn), br az itt lk kevs napot kapnak,
de sok kztk a fehr br. A fehr br fehrek nyolcszor veszlyeztetet
tebbek a barna breknl. A feketknl pedig csak harmincszor annyi
napfny okoz legst (a brrk legfbb okt), mint a fehreknl.
Az ellenrizhetetlen sejtosztds - vagyis a rk- azrt indul meg, mert
ha a napfny oxignnel s vzzel lp klcsnhatsba, ersen reakcikpes

192
LENYGZ RITMUS:
MELANINKIVLASZTS S A SZERVEZET RJA

A melaninmozgalom olyan figyelemre mlt k goltsgban, amely a stt tli idszakokban lesz
pessgeket tulajdont a melaninnak, amelyek elg rr egyeseken, fkpp a stt br, stt szem
g bizonytalan kapcsolatban vannak a festkszem embereken, mert az bels rjukhoz kevesebb
csk tnyleges szerepvel. Mg tbb tlz meglla fny jut el. A hormon befolysolja a szem egyes
pts fzdik a melatonin nev hormonhoz, amely pigmentjeinek ellltst is, s segti a ltst.
a melanin kivlasztst szablyozza sok llatban. A melatonin csodja szerny cmet visel knyv
A kzelmlt egyik amerikai sikerknyve szerint a szerint a hormon visszafordtja az regedst (eL.rt
melatonin nemcsak az ideltolds okozta tnete amerikaiak millii szedik rendszeresen). Leg
ket orvosolja, hanem taln a rkot, st az regeds albbis az egereknl lltlag visszafordtotta. Saj
rtalmait is. Egy megllapts - az els - igaz. nos a ksrletnl hasznlt egerem n
i d melanin
A melatoninhormont az agyalacon a tobozmi hinyos llomnyokbl szrmaztak, teht nluk a
rigy termeli. Nhny llnyben, pldul a bkk ksrlet csak a normlis szintet lltotta helyre.
ban s varangyokban gyors sznvltozst idz el, Mg kevsb bizonytott tny, hogy gygytja a r
gy az llat mindig beleolvad krnyezetbe. Az em kot: a melatonin valban elnyeli a szabad gyk
bereknl azonban a melatonin nem befolysolja a ket, de ht erre a C-vitamin is alkalmas (amely ha
brsznt (kivve, amikor a tobozmirigy megbete tsosabb s jval olcsbb). A hormonnak pp elg
gedse kvetkeztben tl sok melanin rakdik le). kivlak a termszetes tulajdonsgai, flsleges
De valban szoros kapcsolatban ll az alvst s b tdtaniuk felle azoknak, akik a melatonint els
redst, valamint a testhmrskletet s sok ms sorban pnzforrsnak tekintik.
mkdst szablyoz bels rval, amelyet a lt
ideg-keresztezdsen l idegmag mkdtet, ez
pedig kzvetlenl a szemtl kapja az idegi jeleket. Havasi nyl: tlen fehr a szre, nyron sokkal st
Teht az ra tllthat, amikor a vilgossg stt tebb. A melanin mennyisgnek vltozst egy las
sgbe vlt. (Ezrt a legknnyebben gy lehetnk san jr, ves ciklus ra szablyozza. Ennek mak
rr az ideltolds okozta tneteken, ha megr dst a melatonin irnytja, akrcsak a napi ciklus
kezskor minl tbbet tartzkodunk ragyog nap rt; mindig ugyanazok a gnek makdnek - leg
fnyben.) A melatonintermels jszaka a legna albbis az alacsonyabb renda llatoknl - a szervezet
gyobb, ez adja az utastst az alvsra. riban, akr msodperceket mrnek, akr veket.
Az emlskben, amelyek csak tavasszal szapo
rodnak, a melatoninkivlaszts ves ritmusa nem
csak a szaporodst szablyozza, hanem az ven
knti vltozsokat is (pldul a bunda sznt). Le
hetsges, hogy a hormon befolysolja valamelyest
az emberi szaporodst is; egy fogamzsgtl tab
lettban egytt alkalmaztk a szaporodsi hor
monnal, a progesztinnel. Mivel hatssal van a szer
vezet napi ritmusra, alvsi rendellenessgeket is
kezelnek vele. Egyes felttelezsek szerint az elgte
len melatoninkivlasztsnak rsze lehet az vszak
rzkenysgi depresszinak nevezett slyos lehan-

1 93
A VRNKBEN VAN

Afrikai frfi, akinek a br


ben nincs melanin, mert kt
pldnyt hordoz az albiniz
mus gnjbl. A jelensg
gyakoribb Afrikban, mint
Eurpban. Csaknem
minden rintettben kialakul
idvel a brrk valamelyik
formja. Gyakori elfordu
lsnak oka ismeretlen,
de a jelek szerint minden
hordozjnak DNS-ben
ugyanaz a krosods
tall hal, teht kzs stl
szrmazik. A gn taln
a bantu terjeszkedssel"
szrdott szt, amikor
a trtnelmi idkben
megindult az elvndorls
a trpusokrl dl fel.

anyagokat - szabad gykket- hoz ltre, amelyek megtrhetik a DNS-ln


cot. A melanin fkpp azrt nyjt vdelmet, mert fel tudja szvni ket, s
gy negyedre cskkenti a DNS-krosodst. De ez mg nem minden. Ha
nagyon ers az ibolyntli sugrzs, a melanin veresget szenved, s maga
is szabad gykket kezd termelni, amelyek ugyancsak krostjk - nem pe
dig vdik - a DNS-t. Erre fkpp a melaninnak az a formja hajlamos,
amely a vrs hajban s a szeplkben tallhat, ezrt nagyobb az esly a le
gsre s a brrkra a vrs hajaknl. A vrs haj gnjei jtszanak kzre
egy melanocitaserkent hormon ltrejttben is, amely a napfnytl kro
sodott brt melanin termelsre kszteti. Tz nagyon fehr br vrs ha
jbl nyolcban megtallhat ennek a gnnek- a srlt vltozata, mg a
knnyen barnul stt hajak kzl csak minden huszontdikben.
Afrikban termszetes krlmnyek kzt tanulmnyozhat, milyen
krosodst okozhat a nap azokban, akik nincsenek alaposan felvrtezve
ellene. Az albn" kifejezs Balthazar Tellez portugl utaztl szrmazik,
aki csodlkozva ltta, hogy a nyugat-afrikaiak kzt sok a vilgos br s
szke haj. Eurpban krlbell minden hszezredik ember albn, mg
Afrika bizonyos rszeiben ennek a tzszerese. Az afrikai albnknl a br
rk ezerszer gyakoribb, mint pigmentben gazdag testvreiknl. Minden
hsz vnl idsebb albnn megmutatkozik a betegsg, s a fldrsz leg-

1 94
A BR ALATT A LLEK

naposabb rszein (pldul Nigriban) csak minden tizedikk l harminc


vnl tovbb.
m az ibolyntli sugrzs nemcsak bajt okoz. A brn thatolva D
vitamint termel; olyan sokat, hogy annyit a legegszsgesebb trend sem
biztosthat. Hinya a gyerekeknl angolkrt okoz, amely a csontok lgyu
lsval s a koponya eltorzulsval jr. A D-vitamin-termels a napfnytl
fgg. Akik a tengerszint felett msfl kilomteres magassgban fekv
Denver verfnyben lnek, azoknak a krben feleannyi a megbetegeds,
mint bostoni trsaiknl. Az regeknl klnsen nagy a vitaminhiny ve
szlye, rszben azrt, mert nem szvesen mozdulnak ki a ngy fal kzl.
Eurpa-szerte minden harmadik ids ember vrben a szksgesnl keve
sebb a D-vitamin. Grgorszg, Spanyolorszg s Olaszorszg v_.fnyes
ege alatt ktszer ilyen magas ez a szm, mert az regek kerlik a napfnyt.
Ha szennyezett a leveg, akkor is cskken a szervezet vitamintermelse.
i900-ban az iparvrosokban tz gyerekbl kilenc angolkros volt. Ebben
rsze volt a fstnek meg az ablakadnak is, amely arra ksztette az embere
ket, hogy befalazzk laksuk egyetlen fnyforrst. A beplylt afrikai cse
csemk ma is veszlyeztetettek. Az 1920-as vekben az amerikai feketknl
tzszer akkora volt a megbetegeds kockzata, mint a fehreknl.
Br tetszets gondolat, hogy a brszn evolcijt az angolkr veszlye
irnytotta, a melanin valsznleg mgsem a vitaminhztarts megvlto
zsa kvetkeztben fogyatkozott meg. Hiszen mieltt ltrejttek a fsts

Angolkros gyerek - a grbe lb annak


a kvetkezmnye, hogy a csontok lgyak maradnak,
mert nem rakdik le bennk elg msz. A nyugati
vilgban ma ritka betegsg az angolkr. Az esetek
oka rendszerint a D-vitamin-anyagcsere rkltt
zavara, ritkbban a D-vitamin felvtelt gtl
lelmiszerek fogyasztsa.

195
A VRNKBEN VAN

vrosok, az emberek rendszerint napos helyeken tartzkodtak. Az angol


kr civilizcis betegsg. Mg a feketknek is elg heti kt ra napfny,
hogy egszsgesek maradjanak. A csontvzakbl megllapthat, hogy a
betegsg csak a kzpkorban vlt gyakoriv, ahogy nttek a vrosok. Az
strtneti temetkezsi helyeken nyoma sincs sem a feketk, sem a fehrek
kztt, kivve egy mly s stt dunai szurdokban l npcsoportot.
Br a brszn megvltozsa az emberi fejlds legszembetnbb esem
nye, valjban senki sem tudja, mirt kvetkezett be a melaninveszts,
amikor az emberek kivndoroltak Afrikbl. Vannak sokkal bonyolultabb
magyarzatok is, mint a legs, a rk s az angolkr. A napfny elpuszttja a
brben kering antitesteket. Egy fehr ember alig flrnyi napozstl is
komolyan krosodhat. A fekete br taln segt megvni a szervezet vde
kez rendszert (amire a szmtalan trpusi betegsg fldjn klnsen
nagy szksg van). Msok szerint az a magyarzat, hogy a fekete br hajla
mosabb a fagysra, mint a fehr. 1917-ben, az utols kemny tlen a lvsz
rkokban egy francia orvos tbb mint ezer ,,lbfagysi" esetet jegyzett fl a
szenegli katonk krben, mg a fehreknl egyet sem. Taln a melanint
tartalmaz sejtek knnyebben megfagynak. Amikor az ember megrkezett
Eurpba, az ghajlat a mainl mg hidegebb volt. A megfagyott lb s ms
fagysok slyos bajokat okozhattak.
Az albnknl, brmilyen fajhoz tartoznak, a melaninhiny klns s
slyos kvetkezmnyekkel jr. rkltt betegsgk jellegtl fggen
cskkent ltsak s hallsak is lehetnek. A melaninnak ugyanis meglep
feladatai vannak olyan testrszekben is - mint a fl, az agy s az idegrend
szer -, amelyek napfnyt sose ltnak. Akik a feketk nagysgnak kulcst
ltjk benne, taln eltlozzk a jelentsgt, de ktsgtelen, hogy a szerve
zet igen sokfle tevkenysgt befolysolja, fontos szerepe van a test felle
tn belsejben egyarnt.
A melanin hozzjrul az agy felptsnek kialakulshoz. A magzat fej
ldse sorn stt szn sejtek vezrlik az idegeket a megfelel helyekre.
A sejtek egyik legfontosabb feladata, hogy kialaktsk az idegrostokat,
amelyek a kpjeleket tviszik a jobb s a bal szembl az agy msik felre,
gy hozzjrulnak a trrzkelshez. Az albnknl ezek a vezrl sejtek hi
nyoznak, s a ltrendszer vezetkhlzatnak hibja egy rszknl gyen
ge ltst okoz. A sketsg rkldsnek tanulmnyozsa sorn jttek r a
kutatk, hogy a melaninra a flben is fontos szerep hrul. Az ott tallhat
mennyisg megfelel a szem s a br melanintartalmnak. A jelek szerint a
stt brek ellenllbbak a vratlan, ers zajok okozta sketsggel szem
ben. Ezrt nem krosodik olyan slyosan a zajos munkahelyeken dolgoz
A BR ALATT A LLEK

feketk hallsa, mint a fehrek. Olyan felttelezsek is vannak, hogy a kk


szem fehrek hajlamosabbak a sketsgre, mint a stt szemek.
A melanin taln azrt nyjt vdelmet a flnek, mert elnyeli a klvilgbl
(ezttal hanghullmok formjban) rkez energit. A tl nagy zaj szabad
gykket hoz ltre a flben - mint a napfny a brn -, ezeket a melanin
magba szvja. Ha nincs ez a vdpajzs, az rtalmas vegyi anyagok roncsol
hatjk a sejteket.
Akiknek cseng a fle, azokon nha segt egy kis adag rzstelent. Ez
ugyanis rtapad a bels fl melaninjra, s helyrelltja a normlis hallst.
Ennek alapjn ismertk fel a melanin egy msik vratlan tulajdonsgt:
gygyszermegkt kpessgt. A klorokvin nev malriagygyszer sket
sget okozhat, mert koncentrldik a flben, s akik sze fogkonyab
bak a zajrtalomra. Mivel a melanin megkti a gygyszereket, a versenylo
vak doppingvizsglatnl mindig stt szn szvetbl vesznek mintt,
mert abban tovbb megmarad a tiltott szerek nyoma, mint a test tbbi r
szben. Taln van nmi igazsg a melaninmozgalom lltsban, hogy a fe
ketk rzkenyebbek a kbtszer okozta rtalmakra.
gy ltszik, az is megfelel a valsgnak, hogy a melanin kapcsolatban
van az rzkelssel (br a dzsessz ltrejttben jtszott szerepe mg nem bi
zonytott). Rejtett kpessgeire utal tovbb, hogy az agy pigmentje, a
neuromelanin az agy bizonyos rszeiben rakdik le. A neuromelanin rejt
lyes anyag. Az emberben tbb van belle, mint a majomban; a majomban
tbb, mint az egrben, teht az rtelem fejldsben nyilvn szerepet jt
szik. Az idsek krben elg gyakori Parkinson-kr elrehaladtval a beteg
elveszti uralmt mozgsa fltt, s vgl bekvetkezik a kma s a hall.
A betegsg a jelek szerint kapcsolatban ll a neuromelaninnal. Kaliforni
ban trtnt egy htborzongat eset: az egyik krhzban jelentkezett kt fia
tal kbtszeres, akiken slyos Parkinson-kr-tnetek mutatkoztak, s a be
tegsg ktsgbeejt gyorsasggal lett rr rajtuk. A krosodst valamilyen
hzilag ellltott kbtszer szennyezdse okozta, amelyet megkttt az
agy stt, pigmentben gazdag rsze (tbbek kzt ennek eredmnyeknt si
kerlt megtallni az agyban a Parkinson-krt elidz krosods helyt).
A melanin meglep tulajdonsgai kzl brmelyik magyarzattal szol
glhat arra, mirt maradt meg az afrikaiak brben, s tnt el a vilg tbbi
npnek brbl - de lehet, hogy egyik feltevs sem igaz. Termszetesen
vannak, akik szerint a melanin - gy vagy gy - befolysolja az rtelmi k
pessgeket. A jelek szerint az agy s a br melanintartalma kzt nincs
sszefggs. Nincs okunk ktsgbe vonni a feketk tehetsgt s szellemi
belltottsgt, de az biztos, hogy nem agyuk nagyobb pigmenttartalm-

1 97
A VRNKBEN VAN

nak egyenes kvetkezmnye, s semmi sem bizonytja, hogy a melanin


egyltaln befolysolja az rtelmi kpessget.
Mgis vltozatlan hevessggel folyik a vita a fajtk s az intelligencia
krdsrl. A rsztvevk legtbbje mr rg felcserlte a termszettudo
mnyt a szociolgival. Br egsz tmeg statisztikai adat ll rendelkezsre
- vagy taln ppen ezrt -, ma mr szinte lehetetlen tisztzni a rasszok k
pessgeinek lltlagos klnbsgeivel sszefgg krdseket, vagy akr
trgyilagosan vitatkozni rluk. Az egyik tbor statisztikai adatait azonnal
megcfolja a msik. Kutatsok mr nem is nagyon folynak a feketk s fe
hrek kzti lltlagos rtelmi klnbsgekkel kapcsolatban, csak vitk,
amelyekben mindkt elmlet hvei sszekeverik a politikai s biolgiai
szempontokat. De a tudomny mg mindig beszmolhat arrl, hogy mit
tudunk a vilg npeinek rtelmi kpessge kzti rkltt klnbsgekrl
s mit nem.
A szmok egyrtelmek, legalbbis els pillantsra. Az Egyeslt lla
mokban a szabvnyos IQ-tesztek eredmnyei a feketknl tlagosan tz-ti
zent ponttal alacsonyabbak, mint a fehreknl. Az angliai adatok hinyo
sabbak (itt ritkn ismeretes a gyerekek faji hovatartozsa), de a feketk s fe
hrek kzti klnbsg kisebb, mint az Atlanti-cen msik oldaln. Az
Egyeslt llamokban bizonyos csoportoknl (pldul a koreaiaknl s a ja
pn szrmazsaknl) jobbak az eredmnyek, mint a fehreknl. Nagyok az
eltrsek a klnbz trsadalmi osztlyok kzt is, brmilyen szn a brk.
Az adatok rtelmezse krl elkeseredett vitk dlnak. Lehet, hogy a
vizsga vagy a vizsgztatk elfogultak; esetleg klnbz minsgeket vet
nek ssze. De azrt ma mr a legtbben elfogadjk, hogy az IQ-tesztek al
kalmasak a klnbz fajtj vagy eltr trsadalmi helyzet szemlyek
rtelmi kpessgnek mrsre. Maguk a tesztek termszetesen ppolyan
le.veset rulnak el arrl, hogy a klnbsgek rklttek-e, mint a frd
szobamrleg arrl, hogy a slyklnbsgek oka falnksg, a gnek vagy
mindkett. Sokan foglalkoztak az rkldsnek az intelligenciahnyados
alakulsban jtszott szerepvel. Br az els idben szmos csals elfor
dult, nyilvnval, hogy a kpessgek, melyek j vagy rossz teljestmnyt
eredmnyeznek, rkldnek a csaldokban.
Mig eldntetlen s taln eldnthetetlen a vita, mekkora szerepe van az
intelligenciahnyados faji klnbsgeinek kialakulsban a szletett
adottsgoknak s mekkora a neveltetsnek. A fehr csaldokban az rkbe
fogadott fekete gyerekek teljestmnye javul, de nem felttlenl ri el a vele
egy hztartsban l fehr gyerekek szintjt. Azoknak a feketknek az in
telligenciahnyadosa viszont, akiknek tbb fehr gnjk van, nem maga-
A BR ALATT A LLEK

sabb, mint a tbbiek, holott ez vrhat volna, amennyiben a jelensg ge


netikai eredet. Ignyes oktatssal a feketk teljestmnye olykor (de nem
mindig) a fehrekvel azonos vagy azt meghalad szintre hozhat. Mi
tbb, az 1960-as vek ta a feketk s fehrek kzti klnbsg krlbell 5
IQ-ponttal cskkent - ami egy gnekbe programozott szemlyisgjegytl
elgg meglep.
Japnban tven vvel ezeltt ioo krl volt az tlagos intelligenciah
nyados. Ma krlbell 112. Ezt csak a krnyezet minsgnek javulsa
okozhatja; a genetikai vltozshoz ennyi id kevs. Az amerikai iskolkban
a japn gyerekek nagyjbl trsaikkal azonos intelligenciahnyadossal in
dulnak, de hamarosan megelzik a tbbieket. Nem szletett adottsgaik,
hanem szorgalmuk s szleik ignyessge jvoltbl, mint ezt a pedgiai
kutatsok bizonytottk. Br az amerikai indinok genetikai rtelemben
kzelebb llnak a japnokhoz, mint az eurpaiakhoz, tlagos intelligencia
hnyadosuk alacsonyabb a fehreknl, ami szintn arra utal, hogy a g
neknek nincs egyszer s mindenkorra rvnyes hatsuk a teljestmnyre.
Az a nzet, hogy a rasszok vagy trsadalmi osztlyok rtelmi szintje kzti
klnbsgek vltozatlanok, a legjobb esetben is bizonytatlan. De ez soha
sem gtolta a politikusokat (brmi volt a programjuk), hogy tkt kov
csoljanak az IQ-tesztek eredmnyeibl annak klasszikus pldjaknt, ho
gyan lehet a tudomnyt tle idegen clokra felhasznlni.
Ma mr feledsbe merlt az rtelmi kpessgekrl kirobbant heves vita,
melyet az IQ-tesztek dl-afrikai bevezetse vltott ki. A holland szrmaz
sak eredmnyei jval alacsonyabbnak mutatkoztak az angol szrmazs
aknl. A hollandok hossz veken t sajt iskolikba jrtak, s a trsada
lom alsbb szintjeire szorultak. A legtbben szegnyek voltak. Ahogy az
apartheid kezdetvel javult a helyzetk, javultak IQ-eredmnyeik is. Vgl
megkzeltettk az angol szrmazs dl-afrikaiak szintjt, s mr senki
sem mondta, hogy a kt csoport kpessgei kztt rkltt klnbsgek
lteznek. Dl-Afrikban ott a feledsbe merlt lecke mindazoknak, akik
ma a vilg ms rszein szeretnnek pedaggiai apartheidet bevezetni.
Van abban valami szvdert, hogy ppen Dl-Afrika szolgl bizonytk
kal a tudomnyos fajelmlet alapelveinek tves voltrl. Afrika legdlibb
rszn, a Klasies foly torkolatnl a tenger fl tornyosul, mll szikla
falban van egy barlang. Ingatag ltra vezet hozz. A meredek lejtkn
milliszmra hevernek a kovakbl pattintott szerszmok, egy kkorszaki
szerszmgyr maradvnyai. Szzezer vvel ezeltt itt tanyztak a legels
modern emberi lnyek. Abban az idben a tenger sokkal magasabban,
szinte a barlang nylsnl hullmzott. Az reg akkor is tele volt, ma is tele

199
A VRNKBEN VAN

satsok a Klasies foly torkolatnl, Dl-Afrika leg


dlibb rszn. Az egyms fltt lthat kt barlang
klnbz idszakokban nagyjbl egy magassgban
volt a tenger szintjvel, amely a jgkorszak folyamn
emelke'llett s sllyedt. A mintegy 100 ooo ves korai
modern emberekbl nem sok maradt fenn, de az itt
lthat llkapocs alapjn is megllapthat, hogy
nagyjbl hozznk hasonlk voltak, teht lnyegesen
klnbztek az ket megelz csapott ll, zmk
homlok emberektl. Kszerszmaik is szemmel
lthatan korszerbbek. A barlangbl elkerltek j
val ksbbi csontvzak is (legtbbjk az utbbi pr
ezer vbl szrmazik). Az egyiket (fent) kagylfz
rek dsztik. A szletsi ajndkok a gyerek felntt
vlsa sorn sztszrdtak a klcsns adakozs h
lzatban.

200

-
A BR ALATT A LLEK

van lelemmel. A jeges hullmvers ti kagylk s ms kagylflesgek


milliit lteti. Pr perc alatt kiads tkezsre valt kaphat le az ember a
sziklkrl. A barlanglakk risi mennyisget gyjtttek ssze, s nylt
tzbe dobtk, gy stttk meg. A barlang aljt tmr hamu, millinyi s
trtneti lakoma maradvnya alkotja. Az satsok sorn elkerltek a bar
langlakk otthonai. Nem egyetlen hatalmas tzet ltek krl - a barlang
fldjt szablyosan elklnl tzhelyek bortjk, vagyis laki csoporto
kat alkottak, nem zaboltlan csrht. A Klasies folynl tallhatk a csald
els bizonytkai: egy trsadalom hagyta htra ket, nem vadsz horda.
Krlbell egy tucat lak maradvnyai kerltek el. Koponyjuk egyl
taln nem hasonlt a csapott ll, alacsony homlok lnyekhez, akik a le
letek tansga szerint Afrika ms rszeit npes.Wttk be ebben az idben
(s mg kevsb a Neander-vlgyi emberekhez, akik akkoriban Eurpa
egyedilli laki voltak). A legrgibb krlbell szztzezer vvel ezelttrl
szrmazik.
A szerszmok - nylhegyek, lndzsahegyek s hasonlk, a Klasies foly
npnek tallmnyai - errl a tvoli helyrl a vilg nagy rszbe eljutottak,
s tbb szzezer vig hasznltk ket. Afrika legdlibb rsze jval az eur
pai trtnelem kezdete eltt a civilizci kzpontja volt. Kultrja csak n
hny vszzaddal ezeltt halt ki. Mindssze ezervesek a barlang legksb
bi csontleletei, a hottentottk kzvetlen eldeinek maradvnyai. Olyan
trsadalom emlkei, amely az eurpainl jobban trekedett az egyenlsg
re. A stt kzpkor eurpai trsadalmi rendje a jobbgysgon alapul fe
udalizmus volt. A Klasies foly npnek trsadalma viszont ebben az id
ben a javak megosztsra plt. A gyermekcsontvzakat kagylbl kszlt
nyaklncok s dszek kestik. A felntteket dszek nlkl temettk el.
A gyerekek ugyanis ajndkokat kaptak. Ahogy felcseperedtek, bekapcso
ldtak a klcsns csere s egyttmkds hlzatba, gy sztosztottk
rkltt gazdagsgukat.
A Klasies fldjre rkez eurpai hdtk mit sem lttak a bennszlt
tek letnek gazdagsgbl. A hottentottkat a legjobb esetben tkletlen
emberfajtnak tartottk - a hinyz lncszemnek az ember s a majom
kztt. Ezeknek a barbr lnyeknek egy pldnyt i810-ben kzszemlre
tettk Londonban a tudomnyos fajelmlet nagyobb dicssgre. A pl
dny neve (legalbbis az, amelyet gazditl kapott) Saartje Baartmann
volt. Dl-Afrikban egy csaldnl szolglt, amely engedlyrt folyamodott
a kormnyzhoz, Caledon lordhoz, hogy Angliba kldhesse. A kormny
z hozzjrult (br j kztisztviselhz illen ksbb elhrtotta a felels
sget a vitrt, mely az asszony krl kialakult).

201
A VRNKBEN VAN

Tizenkilencedik szzadi kp Saartje


Baartmannrl, akit teljes dszben tettek
kzszemlre a kvncsi londoni s prizsi
tmeg szrakoztatsra.

Megrkezsekor Saartje Baartmannt a Piccadillyn mutogattk. Tompo


rnak mrete nagy szenzcit keltett. A szteatopigia nven ismert llapot
Afrika dli rszben gyakori, mert bsg idejn gy halmozza fel a szerve
zet a tartalkot. De Londonban mg nem lttak ilyet. A szpsgrl s mi
nsgrl alkotott fogalmaik szoks szerint egymsba fondtak: az emberi
let alacsonyabb rend formja csak visszataszt lehetett, az isteni szn
dknak megfelelen. A?J>kban a napokban, amikor Saartjt kzszemlre
tettk, a nagykznsg a kormny buksra szmtott (br a kormny nem
bukott meg, feje, Spencer Perceval a helyn maradt, s vgl lett az egyet
len angol miniszterelnk, aki mernylet ldozatul esett). Mivel az elz
kormnyt a Nagy Seggek Minisztriumaknt" emlegettk, a Kt nagy
segg" cm, mar korabeli gnyrajzon a kvr Grenville lord, az ellenzk
vezre elmlylten tanulmnyozza Saartje tomport.
Sokan felhborodtak a ltvnyon. Az Afrikai Szvetsg, a jakarat s
tiszteletre mlt riemberek trsasga" a trvnyszkhez fordult e sze
rencstlen nszemly nevben, kit egy civilizlt orszgra nzve flttbb
szgyenletes krlmnyek kzt tettek kzszemlre, hogy felhvja a brsg
figyelmt e ltvny srt s illetlen mivoltra"; Saartje Baartmannt ugyan-

202
A BR ALATT A LLEK

is szinte ruhtlanul, meglncolva egy ketrecben tartottk. Amikor a br


kikrdezte (msodik nyelvn, hollandul), elgedettnek mutatkozott, ami
rt gondozjval osztozhat a bevtelen, gy a ltvnyossg nem kerlt le a
msorrl. Mg vidki turnra is elvittk, s Manchesterben Sarah
Baartmann nvre kereszteltk.
Hrom vvel ksbb Prizsba kltztettk az immron keresztny
Saartjt; elszr egy llatszmokbl ll msorban mutogattk, azutn a
Thatre de Vaudeville-ban, mint La Vnus Hottentotte, ou haine aux
Franyaises" -t. Sok tallgats folyt a nemi szervrl (melyet elrejtett a n
zk ell), hisz rgta kzismert volt, hogy a hottentottknl ezt a szervet a
szgyen fggnye", a sinus pudoris takarja. Nmelyek szerint a ni krl
metls azrt alakult ki Afrikban, mert a frfiak nem tudtk elviselni e
frtelmes idomtalansgot"- llaptotta meg a nagy francia anatmus,
Cuvier, aki Saartje 1815-ben bekvetkezett halla utn rt monogrfijban
fljegyezte, hogy az asszony tompora une masse de consistance lastique
et tremblante, place immediatement sous la peau" (rugalmas s reng l
lag tmeg, kzvetlenl a br alatt), s egyltaln nem takar valami isme
retlen csontot, mint sokan feltteleztk. A szgyen fggnye valjban a
labia minora, a szemremajkak megnagyobbodsa volt. Saartje felboncolt

A szerz tallkozsa Saartje Baartmann-nal


(vagy legalbbis testnek gipszmsval).
A figura hossz vekig szerepelt a prizsi
Muse de l'Homme killtott trgyai kzt,
dicstelen emlkeztetve a tudomnyos
fajvdelemre. Ma mr egy falda rejti
az alagsorban.

203
A VRNKBEN VAN

nemi szerveit, csontvzt s a holttestrl kszlt gipszmsolatot Cuvier a


tudomny nagyobb hasznra a francia nemzetnek adomnyozta.
Sok v mltn a maradvnyok a prizsi Muse de l'Homme-ba kerl
tek, ahol a szemremtestet tartalmaz veget nem lltottk ki, de az alak
gipszmsolatt igen. Saartje Baartmann j otthona akkoriban sok szem
pontbl hasonltott az anatmiai mzeumhoz a vros tls vgn: azoktl
a szakavatott fajvdktl rklte tudomnyos felfogst, akiknek az
agyt ott riztk. Mindkt intzmny azt tekintette legfbb feladatnak,
hogy az emberi fajtkat osztlyokba sorolja, s elhelyezze egy rtkskln.
A Muse de l'Homme csak az 1960-as vekben tvoltotta el Saartje marad
vnyait a killtterembl.
A fajtipolgia letnt napjainak ezt a dicstelen rksgt ma a pince m
lyn egy tmr falda rejti, melyet gondosan kibleltek, hogy a figurt
megvjk minden krosodstl. A gipszmsolat vilgosbarna, amilyen a
modell volt letben. Saartje kt kezt a hallt okoz himl hegei bortjk.
Tompora valban nagy, de nem sokkal nagyobb, mint tbb milli elhzott
eurpai s amerikai, akiknek kpessge, hogy egy soha be nem kvetke
z hnsg esetre lelmet tartalkoljanak, ppoly gyilkos fenyegets, mint
maga az hnsg. Ma mr rthetetlen, mirt mondtk megjelenst te
kintve visszatasztnak". Szmos honfitrsa vonznak tallta volna Saartje
Baartmannt - jegyezte meg Dl-Afrika franciaorszgi nagykvete, amikor
1995-ben elltogatott a mzeumba -, s mr nincs r semmi ok, hogy el
rejtsk szem ell. A dl-afrikaiak most kezdemnyeztk a maradvnyok
visszaszlltst hazjukba: ez is azt bizonytja, hogy Saartje teste - st mg
a gipszmsa is - a mai napig politikai zenetet hordoz.
A Muse de l'Homme mai arculata szges ellentte az egy vszzaddal
ezelttinek. A mzeum mindent elkvet, hogy elhatrolja magt a mltj
tl. Az emberek sokf
4t
lesgt s egyenlsgt hirdeti. A fajtk killtsa -
Tous parents, tous aiffrents" - politikailag olyan korrekt, hogy az mr
szinte fj. A faji tpust" teljes joggal elvetik. Killtjk (kellkppen eltl
felirattal elltva) a rgi szvegeket is, melyek a koponykkal s csontvzak
kal az emberisgnek a primitvtl a fejlett vltozatig vel lltlagos fejl
dst igyekeznek altmasztani, de az anyag nagy rszt a vilg npei kzti
hasonlsgoknak szentelik.
Br az emberi rtk fokmrjnek tekintett rasszt elvetettk, helyt a
mzeumban j tipolgia vette t. Megmaradt a ksztets az osztlyozsra s
ezzel az tlkezsre. A killtst meztelen frfiak s nk csoportkpe uralja.
Ahny ember, annyifle - fekete vagy fehr, magas vagy alacsony, reg vagy
fiatal -, mgis egyesti ket, hogy egytl egyig mosolygsak, rtelmes ar-

204
A BR ALATT A L LEK

A mai Muse de l'Homme csoportkpe azt brzolja, milyen elenysz a klnbsg a vilg
emberfajti kzl, de ebben is van rtktlet, csak msfajta, rnyaltabb - nem a brszn, ha
nem a szpsg alapjn.

cak s nagyon szpek. Br a trsadalmi helyzetet ruhtlan embereknl


nehz megtlni, ktsgtelennek ltszik, hogy mindegyikk tisztes polgri
szrmazk.
Manapsg az utca embert sokkal jobban rdekli a meztelen elegancia,
mint az elbukkan br szne. Hogarth (aki faji krdsekben liberlis volt)
egyetrtett volna. Jllehet az egymsnak ellentmond vlemnyek" hat
sra nhnyan elvetik a szpsget mint valsgos tnyt", az, hogy kit tal
lunk vonznak, csakis szoks, divat, meggyzds s illzi" dolga - lla
ptotta meg A szpsg elemzse cm munkjban. Ugyanitt emltst tesz
arrl a flttbb figyelemremlt pldrl, hogy egy nger, aki nagy gy
nyrsgt leli sajt hona fekete asszonyaiban, bzvst tallhatja ppoly
torznak a mi eurpai szpsgnket, mint mi az vt". Br mg mindig ne
hz klnvlasztani a klst az rtkfogalmaktl- mint a mzeum pld
ja is mutatja -, mai tleteink legalbb nem attl a pr gntl fggnek,
amely a brsznt hatrozza meg.
A genetika jvoltbl az emberi minsgrl vgre nem kell a klssgek
alapjn tletet alkotni. A trtnelem folyamn elszr lehet elfogulatlanul
vlemnyt formlni arrl, miben klnbznek egymstl az emberi faj
tk. A vlasz egyrtelm. A biolgiai eltrsek cseklyek, s a bizonytkok
egyiknek vagy msiknak a szellemi flnyrl olyan silnyak, zavarosak s

205
A VRNKBEN VAN

szellemi rtelemben annyira tisztessgtelenek, hogy nem is rdemes fog


lalkozni velk.
A jelek szerint
. mgsem akar vget rni a vita, vajon a rasszokban s a
trsadalmi osztlyokban biolgiai rtk tkrzdik-e. Br az embertan
manapsg nem a vlekedsek alapjn ll, sokan hajlamosak elvi szempon
tokat rvnyesteni alkalmazsa sorn. Ez nagy hiba, amire mindannyiun
kat emlkeztet a Muse de l'Homme gyjtemnynek egy darabja: az i650-
ben elhunyt Ren Descartes koponyja. Descartes ismerte fel elsnek,
hogy mire kpes a tudomny s mire nem. Az ember, mondta, ugyanolyan
gpezet, mint a tbbi, nem pedig csodlatos lny, amely az emberi megis
mers szmra hozzfrhetetlen. Ktsgtelenl vannak dolgok, melyek
csak rnk jellemzek - igazsg, filozfia, valls -, m ezeket nem lehet tu
domnyos vizsglatnak alvetni. Amikor az igazsghoz vezet egyenes
utat keressk, nem szentelhetjk figyelmnket olyan trgyaknak, ame
lyeknl nem juthatunk ugyanolyan bizonyossgra, mint a szmtani s
mrtani levezetsek rvn." A llek, ha van, a szmtan krn kvl esik.
A test azonban tanulmnyozhat, mint brmely ms szerkezet.
Descartes filozfijbl ntt ki a francia felvilgosods s az utna k
vetkez racionalizmus kora. Broca s Gobineau munkssga is a kartezi
nus logika termke volt; ksrlet az emberek kzti klnbsgek trgyilagos
vizsglatra. Azta elbbre j utott a biolgia, s sikerrel jrt ott, ahol k ku
darcot vallottak. Egyrtelmen rcfolt arra az elkpzelskre, hogy a faj
tkban az emberi nem alapvet klnbsgei mutatkoznak meg. Csakhogy
a gnek trgyilagos vilgn kvl a fajtkat s trsadalmi osztlyokat ma is
a rgi mdon elemzik. A klnbsgek felmrse helyett rtktleteket al

.i;yi
kotnak. Melyik csoport rtelmesebb, rdemdsabb, emberibb? Melyik
jobb, melyik rosszabb? Helyes, ha tudomsul vesszk a rasszok valsgt,
vagy ez mr an katasztrfval jrt, hogy jobb, ha a ltezsket is elta
gadjuk?
A tudomnyos fajelmlet, akrmilyen sznezet, akr egy prizsi m
zeumban, akr egy amerikai politikai programban jelenik meg, akr a br
sznt, akr az osztlyhelyzetet tartja szem eltt, htat fordt a tudomny
nak, s visszatr az emberi rtk spiritulis felkutatshoz. Mrpedig na
gyon jl tudjuk Descartes-tl, hogy aki a lelket keresi, annak a tudomny
nem segthet.

206
V. FEJEZET

Eredend bn

,,A jog . . . a trvny gyermeke: valsgos trvnyekbl


valsgos jogok szrmaznak; m a kpzelet szlte
trvnyekb6l, a termszet trvnyeibl, melyeket a kltk,
sznokok meg az erklcsi s szellemi mrgekkel kereskedk
kedvelnek s tallnak ki, kpzelet szlte jogok fatty szrny
ivadkai szrmaznak."

JEREMY BENTHAM: ANARCHISZTIKUS TVESZMK

AGAMEMNON AZ ILISZBAN elrabolja Achilles felesgt. Amikor vetlytrs


tl elnzst kr, tkletes mentsge van: . . . oka nem vagyok ennek, mert
Zeusz tette, s a Moira, s Ernsz, a kdbebolyong: gylsen szvembe ezek
dobtk a vad rtst. . . Mit tehetek mgis? Mindent maga vgez az isten."
Achilles nagyvonalan tudomsul veszi az rvelst, s megbocst: Zeusz
atya, lm, iszony tokkal sujtod az embert. . .
Az agamemnoni vdekezsnek, ahogy joggal nevezhetnnk, furcsn mai
'"

csengse van. A trgyaltermekben nap mint nap alkalmazzk ezt a strat


git. A vtkes nem felels tettrt; nem bntethet, hisz egy nla hatalma
sabb er megfosztotta tlkpessgtl. Nem sjthat le r teljes szigorval a
trvny. Csakhogy ma mr nem az istenek kertik hatalmukba az embereket.
A gnek vettk t az uralmat.
Az amerikai Georgia llam siralomhzban riznek egy Stephen Mobley
nev fiatal gyilkost. 1991-ben meglte John Collinst, aki a Domino Pizza cg
nl dolgozott Oakwoodban, Atlanta kzelben. A nagydarab, rokonszenves
Collins azt tervezte, idvel sajt vllalata lesz, az fogja hzhoz szlltani a piz
zt. llt a pult mgtt, amikor az zletet rabltmads rte. Mobleynak
nem ez volt az els rablsa, de most tarkn ltte a trdre roskadt Collinst. Le
tartztatsa utn Mobley bszklkedett a tetteivel, st domint tetovltatott
a karjra, s pizzsdobozokkal dsztette ki a celljt.
De slyos hibt kvetett el, amikor nem Atlanta vros hatrn bell gyil
kolt, ahol John Collins halla csak egy lett volna a sok kzl. Atlantban nem

* Homrosz: J/isz (Eurpa, 1957); Devecseri Gbor fordtsa.

207
A VRNKBEN VAN

Stephen Mobley
a georgiai
siralomhzban vrja
a dntst genetikai
alapon benyjtott
kegyelmi krvnyrl.

szmt klns esemnynek a rablgyilkossg, s ritkn jr rte hallbnte


ts. A kertvrosi Oakwoodban azonban az llamgysz (aki gonosz, szvtelen
gyilkosnak rta le Mobleyt) villamosszkben vgrehajtand hallbntets ki
szabst krte, s meg is kapta.
Mobleyt most az Atlanta melletti Georgiai Diagnosztikai s Besorolsi
Kzpontban rzik. Az intzmny neve kiss eufemisztikus. Ott ugyanis
nemcsak diagnosztizlja s besorolja az embereket az llam, hanem meg is
li ket; ugyanis a kzpontban helyeztk el Georgia llam villamosszkt.
Senki sem tagadja, hogy Stephen Mobley bns, s olyan veszlyes, hogy
nem lehet szabadlbra helyezni. Slyos bnre nehz enyht krlmnyt
tallni. gyvdei, Charles Taylor s Daniel Summer, mivel semmi ms ala
pon nem fellebbezhetnek a hallos tlet ellen, utols lehetsgknt a
Mobley csald mltJra ptettk a vdelmet. A vdlott apja sikeres zletem
ber, a Sports Shoe nev cipbolthlzat tulajdonosa, aki mindig is nehezen
kezelhet gyereknek tartotta a fit. A fkezhetetlen Stephent egsz sor pszi
chiterhez vittk el. Egy idben azt a fltudomnyos diagnzist lltottk fel
rla, hogy antiszocilis szemlyisgi rendellenessgben" szenved, mivel
kptelen brmifle rtkrendet magv tenni". Vgl a csald kitagadta.
Stephen Mobley apjnak egyik unokatestvre, Joyce Ann Mobley Childers
ngy nemzedkre visszamen antiszocilis viselkedsrl, bnzsrl s er
szakos cselekmnyekrl szmolt be az gyvdeknek. - Sose menj felesgl
egy Mobleyhoz! - mondogattk a lnyoknak a kisvrosban, ahonnan szr
maztak. Stephen kapja rszegen hallra fagyott. Msod-unokatestvre,

208
EREDEND BN

Dean Mobley mr hromves korban kezelhetetlen volt, s amikor beraktk


egy katonaiskolba, jvedelmez szlhmossgba kezdett: apja bankszml
jra terhelte a tbbi dik mosodaszmljt. lete nagy rszt brtnben tl
ttte, de egyszer itt is rajtakaptk, hogy felszentelt pap ltre kbtszert rul
a bibliarn. Sok ms Mobleynak is meggylt a baja a trvnnyel, nmelyik
nek slyos bncselekmnyek miatt. Stephen a jelek szerint csak a legutbbi
volt a hossz sorban. Taylor s Summer gy tlte meg, hogy genetikai ala
pon folyamodhatnak kegyelemrt. Mobley nem szabad akaratbl cseleke
dett, jelentettk ki. Olyan gnt rklt, amely megfosztotta kpessgtl,
hogy klnbsget tegyen j s rossz kztt, ez hajszolta bnbe. Felhasznltk
mg a vdlott apjnak zleti sikereit is, melyeket egy gyilkos versengsre
knyszert zletgban rt el, hogy bizonytsk: fiban rkltt hajlam van a
brutalitsra. Igen kevs vlasztja el a kmletlen sikervgyat az erszakos
bncselekmnytl" - llaptottk meg. Ha Stephen Mobley rkltt fogya
tkossgtl szenved - rveltek az gyvdek -, ez orvosolhat, hiszen csak
meg kell llaptani a diagnzist, hogy megfelel kezelsben rszesljn.
A hallbntets, mondtk, egyedl a javthatatlanoknl indokolt: ebben az
esetben nincs helye. Benyjtottk a fellebbezst.
Az jsgok vilgszerte szalagcmekben kzltk a hrt. Meggondolatlanul
Mobley bnz gnjt" emlegette mindegyik. A kommentrok viszont egy
hanglag elvetettk az tletet: liberlis szlhmossgnak minstettk, jabb
ksrletnek arra, hogy az gyvdek mentegessk azt, amire nincs mentsg. Ha
ltezik ilyen gn, akkor sincs semmi keresnivalja a trvnykezsben. Ha a bn
(vagy akr a bnzsi hajlam) genetikailag meghatrozott, mi rtelme van az
elrettentsnek vagy a bntetsnek? Mg azoknak is fejtrst okozott az gy,
akik nem jsgfcmekben gondolkodnak. Taln kisebb bntets jr, ha olyas
valaki kveti el a bnt, akinek rkltt hajlama van r, remltk Mobley gy
vdei. Holott megtrtnhetne, hogy slyosabban bntetik. Texas llamban az
lnkknek azt kell mrlegelnik, amikor a hallbntetsrl dntenek, fenn
ll-e a valsznsge, hogy a vdlott tovbbra is erszakos bncselekmnyeket
kvet el, amelyek lland veszlyt jelentenek a trsadalomra". Vagyis ha nem
jr sikerrel a vdelem, amelyet az erszakos bncselekmnyekre hajlamost
gnre alapoztak, a vdlott hamar a villamosszkben talln magt.
Meglep, hogy ilyen ktkeds fogadja a bnzs gnjt" - magtl rte
tden ezt a cmkt kapta minden veleszletett bnz hajlam -, hiszen sen
ki sem tagadja, hogy a bnzs rkldik. Egy ngyszz gyerekbl ll cso
port lett, amelynek tagjait Camberwellbl, Dl-London egyik szegnyne
gyedbl vlogattk, i960-tl, nyolcves koruktl kezdve harminc ven t fi
gyelemmel ksrtk a kriminolgusok. Ez id alatt sokan kvettek el kln-

209
GYILKOS TUDOMNY:
A VILLAMOSSZK TRTNETE

Akr erklcss dolog az intzmnyes gyilkossg, amerikai np kedlyalkatval". Hagytk magukat


akr nem, a villamosszknck klns trtnete rbeszlni, hogy a villanyramot mint a leghum
van. Nhny neves feltall is szerepel benne. 1745- nusabb mdszert javasoljk.
ben, alighogy feltalltk a leideni palackot, a hol A trtnet nem vet valami j fnyt a tizenkilen
land Pieter van Musschenbroek megprblkozott, cedik szzad kt legnagyobb mszaki tehetsgre.
hogy ramot vezessen sajt testbe: Azt hittem, Thomas Edison 1882-ben vezette be a villanyt a Wall
vgem van . . . meg nem tennm mg egyszer az Streetre, s egyenramot hasznlt. De nem volt elg
egsz francia kirlysgrt sem." De az els villa nagy a feszltsg, hogy eljusson az ermtl kt ki
mosszkben trtn kivgzsre (vagy elektrotha lomternl messzebbre. Nemsokra George Wes
nasira", esetleg dynamortra", ahogy nevezni tinghouse bevezette a vltramot, s ezt magasabb
akartk) csak 1890-ben kerlt sor. William Kemm feszltsggel mr messzebbre tudtk eljuttatni.
lert vgeztk ki a New York llambeli Albanyban. Azonnal megkezddtt az ramok hborja",
Sorsrl egy llami bizottsg dnttt, amelynek az amelyben termszetesen a vltram gyztt.
volt a feladata, hogy a tudomnyt a hall szolgla
tba lltsa. A guillotine-ti idegenkedtek, gy ta A ksrleti villamosszek, amellyel kivgeztk
Kemmlert.
LENT:

lltk, hogy ez a vrengzs nincs sszhangban az

210
GYILKOS TUDOMNY: A VILLAMOSSZK TRTNETE

Kemmler villamosszknek
korszer vltozata a Georgia
llambeli tlet-vgrehajt
szobban.

Edison fleg azzal rvelt, hogy a vltram ve mot - mgis jra llegezni kezdett. Az elszrnyedt
szlyesebb az egyenramnl. De hogyan gyzhet tlet-vgrehajtk megint radtk az ramot, s ek
n meg errl a nagykznsget? Br maga elle kor meghalt: a sz szoros rtelmben hallra slt.
nezte a hallbntetst, a kszbn ll kivgzs Voltak, akik azzal vdoltk Westinghouse mrn
tudomnyos mdszernek keresse olyan lehet keit, hogy szndkosan megrongltk a berende
sget knlt, amelyet nem lehetett elszalasztani. Ha zst, nehogy a vllalkozs sikerljn. A ltvny
a vltramot emberlsre hasznljk, ki fogja be olyan szrny volt, hogy a sajt a villamosszk be
engedni az otthonba? Teht levlben hvta fel a tiltst kvetelte.
Hallbntetsi Bizottsg figyelmt a Westing Edison azonban nem csggedt. Fizikai ismere
house-fle rendszer pusztt hatsra, melyet ku teit felhasznlva azt javasolta, hogy az ramot ve
tykon mutattak be a nagy nyilvnossg eltt. zessk ss vzzel telt ednyekbe, s az eltlt ezekbe
A kltsgeket Edison llta, s emberei minden be lgassa a kezt. Ez a mdszer is kudarcot vallott.
folysukat latba vetettk, hogy a villamosszk vl Elfordult, hogy egy fiatalember a kivgzs utn
trammal, a hhr ramval" mkdjk. felllt, de mindssze felfggesztettk a kivgzst
Westinghouse nagyon dhs lett. Fedezte egy htre, amg megjavtottk a berendezst.
Kcmmler fellebbezsnek kltsgeit, s az gyet el Mindez nemcsak trtnelmi rdekessggel br.
vitte a Legfelsbb Brsgig. Itt azonban gy tl Ahogy egyre tbb embert ltek meg trvnyesen,
tk meg, hogy a villamosszkben trtn kivgzs megint tmads indult a villamosszk ellen azon a
egy lps elre . . . a knyrletessg s humanits jogcmen, hogy kegyetlen s szokatlan bntetel
tjn". Hiba prblta Westinghouse az utols jrs, ennlfogva alkotmnyellenes. Az rvelst
percben kieszkzlni a vgzst, hogy nem hasznl altmasztotta egy floridai eset, amikor az eltlt
hatjk ramfejlesztit, a kivgzsnek semmi sem haja kigyulladt. A georgiai szket mgis gyakran
llt tjba. Edison maga mutatta meg, hogyan kell hasznljk. Egyik ldozata - akit alig nhny httel
kt genertort sszekapcsolni, hogy a feszltsg azutn vgeztek ki, hogy az itt lthat felvtel k
gyilkos erej legyen. szlt - angol szlets fi volt. Krelmezte az an
A ksrlet katasztroflis eredmnnyel jrt. gol kormnynl, hogy jrjon kzbe az gyben, de
Kemmlerbe tizenht msodpercig vezettk az ra- nem tallt meghallgatsra.

211
A VRNKBEN VAN

fle bncselekmnyeket, a bolti lopstl a testi srtsig. A kutatsi program


viselkedsk httert akarta felfedni.
Kiderlt, nagy biztonsggal megjsolhat, hogy a nyolcvesek kzl kik
fogjk bnzsre adni a fejket, ha szmba veszik, kinek az apjt vagy anyjt
tltk el valamilyen trvnysrtsrt. Termszetesen nemcsak ez kttte
ssze azokat, akikbl ksbb bnzk lettek. Sokan szrmaztak felbomlott
csaldokbl. Hajlamosak voltak az iskolai osztly sztzllesztsre, gyakran
rosszul tanultak, ittak, dohnyoztak s kbtszert szedtek. Ahogy felnttek,
a tbbieknl szabadosabban ltek, s knnyebben elvltak. A nyolcves ko
rukban veszlyeztetettnek" minstett gyerekek hromnegyede ksbb tr
vnysrt lett. Mindez magyarzhat - s magyarzzk is - a trsadalmi ht
tr kvetkezmnyeknt. Lehet, hogy az, de brmi legyen viselkedsk oka, a
kutats egyrtelmen kimutatja, hogy hajlamosabb a trvnyszegsre az a
gyerek, akinek apja vagy anyja bnz; hogy a bnzsi hajlam trkldik
egyik nemzedkrl a msikra.
A trtnet ismers, st banlis. Mindenki tudja, hogy sok bnz szrma
zik szegny - st bnz - csaldokbl. Br a bnzs rkldik a csaldok
ban, nem kell felttlenl a DNS-be kdolva lennie. A tetovlst szvesen hoz
zk sszefggsbe az erszakos cselekmnyekkel, s a tetovlt fiataloknak
gyakran tetovlt szleik vannak, de azrt nincs tetovlsi gn. A szegnysg is
rkldik. Akik szegnynek szlettek, nem akarnak azok maradni, s gyak
ran megprblnak kitrni a nyomorbl. A szegnysg mgis rkletes, akr
a bnzs. De azt, hogy valaki nyomorsgos otthonbl kerlt ki, a brs
gok nem tekintik mentkrlmnynek.
A camberwelli s ms vizsglatokban biolgiai alapon lehet a legbiztosab
ban megjsolni, vajon egy nyolcves elkvet-e ksbb erszakos bncselek
mnyt. Az erszakos hajlam tlnyoman a frfiakra jellemz, nem a nkre.
Londonban - s 1J1indenhol msutt - a frfiak harmincszor annyi gyilkoss
got kvetnek el, mint a nk (a csaldon belli gyilkossgokat leszmtva) .
Semmi ktsg, ebbe a trsadalom s a neveltets is belejtszik, de e z nem vl
toztat a tnyen, hogy a frfiak, klnsen a fiatal frfiak veszlyesek. k az l
dozatok s elkvetk egyarnt. Ez a viselkedsforma valsznleg az idk fo
lyamn alakult ki. Az llatoknl (legalbbis azoknl, amelyeknl az emberhez
hasonlan a hmek szexulis teljestmnyben nagyobbak a klnbsgek,
mint a nstnyekben) akkor a legvadabbak a hmek, amikor fiatalok s prt
keresnek. Ezt mg azok is knytelenek elismerni, akik egybknt cfoljk,
hogy a biolgia hatssal van az emberi viselkedsre.
Tagadhatatlan, hogy mindez sszefggsben van a gnekkel, melyek - a
magassg vagy testalkat nemi klnbsgeirt felelskhz hasonlan - az

212
EREDEND B N

30 1400
ANGLIA S WALES DETROIT

25 1200

1000
20
800
15
600
10
400

200

Kor (vek) Kor (vek)

A csaldon kvli gyilkossgok arnya Angliban s Walesben, valamint Detroitban. Az egyes


korcsoportokban hasonlk az eltrsek a frfiaknl s nknl mindkt vrosban, de a tnyle
ges szmokban drmai klnbsgek vannak - Angliban nem egszen harminc gyilkossg
esik egymilli lakosra, Detroitban tbb mint ezer. A gnek s kultrk nem egymst kizr
magyarzatai az erszakos bncselekmnyeknek.

agynak a hormontermelst szablyoz terletein fejtik ki hatsukat. A frfi


nemi hormon, a tesztoszteron agresszvabb teszi a frfiakat is, az egereket is.
Annak alapjn, hogy valakinl milyen a szintje, megjsolhat, vajon az illet
hajlamos lesz-e az erszakos cselekmnyekre; a testptknek, akik llan
dan szedik, szmolniuk kell a szteroiddh" rohamaival. De arrl semmit
sem rul el a tesztoszteron mennyisge, mirt tbb az erszakos cselekmny
egyes trsadalmakban, mint msokban. A londoni frfiak huszont ves ko
rukban a legveszlyesebbek; a detroitiak huszonht vesen. A kt trsadalom,
br nagyon klnbz, nagyjbl egykor gyilkosokat termel ki.
A gyilkossgok szma azonban nagyon is eltr a kt vrosban. Detroit
ban negyvenszer akkora az erszakos cselekmnyek szma, mint London
ban; egy huszont ves detroiti n sokkal veszlyesebb, mint az ugyanilyen
kor londoni frfi. Mg a bn biolgiai gykereinek lelkes szszli sem l
lthatjk, hogy ennek a magyarzata a gnekben rejlik, s nem a kt vros tr
sadalmi tnyeziben.
Ebbl lthat, hol vannak a biolgiai magyarzat hatrai. Az Egyeslt lla
mokban az erszakos bncselekmnyek szma 1985 ta megktszerezdtt (ez
az irnyzat az utbbi idben megfordult), de nem valamifle robbansszer
evolcis vltozs kvetkeztben. Ha meg akarjuk jsolni a vrhat gyilkoss
gok szmt, nem a gneket kell megvizsglnunk, hanem a fegyvereket. A k
zpkorban a bncselekmnyek szma lezuhant, amikor betiltottk a rvid kar
dokat, s ktsgtelenl hasonl eredmnnyel jrna, ha az Egyeslt llamokban

213
A VRNKBEN VAN

megszigortank a lfegyverek ellenrzst. A legtbb gyilkossg nem biolgi


ai, hanem technikai krds - s mint tudjuk, a legtbb erszakos hall trv
nyes keretek kzt trtnik, amikor egyik llam hadat zen a msiknak.
A trvny nem formtlan massza. Vltozik az idk folyamn, ahogy a k
lnbz kultrk kialaktjk a sajt szoksaikat. Bombayben egy idben f
benjr bnnek szmtott, ha valaki bajuszt festett egy alv nre (mert vn
dorl lelke esetleg nem tall vissza), Dahomeyben pedig az, ha valaki ltta
enni a kirlyt. Angliban is vltozott a felfogs: amikor brtn jrt azoknak,
akik a nk szavazjogrt harcoltak, dicsretben rszesltek volna, akiket ma
letartztatnak borzvadszatrt.
A trvny alapvet ktelessge - hogy megvdje a nagykznsget - tl
lp a jrl s rosszrl folytatott vita hatrain. De erklcsi feladatrl kezdet
tl fogva megoszlottak a vlemnyek, s a vitk elbb-utbb tkrzdtek a
joggyakorlatban is. Amikor tlethozatalra kerl sor, klnsen sok fgg at
tl, vajon a vdlott szabad akaratbl cselekedett-e, felels-e a cselekedetei
rt. A sztoikusok, akik Athnban ltek Kr. e. 300-tl, szigor nzeteket vallot
tak a felelssgrl. Azt vallottk, hogy a vilg az sszersgen alapul, s min
denkiben egyformn lakozik az erny. A trvnynek, mint a kzerklcs dn
tbrjnak semmi oka sincs a knyrletessgre, mert akik megszegik, nem
tesznek eleget ktelessgknek. Ez a krlelhetetlen filozfia nagy hatssal
volt a korai jogi felfogsra s a keresztny teolgira.
Olyan knyes a szabad akarat s determinizmus egyenslya, amellyel a sztoi
kusok s utdaik foglalkoztak, hogy a trvnyhozs a mai napig nem tisztzta
megnyugtatan a hajlamok s a neveltets szerept a bnzs kialakulsban.
Gyakran kln ltezknt kezeli s egyms ellenben mrlegeli ket. Ebben is
az ltalnos - s a genetikusok szmra rthetetlen - tvkpzet nyilvnul meg,
hogy a genetikailag befolysolt jellemvonsok valahogyan elklnlnek a kr
nyezettl. Valjban a hajlam s a neveltets nem zrja ki egymst. Minden tu
lajdonsgra, egyebek kztt a bnz hajlamra is kihat mind a kett.
A trvny alapelve az nllsg: mindenki felels a tetteirt, s ha hibzik,
fizetnie kell rte. Az rvels egyszer s lenygz. De mr rgta ismeretes,
hogy a helytelen viselkedst nem lehet ilyen szigoran elbrlni azoknl, akik
nem tudnak szabadon vlasztani j s rossz kztt.
si gondolat ez: minden kultrnak meg kellett birkznia vele, s kln
fle prbkkal igyekeztek eldnteni a krdst hol teolgiai, hol tudomnyos
alapon (nha egyik a msiknak lczta magt) . Laoszban lltlag a vdlott
vlaszthatott egy tl rizs s egy tl emberi rlk kztt. Ha a rossz tlbl
evett, ez azt bizonytotta, hogy nincs tlkpessge birtokban, gy enyhbb
elbnsban rszeslt. A gondolat megtallhat a rmai s a kzpkori angol

214
EREDEND BN

jogban is (br a prba kiss ms). A cskkent felelssg elbrlsa a mai angol
trvnykezsben nagyrszt egy i843-as tletre tmaszkodik, amikor megl
laptottk, hogy egy magas rang kztisztvisel elleni mernylet elkvetje
elmellapota miatt nem felels a tetteirt.
Daniel M'Naghten egy glasgow-i faeszterglyos trvnytelen fia volt, akin
lassan elhatalmasodott az ldzsi mnia. Nha a rendrsg volt a nyom
ban, mskor a rmai katolikus egyhz. Knzi ldzbe vettk, kinevettk, s
szalmt dobtak az arcba. Franciaorszgba meneklt, de a frik oda is k
vettk. Amikor visszatrt Glasgow-ba, a fejbe vette, hogy azrt gytrik, mert
nem szavazott a torykra; elhatrozta teht, hogy vgez legfbb knzjval, a
konzervatv prti Sir Robert Peel belgyminiszterrel, a korabeli rendrsg
alaptjval. Sajnos sszetvesztette a magntitkrval, Drummonddal, s
azt ltte htba a Whitehallban. A brsg eltt M'Naghten azzal vdekezett,
hogy a szlvrosombeli toryk hajszoltak e cselekedetbe. Brhov megyek,
nyomomban vannak s hborgatnak, teljessggel feldltk lelkem bkjt. . .
Erre bizonytkaim vannak. Mst nem mondhatok."
Korbban is hoztak felment tletet elmebetegsgre val tekintettel, de
azokban az esetekben a vdlott nyilvnvalan rlt volt, mindenfle sszer
dntsre kptelen. A M'Naghten-trgyals j helyzetet teremtett. Az gyvd
arra hivatkozott, hogy M'Naghten rszleges elmezavarban szenved, s csak
egyetlen tvkpzete van. Ennek kvetkeztben nem vonhat felelssgre tet
trt. A br egyetrtett: ha M'Naghten tudatban volt, hogy thgja az iste
ni s emberi trvnyt", amikor vgzett ellensgvel, vagy ha kpes volt k
lnbsget tenni helyes s helytelen kztt", akkor felelsen cselekv sze
mly, s kteles alvetni magt brmely bntetsnek, amelyet a trvny kir
r". Ha nem, akkor elmebetegnek nyilvntjk. Az eskdtszk egyhanglag
kimondta, hogy valban nem felels a tetteirt, s M'Naghtent a broad
moori elmegygyintzetbe zrtk, ahol hamarosan vgzett vele a tdbaj.
A M'Naghten-esetre mg ma is hivatkoznak, ha tletrl s bnssgrl
kell dnteni. Viktria kirlyn vilgosan ltta, mennyire fontos, hogy k
lnbsget tegyenek a kett kzt. Felhbortnak tallta, hogy egy sikertelen
kirlygyilkossgi ksrlet elkvetjt elmebetegsg okn nem bnsnek"
nyilvntottk, s az tletet bns, de elmebetegre" mdosttatta. Ezzel
dnt jelentsg jogelmleti krdsre vilgtott r (br a finom rnyalatok a
vdlott eltt taln kevsb voltak nyilvnvalk).
Az tlethozatalnak msutt is vannak hasonl szablyai, br alkalmazsuk
gyakorisga orszgonknt vltozik. Az Egyeslt llamokban bizonyos lla
mok a ni tetteseknl enyht krlmnyknt figyelembe veszik a menstru
ci eltti feszltsget, Montana, Idaho s Utah viszont teljes egszben elt-

215
A VRNKBEN VAN

Egy frfi holttest fejbl kszlt 1 mm


vkony keresztmetszet. A test sszes
metszett felvittk az Internetre mint
a Lthat Emberi Lnyt" (a kivgzett
amerikai gyilkos felajnlotta testt
erre a clra). A metszet a szem alatti
rszrl kszlt, thalad az orron,
az arcon s a levegvel teli arcregeken.
A fej ferdn llt, amikor a metszet
kszlt, gy baloldalt lthat az agykreg
(a szrkellomny", az agy legfels
rtege). Az arcregeket s az ereket
mestersgesen kkre szneztk.

rlte az elmebetegsgre alapozott vdekezst. A legtbb helyen a brsg csak


akkor mondja ki az tletet, ha mr - mint M'Naghten esetben - eldnttte,
vajon a vdlott felfogta-e, hogy helytelenl cselekszik. Ha nem, akkor a jog
tudomsul veszi, hogy nem sjthat le teljes szigorval az elkvetre.
A jogelmletben ms elbrlsban rszesl a szabad akarat, mint a korl
tozott dntsi kpessg. Az elmebeteg kevsb minsl hibztathatnak,
mint az, aki szellemi kpessgei birtokban cselekszik. Nyilvnval, hogy aki
hangokat hall, gy rzi, a nyomban jrnak, vagy indokolatlan dhkitr
sekre ragadtatja magt, az nem felels teljes mrtkben a tetteirt. Inkbb
krhzi kezelsnek kell alvetni, mint brtnbntetsre tlni. A M'Naghten
gy ta az enyhbb tlet alapja nemcsak az lehet, hogy a brsg eltt ll
szemly nyilvnvalan rlt: nha elg egyetlen tvkpzet, melyrl hossz
vekig senki sem tudott. A problma gyakori. Nagy-Britanniban vente k
rlbell tszz gyilkossgi gyben hoznak tletet, s ebbl nyolcvan esetben
nyilvntjk elmezavarodottnak a tettest.
A bri dnts a felelssg jogi minstse, nem egy betegsg krismje.
A brsg sok esetben kikri az orvosok tancst. Az elmebetegsgek eset
ben ppgy, mint az orvostudomny tbbi terletn a vita a genetika fel

216
ALZHEIMER-KR

Ids korban sok embernek gyengl az emlkezte genetikai hiba, a Down-kr esetben. Taln nem
hetsge; ez a szellemi krosods olyan gyakori, vletlen, hogy a Down-kr tnetei kz tartozik a
hogy normlisnak szmt. A legtbben az egyetlen korai regeds s az emlkezetveszts. A klnfle
szervet sem kml ltalnos leplsnek tulaj csaldok minden egyes gn klnbz formit
dontjk. Szlssges formja az Alzheimer-kr. hordozhatjk, megint csak az emlrkhoz (s egy
A betegsgben szenvedk szma taln a hszmil re tbb ms rkltt betegsghez) hasonlan. M
lit is elri. Nha megsemmist kvetkezmnyek dosulatai uralkod gnek, s hatsuk nha mr
kel jr, s odig fajul, hogy a beteg tkletesen elsza harmincves korban megmutatkozik.
kad.a klvilgtl, csak arrl tud, amit az adott pil A felfedezsnek hasznt lehet venni a korai
lanatban maga krl lt. Radsul bizonyos csa Alzheimer-kr diagnosztizlsnl (br a sikeres
ldokban korn kezddik: a tnetek minden tize gygymdot mg nem ismerik) s a gnt hordoz
dik esetben mr kzpkor embereken is mutat magzatok azonostsnl. A gn felfedezse a be
koznak. tegsg jobb megrtshez vezetett. Br az amino
A betegsg magyarzata a gnekben rejlik - savak sorrendje nem azonos bennk, a kt gn
nem is egyben. Az Alzheimer-kr rkld for szerkezete nagyon hasonl, jllehet nem ugyan
mja valsznleg az egyrtelmen genetikai ala azon a kromoszmn vannak. Mindegyik ki-be
p leggyakoribb slyos elmekrosods. Csak n fondik a sejtlirtyn, gy htszer keresztezi a
hny eset rkletes (akr az emlrknl), s a hi membrnt. Taln kzremkdskkel jutnak t
bs gn csaldonknt klnbz. De rendszerint ms fehrjk a sejtlirtyn. Ha nem megfelel a
a i4-es kromoszmn elhelyezked meghatrozott mkdsk, a fehrjk rossz helyen halmozdnak
gn srlt vltozata rkldik. A tbbi csaldnl fel. Valsznleg ez az oka az rkletes Alzheimer
ltalban az i-es kromoszma genetikai krosod kr gyakori tnetnek: nagy mennyisg bta
sa kzs. A maradk kzl nhnyan a 21-es kro
m ez a
amiloid nev fehrjetredk halmozdik fel az
moszma egyik gnjt rklik: ebbl a kromosz agysejtekben. felfedezs csak a kezdet, a
mbl van tl sok az egyik leggyakoribb rkltt gygymdhoz mg hossz t vezet.

A fehrjk, amelyeket az
Alzheimer-krrtfelels
kt gn llt el, feltanen
hasonltanak: ki-be kgyznak
a sejthrtyn, s csak
nhnyszor gaznak el
a sejthrtyn kvl. Tovbb
a mutcik mindegyikben
a sejthrtyn tvel terlet
krl csoportosulnak, jelezve,
hogy ez a fehrje nem ltja
e el megfelelen a munkjt,
nem szivattyzza az
anyagokat ki-be a sejtekbe.

21 7
LOMBROSO S A BNZ ARC

si gondolat, hogy a bn kil az arcra. Szkratszt akrcsak Julius Caesar harci mnjben, a bnzk
egyszer azzal vdoltk, hogy arca durvasgrl ben az let korbbi formi tkznek ki. A szexulis
rulkodik. A kzpkorban ennek a hagyomnynak bncselekmnyek elkveti felismerhetk telt aj
megfelelen trvny mondta ki, hogy ha egy bn kukrl, a gyilkosok csapott homlokukrl. Lomb
cselekmnynek kt gyanstottja van, a rtabbat s roso nzetei nem voltak olyan egygyek, amilyen
torzabbat kell a valszn elkvetnek tekinteni. nek ltszanak. Felismerte a trsadalom felelssgt
Ccsarc Lombroso tizenkilencedik szzadi olasz s azt, hogy megprbltatsaival egyesek - a b
orvos komolyan vette a gondolatot, s ennek jegy nz hajlamak" - msoknl kevsb tudnak meg
ben fogott hozz a bnelkvets indtkainak tu birkzni. S legfkppen lndzst trt amellett,
domnyos vizsglathoz. Lombrosra nagy hats hogy a bncselekmnynek oka van; nem egysze
sal volt Darwin, klnsen az angol tuds rkl ren a gonosz szndk kifejezse, amely automati
dselmletc. Pavia brtneiben s elmegygyint kusan bntetend. Fontos szerepe volt a bntet
zeteibcn gondosan tanulmnyozta a bnzk s el jog megreformlsban, mert munkssga hozz
mebetegek arct (holttestket fel is boncolta abban jrult annak a gondolatnak az elfogadtatshoz,
a remnyben, hogy tall valami jellemz vonst). hogy a bncselekmny esetben nem megtorlsra,
Elszr nem jrt sikerrel, de vgre egy tonll hanem rehabilitcira van szksg.
koponyjban felfedeztem egy igen hossz sor ata A bnz arc gondolata ma megvets trgya.
visztikus abnormitsl. . . hasonlatosakat az alacso Ha a gyilkosoknak aljas brzatuk van, a trsada
nyabb rend gerinceseknl tallhatkhoz. E kl lom aljastotta le ket. Dc a bnz alkat gondola
ns eltrsek lttn gy talltam, hogy megold ta - az is, amely nem l ki az arcra - lassan pol
dott a bnzk lelki alkatnak s a bn eredetnek grjogot nyer. rkltt fogyatkossgok - geneti
problmja: ltaluk a primitv emberek s alacso kai hibk - valban hajlamoss tehetnek bizonyos
nyabb rend llatok jellegzetes vonsai trnek embereket arra, hogy a trsadalom szmra elfo
vissza korunkba . . . egy atavisztikus lnyben, akinek gadhatatlan mdon viselkedjenek. Hogy ezzel mit
szemlyisge a primitv emberek s alacsonyabb kezdjen a trvnyhozs, az ma ppolyan megol
rend llatok vad sztneit idzi fel." Ms szval, datlan gond, mint Lombroso idejn.

Viaszmsolatok a torini Lombroso-mzeumb/, az


egyik lltlag tipikus tolvajarc (jobbra), a msik
218 olyan ember, akit zllttsgben" talltak bnsnek.
EREDEND BN

fordul. gy a trvny olyasmivel kerl szembe, ami taln j dilemmnak lt


szik. Ha valaki szletstl fogva biolgiailag arra van krhoztatva, hogy
bncselekmnyeket kvessen el - bnz alkata van, amelyet birtokosa ter
mszetesnek tall -, akkor ktsgtelenl nem hibztathat, amirt enged ne
.ki. Ha a vtkesnek bnz gnje" van, ez a M'Naghten-gy precedense
alapjn mg akkor is okot szolgltathat az enyhbb bntetsre, ha maga a
bncselekmny volt az els tnet.
A jog gyakran ignybe veszi a genetikt; a DNS-azonosts ma mr sza
bly, s az USA nhny llamban ktelez a csecsemk vizsglata, nincse
nek-e rkltt betegsgeik. A jelek szerint semmi oka, hogy ne hvjk segts
gl ezt a mdszert az elmellapot diagnosztizlsnl is. Csakhogy ebben az
esetben a genetika olyan terletre lp, amelyet a trvny sajtjnak te.kint: az
egyn s a trsadalom kapcsolatnak terletre.
Az emberek vgl is llatok: egy adott viselkedsi formnl nem az a kr
ds, hogy van-e benne szerepe a biolginak, hanem az, hogy milyen ez a
szerep. Tzmillird sejtjvel az agy testnk legtevkenyebb szerve. A szvbl
.kiraml vr egynegyede folyik t rajta. Minden sejt teljes DNS-molekula
kszletet kap eldjtl, a megtermkenytett petesejttl, de a legtbb sejtben
az utastsok nagy rsze leolvasatlan marad, csak nhny gn lp mkds
be. Mivel minden mkd gn zenete eljut a sejt gpezetbe, knny felis
merni a hasznlatban lvket. Ezeknek a szma a klnfle testszvetekben
igen eltr. A vrsvrsejtekben (amelyeknek feladata egyszer s ignyte
len) hatvanhat gn vgez valamifle munkt, a fehrvrsejtek bonyolultabb
vilgban viszont mr huszonktezer. A szvnek hatezer mkd gnje van, a
hernek ugyanennyi - m az agyban, a test irnytkzpontjban harminc
ezer mkd gn tallhat; csaknem az egsz testi llomny fele. Ezek a g
nek ppgy elromolhatnak, akr a tbbi.
Az rkltt betegsgek jelents rsze kihat az agyra, s az elmegygyint
zetek legtbb lakja DNS-nek valamilyen elvltozst tehetn felelss. Az
idegsejtekre hat mutcik csak annyiban klnbznek - mondjuk - a cisz
ts fibrzist okozktl, hogy nem a testet, hanem a tudatot tmadjk meg.
Mendei szablyt kvetik, s szletskor megmutatkozik a hatsuk. Ok s
okozat nyilvnvalan sszefgg. Rendszerint knnyen megllapthat, ki
hordoz srlt gnt, s nem klnsebben nehz egyrtelm dntst hozni
afell, melyik vlt hibss. Ennek a megtallsa lehet az els lps egy elme
betegsg megrtsben.
Az rtelem j genetikja rvilgt arra a tnyre, hogy az elmebetegsg be
llrl szrmazik, nem gonosz kls erk vltjk ki, mint valaha gondoltk.
Az elmebaj gnjeinek felfedezse megadja a kegyelemdfst az si elkpze-

21 9
A VRNKBEN VAN

lsnek, hogy a tboly az rdg munkja, akit knzssal vagy - ha a dmono


kat metaforikusan rtelmezzk - pszichoanalzissel kell kizni.
Valaha a bnzst is a dmoni megszllottsg kvetkezmnynek tulajdo
ntottk (legalbbis az egyhz). A gonosz nll er volt; akiket hatalmba
kertett, azoknak az volt a vtkk, hogy befogadtk. Mint az rltsg eset
ben, a vita a bnzsrl, hajlamokrl s neveltetsrl mlyebb gykerekre
nylik vissza, mint a tudomny. Arisztotelsz vilgosan ltta a gondot. gy
vlte, ktfle bnz van. Nmelyik gyenge akarat, sajt kvnsgai s szn
dkai ellenben cselekszik. Msok azonban elvetemltek, akik elgedetten s
meggyzdssel vtkeznek. k sokkal nagyobb veszlyt jelentenek, mondta
Arisztotelsz, s kemny elbnst rdemelnek - termszetesen azokrl be
szlt, akiket erklcsileg fogyatkosnak, kvetkezskpp bntetst rdeml
nek tartott; de felfogsa, legalbbis kvetkezmnyeit illeten, nem nagyon
klnbzik Texas llamtl, amely rmmel kivgezne mindenkit, akit sz
letett bnznek tart, s gondosan gy szvegezte meg a trvnyeket, hogy
egyarnt vonatkozzanak azokra, akiknek az erklcsei, s azokra, akiknek a
gnjei hibsak.
Ma, amikor tudomsul vesszk, hogy a gnek szmtalan emberi tulajdon
sgra kihatnak, a trvnyhozsnak nem azt kell eldntenie, elfogadja-e az
ilyesfajta bnkre val veleszletett hajlam gondolatt, hanem azt, hogy eb
ben milyen messzire megy. Csak arrl legyen sz, hogy tudomsul veszik a
hajlamot egy olyan rkltt rendellenessg mellkhatsaknt, amelynek leg
tbb hordozja soha nem szegi meg a trvnyt, vagy elfogadjk bizonytk
knt a gneket, amelyek minden hordozjukat bncselekmny elkvetsre
krhoztatjk? Elfogadja-e - elfogadhatja-e - valaha a trvnyhozs, hogy a
legtbb bncselekmnyt olyan emberek kvetik el, akik szletett trvnysze
gk? A genetika most elszr lp olyan terletre, amelyet a trvny sajtj
nak tekint: az egyn s trsadalom kapcsolatnak terletre.
Slyos rkltt betegsg mellkhatsait mr felhasznltk arra, hogy ko
moly bncselekmny elkvetse esetn cskkentsk a bntethetsget. Tz
vvel ezeltt Georgiban egy fiatal nt lecsuktak anyagyilkossgrt. Enyht
krlmnyknt arra hivatkozott, hogy fennll nla az rkltt Huntington
kr veszlye; ez a betegsg az idegrendszer slyosbod leplsvel jr, egyik
els jele - a tudat labiliss vlsa - gyakran csak felnttkorban jelentkezik.
A vdlott apjnak hallt ez a betegsg okozta. Mivel elg a gn egy pldnya,
hogy hatsa megmutatkozzk, a nnek tven szzalk volt az eslye, hogy
rklte a betegsget. Enyht krlmnyknt arra hivatkozott, hogy dhro
hama, amely a tmadshoz vezetett, betegsgnek els tneteknt jelentke
zett. Akkoriban magt a gnt mg nem talltk meg. A br nem vette figye-

220
EREDEND BN

lembe a vdekezst, s a nt letfogytiglani brtnbntetsre tlte. Nhny


v mlva azonban megjelentek nla a Huntington-kr flreismerhetetlen t
netei. A br emlkezett az gyre, s mivel felismerte, hogy a szerencstlen fi
atal n nem volt felels tetteirt, elrendelte szabadlbra helyezst.
Teht elismerte, hogy egy meghatrozott gn korltozta a szabad akaratot.
Az gy ta megtalltk a Huntington-kr gnjt, s el lehet vgezni a vizsg
latot, teht aki akarja, megtudhatja, olyan balszerencss-e, hogy rklte.
A genetikra alapozott vdekezsnek ma knnyebben helyt adnnak, mint
abban az idben, amikor a diagnzis kizrlag a betegsg els tneteinek
megjelensre tmaszkodhatott. Semmi ktsg, ez az eset kivteles, de meg
mutatta, hogy a trvnyhozs knnyszerrel felhasznlhatja a felelssg
cskkentsre az elfogadhatatlan viselkeds rkltt hajlamt.
Ez olyan krds kzelbe visz, amely nemcsaka trvnyhozst, hanem a
vallst s a filozfit is foglalkoztatja. Mirt ltezik a vilgon bn? Ha az em
ber bnsnek szletik, hogyan nyerhet bocsnatot? A problma a hit s a tr
sadalom lnyegbe vg. A bnzs gnjnek" gondolata valjban teolgiai
krdst vet fel. Ha bizonyos emberek olyan hajlamokkal szletnek, amelyek
trvnyszegsre knyszertik ket, hogyan lehet elmarasztalni ket vagy tl
kezni flttk? Hogyan lehet mindenki egyenl Isten vagy a trvny eltt, ha
egy csoport - senki sem tudja, mekkora - letre szl mentessgre tarthat
ignyt annak teljes szigortl a DNS-be rott bizonytk alapjn?
A korai keresztnysg megszllottan viaskodott a bn s megbocsts
ilyesfajta krdseivel. Sokan ppen ezek miatt vontk ktsgbe az egyhz l
tezsnek jogt mint olyan intzmnyt, amely kpes llst foglalni az embe
ri gyarlsgrl. Ezeknek a gondoknak a megoldatlansga vgl jvtehetet
lenl megosztotta az egyhzat. Most fennll a veszly, hogy a tudomny
ugyanezekkel az erklcsi dilemmkkal szembesti a trvnyhozst, s taln
ugyanilyen fenyegetst jelent osztatlan egysgre nzve. A krds lnyege,
hogy felelssgre vonhat-e az ember, s kinek van joga ezt eldnteni.
Pelagius, negyedik szzadi brit teolgus gy rvelt, hogy az ember felels
minden tettrt, akr j az, akr gonosz. Szabad akarata van. Ha nem lenne,
mi sem akadlyozn abban, hogy tadja magt brmely bnnek tetszse sze
rint. A vele szletett gyarlsg nem mentsg. Arisztotelsz tvedett, amikor
azt lltotta, hogy bizonyos emberek nem tehetnek a cselekedeteikrl; min
denki viselkedhet helyesen, s gy is kell viselkednie. Pelagius ttelnek ve
szlyessgt az uralkod osztly azonnal felismerte. Ha elismerjk az ember
dntsi szabadsgt, minimlisra cskken Istennek s fldi helytartjnak,
az egyhznak a szerepe. Vagyis a ttel a korabeli trsadalmi sszetart er
legfbb intzmnynek a lnyegt rinti. Pelagius De Libero Arbitrio (A sza-

221
A VRNKBEN VAN

bad akaratrl) cm munkjt az egyhzi hatsgok megblyegeztk, s szer


zjt kikzstettk. El is tnt szem ell.
Szent goston azutn lett keresztny, hogy elvetette a manicheusok tteleit,
a szektt, amely szerint a vilg termszetbl addan gonosz, s ezen semmi
sem vltoztathat. Sok gondolatuk a sztoikusoktl szrmazik. Mint az szak-af
rikai Hippo pspke, goston vitba szllt Pelagiusszal, s azt lltotta, hogy az
emberisgnek nincs vlasztsa, nincs szabad akarata, hanem magban hor
dozza a vtket az eredend bn katasztrfja okn. A bn- az Istentl val el
tvolods - velnk szletett s egyetemes. dm s va gyarlsgbl ered, s
amg ember ltezik, ldzni fogja. A bn azt jelenti, hogy senki nem kpes sajt
elhatrozsbl vlasztani j s rossz kztt, s csak Isten adhat bocsnatot, ha
az ember lehetv teszi, s befogadja az igjt. goston tantsa szigor volt.
Mivel a gyerekek bnben szletnek, krhozatra jutnak, ha keresztsg nlkl
halnak meg. A pokol, mondotta, csecsemkkel van kikvezve.
Szent goston nem rtette, mirt vlasztotta Isten a nemisget s a belle
szrmaz lehetsget a bnre az den kertjben: Ha dm j trsasgra s
beszlgetsre htozott, tancsosabb lett volna kt frfit bartokk tenni,
mintsem asszonyt tenni a frfi mell." Azt azonban nagyon jl tudta, honnan
szrmazik a gonoszsg. A romlottsg, akr egy gn, tovbbrkldik egyik
nemzedkrl a msikra dm bne, a nemi aktus ltal. A nemi vgyra - az
szavval lhasgra - szksg volt az emberisg fennmaradshoz, de benne
rejlett a gonosz. III. Ince ppa tallan llaptotta meg a tizenharmadik sz
zadban: Ismeretes mindenekeltt, hogy a kzsls mg hzasfelek kzt
sem nlklzheti a test buja vgyt, a szenvedly hevlett s a gerjedelem
bzt. Ennlfogva az ivadk mr fogantatsakor beszennyeztetik, bemocs
koltatik s megfertztetik; a belje nttt llek pedig rkse a bn vtk
nek." goston szerint a gonoszsg rkletes, s az embernek egyedl nem ll
hatalmbaljl brmit is tenni ellene.
Az emberi nllsg problmja - a bn genetikja - megosztotta az egy
hzat, akrcsak jval ksbb a trvnyhozst. Az ellenttek fkpp akrl
csaptak ssze, vajon hatalmban ll-e brkinek az tlkezs. Az egyhz
megalaptsa ta arra hasznlta fel tekintlyt, hogy eltljen vagy megbo
cssson. A gynsok, bcscdulk (igazolsok a bnbocsnatrl) s misk a
halottak lelkrt mind azt a jogt bizonytottk, hogy dnthet a llek sors
rl. Igaz, az ember bnsnek szletett, de megfelel kezelssel kigygythat.
Ha nem volt hajland fejet hajtani a papi tekintly eltt, mlt bntets vrt
r (amelyet goston kegyes szigornak" nevezett - az eretnekek meggetse
lelkk megmentse rdekben) .
Sok keresztny ms vlemnyen volt. Eurpa-szerte tmadtak csoportok,

222
EREDEND BN

Montsgur vrnak romjai a Pireneusokban. 1244-es ostroma utn ktszz kathar hvt ele
venen meggettek itt; azta a vr romba dlt, de megrizte varzst. A ncik rdekldst is
felkeltette, gy vltk, itt volt a Szent Grl (holott ezt a legendt egyltaln nem szoktk kap
csolatba hozni a katharokkal); mg az a szintn hbortos tlet is felmerl idrl idre, hogy
napimdk szent helye volt. Jelenleg Franciaorszg egyik legltogatottabb helye. Sokan vall
jk magukat (tbb-kevesebb meggyzdssel) katharoknak, s szmos egymssal vetlked
kathar pspk" mkdik Eurpa-szerte. Az emberben ma is ers a vgy, hogy kzvetlenl
folytasson prbeszdet Istennel, ne egy msik ember rvn.

amelyek tagadtk az egyhz jogt a beavatkozsra. Ha a bn vele szletik az


emberrel, pusztn emberi hatalom nem tlkezhet fltte.
Az eretneksgek klnfle sznezetek voltak, de mindegyik azon a meg
gyzdsen alapult, hogy a papok olyan jogokat kvetelnek, melyeknek gya
korlsa nem illeti meg ket. A tizenegyedik szzadban a szakadr elmletek a
bogumiloktl terjedtek el, egy balkni szekttl, amely a manicheusokhoz
hasonlan gy vlekedett, hogy az anyagi vilg bns. Csak a szellem vilga
bn nlkl val, s csak gy remlheti az ember, hogy elnyeri, ha kzvetlenl
Istennel folytat prbeszdet. Az elkpzels szilrdan meggykerezett a dl
franciaorszgi Albi krnykn. Rvidesen hvei, a katharok - katharoi, azaz
tisztk - fennhatsga al kerlt Languedoc nagy rsze. Nem ismertk el az
egyhz tekintlyt, egyszer s bnbn letet ltek, s csak Istentl remltek
megvltst. A ppt megrmtette, hogy veszlyeztetik a hatalmt, s keresz
tes hbort hirdetett ellenk. Katharok ezreit mszroltk le, s mg sokkal

223
A VRNKBEN VAN

tbbet vettek r knzsokkal, hogy vallja magnak az igaz hitet. Trvnyeket


hoztak az albigens eretneksg elfojtsra, s hogy rvnyestsk ket, ltre
hoztk az els inkvizcit, amely nagy buzgalommal ltott munkhoz.
1244 -ben a Pireneusokban fek Montsgur vrnak elestvel a katharokra
dnt csapst mrtek. Hogy veresgket megnnepeljk, a gyztesek gigan
tikus katedrlist ptettek Albiban. Hatalmas falfestmny dszti - a legna
gyobb festmny Franciaorszgban -, egy tizennegyedik szzadi ismeretlen
lngelme munkja. Pratlan tkllyel s rszletessggel brzolja azoknak a
knjait, akik bnsnek talltattak - a kevlysg, kapzsisg, dh, bujasg vt
kben s egyebekben. Aki ltta, nem ktelkedhetett, hogy rkkval knok
vrnak mindenkire, aki nem l a megvlts lehetsgvel, melyet a kp meg
rendelje, az egyhz knl.
De az albi katedrlishoz hasonl gyzelmi bizonytkok csak ideig-rig
hatottak. Szz v sem kellett, s az emberrel vele szletett bn krdse szt
szaktotta a katolikus egyhzat. A reformci levonta Szt. goston tanaibl a
logikus kvetkeztetst: mindenki egyarnt bns, brmilyen hatalmas s
ernyes is, s csak Istennek van joga dnteni afell, ki rszesl megvltsban.
Emberi intzmnyek {kztk az egyhz) semmit sem tehetnek, ami vltoz
tatna az ember eleve elrendelt sorsn. Megvltst csak Isten kegyelme hoz
hat, nem a halandk erfesztsei, hogy trtsenek vagy bntessenek.
Luther Mrton 1483-ban szletett. Szerzetesnek tanult, de megdbben
tette trsai erlytelensge. Dlkelet-Franciaorszgban pldul a parasztok
egy paraszt szenthez, Guinfort-hoz imdkoztak, akinek alakjt egybeol
vasztottk egy gyermekvd kutya pogny blvnyval. Luther az akkori
ban Eurpa-szerte dhng szifiliszjrvnyban az egyhz hanyatlsnak ta
nbizonysgt s az utols tlet eljelt ltta. Olyan keresztynsget hirde
tett, amely visszatr bibliai gykereihez, s eltlt sok rgi, a kezdetek ta r
vnyes vallsi szokst, tbbek kztt a clibtus gonosz s tiszttalan gya
korlsft". Kilencvent ttelben (amelyet vagy kiszgezett a wittenbergi
vrtemplom kapujra, vagy nem) a megvesztegethetsg miatt tmadta az
egyhzat. Luther teolgija szigor volt. Csak Isten dnthet arrl, ki rsze
sl kegyelmben. Semmifle emberi cselekedettel nem lehet kirdemelni -
vagy eljtszani.
A reformci lobbantotta lngra Eurpban a kvetkez szz vben dl
vallshborkat. szakon gyztt a megreformlt hit, s a protestantizmus az
ta is megrizte tlslyt. Vonzerejt az adta, hogy ltala mindenki egyenlv
lett az r szne eltt: a gazdagok mr nem vsrolhattk meg az dvssget.
A szent ldozst nem kellett egyszer haland eltt tett gynssal kirdemelni.
Az egyhz sok szertartst elhagytk, mert vlaszfalat emelt Isten s ember k-

224
EREDEND BN

z. A reformci eszmi tkrzdnek a modern jogrendszerben: a trvny


eltti egyenlsg, rkltt vagy egyb eljogokat nem ismer prtatlansg.
A bnre szletettek felismersnek kpessgbl add kvetkezmnyeket
nem a biolgusok vagy jogszok ismertk fel elsnek, hanem a genetikai de
terminizmus legkvetkezetesebb szszljnak, Klvin Jnosnak a kveti.
Csak a szletskor elrendelt sors szmt, lltotta. Egyedl Isten dnt a sor
sunkrl. Mindenki bnsnek szletett s bntetst rdemel, de Isten az ke
gyelmessgben nhny embernek, a kivlasztottaknak rk letet adott a
predesztincival: ami ltal Isten nmelyeknek megadja az let remnysgt,
mg msokat rk hallra tl. Nem tudhatjuk a hit bizonyossgval, ki a kiv
lasz.tott." Br Klvin eleinte gy vlte, a halandknak nincs mdjuk felismer
ni kivlasztottakat vagy krhozatra tlteket, hamarosan rabul ejtette a csal
ka lehetsg, hogy htha nhny kivlasztott felismerhet mr a Fldn.
A klvinizmus jelenleg legtisztbb formjban Skciban s Ulsterben l to
vbb (ahol a vallshbork idnknt fellobbantak akkor is, amikor msutt
mr rg lezrultak). John Knox skt reformtor kzreadta First Blast of the
Trumpet against the Monstrous Regiment ofWomen (A vgtlet els harsona-

Giuseppe Arcimboldo olasz fest


i566-bl szrmaz, korntsem
hzelg portrja Klvin Jnosrl;
a milni szlets mvszre
nem hatottak az szakon gyorsan
terjed protestns eszmk.

225
A VRNKBEN VAN

szava az asszonyi rmuralom ellen) cm vitairatt, melyben az akkori katoli


kus kirlynt tmadta. Tagadta a jcselekedetek ltal elrhet megvlts -
megigazuls - lehetsgt. A szabad akarat, lltotta Knox, dm bnbeesse
kor semmiv lett. A krhozottak azok is maradnak az idk vgezetig minden
klns ok nlkl s nem a sajt hibjukbl. Az dvzltek bejutnak a meny
nyekbe, brhogyan viselkedjenek is a fldn. Szektja hamarosan megszllott
ja lett a bn trgyilagos mrsnek. Quinlan Evanglikus Baromtern tizent
fok van; az iszkossg s a sznhzba jrs pldul ngy pont, a hzassgtrs s
a vasrnapi vigadozs hat. Br a predesztinci nem szolgl mentsgl a hely
telen viselkedsre, azok, akik nincsenek a kivlasztottak kzt, mindenkppen a
pokol tzre jutnak, brmilyen ernyes letek.
A kevs kivlasztott s sok krhozatra tlt gondolata mg mindig mlyen
l a skt s ulsteri trsadalom egyes rtegeiben. Egy szak-rorszgba ltoga
t papot egyszer gy dvzltek: Murphy tiszteletes, beszljen a sajt vr
szomjas, knzsra ksz, trelmetlen, istenkroml, politikai-vallsos ppista
hite nevben, de ne adja ki magt a szabad ulsteriek szszljnak. Most
nem rorszg dli felben van. Menjen csak vissza a papi trelmetlensghez,
istenkroml misihez, vissza a szentelt olvasihoz, szentelt vizhez, szentelt
fstjhez s bzhez; s ne feledje, mi azoknak a mrtroknak a fiai vagyunk,
akiket a maga egyhza lemszrolt, s a mi szemnkben a maga egyhza szaj
hk szlanyja s utlat trgya e vilgon." Imigyen szlt Ian Paisley tisztele
tes kumenizmusellenes kedvben i958-ban.
Paisley trsadalomszemllete Klvin Genfben alaktott j kormnynak
rksge. Szigor erklcsi nzeteket vallottak. Trvnyben szablyoztk a
nk fktjnek formjt, s megbntettk a borblyokat, ha katolikus md
ra borotvltk meg a frfiakat. Egy rvid let ksrlet sorn bezrtk a vros
kocsmit, s helyettk Abbaye" -ket nyitottak, melyekben a szrakoztatst
kizrlag a Biblia pldnyai szolgltattk. Klvinra olyan mly benyomst
gyakorolt a genfiek ernyes letmdja, hogy gy vlte, jellemket tekintve
msok, mint a tbbiek. Az ilyen feddhetetlen lnyek semmikpp sem lehetnek
a pokol rk tzre krhoztatva. Knytelen volt arra a kvetkeztetsre jutni,
hogy nyilvn a kivlasztottak kz tartoznak, akik rk letre szlettek.
Amint Klvin megfogalmazta, a rgi idk izraelitihoz hasonlan a genfiek is
egyszerre voltak eltvelyedett s erklcstelen" lnyek s olyan emberek, akik
Isten ldsban rszesltek . . . mint oly kzssg, mely megalzza magt az
szne eltt". Genf az erny szigeteknt tndklt a romlottsg tengerben.
Amikor Klvin - hite szerint - felismerte azokat, akiknek remnye van az
dvssgre, s elvlasztotta ket azoktl, akikre krhozat vr, rmutatott egy
si s kros eretneksgre s arra az etikai problmra, amellyel jval ksbb a

226
EREDEND BN

genetika szembestette a trvnyhozst. Abban az elkpzelsben, hogy nh


nyan - a Vlasztottak - megvltsra szlettek, hallgatlagosan benne rejlik
egy csalka gondolat. Mgpedig az, hogy bizonyos embereknek kijr az rk
let, brmilyen bnt kvetnek el. Fltte llnak az egyhz vagy a trvny t
letnek. Ez az antinomista eretneksg felszabadtja a keresztny embert min
den ktelezettsg all az testamentumban lefektetett erklcsi trvnyek be
tartsra. Lehetsges, hogy az igazak mer jmborsgbl ernyesen viselked
nek, de fennllt az a lehetsg is, hogy egyszeren semmibe veszik a trvnye
ket, s tadjk magukat a legalantasabb emberi sztnknek. Nincs szksg
tletre, st ernyes viselkedsre sem, hisz nhnyan mindenkppen dvzl
nek, msok pedig mr krhozatra tltettek. Mivel ez az eretneksg arra a te
rletre tved, amelyet az egyhz (egybknt a trvnyhozs is) jogos birodal
mnak tekint, az llam ezt a gondolatot mindig knyrtelenl elfojtotta.
1534-ben John Bockelson vette t Mnster irnytst, ahol a papok a leg
korruptabbak kz tartoztak egsz Nmetorszgban. Mentesltek az adfi
zets all, de a vros iparosait rknyszertettk, hogy hatalmas sszegeket fi
zessenek Rmnak. A holland Bockelson elkergette a papokat, s j Jeruzs
lemet alaptott a reformtus dogma elferdlt (vagy amint mondta, logi
kus) rtelmezse alapjn. Tagadta, hogy a trvnyhozsnak joga van irny
tania a vros polgrait, akiknek sorsa szletskkor eldntetett. A vilg tbbi
rszre pusztuls vr, csak Mnster vlasztott npe menekl meg. Aki szem
beszllt vele, nyilvn nem lehetett a kivlasztottak kzl val, ezrt az ilyene
ket kivgeztk. Hamarosan bevezettk a tbbnejsget, hogy nveljk az
rk letre kijelltek szmt; neki magnak tizent felesge volt. Bockelson
trnszket llttatott fl a piactren, s kihirdette, hogy Isten kivlasztotta t
az egsz vilg felkent kirlyul. Eltrlte a vasrnapot, s a pnzt is, amelyet
pusztn dszt jelleg aranyakkal helyettestettek.
Az egyhz - s a nemessg - mlysges felhborodssal fogadta mindezt.
A vrost hnapokon bell megtmadtk szomszdai, s hossz ostrom utn
kiirtottk az eretnekeket. Bockelsont foglyul ejtettk, s lncra fztk, mint
egy mutatvnyos medvt. 1536-ban tzes vassal nyilvnosan hallra knoz
tk; hang nlkl trte a knokat. A ketrec, melyben hajdan csontjai voltak,
ma is ott fgg a mnsteri templom mennyezetn.
Hogy az ilyesfajta hiedelmek hov vezetnek, azt egy tizenkilencedik szza
di skt r, James Hogg klns pszicholgiai regnye mutatja. A The Private
Memoirs and Confessions ofa Justified Sinner (Egy megigazult bns emlke
zsei s vallomsai) kt fltestvr, John s Robert Colwan trtnete. Robert
egy klvinista prdiktor, Wringhirn tiszteletes trvnytelen fia. A prdiktor
mintegy sztnsen felismerte a kivlasztottakat, s azzal a kpessggel

227
A VRNKBEN VAN

brt, hogy megmondja, sajt egyhzkzsgben s nmely szomszdos egy


hzkzsgben kik szlettek az gret szvetsgnek hatrain bell s kik
nem". Meggyzi fit, akit knoz a rettegs a krhozattl, hogy a megvltot
tak kztt van. Robertet mintha kicserltk volna:
Srtam rmmben, amirt ilyelnkppen biztostkot nyertem afell, hogy im
mr minden bntl megszabadultam, s hogy emez j llapolomtl tbb meg
nem fosztathatom. Szkellve indulk a mezkre s erdkbe, hogy imdsgban
ntsem ki lelkemet a Mindenhat eltt, amirt ily kegyes volt hozzm: egsz tes
temben megjhodni rzm magam; minden idegem j lettl pezsge; mintha re
plni lettem volna kpes a levegben, avagy szkellni a fk cscsa fltt. Lelkem
flizgulsa magasba emelt, a fld s a rajta cssz-msz bns leremtmnyek
fl; az emberek gyermekei kzt sasnak rzm magam, mely magasan szrnyal
vn sznalommal s megvetssel tekint az alant cssz-msz teremtmnyekre.
Amint gy lpkedk ulamon, titokzatos klsej ifjt pillanlk meg, ki felm
kzelge.

Mondanunk sem kell, az ifj nem ms, mint az rdg. Elhiteti a Megigazult
Bnssel, hogy nem lehet vtkes. Robert Colwan elszr megl egy rtatlan
regembert. Aztn fivre ellen ksrel meg gyilkossgot; hazatrve transzba
esik, s megli anyjt. Vgl rjn, hogy az rdg hatalmba kerlt, s elmene
kl a trvny ell (meg a Stn ell, akirl Colwan most biztosra veszi, hogy
Nagy Pter orosz cr). Vgl ngyilkossgot kvet el, remlve, hogy gy elpusz
ttja bns njt - s a msikat, az rdgt, aki kzben mr flvette az alakjt.
A knyv meglepen jl brzolja a meghasadt tudatot; a szkizofrnia lersval
szolgl egy vszzaddal azeltt, hogy a fogalom kzhasznlatv vlt.
A Robert Colwant elemszt gondolat most j mezben visszatrt a tudo
mnyos nyelvben. A gnekrl s bnzsrl folytatott vitk kzppontjban
azok az rvek llnak, melyek a predesztincira vonatkoznak, s a trsada
lom jogra, hogy tletet mondjon azok fltt, akiknek a sorsa szletsktl
fogva elrendeltetett.
A trvnyhozs mr tbb-kevsb tudomsul vette, hogy vannak ritka
gnek (pldul a Huntington-kr), amelyek fokozzk a bnelkvets koc
kzatt. Most azonban azt kell elfogadnia, hogy a gyakori elmebetegsgek,
amelyeket mr rgta enyht krlmnynek tekintenek, rszben genetikai
befolys alatt llnak. Mr az orvostudomnyban sem csak ritka betegsgek
kel kapcsolatban kerl szba a genetika, hanem olyanokkal kapcsolatban is
(mint a szvbetegsgek), melyek szinte brkit utolrhetnek. Ezeket valamikor
kizrlag krnyezeti rtalmaknak tulajdontottk, most azonban a genetika
bebizonytja, hogy tbb nem elg szemrehnyst tenni a szvbetegeknek,
amirt nem tudnak rr lenni egszsget krost sztneiken. Nhny be-

228
EREDEND BN

tegnek pldul, aki slyos szvpanaszokkal kszkdik, van egy gnje, amely
gtolja a koleszterin eltvoltst a vrbl. Csaknem biztos, hogy ennek a
gnnek a hordozi megbetegszenek (br a tnetek megjelenst megfelel
trenddel s gygyszerekkel ksleltetni lehet). A2 orvostudomny egyre in
kbb felhasznlja a genetikt azoknak a kivlasztsra, akiket meg kell vni a
magukkal hozott tulajdonsgok kvetkezmnyeitl.
Lassan ugyanilyen bonyolultt vlnak a jogszok biolgiai okfejtsei is.
Mr nem arra hivatkoznak, hogy nmelyek mindenfle krlmnyek kzt
predesztinlva vannak a trvnyszegsre; hanem arra, hogy gnjeik miatt ke
vsb kpesek megbirkzni a bnzsre sztnz krnyezeti hatsokkal.
Mint az orvostudomnynak a betegsgek esetben, taln a trvnyhozs
nak is szembe kell nznie a tnnyel, hogy nemcsak nhny, hanem igen sok -
taln a legtbb - bnz azrt kvet el trvnysrtst, mert gnjei hajlamos
s teszik r. A2 ilyen vagy olyan bncselekmnyekrt letartztatott ezrek k
zl sok hordoz olyan gneket, amelyek mdostjk viselkedst, s a geneti
kai alapon ll vdelem elfogadsa esetn mindegyikknek legalbbis eslye

A mono-amino-oxidz (MAO) gnjnek egy holland csaldban elfordul srlt mutcija.


A kp t szemly azonos hely DNS-szakaszait brzolja, minden DNS-egysget ms szn
nel. Balrl a negyedik szemlynl kritikus mdosuls lthat (vrs helyett srga). A nyl a
DNS egyik ptelemnek elvltozst mutatja -vgzetes krosodst okoz az enzimben.

22 9
A VRNKBEN VAN

Az egyik ingerlettviv anyag a szerotonin (a kpen kristlyos alakban), amelyet a MAO


enzim bont le. A slyos depresszit sszefggsbe hozzk a szerotoninhinnyal; nhny n
gyilkos agya ebbl a hrmolekulbl" a normlis mennyisgnek csak a felt tartalmazza.

nylik arra, hogy enyht krlmnyknt felhasznlhatja gnjeit. A trvny


hozs tlete all ea kibv, melyet John Bockelson felismert, ppolyan s
lyos ktsgekhez vezethet, mint amilyenekkel Mnster npe via*odott.
Bven akad bizonytk arra, hogy a gnek szerepet jtszanak a bnzs
ben. Egy embernek, akinek priuszos egypetj ikertestvre van, az tlagosnl
tven szzalkkal nagyobb az eslye, hogy brtnbe jut. A ktpetj ikreknl
(ahol csak a gnek fele kzs, nem mindegyik) ez a szm krlbell hsz
szzalk. Br ezt az arnyt minden ms tulajdonsg estben elfogadnk a bi
olgiai hajlam rvnyes bizonytkaknt, azokra nincs hatssal, akik elszn
tan tagadjk a lehetsget, hogy a gnek sszefggsben llnak a bnzssel.
m egyre meggyzbbek a bizonytkok.
Krlbell harminc vvel ezeltt egy holland frfi feljegyzseket kezdett
kszteni a csaldjban rendszeresen visszatr, nyugtalant viselkedsfor-

230
EREDEND BN

mkrl. A fiatalemberek kzl sokan csekly rtelmi kpessgek s hirtelen


haragak voltak. Ha felbosszantottk ket, agresszvv vltak. Volt, aki dur
vn viselkedett a nkkel (egyikk megerszakolta a sajt hgt). Msok
gyjtogatk lettek. Egyikk, akit intzetbe zrtak, leszrta felgyeljt egy
vasvillval. Genetikushoz fordultak a problmval. A tbb nemzedkre ki
terjed betegsg jellegzetes rkldsi rendet mutatott: a ni gon rkl
dtt, de csak a frfiakon mutatkozott meg a hatsa. Pontosan ez vrhat egy
olyan gntl, amelynek a hordozja az X-kromoszma. Megvizsgltk a mg
l nyolcat a betegsgtl megtmadott tizenngy frfi kzl. Vizeletk nagy
mennyisgben tartalmazott bizonyos vegyi anyagokat, amelyeknek szerepe
van az idegek ingerlettviv szerepben. Ezeket rendszerint lebontja egy
enzim (a MAO: a mono-amino-oxidz), teht valsznleg ez krosodott.
Hogy ez az enzim pontosan milyen feladatot lt el az idegek kzti inger
lettovbbts bonyolult munkjban, nem vilgos. A MAO rszt vesz az adre
nalin, az ss vagy fuss" hormon anyagcserjben, s valamilyen mdon egy
msik kzvett, a szerotonin lebontsban is (amely belejtszik pldul az
LSD hatsba). Az enzim egyik formja azt a jelentktelenebb feladatot ltja
el, hogy a vrsborban, sajtban s csokoldban tallhat anyagokat meg
emszti. Nhnyan, akiknek a szervezetben alacsony a MAO-tartalom, lidr
ces lmokkal kszkdnek, esetleg eljulnak, ha valamelyikbl tl sokat fo
gyasztanak. Bizonyos gygyszereket, amelyek tevkenysgt gtoljk, a dep
resszi kezelsre alkalmaznak, de megint csak nem vilgos, ezek hogyan fej
tik ki hatsukat.
A genetikusok nagy rmre a holland vizsglatban rszt vev betegek
kzl mindegyiknl talltak egy rkltt hibt a mono-amino-oxidzt el
llt gnben. A mutciban egy mdosult DNS-bzis krostotta az enzim
tevkenysgt. Br azoknak a cselekedetei, akik ezt a mdosulst hordozzk
- a hromezermillird DNS-bzis kzl egyetlenegyben -, klnbzek le
hetnek, a gyjtogatstl a tettlegessgen t az otromba rzelemnyilvntsig,
viselkedsk ltalban normlis. A gnhibs frfiak viselkedst a pszichite
rek egyetlen ismert elmebetegsggel sem tudtk rokonsgba hozni. A legtbb
szban forg frfi nem kvetett el trvnysrtst. St egyikk ns, gyerekei
vannak, lland munkahelye. Taln a szervezetkben visszamarad idegi t
vivanyagok neheztik meg, hogy elviseljk a feszltsget, s olyan dhroha
mokat vltanak ki bellk, amelyekkel szemben tehetetlenek. A hibs gn
egyb kvetkezmnyekkel is jr. Hordozinak olykor veszlyesen felszkik a
vrnyomsuk, lmatlansgtl szenvednek, s bizonyos lelmiszerek (pldul
mlesztett sajtok) fogyasztsa utn nyugtalansg lesz rr rajtuk. A frfiak
kzl sokan fiatalon meghaltak, taln azrt, mert - br akkoriban errl senki

231
A VRNKBEN VAN

fgy ltja betegsgt


egy szkiwfrnis.

11 r1sK
o u -r
OF

RQUR
sem tudott - rkltk a hibs gnt, s kptelenek voltak megbirkzni a m
sokra nzve rtalmatlan krnyezeti hatsokkal. A gnt kutattk ms csopor
tokban is, akr szenvedtek tagjai lelki zavarokban, akr nem, de egyelre a hi
ba mindssze egyetlen csaldra korltozdik.
Az ilyesfajta, ltszlag egyrtelm kapcsolat egy hibs gn s az antiszocilis
viselkedsmd kztt termszetesen nagy felhborodst vltott ki. Megindult
a bnz gnnel" foglalkoz jsgcikkek radata. A kutatcsoport egyik tag
ja el akart fogadni egy llst Nmetorszgban, de villmgyorsan meggondolta
magt, amikor egy nmet genetikus a holland kutatst prhuzamba lltotta a
ncikat tmogat biolgusok tevkenysgvel. A nagykznsg szmra for
galomba hozott vltozat - hogy azok, akiknek egy bizonyos gnjk van, mind
bnzkk vlnak - tlzs volt, de rvilgtott egy tfogbb nehzsgre,
amellyel a trvnyhozsnak rvidesen szembe kell nznie; ez mr nem szort
kozik egyetlen csaldra, mint a holland mutci, hanem ltalnos rvny.
A szkizofrnia gyakori betegsg, csak Angliban flmilli estet tartanak
szmon. A meghasadt nt valamikor dmoni megszllottsgnak tulajdon
tottk. A gonosz hangok, melyek azt parancsoljk a szerencstlen ldozat
nak, hogy bnt kvessen el, brmit diktljon is jobb termszete, csakis kvl
rl jhetnek - ez nyilvnvalnak ltszott -, s ki kell zni ket. A betegsg
megsemmist: ltomsok, hangok, logikai s rzelmi lepls. Nha a beteg
szinte mozdulatlann dermed, msokon knyszeres mozgsok mutatkoz
nak. Gyakran sszefggstelen mondatok dlnek belle. Mindez mr serd
lkorban megkezddhet, s folytatdhat egy - sokszor ngyilkossgba tor
koll - leten t.

23 2
LTHATV TETT HANGOK

A hallucincik olyan benyomsok, amelyek kvl


rl rkez jelek nlkl keletkeznek. Hangok vagy
ltvnyok lehetnek. A pozitronemisszis tomo
grfia PET gy kszt felvteleket a bels szervek
- -

rl, hogy rszecskegyorsitbl kibocstott sugarak


kal bombzza a szveteket. Ennek hatsra a vrbe
fecskendezett kontrasztanyag azokon a pontokon
villan fel, ahol a sejtek ppen mkdsbe lpnek.
Egy szmtgphez kapcsolt letapogat berendezs
sel feltrkpezhetk ezek a tevkenysgi kzpontok.
A kp egy szerencstlen szkizofrnis agynak
aktv terleteit brzolja; a beteg azt rzkelte,
hogy fnyben sz, sznpomps tjban test nlkli
fejek gurulnak, s utastsokat adnak neki. Az bra
hamis sznei csak az idegtevkenysg szintjeit mu
tatjk. A beteg a kszlkben lt, s ha vzija t
madt, megnyomott egy gombot. A ltomsok ide
jn agynak egyes rszei (fkpp a bal oldalon) ten, amely a valsg bels kpt lltja el, akr r
sznesen rajzoldtak ki, ahol mkdsbe lptek az keznek adatok a klvilgbl, akr nem. A beteg a
agysejtek. A mkds egy rsze mlyen az agy bel bels kpmozgst tvesen kls jelzsnek fogja fel,
sejben, a talamuszban ment vgbe, azon a terle- amely ltszlag hitelesen kzli vele, mit kell tennie.

B AL JOBB

-16 mm -8 l'\,'Tl 0 mm

8 :nm 32 ffi."TI

FENT S BALRA: A pozitronemisszis


tomogrfia PET letapogatja
- -

egy szkizofrnis beteg agyt hallu


cincik kzben. Az agy mkd
terletei fnyfoltokknt rajzoldnak
ki. Az aktivits szintje nha olyan
magas, hogy ellenllhatatlan erej
bels kpeket llt el.

233
A VRNKBEN VAN

A szkizofrnia diagnzist gyakran felhasznljk a jogszok: arra hivat


koznak, hogy gyfelk nem felels cselekedeteirt. Az utbbi vekben n
hny szkizofrnis beteg, akit elbocstottak az elmegygyintzetbl annak
az irnyelvnek megfelelen, hogy sajt kzssgkben kezelik majd ket,
minden eljel nlkl gyilkolt. llapotukat mindig figyelembe veszik, amikor
sorsukrl dntenek. A legtbb gyilkosnak kijr brtnbntets helyett ket
valsznleg elmegygyintzetbe kldik, s gygyszeres kezelssel igyekez
nek elfojtani a betegsg tneteit.
A betegsg rkldik a csaldokban. Noha krlbell minden szzadik
ember lesz szkizofrnis, a beteg szlk gyerekei kzl minden tizediknl
alakulnak ki a tnetek. Ez termszetesen addhatna abbl is, hogy egy csald
minden tagja azonos ignybevtelnek van kitve. Taln maga a csald a fele
ls: a radiklis pszichiterek szemben a diszfunkcionlis csald" valamikor
ppen olyan dnt oka lehetett az elmebetegsgnek, mint a DNS brmelyik
rsze. Az i960-as vekben az a romantikus nzet uralkodott, hogy a szkizof
rnia rtelmes vlasz egy tbolyult vilgra.
A betegsg rkldse mg nem bizonytja genetikai meghatrozottsgt.
De sokfle okbl felttelezhet, hogy a gneknek van nmi szerepk a szkizof
rniban s ms tudati rendellenessgekben ppgy, mint a szvbetegsgben
vagy cukorbetegsgben. A pszichiterek mr rgta elkvetnek mindent,
hogy megtalljk a felels gneket. Sajnlatos mdon munkaterletk tele
van ilyen vagy olyan betegsgek (tbbek kztt a szkizofrnia) gnjeinek
tetemeivel, melyek akik a jl vgzett munka utn tvoznak. Az ilyesfajta gnek
felkutatsra sok mdszer knlkozik. A szkizofrnia esetben mindegyikkel
megprblkoztak. Ha egy ktpetj (teht gnjeinek felben azonos) ikerpr
egyik tagja tudathasadsos, a msiknl krlbell hat az egyhez a megbetege
ds eslye. Az egypetj ikreknl (akiknek minden gnjk azonos) a kockzat
jval..Jllagasabb: kett az egyhez. A msik informci a gnek szereprl az
rkbe fogadott gyerekektl szrmazik. A megbetegeds eslyeit illeten ha
sonltanak biolgiai szleikhez (alcikkel taln sohasem tallkoztak), s az
rkbe fogadott szkizofrnis gyerekek biolgiai rokonainl nagyobb val
sznsggel mutatkoznak meg a tnetek, mint az rkbe fogad szlknl.
A szkizofrnia genetikai alapja meglehetsen bonyolult. A betegsget - akr
az emlrk esetben - egyes csaldoknl befolysolhatjk a gnek, msoknl
nem. Elfordulhat, hogy mg azok kzl sem mindenkinl mutatkozik meg,
akiknek mdosult a DNS-e. A krnyezeti hatsok is fontosak. Az alkoholiz
mus, kbtszer-fogyaszts s agydaganat is elidzheti tneteit. Sok tudati
rendellenessget - depresszit, emlkezetkiesst, nyugtalansgot, szorongst -
idz el az rkltt hajlamnak s a nehz krhnnyeknek ez az tvzete.

234
-

EREDEND BN

Most azonban rendelkezsre ll a bizonytk, hogy a tudathasads, leg


albbis nmelyeknl, a hibs DNS-sel van sszefggsben. A molekulris bi
olgia arra utal, hogy nhny esetben nem egy, hanem kt kromoszmn el
helyezked gnekkel magyarzhat a hajlam. Nagyon kevs emberben
hinyzik a 22-es kromoszma egyik apr darabja. Ebbl mindenfle bajok
addhatnak: szvbetegsg, farkastorok, jellegzetes arc. Minden tizedik beteg
nl kialakul a szkizofrnia. Ms tudathasadsos betegek csaldjnak vizsg
lata is arra mutat, hogy olyan gnek jtszanak szerepet a betegsgben, ame
lyek ezen a kromoszmn (valamint a 6-os kromoszmn) helyezkednek el.
Az egyik taln azt az enzimet kdolja, amelyik az idegsejtek ingerletlviv
anyagait (pldul az adrenalint) bontja le. A MAO-hoz hasonlan ez is befo
lysolja az idegsejtek mkdkpessgt, s akiknl alacsony a szintje, hajla
mosak az elmebetegsgre.
Akiknl nem mutathatk ki a szkizofrnia elzmnyei, azoknl nha nem
knny fellltani a krismt (klnsen birsgi krnyezetben). Ktsgte
len, hogy rvidesen genetikai vizsglatot fognak alkalmazni, s a brsgok a
tbbi bizonytk mellett ezt is figyelembe veszik a vdlott elmellapotnak
megllaptsakor. Ez jabb lps annak a gondolatnak az elfogadshoz,
hogy nmelyeknl a trvnysrtsnek genetikai oka van. A legtbb szkizofr-

Alkoholista mja. A sejtek


elpusztultak, s elfordulhat,
hogy a beteg a maradk
sejtek vrzsbe hal bele.
A gnek taln szerepet
jtszanak az alkoholos
veszlyeztetettsg
nvelsben.

23 5
A VRNKBEN VAN

nis azonban sohasem kerl bajba, s vatosan kell bnni a krdssel, hogy
egy adott bncselekmny mgtt vajon ez a betegsg ll-e vagy sem.
Amennyiben a bnz viselkeds ilyen nyilvnvalan rkldik - amint a
szociolgusok kimutattk -, s a DNS-technika felhasznlhat azoknak a
betegsgeknek a kimutatsra, amelyek hajlamoss tesznek r, mirt kavar
nak olyan nagy vitt a bnzsi hajlamot nvel gnek? Ez visszavezet a sza
bad akarat si krdshez. Ha a tudomny segtsgvel felismerhetk a g
nek, amelyeknek legfbb feladata nem az, hogy nyilvnval betegsgeket
okozzanak, hanem hogy elfogadhatatlan viselkedsre tegyenek hajlamoss
valakit, akkor nhny embernek mdjban llhat, hogy tbb-kevsb meg
gyzen trvnyszegsre szletett embernek minstse magt. Ekkor a trsa
dalom szembekerl a problmval, amelyet Klvin vetett fl: bizonyos em
berek ms elbnst rdemelnek, mert sorsuk mr szletskkor elhatrozta
tott. Br eredeti formjban a klvinizmus azt vallotta, hogy a kivlasztotta
kat csak Isten ismeri, s ktelessge mindenkinek, akr dvssgre jut, akr
nem, hogy Istennek tetsz mdon viselkedjk, tantst rvidesen arra hasz
nltk fel, hogy bizonyos embereket szletsk jogn kivltsgos helyzetbe
juttassanak. Most a genetika egyesek szerint Istent jtszik (vagy legalbbis
Wringhim tiszteletest), amikor azt mondja magrl, hogy felismeri - taln
mr szletskor -, ki vlasztatott ki bnzsre s ki nem. Hogyan fog meg
birkzni a trvny a Megigazult Bnsk egsz nemzedkvel?
Az Egyeslt llamokban egyre nyilvnvalbb ez a gond. A brsgoknak
azeltt nem okozott klnsebb fejtrst, hogy mikpp jrjanak el azokkal,
akiket gnjeik slyos elmebetegsgekre tettek hajlamoss. 1992-ben azonban
addott egy eset, amelynek kimenetele messzemen kvetkezmnyek lehe
tsgt rejtette magban.
John Baker sikeres kaliforniai gyvd, pontosabban az volt. Egyszersmind
alkoholista. Hivatsnak feszltsge miatt ivsnak adta a fejt. gyvdi gya
korlatban annyira eladsodott, hogy pnzt emelt le egyik gyfele szmlj
rl. A bncselekmnyt hamarosan felfedeztk, s t a Kaliforniai Jogsz Egye
slet el idztk. gyfelet meglopni slyos vtsg. A bntets kzenfekvnek
ltszott: eltilts a hivats gyakorlstl. John Baker beltta bnssgt, s
szmolt azzal, hogy plyjnak befellegzett. De gyvdjre hallgatva megje
gyezte, hogy apja alkoholista volt, s szak-amerikai indin vr folyt az erei
ben. A bennszltt amerikai kzssgek alkoholproblmja kzismert.
Rszben genetikai eredet. Az amerikai indinok szervezete - akrcsak az
zsiai npek, amelyektl szrmaznak - kevsb kpes az alkohol lebonts
ra. Ebben (mint a mono-amino-oxidz holland mdosulsban s taln a
szkizofrnira val hajlamot okoz gnek esetben) szerepet jtszik egy en-

236
EREDEND BN

zim, ezttal az alkohol-dehidrogenz. Az enzim indin mdosulata kevsb


aktv, mint a legtbb eurpai vltozat, kvetkezskpp azok, akikben ez m
kdik, fogkonyabbak az alkohol kros hatsra.
Baker gyvdje indtvnyozta, folyamodjanak enyhbb tletrt azon az
alapon, hogy a vdlott rkltt adottsgainl fogva kptelen megbirkzni az
alkohol ksrtsvel. Mindkettjk meglepetsre a vdekezs bevlt. John
Bakert nem trltk az gyvdi nvjegyzkbl, csak felfggesztettk, s ha
akart volna, rvidesen visszatrhet a hivatshoz. Mr nem iszik; de nem is
folytat gyvdi gyakorlatot. Mint mondja, a munkjval jr ignybevtel
esetleg megint rvenn, hogy a pohrhoz nyljon. Inkbb egy szerencsej
tk-forgalmaz vllalatot vezet.
Az eset olyan problmt vet fel, amely vgl korltozhatja a gnek brsgi
alkalmazst. John Baker vdekezse nem egy riika rkltt betegsgen, ha
nem egy normlis mdosulsi rendszeren alapult. Amerikaiak tzmillii - in
din vagy japn szrmazsak, de sok eurpai szrmazs is - szletsi
adottsgaiknl fogva nem brjk az alkoholt. Ezrt tbb gn is felels; nha
(pldul Bakeml) a mreglebont mechanizmus mdosulsval fgg ssze,
mskor viszont a kpessggel, hogy valaki elkerlje az alkoholfggsg vesz
lyt. Lehetsges, hogy az eurpai szrmazs alkoholistkban inkbb egy in
gerlettviv anyag klns vltozata tallhat, amely az agy gynyrkz
pontjban" helyezkedik el; a szervezetnek erre a rszre gyakran hivatkoznak
azok, akik a fggsg vegyi alap elmleteit kedvelik. Tz alkoholistbl akr
ht is hordozja lehet ennek az anyagnak (amely a D2 dopaminreceptor gn
A1 vltozataknt ismeretes). A legtbben, akik ilyesfajta gneket rkltek,
nem lesznek alkoholistk, de ha mgis, rendszerint megmaradnak a trvny
korltain bell. Elvben viszont mindegyik ignyt tarthatna r, hogy gnjeit
szmtsba vegyk, amennyiben italos llapotban thgn a trvnyt.
A trvny alapvet feladata, hogy azonostsa s megfelel elbnsban r
szestse azokat, akik nem tartjk be a trsadalmi szablyokat. Az enyht k
rlmny gondolatban ki nem mondva benne foglaltatik a normalits: csak
azok a kevesek nem tartoznak teljes felelssggel cselekedeteikrt, akiknek
biolgija ( netn elviselhetetlen krlmnyei) rendkvliek. Valamikor a ge
netika is csak azokkal a gnekkel foglalkozott, amelyeknek kvetkezmnye
knt a megszokottl jelentsen eltr helyzet llt el: az albnkkal, a ciszts
fibrzissal, a szkizofrnival. Egszen a kzelmltig a genetika a szlssgek
.
tudomnya volt.
Mindez felveti a nyilvnval krdst: tulajdonkppen mi szmt normlis
nak a trsadalomban vagy a biolgiban? A genetikai gondolkodsmd leg
nagyobb vltozst az a felismers hozta, hogy nincs mrvad" genotpus.

237
A VRNKBEN VAN

Nem igaz, hogy mindenki egyforma, kivve azt a nhny embert, aki rk
ltt betegsget hordoz. pp ellenkezleg, nincs kt hasonl ember. A DNS
en hrommilli gnhely tallhat, amely szemlyenknt ms s ms. Fkpp
olyan rszeken, amelyeknek nincs lthat feladatuk, de ezrvel vannak m
kd gnek (kzlk sok kihat a viselkedsre), amelyek egynenknt kln
bzk. Pldul az ltalnos npessgben a MAO-enzim mkdsnek tbb
mint szzfle vltozata fordul el. A gyenge mkdkpessg sszefggsbe
hozhat az alkoholizmussal, a depresszival s az izgalom abnormlis haj
szolsval. Az enzim, melynek egy holland csaldban megfigyelt elgtelens
gt gyakran kihasznljk a bnz gn" elmlet vdelmezi, annyira vlto
zkony, hogy potencilis bnzk ezrei hivatkozhatnnak r, ha akarnnak.
Ez a sokflesg azt jelenti, hogy a biolgira alapozott vdelem rvidesen
mindenki eltt nyitva ll. A D2 dopaminreceptor gn A1 vltozatt (amelyet
bizonyos mrtkig sszefggsbe hoznak az alkoholizmussal) a npessg egy
tde hordozza. Taln jutalomgn", amely az azonnali kielgls minden
formjnak kedvez. lltlag gyakori pldul a kokainistknl. A kokain fo
kozza a gynyrkzpontban a dopamin termelst, melyet a felttelezett re
ceptor lekt. Nhny kbtszeresnl elfordulhat, hogy tudtn kvl geneti
kai hibjnak megfelelen kezeli magt. Egyesek szerint a dopaminszint in
dokolatlanul magas az autista gyerekeknl s azoknl, akik nem tudnak meg
birkzni a lelki srlsekkel, st a viszonylag zrkzott embereknl is. Br so
kan azt krdezik, lehetsges-e, hogy egyetlen gnnek ennyifle, egymstl el
tr hatsa legyen, az a tny, hogy ilyen sokfle emberben megtallhat, feltt
lenl megvltoztatja a genetika s trvnyhozs klcsnhatst.
Amint egyre vilgosabb vlik, hogy a nemkvnatos viselkeds bizonyos
formi (szmos fizikai betegsghez hasonlan) az rkltt kptelensgt
tkrzik arra, hogy valaki megbirkzzon a nehz krlmnyekkel, nagy a k
srts, hogy minden rossz viselkedst a gneknek tulajdontsunk. Olyan tet
teket, amelyeket valamikor egyszeren rossz nevelsbl vagy ppensggel
pajkossgbl ered antiszocilis viselkedsnek minstettek volna, manap
sg egyre inkbb termszetadta gyengesgnek tulajdontanak. A gyerekek
mindig is rosszalkodtak, nha katasztroflisan viselkednek. Minden iskol
ban akadnak tanulk, akikkel sok baj van, s akik nem tudnak koncentrlni.
A problma rgi, akrcsak a rla alkotott, egymssal szemben ll vlem
nyek. A korai reformerek vagy az iskolk megkrgesedett sterilitst s me
revsgt", vagy bizonyos tanulk rkltt bns hajlamait" s hinyz
leterejt" hangslyoztk. Az 1960-as vek felfogsa, hogy csak a rendszer hi
bs, harminc vvel ksbb nyomaszt szimmetrival mozdult el a gondolat
fel, hogy a problmt a fiatalok jelentik.
EREDEND BN

Valamikor a zaboltlan gyerekekrl azt tartottk, hogy szksg esetn meg


kell ket rendszablyozni. Most azonban ltezik egy betegsg, a figyelemhi
nyos hiperaktivitsi rendellenessg (ADHD). Tnetei kzt van a gyenge kon
centrlkszsg, az alacsony kudarctr kpessg s az ltalnos hajlam a fk
telen viselkedsre. Mita ezt az llapotot vagy egy vtizeddel ezeltt felismer
tk, jrvnyos mreteket lttt, s amerikai gyerekek milliit tmadta meg.
Nhny kaliforniai osztlyban a tanulk egynegyednl diagnosztizltk.
A szlket termszetesen nyugtalantja a dolog, s pszichiterhez fordulnak ta
ncsrt. Sokan szervi betegsgnek tartjk, s gygyszeres kezelst alkalmaznak,
amely nhny gyereknl jelents javulst eredmltiyez. Olyan sokan kapnak
gygyszereket, hogy egyesek szerint ez mr nem is kezels, hanem ksrletezs.
Ez a betegsg (ha egyltaln az) vajon mirt olyan gyakori? Az okokat az
dtk festkanyagtl a szmtgpes jtkokig mindenben keresik. Sok
pszichiter szerint azonban a gnek felelsek rte, s a betegsg viselkedsi
sklja az ingerlkenysgtl a beszmthatatlansgig fokozd dhrohamo
kig terjed. Szlssges megnyilvnulsa Tourette-szindrmaknt ismeretes:
szidalomkitrsekkel, kpkdssel s kiszmthatatlan viselkedssel jr.
Hordozi ltalban alkot s kreatv emberek. De nha vratlanul kitrnek
sokszor a krlttk lk legnagyobb rmletre. Nmelyek szerint ismt a
gnek a felelsek, a D2 dopaminreceptor gnjnek Al vltozata. A gn taln
fokozza a ksrtst, hogy hordozja engedjen a minden gyereknl gyakori
ksztetsnek, s ez vezet az elmebetegsg diagnzishoz.
Kimutattk, hogy az ADHD-ben szenved gyerekeknl sokkal gyakoribb
a felnttkori kbtszer- vagy alkoholfggsg kialakulsa. J ideje nem ti
tok, hogy a fktelen gyerekeknl nagyobb az esly, hogy sszetkzsbe ke
rlnek a trvnnyel, mire felnnek. Nagy-Britanniban a fiatalkorak bn
cselekmnyeinek negyedt az sszes fiatal bnelkvetk hrom szzalka k
veti el. Sokan felnttkorukban is folytatjk bnz plyafutsukat. A Nixon
kormny egy idben minden gyereken el akarta vgeztetni a vizsglatot,
hogy kiszrjk a bnzst megelz" viselkedst, mieltt sor kerlne tr
vnysrtsre. A camberwelli gyerekek megfigyelse sorn is a tlsgosan te
vkenyeknek s sztnsen cselekvknek volt nagyobb az eslye, hogy fel
nttkorukban rcs mg jutnak. Egy fiatal kaliforniai rabl, akinl diagnosz
tizltk a Tourette-szindrmt, mr hivatkozott r, hogy bncselekmnye a
betegsg egyik tnete, de vdekezst elutastottk.
Mindenesetre legalbbis elkpzelhet, hogy a gyerekes rosszalkods s a
felnttkori bnzs ugyanabbl a forrsbl ered; mghozz taln legalbb
rszben genetikai forrsbl. Az ADHD jelentsgnek nhny lelkes ameri
kai szszlja szerint a foglyok fele azrt kerl brtnbe, mert olyan gneket

23 9
A VRNKBEN VAN

hordoz, amelyek hajlamoss teszik a bnzsre vagy hasonl rendellenes vi


selkedsre. Ha igazuk van, a brtnk ppannyira a genetikailag balszeren
cssek intzetei, mint amennyire bntets-vgrehajt intzmnyek. Egyelre
ez inkbb csak tengerentli felfogs. Nagy-Britanniban csupn minden hu
szadik bnzt nyilvntanak mentlis rendellenessgben szenvednek, s
azoknak a szma, akiknl tarts (s esetleg veleszletett) llapotot diagnosz
tizlnak, mindssze nhny szz. Az ADHD-diagnzis azonban - s a keze
lsnl alkalmazott tbbfle gygyszer - egyre ltalnosabb vlik Angliban
is, s ktsgtelenl hamarosan a trvnyhozs sem trhet ki elle.
A kialakul ADHD-kutats, brmi legyen is tudomnyos rtke, jelzi a
problmkat, amelyek abbl addnak, hogy a genetikai rvek egyre tgabb te
ret kapnak a brsgokon. Ha elfogadott vlik, hogy a botrnyos viselkeds
az iskolban bocsnatot rdemel (s valjban kezelsre szorul mint beteg
sg), mert veleszletett fogyatkossgot tkrz, nehz amellett rvelni, hogy
figyelmen kvl hagyjk a genetikai hajlamokat, amikor ugyanennek a sze
mlynek a felnttkori viselkedst mrlegelik. Ha sokkal tbb ADHD-ben
szenved gyereket diagnosztizlnak (pldul az Egyeslt llamokban), mint
ahny felntt bnz van, akkor sok, vagy taln a legtbb trvnysrt hivat
kozhat majd gnjeire mint mentkrlmnyre.
Nyilvnval, hogy a trvnyhozs ezt nem veheti tudomsul, hisz mgis
csak a tnyekkel foglalkozik, brmit mondjanak a filozfusok. Legfbb fel
adata, hogy biztostsa a trsadalom zkkenmentes mkdst. Elmlete
idvel alkalmazkodik mindenfle tudomnyos felfedezshez, akr a teolgia.
Klvin a predesztincirl vallott felfogsban elfogadta, hogy - br nh
nyan krhozatra jutnak, msok dvssgre - elengedhetetlen, hogy minden
ki ernyesen ljen. Ugyangy, br a trvnyhozs taln knytelen lesz beltni,
hogy sokak szabad akaratt korltozzk a gnek, az cselekedeteiket is szn
dkosnak kell tekintenie, egyszeren mert ezt kveteli a rend. Hiba vlik vi
lgoss, hogy a legtbben szletett gyengesgkbl addan kvetnek el tr
vnysrtst, a trvnyhozs knytelen lesz figyelmen kvl hagyni ezt a tnyt,
mert kvetkezmnyei - amint ezt John Bockelson s antinomista trsai ha
mar szrevettk - igen krosak.
Stephen Mobleyt, az atlantai gyilkost eddig nem vetettk al genetikai
vizsglatnak. gyvdei kapcsolatba lptek a kutatcsoporttal, mely a hol
land csalddal foglalkozott, s krtk, hogy vizsgljk meg vdencket, nem
fedezhet-e fel benne a MAO-enzim termelsnek fogyatkossga. Br cse
kly a valsznsge, hogy a vizsglat pozitv eredmnnyel zrul (vgered
mnyben a holland csald megtmadott frfitagjaival ellenttben az rtel
mi szintje normlis), a vdelemnek ms eslye nincs; s ha a kivgzst elg

240
EREDEND BN

Albi szkesegyhza; ismeretlen


tizennegyedik szzadi mester
kpe az utols tletrl.
Kzelrl nzve a gytrelmek
rzkletesen trulnak a nz
szeme el, de a kzponti figura
hinyzik. Az tlkez angyalt
megsemmistettk, amikor
boltves tjrt nyitottak
a festmnyen t - ez volna
a tudomny s a trvnyhozs
mai helyzetnek metaforja?

...

hossz ideig ksleltetik, felmerlhetnek ms enyht krlmnyek. A kuta


tk felajnlottk, hogy elvgzik a ksrletet mindssze a vegyszerek rrt -
krlbell ezer dollrrt. Az Amerikai Jogszok Egyeslete, br a bnssg
vagy rtatlansg kimondsban ellenzi a genetika felhasznlst, azt megen
gedhetnek tartja, hogy az tlethozatalnl figyelembe vegyk. A br azon
ban elutastotta a krelmet. Vlemnye szerint a kutats egszen j s egye
lre nem meggyz . . . a genetikai kapcsolat elmlete tudomnyos szem
pontbl nem ll az elfogadottsgnak azon a szintjn, amely indokoln beve
zetst a trvnyhozsba". Stephen Mobley teht a siralomhzban marad.
A trtnet groteszk fordulata, hogy apja mindenron szabadulni akart fia
gyvdeitl, mert a genetikai alapon ll vdelem szgyenfoltot ejtett rajta.

241
A VRNKBEN VAN

A vdelem most fggben van. Br a villamosszk kszen ll, finak kivgz


st elhalasztottk.
A katolikus egyhznak a languedoci eretnekek ellen folytatott hborja
kezdetn az egyhzi hadsereg megostromolta a Bzier falain bell lket, ka
tharokat s katolikusokat egyarnt. Amikor a vros elesett, a katonk megkr
deztk a fparancsnokot, kit mszroljanak le: az eretnekeket nyilvn el kell
klnteni a hvktl, gondoltk. Vezetjk vlasza egyszer volt, s nyersebb
formban taln elre jelezte azt, ami a jvben a jogrendszer felfogsa lehet.
ljtek meg mindet - mondta -, az r majd kivlasztja az vit" ; ha kts
ges, ki bns, mindenkit meg kell bntetni, hogy a bns semmikpp ne me
nekljn. Megltk mindet, egyeseket - taln - hogy dvssgre jussanak,
msokat, hogy krhozatra. Taln ugyanez a drki logika rvnyesl majd, ha
idvel a genetika egyre tbb bnelkvetsre hajlamost gnt azonost.
Albi katedrlist azrt ptettk, hogy megnnepeljk a katolikus egyhz
nak a katharok fltt aratott gyzelmt. Falain a htborzongat brzols
mindama knzsokrl, amelyeket a kzpkori ember kiagyalt a krhozottak
szmra, a trvnyhozsnak szl zenetet is hordoz. Az tletre vrk kez
ben nyitott knyv, amelybe letket - s bneiket - fljegyeztk. Egy alak
azonban hinyzik. A bossz angyala helyn - aki a feltmadottak sorsrl dnt
- a hatalmas fresk kzepn elegns boltv ttong. Ajtt vgtak a festmnybe,
hogy bejratot nyissanak a kpolnhoz, melyet a tizenhetedik szzadban p
tettek a templomhoz, amikor elfogadhatnak ltszott, hogy egy hromszz
ves mestermvet megcsonktsanak. Az ptkezs sorn elpuszttottk a fest
mny kzponti figurjt, amely valamikor az igazsg mrlegt tartotta. Albi
diadalmas tansgttele az egyhz hatalmrl ma: tlethozatal br nlkl.
Nhnyan azt remlik, az res helyre odatehetik a genetikt, hogy az ol
vassa ki az let knyvt, de nem a hall utn, hanem szletskor. Csakhogy
ezzel veszlyeztetnk az igazsgszolgltats mkdst, s mindenkitl meg
tagadnk a szabad akaratot, akr j, akr rossz az illet. A kros viselkeds
nem lehet mindenkire rvnyes mentsg. Ha egyesek flmentst kapnak a
gnjeik miatt, akkor msok, akiknek nem ilyen az alkata, nluk bntethetb
b vlnak. A hajlam ktl kard. Ha a legtbb bnz a gnjei miatt kvet el
trvnysrtst, akkor az enyht krlmny rvnyessgi kre mindenkit
magban foglal, s rtelmt veszti. Ahhoz, hogy a trvny fennmaradjon, fi
gyelmen kvl kell hagynia az eredend bn, az rkltt gyarlsg igazol
st, mint ahogy nem vesz tudomst a szegnysgrl, akr beleszletik valaki,
akr nem. A trsadalom nem a gnek, hanem az emberek mve, s amit tesz
nek, azt a trvny s nem a tudomny alapjn kell megtlni.

242
VI. FEJEZET

Hall vagy feltmads

Eppengy a halottakfeltmadsa is.


Elvettetik romlandsgban,
feltmasztatik romolhatatlansgban.
PL I. LEVELE A KORINTHUSBELIEKHEZ 15,42

Az LET VALSZNTLEN GY. Mr az is csoda, hogy eltartott hrommil


lird hg. Az pedig egyenesen elkpeszt, hogy az llnyek kpesek fenn
maradni s msolatokat kszteni magukrl, holott a fizikai trvnyek r
telmben azonnal el kellene pusztulniuk. Egy llat olyan instabil kmiai
reakcik kvetkezmnye, amelyek a hall esetn azonnal ellenkezjkre
fordulnak. Akkor mikpp lehetsges, hogy (a The Book of Common Prayer
- az anglikn hivatalos ima- s liturgiaknyv - utn szabadon) ez a mi
gyarl testnk, mely arra rendeltetett, hogy ismt porr legyen, mgis rk
letre tmad az egyms nyomba lp genercikban?
Nmelyik vallsnak az a naiv elkpzelse, hogy a halottak tovbb lnek.
Testk egyszeren eltvozik, s taln mg visszatr. A holtak megszltjk
az lket. Saul, Izrael els kirlya az endori boszorknytl akarta megtud
ni, mit gondolnak az eldk, s ezrt sok brlattal illettk azok, akik szve
sebben vettk, ha gyeiket Isten s nem az sk irnytjk.
A hall fltt aratott gyzelemnek ez a sz szerinti rtelmezse figyel
men kvl hagyja a bomls egyszer tnyt. Minden valls szvben ott a
megjuls: a halltl bemocskolt test feltmadsa ilyen vagy olyan form
ban. Platn felismerte, hogy erre a legjobb mdszer, ha a hst klnv
lasztja lnyegtl, a llektl, mely tovbb lhet akkor is, ha a test felbomlik.
Mende! ugyanerre a gondolatra jutott. Munkssga elvlasztotta a geneti
kai tizenetet - amely letben marad, amg minden let vget nem r - hor
dozinak mlkony ltezstl. August Weismann nmet embriolgus
mg tovbb ment. Segtsgl hvott egy fizikai ltezt, a csraplazmt,
amely tovbbtja az letet, de elklnl a szmtl, a testtl. A paradoxon
az volt, hogy egy roskatag test minden generciban friss csra plazmt hoz
ltre. Vajon hogyan? Mifle fiatalt elem nyjtott ezermilli feltmadst
az letnek, mita megkezddtt? Weismann nem tudta.

243
244
HALL VAGY FELTMADS

A Szmpozionban Diotima prfta ezt mondja Szkratsznek:

A szerelem trgya, Szkratsz, nem a szpsg, mint vled. . . A szerelem trgya. . .


a nemzs . . . mert a nemzs ltal juthat a haland legkzelebb az rkkvalsg
hoz s a halhatatlansghoz. Ilyen mdon minden haland fennmarad, nem
rkre ugyanabban a formban, lvn ez az istenek eljoga, hanem azon folya
mat ltal, melyben a kor okozta vesztesgek hasonnemG nyeresgek ltal orvo
soltatnak. A halhatatlansgra trekszik minden egyn, ezrt rabja a moh vgy
nak s szerelemnek.

Ms szval az rk let kulcsa a nemisg; ennek rvn szlethet jj a


test s orvosolhatk az regeds okozta krok.
Weismann-nak ms volt a vlemnye. Szerinte a ktszer semmibl
nem lesz egy". Mirt lenne kt reg s roskatag egyed alkalmasabb egy fia
tal ltrehozsra, mint egyetlen koros, de aszexulis nstny? Kt lerom
lott csraplazma-llomny nem fog megfiatalodni attl, hogy sszekevere
dik. A nemisg magban nem elg. St, inkbb hanyatlssal jr. Bven
addik bizonytk arra, hogy igaza volt. A szaporodsrt drgn megfizet a
hm is, a nstny is. Sok llny kzl a hm belepusztul a kzslsbe
( elfordul, hogy felldozza magt prja nszlakomjn). A meztelen csi
gk egyik faja kzsls utn leharapja sajt pniszt, s dugknt benne
hagyja a nstnyben, hogy az semmikpp se tudjon msik prt keresni.
Mg a muslick is hosszabb letek, ha zzessgben lnek, s ugyanez a
helyzet a frfiakkal s nkkel is.
A nemisget, br rgta tudjk rla, hogy kapcsolatot teremt az let kez
dete s vge kztt, rendszerint inkbb a lealacsonyods, mint a megvlts
forrsnak tekintik. dmot s vt is emiatt ztk ki az denkertbl,
amiben va bnsebb volt, hiszen vette r dmot az erklcstelensgre
(a tma llandan ksrt a nemek ideolgijban, amely a szexulis felels
sget rendszerint a nkre hrtja).
Teht a nemisg s valls kapcsolata mlysgesen ktrtelm. Mindket
t benssges lmny: mindegyikben ott rejlik a fenyegets s az gret
egyarnt, s valamilyen mdon mindegyik legyzi a hallt. Nha zavarba
ejten nyilvnval a kapcsolat kzttk. vilai Szent Terz ltomsban
megjelent Krisztus. Kezben hossz aranylndzst lttam . . . mintha sz
vembe dfte volna tbbszr is gy, hogy a zsigereimbe hatolt. Amikor ki
hzta . . . bennem megmaradt az Isten irnt val, nem szn szeretet tze.
Nem testi fjdalom ez, hanem lelki, br rsze van benne a testnek is - mg-

TLOLDALT: Jzus feltmadsa'', Matthias Grnewald festmnye 1513-15-bl; a mvsz eb


ben az idben mainzi udvari fest volt.

24 5
A VRNKBEN VAN

hozz igen nagy rsze. Oly desek a szeretet beszdei a llek s Isten kztt,
hogy ha brki hazugnak vlne, csak azrt knyrgk Istenhez, vgtelen j
sgban rszestse ez lmnyben t is."
A genetika j megvilgtsba helyezi a nemisg, regeds s hall szvet
sgt. Megmutatja, hogy tvedsekbl ered mindegyik: a genetikai zenet
msolsi hibibl, mutcikbl. Ezek okozzk, hogy az egynek romlan
dk, a gnek azonban megmaradnak. A nemisg minden nemzedkben
megjtja a csraplazmt, s ez a hossz tv fnnmaradst biztost evo
lcis vltozs anyaga. Egyre valsznbbnek ltszik, hogy a szexulis
megjuls ra a szomatikus elkorcsosuls, amelyben a test sejtjeinek mu
tcii vezetnek a sokfle bajhoz - rkhoz, szvbetegsghez, szellemi ha
nyatlshoz-, mely az regkorral mindenkit utolr.
Mindenfle zenet lemsolsakor hibk keletkeznek. A DNS feladata
(agyoncspelt hasonlattal lve) olyan, mintha valaki jra meg jra lerna
egy lexikont, egyik msolatot kszten a msik utn. Mint a szerzetesek a
nyomtats feltallsa eltt. risi volt a hibaszzalk. A msol nha
sszekeverte a betket, nha zagyvasgot rt le, mert szeme egy msik ha
sbba tvedt, s egyes rszeket kihagyott. Nmetorszg rgi trkpein sze
repel Suatutanda tartomnya. Annak az rnoknak a tvedsbl szrma
zik, aki lemsolta Tacitus szavait, hogy a trzsek visszatrtek ad sua
tutanda" - hogy rizzk birtokukat -, de kifelejtette a szkzt.
Nhny knyvet sokszor tmsoltak. Ha az rdek pp hogy tudott ol
vasni (egybknt is tilos volt kijavtania a hibkat), s rontott pldnyt ka
pott, tovbbadta a hibkat, s maga is megtoldotta nhnnyal. A npszer
knyvek nemzetsgekbe sorolhatk, ha flrajzoljuk a felhalmozott hibk
csaldfjt. Az irodalmi szrmazsi g vgn a pldnyokban mr annyi a
tveds, hogy szinte olvashatatlanok. Tbb nem is tudom, hov forduljak
latin knyvekrt, a piacon minden pldny olyan hibs . . . Ezek a knyvek
tele vannak hazugsgokl(al" - panaszkodott Cicero ktezer vvel ezeltt.
A ketts spirl fizikailag olyan trkeny, hogy felttlenl be kell cssznia
egy-egy hibnak valamelyik egysg- egy DNS-bzis - lemsolsnak min
den pr ezer ksrletnl. Az ilyen mrv romls nhny sejtosztds utn
rthetetlenn tenn az zenetet, s az let megllna. A gyakorlatban sokkal
lassabban halmozdnak fel a hibk, mint ahogy az egyszer kmiai ismere
tek alapjn vrhat. De azrt felhalmozdnak, s egy id utn a test DNS
dokumentuma olvashatatlann, hazugsgokkal teli knyvv vlik.
Csakhogy az llny nem egyszer msolgp. Megvannak a sajt szer
keszti, akik menet kzben kijavtjk a hibkat - st felhasznljk ket ar
ra, hogy javtsanak a kziraton. Valamikor a mutcit egyszeren a ha-
HALL VAGY FELTMADS

Palstot visel, mosolyg


nalak szobra a nrnbergi
Szt. Sebaldus-templomban.
Szernyen pillant a lba
eltt hdol hivekre, maga
a megtesteslt tisztasg.
De htulrl egszen ms
kpet mutat Vilg Asszony,
ahogy a szobrot nevezik.
Csupasz htt rothad hs
bortja, s innen nzve mr
nem a tiszta szemrmet,
hanem a frtelmes romlst
testesti meg.

nyatls gpezetnek eszkzeknt fogtk fel; ritka hibnak egy pontosan


belltott gpezet mkdsben. rtalmas kls hatsok kvetkezmny
nek lttk, akr a betegsget. Ma mr tudjuk, hogy valjban a gnek ter
mszetes tulajdonsga, amely fennmaradsukat biztostja mg akkor is, ha
gazdjukban krt okoz. A mutci trtnete mindennl jobban egyesti az
emberi llapotrl vallott tudomnyos s spiritulis nzeteket. A feltma
ds gondolatnak - annak, hogy a romland test romlatlanul felemelkedik
- j s pontos rtelmet ad.
Az elkorcsosuls tnyei elg nyilvnvalk. Nyolc vvel ezeltt kltztem
be jelenlegi hzamba szak-Londonban. Ma pontosan feleannyi rem
nyem van, hogy mg egy vig lek, mint a kltzs napjn. Akrmilyen a
hallozsi arny, a harmadik vilgban vagy az elsben, s akrmilyen kor

247
A VRNKBEN VAN

a veszlyeztetett szemly, az egyni esly a hallra minden ml vvel meg


duplzdik. Vagyis egy tizenhat vesnek egy a ktezerhez az eslye arra,
hogy egy ven bell meghal, mg azoknl, akik elrik a szzadik vket,
csak egy a ketthz az esly, hogy a kvetkez szletsnapjukat is megn
nepelhetik. Az tteremben a borospoharakkal ellenttben (amelyeknek
eslye, hogy eltrnek, fggetlen a koruktl) a vendgek hallozsi eslye
nem lland, mert az regedssel testk egyre kevsb tudja fenntartani
magt. A hall a jelek szerint dinamikus folyamat.
Az elhasznldsnak is szerepe van abban, hogy nem vagyunk halhatatla
nok. Az let sorn a szv hromszzezer tonna vrt szivattyz t - meg lehet
ne tlteni vele egy tisztessges mret tartlyhajt. Nem csoda, hogy kifrad.
Kopnak az zletek is, s a zsr akadlyozza a vr ramlst a vererekben.
Fontos tnyez az egyszer gplells, de az regeds valjban az let ter
mszetbl addik: be van programozva. Bizonyos gnek ugyanis a fiatalok
ban hasznosak, az regeknek azonban drga rat kell fizetnik rtk. Pld-

A sorvads kpei. BALRA: slyos zleti gyullads, amelynek oka gyakran az, hogy az immun
rendszer a test sajt sejtjeit tmadja meg. JOBBRA: relmeszeseds, fknt zsrlerakds,
amely elzrja az ereket, s hallt okozhat.
HALL VAGY FELTMADS

ul azok a fiatalok, akiknek a szervezetben a tpllk gyorsan alakul zsrr,


tllik az nsges idket, de knnyen elhznak, s id eltt meghalnak. A ma
lj, holnap fizess" filozfija akkor elnys, ha tbbet nyom a latban a ha
szon, hogy segt a fiataloknak letben maradni, amg a gnjeiket tovbbad
hatjk, mint az a kr - amely az evolci szempontjbl kzmbs -, hogy
ugyanez a gn megli hordozjt, mikor mr utdai vannak.
m egyre biztosabbnak ltszik, hogy az regeds a genetikai lepls fo
lyamatt tkrzi: a test sejtjeinek az osztds sorn bekvetkez baleseteit.
A mutcikat valamikor csak a hm ivarsejttel s a petesejttel hoztk ssze
fggsbe. Amit tudunk rluk, nagyrszt mg ma is ezekbl a szlktl gye
rekekre trktett hibkbl szrmazik. A genetika csak most kezdi feltr
ni a test s a csraplazma mutciinak kapcsolata alapjn a szoros ssze
fggst az egyiknek a hanyatlsa s a msiknak a megjulsa kzt.
A legismertebb mutci mutatta meg elsnek vletlenl s hossz vek
kel a felfedezse utn, milyen kzeli kapcsolatban ll a hall a megjuls
sal: az apr vltozs a DNS-ben, amely Viktria kirlyn leszrmazottai
nak vralvadsi betegsgt (hemoflijt) okozta. Az emberi genetika m
sik nagy laboratriuma, Hirosima s Nagaszaki vrosa mellett Viktria ki
rlyn gnje szolglt tmutatssal, hogy micsoda - s kicsoda - felels a
genetikai zenet hibirt.
1905-ben, eleget tve minden uralkod szletett ktelessgnek, hogy
utdokrl gondoskodjk, XIII. Alfonz, Spanyolorszg utols Bourbon-ki
rlya nneplyesen Angliba ltogatott menyasszonyt vlasztani. Egy dsz
vacsorn tallkozott Viktria Eugnia hercegnvel, Viktria kirlyn uno
kjval, akit a csaldban Ennak hvtak. Az rkltt tkletessg megteste
slsnek ltsz magas, szke hercegn hvs modora kitnen leplezte a
valdi rzelmeket. Teljes szvembl kvntam, hogy az enym legyen ez a
spanyol, aki ellenllhatatlan volt, mint a tz, s ppolyan veszlyes is" - r
ta regkorban. Rvidesen megllapodtak egy biarritzi nyaralsban.
Ena csak tszr tallkozott Alfonzzal, mieltt a menyasszonya lett. Np
szer jegyessg volt: egy kzvlemny-kutats t helyezte a nyolc lehets
ges spanyol kirlynjellt listjnak els helyre. A sajtvisszhang - s a
hzassg alakulsa - klns mdon hasonltott Viktria kirlyn szp
unokjnak, Kroly herceg eskvjnek trtnethez. Ena esetben nagy
remnyeket fztek ahhoz, hogy a tiszta vr majd letet lehel a spanyol ural
kodhzba, melyet mindenki slyosan krosodottnak tartott.
Ktszz ve uralkodott Spanyolorszgban Alfonz csaldja, a Bourbonok.
A tboly s ktsgbeess aprl fira szllt. A sorban az els, V. Flp bs
komorsgtl szenvedett. Elvesztette idrzkt. Az egsz udvarnak jszaka

249
A VRNKBEN VAN

kellett lnie s nappal aludnia. Leszrmazottait egyszer gy jellemeztk:


V. Flp - kiegyenslyozatlan, rzki; IV. Ferdinnd - rlt s impotens;
III. Kroly - nem egszen pelmj; IV. Kroly - gyengeelmj; VII. Ferdi
nnd - tlfttt, rzki, kegyetlen s vrszomjas; II. Izabella - nimfom
nis; XII. Alfonz - tdbajos. Radsul a Bourbonok vrbajjal is fertzttek
voltak: XII. Alfonzot ez vitte el, mieltt a tdvsz vgezhetett volna vele.
A csaldban lappangott egy vgzetes baj, amelyrl azokban a genetika
eltti idkben gy vltk, rkltt fogyatkossgbl ered. Igen nehezen
tudtak eleget tenni minden uralkod legfbb ktelessgnek, a fiutd
nemzsnek. XIII. Alfonz egyetlen fi egyetlen fia volt, s kirlynak szle
tett, mert apja meghalt huszonnyolc vesen, rviddel azutn, hogy meg
fogant. Ennl kisebb mennyisg kirlyunk mr nem is lehetne" -jegyez
te meg szletsekor az akkori miniszterelnk. Nyilvnvalnak ltszott,
hogy ha a Bourbonok fenn akarnak maradni, meg kell julnia a csaldnak:
j vrre - vagy a modern szhasznlattal - j gnekre van szksg.
Utols - s eredmnytelen - ksrletk, hogy kellkppen hibtlan csa
ldba hzasodjanak, olyan gnt hozott napvilgra, amely ksbb dnt
szerepet jtszott a mutci megismersben. XIII. Alfonz vlasztsa hozz
jrult ahhoz, hogy Spanyolorszg trtnete j fordulatot vegyen, s egy v
szzaddal ksbb rvilgtott a meglep tnyre, hogy mikpp srl a DNS.
Mint kiderlt, a titok nyitja nem a Bourbonok vrben rejlett.
i906 mjusban Ena megrkezett a Pardo palotba, egy szz kilomter
hossz fallal krlvett birtokra Madrid kzelben. Mg abban a hnapban
felesgl ment Alfonzhoz. Mikor az eskv utn a menet a kirlyi palotba
tartott, kocsijukra bombt dobott egy Mateo Morral nev anarchista (akit
az jsgok vrbajos degenerltknt emlegettek), s Ena - a jv htbor
zongat eljeleknt - egy lefejezett r vrben zott.
Nhny hten bell ll:potos lett, s mindenki nagy rmre fit szlt;
Alfonzot, Asztria hercegt, a spanyol trnrkst. Apja msnap pomps
szertartson mutatta fel az udvari np eltt ezsttlcn. De nem sokig
tartott az rm. A spanyol kirlyi csaldban a fikat krlmetltk, taln a
kzpkori zsid tancsadk hatsra. Amikor az jszltt rks tesett a
mtten, elllthatatlanul mltt a vre. Apja elborzadva eszmlt r, hogy
finak veleszletett betegsge van.
Az jabb rkletes kr visszhangja elkeseredett volt s kiszmthat. Az
tszli zsurnalizmus korai pldjaknt az American Examinervilgg kr
tlte Asztria hercegnek titkt. Alfonzot hibztatta. Finak betegsgt a
Bourbonok sok vszzados elmebetegsgvel hoztk kapcsolatba. Tud
vn, hogy az sk bneinek mily slyos terhe nehezedik r, tancsadi

250
HALL VAGY FELTMADS

rendkvl egszsges s leters hitvest vlasztottak, remlvn, hogy


majd j ert nt a spanyol kirlyi csaldba." Az erfeszts nyilvnvalan
eredmnytelen maradt.
Hogy Alfonz tudott-e korbban a veszlyrl, az nem vilgos; vgered
mnyben a hemofilia rkldsnek trvnyszersgeit csak eskvje utn
t vvel ismertk fel. Ha tudott volna rla, nyilvn nem Ent vlasztja. Nem
tudok megbklni azzal, hogy utdom olyan betegsget rklt, amely az
csaldjban volt, nem az enymben. Tudom, hogy igazsgtalan vagyok. Be
ltom; de nem vagyok kpes mskpp gondolkodni . . . " - mondta.
Viktria kirlyn - Asztria hercegnek ddanyja - abban a tudatban
nevelkedett, hogy ivadkai lesznek Eurpa uralkodi. Csak harmincas vei
kzepn szerzett tudomst a bajrl, melynek rvn csaldja ppoly fontos
szerephez jutott a tudomnyban, mint a trtnelemben. Nyolcadik gyer
meke, Leopold, Albany hercege beteges kisfi volt. Ngyszer vagy tszr
jutott a hall kszbre . . . s szinte pr hnaponknt gynak dnti valami
betegsg" - rta a kirlyn Disraelinek. Leopold huszonkilenc ves kor
ban megnslt, de nhny v mlva meghalt. A hemofilia nven ismert
vralvadsi rendellenessgben szenvedett. Szletsekor Viktrinl - a
trtnelemben elszr - kloroformos rzstelentst alkalmaztak. Ez nagy
vitt vltott ki (megfosztja Istent a mly s szvbl jv seglykiltsoktl,

Hemoflis beteg vrmlenyes horzsolssal:


a vr tszivrog az erekbl a szvetekbe.

251
A VRNKBEN VAN

melyekkel szksg idejn fordulunk hozz" - mltatlankodott egy pap).


Mondani sem kell, Leopold betegsgt a gyerekszlsnl alkalmazott ter
mszetellenes fjdalomcsillaptsnak tulajdontottk. De ma mr Ludjuk,
hogy egy mutci okozta, amely a kirlyn szmos utdjban felbukkant,
br korbban nem volt jele a kirlyi csaldban.
Megsemmistek a tnetek. A legkisebb vgsnl jelentkez vrzs is
elg baj volna, m a betegek minden srls nlkl is sokat szenvednek,
mert a vr tszivrog a szvetekbe s az zletekbe. Annak a gnnek, amely
Leopoldot meglte, egy pldnya Viktria unokjnak, Alekszandrnak
II. Mikls crral kttt hzassga rvn kerlt be az orosz kirlyi csaldba.
Fiukat, a gyermek Alekszej crevicset, amikor csaldjval nyaralt, egy z
ben kocsikzni vittk. Hirtelen egsz testben szivrogni kezdett a vr az
artrikbl s erekbl. A cseldek beszmolja rzkelteli, milyen szv
szaggat llvny lehetett a betegsg: a kocsikzs " maga volt a borzalom.
A kocsi minden zkkense, minden grngy az ton iszonyatos gytrel
meket okozott a gyermeknek, s mire hazartnk, a ficska szinte eszm
letlen volt a fjdalomtl." Finak betegsge bernykolla Mikls cr ural
kodsnak tovbbi veit.
A hemoflia ni gon jutott a cr csaldjba, akrcsak Alfonzba. A gene
tika nyelvn a betegsg nemi ktds: az X-kromoszma hordozza. Mivel
a frfiaknak csak egy X-kromoszmjuk van, minden fin, akinek egy pl
dnya van a gnbl, megmutatkozik a hatsa. A lnyoknak kt X-kromo
szmjuk van, gy k csak akkor lesznek hemoflisak, ha kt kln pl
dnyt rklnek. Ez nagyon ritka eset. Az rklds szablyt i911-ben is
mertettk az Eugenikai Trsasg (a londoni egyetem Galton Laboratriu
mnak eldje) egyik els kzlemnyben. Nhny csaldban hossz idre
visszavezethet a gn. Az egyikben, amely a Tenna nev svd falubl szr
mazik, a tizenhetedik szzadra megy vissza. Br a kirlyi csald esetben
nem mltattk nyomtatasban a betegsget, trtnett az Eugenikai Trsa
sg kt hossz, kziratos tekercsen rizte meg, melyen Viktria kirlyn
tbb szz rokonnak s snek neve szerepel. Szrmazsa anyai gon tizen
ht nemzedken t nyomon kvethet, s egyiknl sincs jele vrzsi rendel
lenessgnek (br egyik tizenhetedik szzadi st ismeretlen okokbl Brte
len Ludovicusnak neveztk). A csaldi mutci nyilvn j volt.
Azt a pldnyt, amely bekerlt az oroszorszgi Romanov-hzba, a jeka
tyerinburgi mszrls kitrlte. Az, amelynek Viktria kirlyn unokja,
Ena volt a hordozja, nemcsak Asztria hercegnl jelent meg, hanem a
kirlyn ksbbi figyermeknl, Gonzalnl is, aki szintn hemoflis
volt. Ena mgis tovbbi gyermekeket szlt, ht v alatt hetet. Egy hnap

252
HALL VAGY FELTMADS

vigalom, nyolc hnap kn, / hrom h pihens, kezddik megint: / A spa


nyol kirlyn gy l szegny!" - mondta egy korabeli rigmus. A spanyol
trtnszek a mai napig azt lltjk, hogy az angolok eltitkoltk a betegs
get, mert klnben nem jtt volna ltre a hzassg, amely egyesti a spa
nyol s az angol kirlyi hzat. Nyilvnvalnak ltszik, hogy Ena csaldja
tudott valamifle rkltt betegsgrl. Mire sor kerlt az eljegyzsre Al
fonzzal, a menyasszony kt btyjn, Leopold nagybtyjn s tbb unoka
testvrn mr megmutatkoztak a hemoflia tnetei. Ma mr senki sem
tudhatja biztosan, valban figyelmeztettk-e bizalmasan a spanyol nagy
kvetet, amint nhnyan mondjk.
Hogyan talljon a spanyol trnrks felesget, s gondoskodjk a mo
narchia fennmaradsrl? A felnvekv ifj herceg gynge volt s beteges,
elkldtk a Pardo palothoz tartoz terleten egy kis hzba. Br egyves
korban besoroztk katonnak, az utols Alfonz mg fra sem mszhatott.
A szbeszd az egsz orszgban elterjedt. Nmelyik paraszt szentl hitte,
mindennap felldoznak egy katont, hogy az ifj herceg friss vrt kapjon.
Nmi genetikai irnia van abban, hogy roppantul rdekelte az llattenysz
ts, s szleitl minden szletsnapjra egy trzsknyvezett sertst kapott.
Tbbszr megksreltk, hogy megfelel felesgjellteknek mutassk be
a herceget Eurpa alacsonyabb rang arisztokrcijbl, de senki sem
akart behzasodni a nyilvnvalan beteges csaldba. Egy svjci klinikn
megismerkedett egy kubai nvel, s felesgl vette. Apja azonnal arra
knyszertette, hogy lemondjon trnrklsi jogrl; lltlag azrt, mert
kzrend szemllyel kttt hzassgot, de valjban azrt, hogy eltvolt
sk a genetikai szennyezdst a kirlyi rklsi gbl.
Az ifj pr az Egyeslt llamokba kltztt. Hzassguk rvidesen fel
bomlott. A herceg kvetkez hzassga egy kubai modellel mindssze hat
hnapig tartott. Akkor viszonyt kezdett egy Mildred Gaydon nev nvel,
aki egy jszakai loklt vezetett Miamiban. Az asszony 1938-ban autbaleset
ldozata lett. A megtagadott spanyol trnrkssel elllthatatlan vrm
ls vgzett. Szomor prhuzam, hogy hemoflis ccse, Gonzalo is baleset
ben halt meg; a volnnl sajt nvre lt. A lnytestvreknl kett az egy
hez volt az esly, hogy maguk is hordozzk a gnt. Apjuk ktelessgnek
rezte, hogy kzlje a problmt krikkel. Br vgl frjhez mentek, egy
idben mindketten gy reztk, hogy rk vnlnyok maradnak - s
mindketten kzrend frfiakhoz mentek felesgl.
A spanyol kirlyi prnl napirenden voltak a veszekedsek. Az sem tett
jt a hzassgnak, hogy Alfonzo igen szabadosan lt. Monsieur Lamy ln
ven gyakran ltogatott el Prizsba, s hossz ideig viszonyt folytatott egy

253
A VRNKBEN VAN

Edward kenti herceg (William Beechey festmnye,


1818).

Viktria kirlyn6 (Thomas Sulley festmnye, 1838).

ll <lyrgy EURPA KIRLYI CSALDJAI

Szz )
111 Albert Vik
tria
(181i-1901)


---,----

-
1V VI Edword
-
;,...,,, 1l v
v
r11 VIimos
Oy<gy

0 Norm61is Hemollil lrli (!) lohetsge1 hemolll6s G> Hirom n6


O Normtlls (e) Hordo16 n6 L1ho1sges hordoz

254
KIRLYI VR:
VRZKENYSG AZ EURPAI
KIRLYI CSALDOKBAN

Az eurpai kirlyi csaldok hemoflis megbetegedseinek


csaldfja s nhny fszereplje. A csaldfrl vilgosan
leolvashat, hogy az rklds nemekhez kttt. Minden
rintett gyerek (fekete ngyzet) fi (ngyzet), s anyjtl
rklte a gnt. Minden hordoz n (fekete karika kze
pn ponttal) kzvetlen leszrmazottja ni gon Viktria
kirlynnek. A gnt nem rkti t a kirlyn egyetlen fr
fi.gi leszrmazottja sem (lthat pldul, hogy az angol ki
rlyi csaldban nemzedkek ta egyetlen hemoflis meg
betegeds sem fordult el).
A csaldfa fltt Edward kenti herceg - akitl valsz
nleg a mutci szrmazik - s Viktria kirlyn kpe. Leopold herceg (Edwin Landseerfestmnye,
Jobbra Leopold herceg, akinek a betegsge felhvta a figyel
1860-as vek).
met, hogy hibs gn van a csaldban. Lent a spanyol kirlyi
csald: Alfonz s Ena Asztria hercegvel, aki fradtnak s
betegesnek ltszik.

LENT: Alfonz spanyol kirly s Ena kirlynAsztria herceg


vel, aki a Santiago-rend kpenyt viseli; 1924 nyarn.

255
A VRNKBEN VAN

sznsznvel. Kt trvnytelen gyereke szletett a kapcsolatbl; hogy egyi


kk sem lett hemoflis, azt Alfonz magnbossznak rezte a felesge ellen.
Miutn 1931-ben npszavazst rtak ki a monarchia jvjrl, s ennek
eredmnyeknt elztk az orszgbl a kirlyi prt, a hzastrsak vgkpp
elidegenedtek egymstl. Drga uram, fogadja rszvtemet!" - mondta
lltlag Alfonz, mikor egy spanyol honfitrstl hallotta, hogy annak is
angol felesge van. Ena az 1960-as vek kzepig Lausanne-ban lt; elb
vl, csak szrnyen unalmas szegnyke" - mondta rla Noel Coward.
Az eurpai kirlyi csaldok - rthet mdon - mg ma sem szvesen
hozzk nyilvnossgra a hemoflia tnyeit. Elutastsra tallt minden igye
kezet, hogy megvizsgljk azokat, akik ma is veszlyeztetettek lehetnek Vik
tria utdai kzl. Valjban kicsi a valsznsge, hogy a gn a mai kirlyi
csaldokban felbukkan. Ha egy n hordozza a gnt, lnyainl akkor is csak
egy a ketthz az rkls eslye. Ha tbb fia van, s mindegyik egszsges,
az esly cskken. Minden genercival, amelyben nincs beteg fi, kisebb
lesz annak a valsznsge, hogy a gn mg mindig a csaldban lappang.
Mivel Viktria legtbb leszrmazottjt ma mr tbb nemzedk vlasztja
el az utols nyilvntartott hemoflistl, nemigen vrhat, hogy a gn v
ratlanul felbukkan. Lehetsges, hogy mr ki is veszett a mutci. De mivel a
termkenysg minden kirlyn szent ktelessge, Viktria X-kromoszm
jnak rszecskit ma szznl jval tbb ember hordozza, s valamelyik ni
leszrmazottjban mg mindig ott rejtzhet a gn. Egy fiatal fi, Paul
Alexandre, akinek anyja Asztria hercegnek unokahga volt, 1975-ben, t
ves korban belehalt egy betegsgbe, amelyet vrrel kapcsolatos probl
maknt" rtak le. Lehet, hogy hemoflis volt (br ezt a csald tagadja). Ha
igen, t lnytestvre kzl egynl vagy tbbnl tnylegesen fennll a ve
szly, hogy Viktria mutcijt trktik egy j genercira. Az egszsges
fik utdai mentesek tle mg akkor is, ha apjuk csaldjban van hemoflia.
Teht a mai angol kirlyi csald (Viktria elsszltt fia, VII. Edward ga)
nem hordozza a gnt. A spanyol kirlyi csaldbl is kiveszett.
A betegek sorsa sem olyan remnytelen, mint rgen. Eleinte klns
gygymdokkal ksrleteztek az orvosok. Azt tartottk, hogy segt a rnt
gensugrzs, az adrenalin, a ni hormonok s a brmos tojsfehrje-kivo
nat. A vipera mrge, amely vralvadst okoz, hasznlt egy keveset, de val
di sikert csak a vrtmleszts hozott: elszr teljes vrt kapott a beteg, k
sbb a hinyz fehrjt. Ma mr sok hemoflis normlis letet l.
Viktria nem rtette, honnan szrmazik a betegsg. Nem a mi csal
dunkban volt" - lltotta makacsul, vagyis nem az apai, Hannoveri-gban,
csak anyja csaldjbl jhet, a Szsz-Coburgoktl. A legtbb spanyol is
HALL VAGY FELTMADS

nyilvnvalnak tallta az okot, s si hagyomny szerint egy asszonyt v


dolt. Biztosra vettk, hogy az kirlyi csaldjuk egy dhs asszony tktl
szenved. Charlotte, Habsburg Miksa mexiki uralkod felesge tokkal
sjtotta azokat, akik megtagadtk a segtsget frjtl (Mikst 1867-ben
agyonlttek, miutn a francik eredmnytelen ksrletet tettek, hogy n
veljk befolysukat az jvilgban). Mindannyian megbnhdtek: Eugnia
csszrnt megfosztottk a trnjtl Franciaorszgban, IX. Pius ppa elve
sztette a hatalmt, Ferenc Jzsef fia ngyilkos lett, felesgt meggyilkoltk,
s ksbb unokaccst is Szarajevban. Mg XII. Alfonz els felesgnek
hallt is Charlottc tknak tulajdontottk. Termszetesnek ltszott, hogy
ezzel magyarzzk az j rkletes betegsget is. Ena azonban magt vdol
ta, s mnija lett, hogy egy protestns ltnok rontsa van rajta, ezrt vo
nakodva br, de katolizlt.
Viktria, Ena s Alfonz ppgy, mint a spanyol mitolgia, a nkre hr
totta a felelssget az rkltt betegsgrt; semmi ktsg, ez sszefgg a
primitv felfogssal, hogy a romls va ta a nktl szrmazik. Nemcsak a
keresztnysgre jellemz ez a meggyzds - s a trsadalmi-erklcsi nyo
ms, amely emiatt a nkre nehezedik. A japn teremtsmtosz vaskosabb
dm s va trtnetnl, de a tmja hasonl. A Magtl Megdermedt
Szigeten, a japn denkertben az asszony ksrtsbe vitte a frfit, ezrt
meglakolt. Ivadkuk borzalmas picagyerek lett; a katasztrfa teljes eg
szben annak tulajdonthat, hogy a n kezdemnyezni mert. Amikor m
sodszor is megprblkoztak, de most mr a frfi akaratbl, megszletett
Japn s vilgra jttek istenei. Anyjuk, lzanami belehalt a Tzisten szlet
sbe, s amikor frje, Izanagi a Hadszba ment, hogy megmentse, teste
mr oszladozott, nemi szervbl frgek msztak el.
A Bourbonok - s Viktria kirlyn eldei - hittek abban, hogy a kir
lyok Isten kegyelmbl uralkodnak, s ez a joguk egszen dmig megy
vissza; hittek sajt vrk pratlan tkletessgben (mg akkor is, ha be
tegsg esetn cserbenhagyta ket). Hirohito, az utols japn csszr, aki is
tennek tartotta magt, mg tovbb ment rkltt magasztossgnak bizo
nytsban. Egyenesen a napistentl, Amateraszutl, a japn nemzet meg
alaptjtl szrmaztatta magt. Klns, sorsszer egybeess folytn a
csszr isteni mivoltnak elvesztse s az eurpai kirlyi vr fogyatkoss
gai egytt szolgltattk a mutci rejtlynek kulcst.
1945 augusztus hatodikn felszllt az Enola Gay a csendes-ceni Tinian
szigetrl. A meleg, tiszta reggelen 8.15-re Hirosima fl rt. Az els dh
bl bevetett atombomba, a Little Boy fl kilomterrel a fld fltt robbant
fel, tizentezer tonna TNT erejvel. Megsemmist volt a hatsa. Negyven-

257
A VRNKBEN VAN

A japn teremtsmtosz. Az els ember,


Izanagi, s nvre, Izanami hatalmas fallikus
lndzsval krztt kzslsk eltt,
majd megalaptottk a szrmazsi gat,
melynek egyenes leszrmazottja a jelenlegi
japn csszr. Rszlet egy selyemtekercsbl,
mely a Meidzsi-korszakbl szrmazik
(tizenkilencedik szzad vge) .

ezer hz dlt ssze, s nyolcvanezer ember halt meg azonnal vagy nhny
hten bell. A bombzst minstettk minden idk legcinikusabb tudo
mnyos ksrletnek is, a trtnelem legnagyobb esemnynek" is - pl
dul Truman elnk.
Hirosima szmthatott a tmadsra. 1945 jliusra mr tbb mint egy
milli japn esett ldozatul a lgitmadsoknak. Hirosima az egyik utols
vros volt, amely megszta a bombzsokat, ezrt idelis lehetsget k
nlt az j fegyver erejnek bemutatsra. A korbban nyomorsgos ipar
vros az 1930-as vekben a katonai er hihetetlenl gyors fejldsvel fon
tos haditmaszpontt vlt, itt volt a Msodik Csszri Hadsereg fhadi
szllsa s az j birodalomba znl csapatok kiindulsi pontja. A hbor
utols hnapjaiban a vros npessgnek nagy rszt - a gyerekeket is -
beszippantotta a hadigpezet. A bombzs minden idk legnagyobb em
berimutci-vizsglatnak akaratlan rsztveviv tette ket.
HALL VAGY FELTMADS

Klns mdon nem drmai lmny ma megllni a becsapdsi pont


nl. Egy jelentktelen utcban, a benzinkttal szemben, sokemeletes par
kolhz falban grnitlap jelli a centrum alatti pontot. A kzelben egy so
kat fnykpezett romos plet, melynek tetejt beszaktotta a hatalmas
robbans. A szomszdos Bke parkban egy domb, melyet az ott elgett
holttestek hamvaibl emeltek, s egy killts, amely ppgy beszmol a
japnok kegyetlenkedseirl, mint a vgs katonai rm tettrl, amely vget
vetett a hbornak. A vros az atomellenes tiltakozs kzppontja lett, s
ahnyszor atomksrletet hajtanak vgre, Hirosima polgrmestere levl
ben tiltakozik az rdekelt orszgnl - hiba.
A klvrosokban is tallni emlkeztetket. A Bke parktl nhny mr
fldnyire a Mitaki-dzsi-szentlyben van egy japn.tez, amely az angol pub
hoz hasonlan tbb is, kevesebb is, mint amire a turista szmt. A krnyezet
szebb mr nem is lehetne: szikls vlgy, benne Buddha-szobrok szzai, tlen
mindegyik piros kttt sapkt kap, hogy meg ne fzzon. tven vvel ezeltt
ez a hely maga volt a borzalom. Emberek ezrei kapaszkodtak fl a keskeny s
vnyeken - sszegve, sebesen s knok kztt. Nhnyan vzrt jttek, de so
kan azrt, hogy megszentelt helyen rje ket a hall, melyrl tudtk, hogy
mr nagyon kzel van. A lenti vros bombatmadsnak tlli voltak.

Hirosima az atombomba puszttsa utn. A httrben lthal kupols plet romjait a mai
napig meghagytk emlkeztetl.

--

259
A VRNKBEN VAN

Hirosima mra jjplt. A tiszta utcktl, a j kzlekedstl s az n


magval megbklt trsadalom hangulattl eltekintve brmelyik modern
angol vros is lehetne. Az egyik legrgibb ptmny egy csoport amerikai
barakk, amely a bombzott terletre nz. Kzel van a Carp Castle (Ponty
vr) nev, jonnan helyrelltott si vrhoz. A tmadk fellegvrt a jap
nok Halpogcsa vrnak" nevezik, mert a hajltott hullmlemezbl kszlt
barakkok hasonltanak egy helybeli csemeghez. Trtnete kzvetlenl a
fegyverlettel utn kezddtt. Amint a szerzdst alrtk, a japnok meg
kezdtk az egyttmkdst az amerikai megszllkkal. Ltrehoztk az
Atombomba Sebesltjeinek Bizottsgt, hogy a bombzs uthatsaival
foglalkozzon. Eredetileg az volt a feladata, hogy helyrelltsa a rendet s ke
zelje a sebeslteket. Elbb hrom vasti kocsiban rendeztk be fhadiszl
lsukat, azutn egy kirtett katonai ptmnyben, melyet elg szerencst
lenl A Diadalmas Visszatrs pletnek" neveztek. Rvidesen tkl
tztek a Halpogcsa vrba.
A Bizottsg (mely azta a Sugrhats Kutatsi Alaptvny nevet kapta)
1947 ta tanulmnyozza a bomba hatst a tllkre s gyermekeikre. A fi
zikusok, akik a bombt terveztk, csak robbanerejt tartottk szem eltt.
Elkpedve lttk, hogy ezerszmra szedi ldozatait egy j s szrny beteg-

A Sugrhats Kutatsi Alaptvny plete - kzismert nevn a Halpogcsa vr. Most Hirosi
ma egyik legrgibb ptmnye, ahonnan jl ltni az alatta elterl modern vrost.

260
HALL VAGY FELTMADS

sg, mely egy v mlva vagy azon tl a test kiszradsa rvn hallt okoz.
gy vltk, hogy az embert hamarabb meglheti egy tgla, mint a sugr
rtalom" - mondta ksbb egyikk.
Eleinte mindenki azt hitte, hogy a japnok csak egyttrzst akarnak ki
vltani az uthatsokrl szl jelentsekkel. De hamarosan vilgoss vlt,
mennyire megfelelnek a valsgnak. Nagy riadalmat vltottak ki, minden
ki megrettent az alattomos j pusztt ertl - az atomsugrzstl. A tl
lk kzl sokan estek ldozatul annak a hatsnak, hogy a sugrzs ron
csolja a DNS-t, mert risi energijt tviszi az l sejtekbe. Amikor a
megfelel hullmhossz sugrzs behatol a szervezetbe, megszaktja a
DNS-lncot. Radsul klcsnhatsba lp a vzzel s a sejt alkotrszeivel,
gy elektromos tlts molekulk szabadulnak fel, amelyek elpuszttjk a
genetikai llomnyt. A sugrzs egsz kromoszmkat sztzzhat. Az ers
sugrzs gyorsan elpuszttja a sejteket, klnsen a sejtosztds folyamn,
amikor DNS-k a legsebezhetbb. Ha a blsejtek elhalnak, a test elveszti
vzmegtart kpessgt. Hirosimban az atombomba ledobsa utn ez
reknl vezetett a hnys s hasmens nhny napon bell kiszradshoz s
hallhoz. Az letben maradottak sem voltak tl a veszlyen. A vrsejtek
pusztulsa az immunrendszer legyenglshez vezetett, s az ldozatot egy
hnapon bell elvitte valamilyen fertzs.
A rk si betegsg (hromezer ves egyiptomi mmikban is diagnoszti
zltak mr daganatot). Most, amikor az iparosodott orszgokban a npes
sg egyharmada elbb vagy utbb megkapja, szinte ltalnos. A bombk le
dobsa idejn mr vilgos volt, hogy kls tnyezk is kivlthatjk. A vegyi
anyagok szerept Londonban fedeztk fel i775-ben, mikor megllaptottk,
hogy a kmnyseprk hajlamosak a hererkra, a dohny hatst pedig az
i920-as vekben Nmetorszgban, amikor gyakoriv vlt a tdrk azok
nl, akik rkaptak a dohnyzs j szoksra. A rntgensugr - amelyet csak
a hbor alatt kezdtek szles krben betegsgmegllaptsra alkalmazni -
sokat meglt az els rntgenolgusok kzl. Marie Curie, akinek az volt a
szoksa, hogy kpenye zsebben egy kis veg rdiumot tartott, s megmu
tatta az rdekldknek, miknt ragyog a sttben, maga is rkban halt meg.
Hirosima lakossga s a kutatk, akiket odakldtek, hogy tanulmnyozzk
ket, nagyon jl tudtk, milyen veszllyel kell szembenznik.
Br Hirosimban sok ezer ember halt meg sugrbetegsgben (s sokkal
tbben halnak meg rkban jval ksbb), a tllkben megbjt egy sokkal
mlyebb flelem: rettegs azoktl a hatsoktl, amelyek nem hnapokkal
vagy vekkel, hanem nemzedkekkel ksbb mutatkoznak meg. A terhes
nk ktsgtelenl veszlyeztetettek voltak. A magzat nagyon rzkeny a su-

261
A VRNKBEN VAN

grzsra, s sok csecsem, akinek anyja tllte a robbanst, halva szletett,


vagy slyos krosodssal. Ha azonban a sugrzs krostja a csrallo
mnyt - a tllk ond- s petesejtjeit -, a bomba rt olyanok fizetik
meg, akik sok vvel a ledobsa utn szlettek.
H . J. Muller amerikai genetikus az i930-as vekben kimutatta, hogy a
rntgensugarak mutcikat hoztak ltre az ecetmuslickban. A legkisebb
mennyisg is. Ebbl azt a kvetkeztetst vonta le, hogy a sugrzs szintjnek
kis mrv, de tarts megemelkedse is slyos kvetkezmnyekkel jr a ge
netikai jv szempontjbl. A tizenkilencedik szzadi flelmek az rkletes
degenerldstl j s mg lesebb megvilgtsba kerltek. 1945-re mr
srgsen fel kellett mrni a veszlyt, mert szzas nagysgrendekkel trtek el
a klnbz becslsek arrl, milyen erej sugrzs hatsra kettzdik meg
az emberi mutcik szma. A bombzott vrosok idelis lehetsget knl
tak a mrsek elvgzsre. A Sugrhats Kutatsi Alaptvny els feladata az
volt, hogy megvizsglja a tllk gyerekeit, szenvedtek-e genetikai kroso
dst. A flelem az j mutcis hullm keletkezstl alaptalannak bizo
nyult, de vgl (mint a tudomnyban oly gyakran) a kutats vratlanul
megvlaszolt egy egszen ms krdst. Hirosimban s Nagaszakiban felfe
deztek egy olyan mutcikpz okot, amely hatalmasabb s krlellietetle
nebb mindennl, amit az emberi tallkonysg kieszelhet.
Emberek ezrei - volt, aki elszenvedett sugrzst, volt, aki nem - jrtak
kontrollvizsglatokra a Halpogcsa vrba egsz letkben. Sokszor gyere
keikkel egytt jttek. A tllk, akiket hibakusknak neveznek, ma mr re
gek, s a Japnban szoksos mly meghajlssal dvzlik ket. Megrdemlik
a tiszteletteljes bnsmdot, mert a Sugrhats Kutatsi Alaptvny nem
nyjt kezelst. Szerzdse rtelmben szigoran csak kutat. Valamikor a
tllk rossz nven vettk, hogy gy bnnak velk, mint a tengerimalacok
kal, de azta legtbbjk beltta a szakemberek munkjnak jelentsgt.
A kutatmunka nagy rsznek tmja a rk egy sugrzst szenvedett k
zssgben, melyet hosszabb ideig s alaposabban tanulmnyoztak, mint
brmely ms csoportot. A fehrvrsg a hbor utni t ven bell meg
jelent a tllkben, s i968-ban tetztt. Viszonylag gyakori a tdrk is,
s az atombomba tlli akr dohnyoznak, akr nem, fokozottan vesz
lyeztetettek. Bizonyos rkbetegsgeknl (pldul a pajzsmirigyrknl)
egypercnyi sugrzs hatsa is megmutatkozik. A hats eddig, br fennll,
nem slyos, a rkos hallesetek szma nem egszen t szzalkkal maga
sabb, mint ms japn vrosokban. A tllk mr abban a korban vannak,
amikor felszkik a rkos megbetegedsek szma - s amikor az atombom
ba hatsa teljes egszben feltrul. A tudsok szeretnk a kutatsi progra-
HALL VAGY FELTMADS

mot 2015-ig folytatni, amikor szinte mindenki, aki tlte a bombatma


dst, halott lesz mr. De folyik a vita arrl (fknt az Egyeslt llamok s
Japn kereskedelmi kapcsolatai miatt kialakult nzeteltrsek kvetkezt
ben), hogy ki llja a kltsgeket, gy lehetsges, hogy a Halpogcsa vr sok
kal hamarabb besznteti mkdst.
1946-ban 6389 gyerek szletett Hirosimban, ebbl sok a tllktl.
1953-ra htezer terhessget tartottak nyilvn a bombzott vrosokban.
A japn anyaknyvekbe mindenkit a honszeki, az si otthon szerint jegyez
nek be. Hirosimban s Nagaszakiban az anyk lelmiszerjegyeket kaptak,
hogy hajlandk legyenek rszt venni a felmrsben. A kutatk fljegyeztk
az letben maradottak arnyt, a szletsi rendellenessgeket s a szletsi
slyt azoknl a gyerekeknl, akiknek a szlei sgrzst szenvedtek, s egy
megfelel kontrollcsoportnl, amelynek a szlei nem.
Abban az idben a humngenetika mg gyerekcipben jrt. A sugrku
tatknak csak kezdetleges mutcis adatok lltak rendelkezskre (pld
ul a nyilvnvalan krosodott csecsemk szletse). Az emberi kromosz
mk szmt csak az 1950-es vekben llaptottk meg, s csak az 1960-as
vek kzepn vlt lehetv, hogy elemezzk a klnbsgeket a fehrjk
ben, vagyis a gnek termkeiben. A fejld vizsglati eljrsokat a Sugr
hats Kutatsi Alaptvny kihasznlta. Elszr a sikertelen terhessgeket s
a nyilvnvalan krosodott gyerekek szletst vizsgltk. Kivve azoknak
az anyknak a gyermekeit, akiket a terhessg alatt rt a sugrzs, nem tall
tak semmifle hatst (br ez a felmrs az elsk kzt vilgtott r arra, hogy
ha a szlk rokonok, pldul unokatestvrek, az utdok tlagosan kevsb
egszsgesek, mint akkor, ha a szlknek nem volt a kzeli mltban l
kzs sk). Negatv eredmnnyel jrt a srlt kromoszmk szmbavte
le is a sugrzst szenvedett szlk utdaiban. Mr-mr felhagytak a kuta
tsi programmal, hiszen hatalmas munkt s kltsget ldoztak a jelek sze
rint hiba. A szakemberek azonban folytattk a munkt, nem trdve a b
rlattal, sem azzal, hogy Hirosima s Nagaszaki laki mg mindig rossz
szemmel nzik a vllalkozst (a kutats tbb ismerettel szolglt a japn n
pessg genetikai szerkezetrl s evolcis trtnetrl, mint brmely ms
csoportrl). Vgl lassan megszlettek az els jelents eredmnyek.
A legtfogbb felmrs, amelyet tven vvel a hbor befejezse utn
zrtak le, huszontezer gyerek s szlei vrfehrjinek klnbsgeit vetette
ssze. Az n. ktdimenzis elektroforzis eljrst alkalmaztk, amely ki
mutatja a gnmutci sorn keletkez csekly elektromostlts-klnbs
geket. Harminc klnfle fehrjt vizsgltak minden egynben; sszesen
jval tbb mint egymilli gnt.
A RK MINT A SEJTEK GENETIKAI BETEGSGE

A rk nem egyetlen betegsg, hanem sokfle lehet. sze leszakad, s tkerl a 9-es kromoszmra.
De minden rkban szerepet jtszik a DNS hibja, A szakads olyan gnben trtnik, amely a sejtn
amely a legtbb esetben a testi sejtek osztdsa so vekedst szablyozza (protoonkogn). Amikor egy
rn keletkezik. Mint a rontott eredeti kzirat m tredk tkerl j helyre, a 9-es kromoszmn
solatnl, nha r lehet tallni a testben a rkos sej sszeolvad egy helyi gnnel, s a kett egytt j,
tekre olyan mdon, hogy nyomon kvetjk a hiba abnormlis fehrjt termel, amely felgyorstja a
tovaterjedst. A leukmia egyik formjnl pl sejtosztdst.
dul minden fehrvrsejt hordoz egy szokatlanul Ms rkbetegsgek esetn a sejtosztds-szab
kis 22-es kromoszmt (Philadelphia-kromosz lyoz gnek krosodst vrusok, esetleg vegysze
mnak hvjk, mert ott fedeztk fel). Vagyis ezek rek vagy sugrzsok idzik el. Nha rkltt a
nek a sejteknek valsznleg egyetlen kzs srlt hajlam egy bizonyos rkra. Ez a helyzet pldul a
sk volt mlyen a csontvelben. A testi sejtek kl szem retinoblasztma nev rkos megbetegeds
nok, azaz nem szexulisan szaporod azonos sej nl. rkldik a csaldokban, de egy testi sejt mu
tek. A rk azrt alakul ki, mert a rosszindulat sej tcija is kell hozz. Ha egy gyerek olyan balsze
tek gyorsabban szaporodnak az egszsgeseknl, rencss, hogy az adott gn hibs pldnyt rkli,
s akkor is osztdnak tovbb, amikor a tbbiek - de megfelel testi sejtjben is mutci fordul el,
bels programjuknak megfelelen - elpusztulnak. akkor rkos lesz.
Sok mutcira van szksg, hogy egy normlis A rkbetcgsgekrt egyb tnyezk szintn fe
sejt talakuljon rkoss. Minl tbb osztdson lelsek. A testi sejtekben olyan mechanizmus m
esett t a sejt, annl tbb az esly, hogy felhalmo kdik, amely szleli a DNS-srlst, s utastja a
zdik a szksges mennyisg. Ezrt az regek be sejtet, hogy lljon le az osztdssal, st kvessen el
tegsge a rk. A rkgenetika mr kimutatta, nha ngyilkossgot. Elfordul azonban, hogy ezek a
milyen bonyolult a folyamat, s milyen sok gn biztonsgi r" szerept betlt gnek mutci r
vesz rszt benne. Leukmia esetn pldul azrt vn krosodnak, gy a rkos sejtek burjnozni kez
cskken a 22-es kromoszma mrete, mert egy r- denek. A mentrendszereket megronglhatjk k
lnfle vegyi anyagok - pldul a dohnyfst
sszetevi -, gy az ers dohnyosok gyakran el
puszttjk a vdelmkre kialakult gneket.

Osztd rkos sejt. A szoksos negyvenhat kromo


szma helyett hetvenkilenc van benne. A legtbbnek
a szne kk, de az 1-es kromoszmt pirosra, a 17-est
pedig srgra festettk (klnleges, gynevezett kro
moszmafestkkel, amely csak meghatrozott kro
moszmhoz ktdik). Az elbbi rszei egyesltek az
utbbival, s tovbb nveltk a genetikai zrzavart a
slyosan srlt sejtben.
HALL VAGY FELTMADS

Az eredmny egyszer s megnyugtat volt. Mindssze hat mutcit


talltak. Egy adatfelvteli hiba kvetkeztben elszr azt hittk, hogy
egyenl mrtkben oszlanak meg a csoportok kztt, de a tnyleges ered
mny az volt, hogy mutci ngy olyan gyerekben fordult el, akinek sz
lei nem szenvedtek sugrzst, s kett azoknak az utdaiban, akik kzel
voltak a bombhoz. A mutcik szma olyan alacsony, hogy ennek alap
jn nem lehet biztosan kijelenteni: a sugrzsnak egyltaln nincs hatsa.
De az nyilvnval, hogy alaptalan volt a flelem a mutcis szrnyetegek
j fajtjtl.
Jelenleg az eljrsok fejldse kvetkeztben a kutats inkbb magval a
DNS-sel foglalkozik. Nhny tll s gyerekeik valamifle rkkval
sgban rszesltek, mert sejtjeiket folykony nitrognbe fagyasztottk, gy
vrjk a technikai ttrst, amikor rejtett genetikai vltozsokat is feltr
hatnak bennk. Mr sor kerlt a hemofliagn hatezer DNS-bzisbl ll
szakasznak sszehasonltsra a gyerekekben s sugrzst szenvedett sz
leikben, s ismt csak nem talltak j mutcikat.

A gnllomny fehrjket elllt rszeiben viszonylag ritka a mutci (br gyakorisga g


nenknt ezerszeres nagysgrendben klnbzhet). A genetikai llomny bizonyos rszeiben
azonban rendkvl gyakori, gyerekeikhez kpest ezerszeres a szlkben . Klnsen a DNS
ujjlenyomatban", ahol a rvid DNS-szakaszok bizonyos egysgei tbbszr ismtldnek. Az
ismtldsek szma elg gyakran nvekszik vagy cskken, gy ms-ms kpet ad, amikor az
ismtld rsz mindkt oldalnl vgjk cl a DNS-t - minl hosszabb az ismtlds, annl
lassabban jut be az elektroforetikus glbe. A bal oldali autoradiogramon s mellette az egy
szerstett brn egy anya, apa s hrom gyerek felvtele lthat, tovbb az ismtldsek
szma egy bizonyos DNS-darabban mindegyikk esetben. Az anynl 5-bl 3 ismtlds, az
apnl 2-bl 5 tallhat. A gyerekek 3-bl 2, 5-bl 2, 3-bl 2 ismtldst rkltek. Minden j
mutci - mondjuk- 6 ismtldssel vagy 1 ismtldssel a gyerekben azonnal szrevehet.

ANYA APA GYEREK


2 3
A VRNKBEN VAN

A DNS bizonyos rszeiben - pldul a hres ujjlenyomatban" - sokkal


tbb a mutci, mint a genetikai llomnynak abban a kis rszben, amely
tnylegesen fehrjket llt el. Minden szzadik gyereknl mutatkozhat
spontn mdon csekly klnbsg az ujjlenyomat mintjban a szlkhz
kpest. Most sem nvekedett a bomba szmljra rhat genetikai kroso
dsok szma, br tbb j mutcit fedeztek fel.
Ma mr a legtbb kutat beltja, hogy az tven vvel ezeltti borlt
jslatok tvedtek, s a sugrzs nem jelentkeny gnkrost tnyez. A ja
pnokat nehezebb volt meggyzni. Olyan szrnyek voltak a lthatatlan
gyilkos hatsnak azonnali kvetkezmnyei, hogy biztosnak ltszott: akik
elszenvedtk, azoknak a gyerekein is megmutatkozik a hats. A flelmet to
vbb nvelte, hogy az i950-es vekben rendkvl szles nyilvnossgot ka
pott a DNS szerkezetnek felfedezse.
A hibakusk lassan olyan elbnsban rszesltek, mint Nyugaton azok a
(tbbek kztt kirlyi) csaldok, amelyekrl gy tudtk, hogy rkletes
betegsgek hordozi. Sokan mg gyerekek voltak, amikor az atombomba
lerombolta a vrost. Ahogy felnttek, lassan hzassgra gondoltak. Japn
ban akkor is, most is beleszlsa van a szlknek abba, hogy fiuk vagy l
nyuk kit vlaszt. Mint az ortodox zsidk s sok ms csoport, hzassgkz
vettt bznak meg, hogy nzzen utna a leend hzastrs erklcsi s testi
egszsgnek. A mltban elfordult betegsgeket alaposan fontolra ve
szik, mieltt kt csald egyesl. Olyan alapos a vizsglds, hogy a trvny
mr megprblta korltozni, nem sok sikerrel.
Egyre jobban elterjedt a szbeszd, hogy akik sugrzst szenvedtek, ge
netikailag krosodtak. Az amerikaiak szerint nem; de ht k a sugrbeteg
sgrl szl hreket is azzal intztk el annak idejn, hogy a japnok
egyttrzst akarnak kicsikarni. A hibakusk rmlten tapasztaltk, hogy a
hzasulandk piacn messzirl elkerlik ket. A nk kevsb tudtak meg
szabadulni a blyegtl, mint a frfiak. Tizent vvel a hbor utn a frfi
ldozatok hromnegyede mr tallt hzastrsat, a nknek azonban a fele
mg nem ment frjhez. Nagyon is eleven az si eltlet a nkkel szemben,
ha nemisg s szgyen tallkozik.
Nem szabad semmibe vennnk a sugrveszlyt. Lehetsges, hogy a hm
ivarsejtet s a petesejtet kevsb krostja, mint valaha gondoltk, de az le
tet biztosan megrvidti. A hats nha azonnal jelentkezik; mskor - mint
Hirosima rkos ldozatainak esetben - ksleltetve. Ami azt bizonytja,
hogy a DNS-krosods nem korltozdik a csrallomnyra, hanem a test
minden sejtjre kihat. Jelenleg a genetika legizgalmasabb terlete a testi sej
tekben azoknak a vltozsoknak a tanulmnyozsa, melyeket vagy a sugr-

266
HALL VAGY FELTMADS

Mr. s Mrs. Okada -


kt tll, aki
sszehzasodott.
Korbbi menyasszonya
otthagyta Mr. Okadt,
amikor megltta
sugrzs okozta
sebhelyeit.

zs okozott, vagy sem. Ez a kutats az regedssel s a fizikai leplssel fog


lalkozik, de kzben kimutatja, mi okozza az rkltt mutcikat, s - taln
- felfedezte, hogyan tudja egy kis csoport sejt elkerlni a tbbiek sorst.
Az egyetlen klnbsg a petesejtek, ondsejtek s a test tbbi sejtjei kzt
az, hogy az utbbiakrl a nemisg elnye nlkl kszl msolat. Ettl elte
kintve minden sejtben rvnyesl a genetika minden folyamata. Mivel
ezek kzt a mutci is jelen van, mindenkinek a genetikai azonossga vl
tozik a korral. Akr tetszik, akr nem, mindannyian fejld rendszerek va
gyunk a genetikai hanyatls plyjn, mely a megtermkenytssel kezd
dik s a halllal vgzdik.
Mindenki egyetlen megtermkenytett petesejtbl indul el; szznyolc
van centimter hossz DNS-spirlbl. Egy felntt azonban szzbilli sejt
bl ll - ez a szm mr szinte felfoghatatlanul nagy: a tz utn tizenngy
nulla ll -, s mindegyiknek megvan a maga DNS-msolata, amely sok
szoros msols rvn a petesejtbl szrmazik. Radsul a test sok sejtje to
vbb osztdik, egy tlagos let sorn a sejtosztdsok mennyisge olyan
szmmal fejezhet ki, melyben a tz utn tizenhat nulla ll. Ilyen mdon
nha egy aprcska petesejt hatalmas felntt alakul, de sokkal tbb sejtnek
az a feladata, hogy megjtsa az elhasznld testet. Szervezetnk rn
knt tbb ezer kilomternyi DNS-t llt el (a frfiak fokozottabb mr
tkben, mint a nk, mert folyamatosan termeli az j hm ivarsejteket -
naponta szzmillit, amelyben annyi DNS van, hogy ktszer krlrn a
Fldet -, mg a nk a serdlkor eltt kialakult petesejtkszletet hasznljk
A VRNKBEN VAN

fel). Mondanunk sem kell, bonyolult kmiai folyamatrl van sz, amely
ben mintegy hrommillird egysget kell lemsolni, ahnyszor csak oszt
dik egy sejt. s minden osztdskor jabb mutcik keletkeznek.
A msolssal jr, hogy egyre hibsabb vlik a sejtek genetikai zenete
s az ltala megformlt ember minsge. Az reg sejtek egsz kromosz
mkat vesztenek el, akrcsak a sugrzsnak kitett sejtek. Egy finak min
den sejtjben van X- s Y-kromoszma. Egy tvenves frfiban minden
ktszzadikbl hinyzik az Y (nnl minden huszadikbl egy X). A gnek
is pusztulnak. Az regeds slyos kvetkezmnyeire elszr a (ni gon
rkld) mitokondriumoknl figyeltek fel. Jelenleg gy ltszik, hogy az
regkori betegsgeket a DNS-ben elfordul mutcik okozzk, mivel a
mitokondriumok a testi sejtekben mkdnek.
Az els tmutatssal az rkltt mitokondrilis betegsgek szolgltak.
Tneteik magasabb korban jelentkeznek, mint az olyan betegsgek, me
lyekben a sejtmag DNS-nek van szerepe. Mint kiderlt, azrt, mert a
mitokondris DNS-ben (amely rkltt hiba folytn amgy sem tkle
tes) az vek folyamn egyre tbb mutci alakul ki. Egy csaldban pldul
- egy kislny balszerencsjre - rkltt mitokondriumainak kilencvent
szzalka slyos rendellenessget hordozott. Hat hnapos korban bele
halt egy agykrost betegsgbe. Tizenhat ves unokatestvre, akiben a sejt
alkotelemeinek valamivel kisebb rsze jelentkezett mutci formjban,
mg mindig egszsgesnek ltszott. Viszont a lny hatvant ves desanyja
(aki ugyanolyan arny srlt gnt rklt, mint a lnya) mr sket volt,
tbolyult s nyomork. Az idk folyamn a szerencstlen hlgy elszrtan
mkd mitokondriumaiban felhalmozdtak a hibk, s vgl mkds
kptelenn tettk az egsz szervezetet.
Ezeknek a baljs gneknek kirlyi kapcsolatuk is van. A cr c aldjt
(tbbek kztt hemoflis fit) az i917-es forradalom utn kivgeztk.
i992-ben csontjaikat kiliantoltk, egyrszt azrt, hogy megvizsgljk, ha
misan vallja-e magt Anna Anderson a cr lnynak, Anasztzinak, ms
rszt azrt, hogy sszehasonltsk DNS-t az l leszrmazottakval ( tb
bek kztt a jelenlegi edinburghi hercegvel). Kiderlt, hogy a cr ktfle
mitokondriumot hordozott. Az egyik azonos volt anyai gi rokonai
mitokondriumval, a msik egyetlen DNS-vltozsban trt el tlk. Ez a
mutci vagy az testben alakult ki, vagy taln anyjban.
A mitokondriumnak tfogbb szerepe is van az regedsben s a szerve
zet leplsben. Mivel legfbb feladata az energiatermels, s ez a kpessge
a korral felhalmozd mutcik miatt cskken, a test is legyengl. A kr at
tl a szvettl fgg, amely hibs msolatban kapja az zenetet. Ha a mutci

268
HALL VAGY FELTMADS

a fejlds korai szakaszban kvetkezik be, a szaporod sejtek sztvihetik az


egsz szervezetben. Ha ksn, csak nhny terletre korltozdik. Nmelyik
Alzheimer- vagy Parkinson-kros ids emberben az agy bizonyos terletei
tele vannak olyan mitokondriumokkal, amelyekbl bizonyos DNS-szaka
szok hinyoznak. Ugyanez a helyzet szvkoszorr-bajokkal kszkd bete
gek szvizmaival. Aki sokig l, annak a mitokondriurnait annyira elraszt
jk a mutcik, hogy lete kohi s energii mr alig pislkolnak.
Minden gnre ugyanaz a sors vr. Ahogy mindegyikrl jabb msolatok
kszlnek, hibk cssznak be. Ezek elbb vagy utbb annyira meghamist
jk az informcit, hogy a gpezet elromlik, ami vgzetes kvetkezm
nyekkel jrhat; pldul majdnem minden nyolcvanves ember szenved va
lamifle rkban. A mutcik sejtpusztt szereprl feltrt j ismeretek ar
ra utalnak, hogy a fizikai lepls feltartztatlrlatlan folyamat. Ezrt jr
tak olyan kevs sikerrel az emberi let meghosszabbtsra tett ksrletek:
ma taln tbb nyolcvanves l, mint rgen, de mg mindig igen kevs az
olyan ember, aki megnnepelheti a szzhuszadik szletsnapjt. Innen
szrmazott az els fontos tmutats arra vonatkozan is, hogy mi okozza
az j genercit ltrehoz sejtek krosodst, ha nem a sugrrtalom.
A vlaszt rszben Viktria kirlyn gnje adta meg.
Viktria azrt lett kirlyn, mert IV. Gyrgynek nem szletett rkse.
lgy tbb pr indult a versenyben (melyet a korabeli lceldk ,,A Rmsges
Hymen Hbornak" neveztek), hogy az gnjeik foglaljk el Anglia trn
jt. Hrom hercegnek - Clarence, Cambridge s Kent hercegnek, Gyrgy
kirly fivreinek - volt eslye a gyzelemre. Egyikk sem rvendett nagy
npszersgnek (Shelley ostoba fajtjuk salakjnak" nevezte ket), s
mindegyik mgtt viharos mlt llt. Vgl Edward, a kenti herceg gyztt.
Edward knyrtelen volt, akadkoskod, merev s - egyik kortrsa sze
rint - olyan aprlkosan szablyos, mint a kottapapr. Gibraltri kormny
zsga idejn szigora zendlst vltott ki, gy nyugllomnyba helyeztk.
Ealingben lt tovbb fnyzen. Hossz veken t egy Threse Bernardine
nev francia n volt a szeretje (aki flvette a Madame de St. Laurent ne
vet). Amikor a herceg Brsszelbe kltztt vele, tallkozott Victoire leinin
geni hercegnvel. Hosszas ttovzs utn megkrte a kezt, s soha tbb
nem tallkozott Madame de St. Laurent-nal. Rviddel az eskv utn
Victoire llapotos lett, s a kirlyi pr visszatrt Angliba. Lnyuk, Viktria
1819. mjus 24-n szletett a Kensington palotban. Apja egy ven bell
meghalt; dinasztikus ktelessgt beteljestvn tlpett egy olyan szfrba,
ahol (legalbbis e vilgi kpviselje, Robert Owen szerint) megbzatsa r
vnyt vesztette.
A VRNKBEN VAN

Mivel hossz idbe telt, mg Edward rsznta magt dinasztikus ktele


zettsgeinek teljestsre, mr tvenegy ves volt, amikor Viktrit nem
zette. Testnek sejtjeiben a gneket - akrcsak a mitokondriumokat roko
nban, Mikls crban, akit ennyi ids korban vgeztek ki - mr alaposan
tnkretettk a mutcik. gy ktsgtelenl azokat a gneket is, melyek kz
remkdtek hm ivarsejtjeinek termelsben, teht annak a ltrehozs
ban is, amelybl az j uralkod szletett. Ez az egyetlen genetikai baleset -
a hemoflia gnje Viktria reged apjban - vezetett nyomra a mutcik
legenergikusabb elidzjnek, amely egyszer, krlelhetetlen s nyilvn
val: maga az regkor.
Erre ma mr nem a kirlyokrl szl adomk szolgltatjk a bizonyt
kot, hanem a molekulris biolgia legjabb felfedezsei. A legtbb hemo
fliamutci az utbbi idben keletkezett, mint az, amelyViktria kirlyn
csaldjban megjelent. Olyan csaldokban is felbukkan, mint a Hannove
riek, amelyekben korbban nem fordult el ez a betegsg. Ha nyomon
kvetjk mindegyiknek az eredett, vagyis megvizsgljuk azoknak a szr
mazsi gaknak a DNS-t, amelyeknek tbb nemzedke l ma is, meglla
pthatjuk, mikor kerlt a csaldba. Egy hemoflis finak (vagy hordoz
anynak), akinek egyik szljben sincs meg a gn egy pldnya, j mut
cit kellett rklnie. Sok ilyen csaldot tanulmnyoztak. Ha olyan csal
dokkal hasonltjk ssze ket, amelyek nem szenvedtk el a mutcit, meg
lehet llaptani, mi okozhatta a krosodst.
Az letkor szerepe nyilvnval. A szl, akiben az j hemofliamutci
keletkezett, tlag nyolc vvel volt idsebb, mint az tlagos - mutcimen
tes - szlk a npessg egszben. Az regkor ugyangy megtmadja az j
nemzedk gnjeit termel gneket, mint a szlket, akik ltrehozzk ket.
Ez a hats nyilvnvalan sokkal jelentsebb, mint a sugrzs. A szlk
kornak eltoldsa vltozst idz el a mutcik szmban. Japnban ha
sonl a helyzet, mint msutt: az utbbi idben az emberek nehezen szn
jk r magukat, hogy gyermeket vllaljanak. i970-ben a hsz s harminc v
kztti japn nknek mindssze tizennyolc szzalka nem volt frjnl.
i990-re ez a szm negyven szzalkra emelkedett; a fizetsbl l frfiak s
nk olyan buzgn fradoznak a gazdasgi csodn, hogy nem sok idejk
marad a nemi letre. A hzassgok ksbbre toldnak, gy a szlk regeb
bek - tbb a mutci. Hogy mennyi, azt nehz megllaptani, mert gyor
san befejezik a csaldalaptst, s kevs a gyerek ( Japnban tlagosan 1,4),
teht ritka a nagyon ids szl is magas mutcis arnnyal.
A Hirosima s Nagaszaki gyermekeirl rott tanulmnyokat olvasva ne
hz nem szrevenni a szerzk csaldottsgt. Br termszetesen megkny-

2 70
TRPK, DOMINNS GNEK S REG SZLK

Az rkltt trpesget tbb ezer ve ismerik: flje ptshoz csak ssze kell szmolni, hny ilyen sz
gyeztk mr a rgi grgk is; az egyik egyiptomi lets fordul el.
sron lthat egy trpe emlkmve, aki valami Gnjre gy talltak r, hogy hossz idn t ke
fontos szerepet jtszott az udvar letben; Velz restk a Huntington-kr elidzjt, amely a k
quez szmos portrt festett a spanyol kirlyi udvar zelben helyezkedik el, a 4-es kromoszma vg
trpirl (kztk a leghresebb Las Meninas cm nl. Normlis krlmnyek kzt az a feladata,
remekmvnek fontos alakja, a Maribarbola nev hogy a sejtek felletn receptormolekult lltson
trpe, az ifj Margarita hercegn szolglja). el a nvekedsi jelzanyag szmra, amely oszt
A korltozott nvekedsnek sokfle oka lehet. dsra utastja a sejtet. Ha genetikai baleset kvet
Nha pldul az rkltt elgtelensggel termel keztben ez nem mkdik megfelelen a nveke
dik a nvekedsi hormon. De a trpesg leggya d CS()ntban s a ktszvetben, kialakul a trpe
koribb rkltt formja az akondroplzia: a hosz sg. Minden rintett esetben a gnnek ugyanazon
sz csontok fejldsi elgtelensge. Az rintettek a helyn van a mutci (ami mr magban is szo
nek rvid a lbuk, a karjuk s jellegzetesek az arc katlan: a hemoflinl pldul egszen ms a hely
vonsaik. Ettl eltekintve egszsgesek. Krl zet). A mutci meglepen gyakori - krlbell
bell minden huszontezredik gyerek szletik harmincezer szletsenknt egy eset -, teht a g
akondroplziai trpesggel; tzbl nyolc normlis nen bell valsznleg van egy instabil terlet. De
magassg szlktl. A folyamatban szerepet jt az a legfigyelemremltbb, hogy elfordulsa szo
sz gn dominns; vagyis egy pldny is elg, rosan sszefgg a szlk korval. A harminct
hogy hatsa megnyilvnuljon. A normlis szlk ves apk esetben tbb mint tzszer gyakoribb,
tl szletett trpkben teht j mutcinak kell mint a huszont ves apkban (s feltehetleg mg
megjelennie. A mutci gyakorisgnak meglla- magasabb, ha az apa ennl idsebb).

Az 5. dinasztia idejbl szrmaz szobor egy gzai


srrl (kb. Kr. e. 2500-2300) . A trpe Seneb a felesge
mellett l. Kt gyerekk a lbuknl ll.

27 1
A VRNKBEN VAN

nyebbltek, amikor azt tapasztaltk, hogy a sugrzs nem okozott sok mu


tcit a fehrjket kdol gnekben, a kutatk is emberek, s a pozitv
eredmnyeket jobban szeretik a negatvaknl. De amikor hozzfrhetv
vlt a DNS-vizsglati eljrs, a Sugrhats Kutatsi Alaptvnynl nyoma
sem maradt a kibrndultsgnak. Kiderlt, hogy munkjuk jabb dnt
felismerssel szolglt a mutcik keletkezsrl, s mer vletlensgbl j
megvilgtsba helyezte az egyetemes, si hajlamot, hogy a nket hibztas
sk a nemisg velejrjnak tartott romlsrt.
A felfedezs alapja az volt, hogy lehetsg nylt a vltozsok megfigyel
sre a DNS-ben, klnsen azokban a rszekben (mint az ujjlenyomat"),
ahol magas a mutcis arny. A genetikai llomnynak ebben a pratlanul
gyorsan vltoz rszben a sugrzs semmifle hatssal nem volt a mutci
kra Hirosimban. De a huszonnyolc spontn ujjlenyomat" -mutci k
zl, amelyet (az ezerngyszz megvizsglt gnben) talltak - mikzben
eredmnytelenl kutattak az atombomba kvetkezmnyei utn -, huszon
t az aptl szrmazott. Az anytl csak hrom. Ms szval, legalbbis a
DNS-ujjlenyomatokban, a mutcirt tlnyomrszt a frfiak voltak fele
lsek. Az eltlet a ni hibakuskkal szemben teljesen alaptalannak bizo
nyult; a mutcik nagy rsze - a mkd gnek esetben ppgy, mint a
DNS-ujjlenyomatoknl - a frfiakban keletkezett. Az reg frfiak, mint
Edward kenti herceg (aki vletlenl s elszomortan pp annyi ids volt,
mint n most, amikor Viktria kirlyn megfogant), a legveszlyesebb sze
relmi partnerek. Mzes I. knyvtl napjainkig teht ltalban tvesen hi
bztattk a nket a vrvonal beszennyezsrt.
Br a frfiak tesznek legtbbet a csrallomny krostsrt, annak
megjtsa nagyrszt a nk dolga. Jllehet apja reg volt s roskatag, Vik
tria - mint minden gyerek - fiatalon s letersen szletett. Minek k
sznhette - utdaival egytt - a feltmadst? Hiba a Biblia minden bizo
nyossga s Weismann minden ktelye, a vlasz a nemisg; s klnsen e
folyamatnak a nkre es rsze.
A nemisgnek nagyon fontosnak kell lennie, egyszeren azrt, mert a
szaporodsnak ez a klns mdja igen kltsges. Amikor a nstny kap
csolatba kerl a hmmel, felhgtja sajt gnjeit olyasvalakinek a gnjeivel,
aki maga nem sokat tesz ezeknek a gneknek a fennmaradsrt. Radsul
fikat is szl, akik ugyanilyen nz mdon viselkednek majd. Hogy a ter
mszet ezt az risi rfordtst ellenslyozza, a nemisgnek igen komoly
elnykkel kell jrnia legalbb a gnekre nzve, ha termkeikre nem is. s a
haszon valban risi: a nemisg vilga rr lett a hallon.
A nemisg legfbb feladata, hogy a mutci okozta krokat meg nem

272
HALL VAGY FELTMADS

A here s a petefszek keresztmetszete. A here kis csvek sokasgbl ll (itt tvgtk ket),
melyekben a sejtek folyamatos osztdssal termelik a hm ivarsejteket. A petefszek viszont
mindssze krlbell szzezer felhasznlhat petesejtet tartalmaz, s ebbl alig tszz rik be
az let sorn.

trtntt tegye. Erre sokfle mdszere knlkozik. A legegyszerbb egy sz


r. Az ivaros szervezetben sokkal tbb sejt indul tnak, hogy tvigye a gne
ket a trtnelmen, mint ahny valaha is clba r. Egy n szervezete mr a
megszlets eltt felhalmozza teljes, krlbell egymilli petesejtbl ll
kszlett, s termkeny letszakasza sorn idrl idre tnak indtja ket.
Havi ciklusokban tbb ezret. Egy frfi minden kzslskor annyi hm
ivarsejtet mozgst, hogy Eurpa teljes ni npessgt megtermkenythet
n vele. Fradhatatlanul termeli a hm ivarsejtek ezreit nap mint nap. A mo
dern vilgban ebbl a sok millirdbl alig kett vagy hrom hasznosul.
Minden petesejt s minden hm ivarsejt a testi sejtek hossz osztdsi
lncnak vgn jelenik meg. Ez a szdt sorozat vlasztja el ket a hajdan
megtermkenytett petesejttl a nben s a frfiban egyarnt. A sejtek
elenysz tredknek van csak eslye, hogy tjut ezen a csrasejtek kt
nemzedke kz iktatott fizikai szrn, mert ez knyrtelenl kirostlja
ket, ha olyan mutcit hordoznak, amely cskkenti versenykpessgket
a frfin s nn trohan szomatikus versenyfutsban a kifejlett csrasejtt
vlsrt.
Ez darwini rtelemben vett termszetes kivlasztds, de a kzd felek
nem egsz szervezetek, hanem sejtek, s a kzdtr maga a test. A szrna
gy lesz rr a szksgszer hanyatlson, hogy a fejlds korai szakasz
ban tartalkol egy sejtvonalat, amely vgl ltrehozza nemi sejtjeit. A sejt
vonal roppant mennyisg sejtet kpes termelni, de kzlk csak nhny
kivlasztott jut el a kvetkez nemzedkig a hm ivrsejt s a petesejt tall-

273
AZ IMMUNRENDSZER S A TERMSZETES
KIVLASZTDS A TEST SEJTJEIBEN

Testnket szntelenl ostromolja egy titokzatos s sejt kifejldik, mutcik sorn t DNS-szakaszok
szakadatlanul vltoz sszettel hadsereg. Br esnek ki, s vgl a kt terlet kdja egyms mellke
milyen legyen is az ellensg - baktriumok, vru rl. A knny lncban krlbell ktszz gn van a
sok, egyszer vagy bonyolult sszettel vegyi vltoz terleten, a nehz lncban nagyjbl ugyan
anyagok-, az immunrendszer ellenll. Mg azokra ennyi. Klnbz szm darab esik ki egy fejld
a laboratriumban kiksrletezett vegyszerekre is sejtcsaldban, s forr ssze - tbb szz sszekt
vlaszolni tud, amelyekrl soha semmifle llny gn ignybevtelvel - a molekula lland rszvel.
nem szerezhetett tapasztalatot. Elkpeszten pon Amellett, hogy a gnek ilyesfajta egyeslse gazdag
tosan mkdik: antitesteket (vdekez fehrjket) vltozatossgot eredmnyez, minden vltoz gn
termel, s gy alaktja ki ket, hogy hozzktdje nek igen nagy a mutcis arnya. Teht sok milli
nek a betolakodhoz, majd semlegestsk. A tma fle antitest jhet ltre mindssze pr szz gnbl.
ds msodik hullmt mr ppen az az ellenanyag Amint j antign jelenik meg a szervezetben,
fogadja, amely elpuszttja a betolakodkat. Az im brmelyik nyiroksejt, amely megkzeltleg hoz
munrendszer mkdse rvilgt, milyen eredm zill antitestet termel, szaporodni kezd. Kzben
nyes s hatsos az evolci, amely nem genercik mutcik keletkeznek, ezekbl j vltozatok jn
sorn megy vgbe, hanem egyetlen testen bell. nek ltre. Azok, amelyek a legjobban illeszkednek a
Csak nemrg vlt vilgoss, hogy nagyjbl ugyan betolakod antignhez, tovbb osztdnak, mg
ilyen folyamat jtszik kzre a hm ivarsejt s pete termszetes kivlasztds rvn nem fejldik a sej
sejt kialakulshoz vezet lncolatban is. tek csaldi ga, klnja, amely ltrehozza a megfele
Az antitesteket (ellenanyagokat) klnleges l antitestet. Ha az els tmadst visszavertk, n
nyiroksejtek termelik. Minden antitestet ngy fe hny emlkez sejt" tartalkban marad, s kszen
hrjelnc alkot, kt nehz s kt knny, amelyek ll egy esetleges msodik tmadsra.
Y alakban helyezkednek el. Az Y als szra mind
egyikben azonos, de a molekula vgn lv terle BALRA LENT: Antitesteket termel nyiroksejt, amely
tek antitestenknt vltoznak, s mindegyik egy nek felsznhez idegen vrsvrsejtek tapadnak.
egy meghatrozott antignnek (betolakod fehr JOBBRA LENT: Nagy energij rntgenmikroszkp
jnek) a felismersre alkalmas. felhasznlsval kszlt, szmtgppel ltrehozott
A vltoz s lland terletek kialaktsrl a hromdimenzis kp az antitestnek arrl a felismer
DNS kt, egymstl nagy tvolsgra elhelyezked terletrl, amely az antignhez (kk vonalszaka
gncsoportja gondoskodik. Ahogy egy-egy nyirok- szok) ktdik.

27 4
HALL VAGY FELTMADS

kozsa rvn. Vagyis a gnek szempontjbl a test olyan koszisztma,


amelyben a ltrt val kzdelemnek ppoly dz formja jelenik meg,
mint a klvilgban. Csak a legjobbaknak - vagyis a mutciktl legkevs
b krosodottaknak - van eslyk a gyzelemre. A sejtek csatjbl ad
dik, hogy azok a szvetek (pldul az agy s az izom), amelyeknek sejtjei
kevsb osztdnak, gyorsabban is regszenek mutci rvn az osztdk
hoz (pldul a vrhez) kpest, ahol mindig a legjobb sejt diadalmaskodik.
Br szokatlan gondolat, hogy a test formld szervezet, mkdse kz
ponti jelentsg, fkpp az immunrendszer szempontjbl.
Amikor mr ltrejttek az ond- s petesejtek, akkor is bven addik le
hetsg a mutcitl krosodottak kiszrsre. Vgeredmnyben minden
megtermkenytsi ksrletnl csak egy hm ivarsejt lehet sikeres; millik
elpusztulnak tkzben. A legtbb megtermkenytett petesejt is elpusztul,
gy ismt md nylik a genetikailag nem tkletesek kiselejtezsre, mieltt
ltrehozhatnnak egy jabb szmt, amely mr a sajtjuk.
A genetikai szr eredmnyessgt nveli az ond- s petesejt kialaku
lsnak mdszere is. Ezek a testi sejtektl eltren nem egyszeren a ko
rbbi sejt hibs msolatai. Gnjeik j kombincikba rendezdnek egy
bonyolult sejtfolyamat sorn, melyben az aptl s az anytl szrmaz
kromoszmk felsorakoznak egyms mellett, majd kromoszmadarabo
kat cserlnek egymssal. gy egyes ivarsejtek tbb srlt gnt kapnak egy
szerre, msok pedig egyet sem. Azoknak a pusztulsa, amelyeknek szeren
cstlen kombinci jut, egyetlen sejt rn sok mutcitl megtiszttja a
gnllomnyt: ez az utols kr a biolgiai versenyfutsban, mely a legver
senykpesebbeket juttatja az j generciba.
A nemisg azt jelenti, hogy csak a legjobb sejtek jutnak el a closzlopig.
Csakhogy minl regebbek a szlk, annl hosszabb id llt rendelkezsre
a mutcikpzdshez, s annl gyengbb lapokkal indul a jtk. A helyzet
slyosabb a frfiaknl, mert bennk egsz letk sorn j s j hm ivarsej
tek termeldnek ismtelt sejtosztds rvn. Nluk teht nagyobb a veszly,
hogy genetikai rksgk megsrl, mieltt tovbbadhatnk. Petesejttl
petesejtig, egyik nemzedktl a msikig krlbell hsz sejtosztds megy
vgbe, tekintet nlkl az anya korra. Egy huszonnyolc ves apnl (Nyuga
ton ez az tlagos csaldalaptsi kor) a szomatikus versenyfutsban krl
bell hromszz sejtosztdsra kerl sor, mire egy hm ivarsejt ltrejn.
Egy tvenegy ves frfiban (lsd a kenti herceg) tbb mint ezer osztds
lncolata vlasztja el sajt csrasejtjeit az t ltrehoz hm ivarsejttl (ebben
az esetben III. Gyrgytl); s mindegyik nveli a balesetek veszlyt. Ez a
magyarzata a mutci s a szl letkora kzti sszefggsnek.

27 5
A VRNKBEN VAN

Hm ivarsejt s petesejt
tallkozsnak nagy
pillanata. Vgre
befejezdtt a csrasejteknek
a szervezetben folytatott
genetikai versenyfutsa.

Tekintet nlkl a remnybeli szl korra, a nemisg nemcsak arra j,


hogy cskkentse a vesztesgeket. Amikor kiszri az utastsok legjobb pl
dnyt a testen t vezet genetikai ton egyik megtermkenytstl a msi
kig, csak annyit tesz, mint egy rstudatlan msol, akinek nem az a dolga,
hogy megrtse az rott szveget, csak az, hogy minl kisebb zavart okoz
zon. Akr ivariak, akr nem, a sejtek sokat tesznek az rkltt zenet pon
tossgnak biztostsrt. gy viselkednek, mintha a sajt korrektoraik
lennnek, sszevetik a DNS-t egy eredeti pldnnyal, s kijavtjk, mieltt
tovbbadnk. Ez a folyamat a nemisg idejn a legaktvabb, s a magunk
fajta hossz let llnyekben a legeredmnyesebb, ami ismt a DNS-k
rosods s az letkor kapcsolatt hangslyozza.
Az els lps az rkltt zenet rzsben annak biztostsa, hogy mi
nl kevesebb rtalom rje a kdot. Egsz sor enzim s vdfehrje teszi r
talmatlann a kros vegyi anyagokat a sejtben. Ezeknek a vdelmezknek a
srlse - pldul a cigarettafsttl - hajlamoss tesz a rkra. A msodik
vdelmi vonal bizonyos sejtosztdsgtl fehrjkkel rveszi a balszeren
csjkre mutcit szenvedett sejteket, hogy ngyilkossgot kvessenek el.
A legfontosabb vdelem az enzimek hada, amely sszeeszkblja a mutci
s DNS-t. Kln erre szakosodott enzimek visszafordtjk a kmiai vlto
zsokat a DNS-bzisokban, msok kivgjk s helyrelltjk a mutcit
HALL VAGY FELTMADS

tartalmaz darabokat. Megint msok felismerik s helyettestik a ketts


spirl eltorzult darabjait, amint mutcis lncai megprblnak egyms
hoz illeszkedni. Ebben a bonyolult gpezetben is idnknt krt tesz a mu
tci, amibl slyos betegsg szrmazhat. A rkbiolgusok nagy figyelmet
szentelnek a DNS-javts mechanizmusnak, mert ennek - s hibinak
megrtse a betegsgek jobb megrtshez vezethet.
Hogyan fejldtt ki a genetikai korrektraolvassnak ez a bonyolult
rendszere? A vlasz, mint oly gyakran, a nemisgben rejlik. Taln kzen
fekvnek ltszik, hogy a nemisg a szaporodsrt alakult ki. De lehets
ges, hogy inkbb az eltorzult DNS megjavtsra tett kzs erfesztsnek
indult. Az stengerben szkl nem nlkli sejteket, melyeknek csak egy
pldnyuk volt genetikai utastsaikbl, az a veszly fenyegette, hogy a fel
halmozd mutcik megzavarjk ket, s fogalmuk sem lesz, melyik
volt az igazi DNS. Az ellenrzsnek az a legknnyebb mdszere, ha meg
krdezik a szomszdjukat, vagyis sszevetik sajt kdjukat egy hibtlan
pldnyval. Ehhez egyeslnik kellett, hogy sszehasonltsk gnjeiket.
s megszletett a nemisg. Aki gyesen csinlta, elg sokig lt, hogy sza
porodhasson.
A nemisg minden sejt szmra biztostja a korrektor munkjnak leg
fontosabb eszkzt: a kzirat hibtlan pldnyt, mellyel az eltte lv
szveget sszevetheti. Vagyis mindenkinek van egy tartalk pldnya
minden gnbl, ugyanis mindkt szljtl kapott egy-egy msolatot. Ha
ezek kzl mutci rvn megsrl valamelyik, a msik feltehetleg hi
btlan marad. A nemisg azzal emeli magasabb rangra a biolgiai mso
lt kolostori eldjnl, hogy rstudv teszi: lehetsget ad neki arra,
hogy a hibkat sszevesse egy tiszta pldnnyal, mieltt az zenetet to
vbbtan.
A folyamat akkor a leglnkebb, amikor a hm ivarsejt s a petesejt ki
alakul. Minden kromoszmapr tagjai felsorakoznak: az anyai vltozat
prba ll apai megfeleljvel. Az illeszkeds pontos, a DNS-hasts s
sszeilleszts lzas tevkenysgvel jr. Az elvgott molekulk nha ms el
rendezsben illeszkednek egymshoz, gy a csrasejt kialakulsa olyan j
gnkombincikat hoz ltre a hm ivarsejtben, illetve a petesejtben, ame
lyek klnbznek az ket ltrehoz egyntl. Ez a rekombinciban nyil
vnul meg, abban a folyamatban, ahogy az utdokban ms tulajdonsgok
kapcsoldnak egymshoz, mint a szlkben. De rendszerint nincs lthat
jele a gnek jrakeveredsnek, egyszeren minden DNS-molekulban
helyrejnnek a hibk, mieltt a ketts spirl beszllna a kvetkez nemze
dk ltrehozsrt folytatott versengsbe.

277
A VAK KORREKTOR - DNS-JAVTS
S GENETIKAI BETEGSGEK

Ez a knyv - mint a legtbb manapsg - szvegszerkesztn kszlt, mely


nek szmos eszkze van a hibk javtsra. Nmelyik egyszer: a visszalp
tet billenty s a trls. Msok bonyolultabbak. Ha az ember a megfelel
billentyket ti le, a program sszeveti a szveget egy sztrral, s kijelli az
ismeretlen szavakat. Nemsokra olyan programok is kszlnek, amelyek a
szvegsszefggst is felismerik: ha az ember azt rja, hogy oda", ahelyett,
hogy oka", a gp azonnal kijavtja a hibt. A javtfestk napja leldozott.
A test szerkesztmechanizmusa mg eredmnyesebben mkdik. Sok
tzmillinyi betnl" akad egy msolsi hiba - erre a rekordra minden
gprn bszke lehetne mg akkor is, ha a legjobb szvegszerkesztn dol
gozik. A fennmaradsunk a mutcik kijavtsra val kpessgtl fgg.
A xeroderma pigmentosum ritka betegsg, a srlt DNS-szakasz kivgs
ra alkalmas enzim hinya okozza. A gn hordozi rendkvl rzkenyek az
ibolyntli sugrzsra - s mindegyikkben kialakul a brrk. Kevesen l
nek harminc vnl tovbb.
Az ataxia telangiectasia rokon betegsg. Azokat, akik rklik - minden
tezredik embert -, a brrk egy bizonyos fajtja fenyegeti, s nagyon rz
kenyek a rntgensugrzsra. Elfordulhat, hogy a sugrkezels maradan
d sebeket hagy rajtuk. A betegsget elidz gn normlis formjban
olyan fehrjt llt el, amely felismeri a DNS-krosodst, s lelltja a sejt
osztdst, amg fennll a hiba. A betegsg kialakulshoz a mutcis gn
kt pldnya kell. De azoknl a nknl, akik egyetlen pldnyt hordoznak

Ebben a betegben a xeroderma


pigmentosum a korai szakasznl
tart. A sttfoltok idvel
sztterjednek, s vgzetess
vlhatnak.
A VAK KORREKTOR

belle - csak Angliban negyedmillian vannak -,


tszr nagyobb az emlrk veszlye, gy ez a gn a
betegsg rkltt formjnak leggyakoribb oka.
Nhny nnl mg a mellkasrntgennel jr sz
rvizsglatok is nvelik a kockzatot. A javtgn
krosodsval fgg ssze a vastagblrk leggyako
ribb formja; a betegsgre val rkltt hajlamot
minden ktszzadik ember hordozza.
Abbl is nyilvnval a DNS-helyrellts bonyo
lultsga - s letbevg jelentsge -, hogy milyen
slyos kvetkezmnyekkel jr, ha a testnek a gene
tikai llomny javtsra szolgl szmtalan me
chanizmusa kzl csak egyetlenegy elromlik.

JOBBRA: Egy rosszul illeszked (srgra sznezett) DNS-bzis ketts

kivgsa az n. kimetszsesjavtssal. A pirosfoltok a DNS-ben azo


kat a helyeketjelzik, amelyeket felismert a javtenzim; a molekula
nagyobb szakaszt - mindig huszonnyolc bzisprt - kell kivgnia,
hogy kijavtsa az egyetlen ponton trtnt krosodst. Ekkor a hiny
z egyszl darabot gy ptolja, hogy a hozzill szlban hordozott
kiegszt DNS-zenetet lemsolja. A xeroderma pigmentosum en
nek a mechanizmusnak a meghibsodsbl szrmazik.

LENT: Patknyembribl szrmaz daganatos sejtek csoportja,


amelybl hinyzik a daganat ellen vd P53-as szuppresszor gn.
A krosods gy kvetkezett be, hogy a sejteket dohnyfsttel ke
zeltk.

27 9
A VRNKBEN VAN

Mint Hirosima ldozatainak pldja mutatta, az lvilgban elssorban


a hmek felelsek a mutcirt. A kijavts viszont inkbb a nstnyek tar
tomnya. A petesejt alakulsa sorn (az j gnsszettelek tansga sze
rint) sokkal tbb DNS-hasts s -illeszts trtnik, mint a hm ivarsejt lt
rejttekor. Valjban nhny llnynl, pldul az ecetmuslicnl, a h
mekben egyltaln nem megy vgbe rekombinci, vagyis valsznleg
nem trtnik DNS-hasts, -jrakevers s -javts. A jelek szerint egy tla
gos gnnel az a helyzet, hogy a hmek krt tesznek benne, s a nstnyek
kijavtjk. Tves teht a hagyomnyos elkpzels, hogy a nk a szennyez
ds forrsai. ppen hogy k a feltmads lnyege.
A DNS javtsa ktsgtelenl szerepet jtszik a genetikai zenet megj
tsban. De mg mindig az a biolgia legnehezebben megoldhat probl
mja, hogy mirt szletnek fiatalon a csecsemk. A vlasszal megolddna
a nemisg s a mutci kzponti krdse, s taln kzelebb kerlnnk az
regedsnek s a vele jr minden nyomorsgnak a megrtshez. Nmi
magyarzattal szolgl a biolgiai ra, amely minden gyerek szletsekor
tlltdik. Mkdse megjtja a gneket. De ha elromlik, az katasztrof
lis kvetkezmnyekkel jr.
A laboratriumi kmcskultrkban kitenysztett sejteknek beprogra
mozott lettartamuk van. Bizonyos szm sejtosztds utn felhagynak a

...

A kromoszmkon festssel
tettk lthatv a telomrkat.
Nhny sejtet sszezztak;
a kromoszmk vgn az lnk
sznG foltok a telomrk.

280
HALL VAGY FELTMADS

DNS msolsval, s lomba merlnek vagy elpusztulnak. Hogy hnyszor


osztdnak, az annak az llnynek az lettartamtl fgg, amelytl szr
maznak. Az egr sejtje hamarabb fladja, mint az elefnt.
Nhny sejt azonban nem engedelmeskedik az utastsnak: elpuszttha
tatlan, s addig osztdik, amg csak tpllkhoz jut. Tbbsgk rkos sej
tekbl szrmazik. Egyikk, a HeLa sejtvonal a mai napig fennmaradt, hol
ott se - egy Helen Laing vagy Henrietta Lacks nev fekete n - tbb mint
tven ve belehalt a betegsgbe. A rkbetegsget az okozza, hogy a sejt nem
hajland tudomsul venni az utastst a sejtosztds beszntetsre, ha
nem megllthatatlanul szaporodik, s sztterjed az egsz testben.
A mai rkkutats fkpp a sejthalandsg genetikjval foglalkozik; az
gynevezettt programozott sejthall" kivlt okait keresi. Legalbb egy
kzlk szoros kapcsolatban van a genetikai zenet szexulis megjts
val. A kromoszmk kicsit hasonltanak a cipfzkhz. Pici tokban (vagy
kupakban) vgzdnek, amely ebben az esetben nem fmbl van, hanem
DNS-bzisokbl, s egyetlen hatrszes szakasz ismtldseinek ezreibl
ll: ez a telomra. Egy jellegzetes osztd sejtvonal krlbell szz DNS
bzist veszt osztdsonknt. A telomrk a hall idzti. Az, hogy mikor
hagynak fel a sejtek az osztdssal, attl fgg, mennyi maradt meg a
telomra vdkupakjbl. Amikor a mutci a telomrabzis szmt k
rlbell ngyezerre faragja le, a sejt nem tud tovbb osztdni. A telomra
az ra, amely tervezett lettartamnak folyamn vezrli a sejtet. Ha meg
szmoljuk, mennyi maradt a kupakbl, meglehets bizonyossggal elre
jelezhetjk, mikor regszik el a sejt.
Ami igaz a sejtekre, igaz az emberekre is. Egy nyolcvanves emberben ke
vesebb ilyen egysg van, mint egy gyerekben, hiszen mr igen sok szakasz
elveszett belle. A telomrk valamifle genetikai vgzet hordozi, s csak
arra vrnak, hogy hordozikat - akr gnek, akr emberek - aggsgba ta
sztsk. s mintha Nemezis istenn intzte volna (aki knye-kedve szerint
osztogatta a j- s balsorsot), az emberek szletsktl fogva nem egyen
lk. A gyerekekben krlbell hatezertl ennek ktszeresig is terjedhet a
telomraszakaswk szma. Az egypetj ikreknl nagyjbl egyforma a
kromoszmakupak hossza, vagyis a telomra mrete valsznleg geneti
kailag meghatrozott. A legkisebbet eddig egy kilencvenht ves frfiban
talltk, akinl minden kromoszma vgn alig tezer ismtld szakasz
maradt. Goethe Faustja, taln emlkeznek r, szzves korban halt meg
(ktsgtelenl ennek megfelelen lecskkent szm telomrval) , mert be
leunt az letbe, s lemondott a halhatatlansgrl. Goethe, br biolgus volt,
nem ismerte fl, hogy hsnek gnjeibe volt kdolva ez a vlaszts.

281
A VRNKBEN VAN

A kops kvetkeztben a telomrk hossza nmelyik csecsemnl - aki


rvid kromoszmavgzdssel szletett - korbban cskken a szksges
szint al, mint msoknl. k taln gyorsabban regszenek, mint szeren
cssebb trsaik. Hogy a telomramutcik mikpp okoznak leplst, s
egyltaln okoznak-e, azt nem tudjuk. Egyszer, egyszerst, de baljs
szmts szerint a telomrasor als hatrn lv csecsem alig hetvenvi
letre van beprogramozva, mg az, aki bsgesebb adomnyban rszeslt,
vagy hsz vvel tovbb lhet, mieltt kimlna, mert mr se szem, se fog, se
telomra, se semmi. A gnek vizsglata rvn nemsokra taln meg lehet
becslni, vajon egy 2000-ben szletett csecsemnek van-e eslye, hogy v
gigli az j vezred els szzadt.
A nemisg tlltja a telomrart. Ahogy a hm ivarsejt, illetve a pete
sejt kialakulsa sorn a kromoszmk prba rendezdnek, egy enzim j
letre kelti ket, mert j kromoszmavgzdseket hoz ltre. A gn - az if
jsg igazi forrsa - olyan enzimet termel, a telomerzt, melyet a tudsok
darabos humorval TLC-nek, vagyis telomrahosszabbt komponens
nek" neveznek. Csupn a csrasejtet termel szvetekben mkdik; teht
csak a hm ivarsejtet s a petesejtet lehet megfiataltani.
De van a szably all egy kivtel. A rkos sejtekben mkdsbe lpnek a
TLC-gnek, s a sejtet j letre keltik. Taln ez a gn teszi lehetv, hogy
ezek a sejtek tovbb osztdjanak, s vgl legyrjk azokat, melyek enge
delmeskednek a hibtlan utastsnak, s elpusztulnak. Aktivitsa legalbb
ezerszer nagyobb a rkos sejtekben (s az ondsejtek, illetve a petesejtek
eldeiben), mint a tbbiben. m azok, akiknek rkos szvetei rtalltak az
rk letre, valsznleg hamarabb meghalnak, mint azok, akiknek sejtjei
megadjk magukat az eleve elrendelt pusztulsnak.
A telomrk rvilgtanak, milyen szorosan sszefgg a mutci meg az
letkor, s milyen fausti :wezsg a nemisg s hall alkuja. Semmi ktsg,
hogy mindkett csak rsze, taln csekly rsze a megjuls gpezetnek,
amely csodt mvel, ahnyszor egy csecsem megszletik. De nyilvnval,
hogy amikor a halottak jelkpes rtelemben feltmadnak utdaikban,
gnjeik mr msok lesznek. Szt. Pl a biolgusok szmra ismers mdon
rta le az ellentmondst a testben lv s az zenetet tovbbt sejtek gene
tikai zenetnek sorsa kzt: Mert szksg, hogy ez a romland test
romolhatatlansgot ltsn magra, s e haland test halhatatlansgot lt
sn magra." A biolgia a tanbizonysg r, milyen igaza volt: br hordo
zik lete muland, a gnek rkk lnek.

282
TOVBBI OLVASMNYOK

A genetika s a szletstl elrendelt sorsba vetett hi"t olyan sokat rul el arrl, mi
lyennek ltjuk nmagunkat, hogy az rklds tanulmnyozsa sorn az olvasm
nyok kre szinte hatrtalan. Az testamentumtl a Tudomnyos Akadmiai Kzle
mnyekig minden belefr, tbbek kztt a filozfia nagyrsze (nem beszlve a tisz
tes mennyisg szpirodalomrl, kltszetrl s letrajzrl). A knyvemben flve
tett krdsek rgen megfogalmazdtak, a vJaszokra azonban (br pusztn biol
giai rtelemben, s mg mindig hinyosan) csak mostanban derl fny. Teht ahol
csak lehet, a legfrissebb kiadvnyokra utalok egy-egy adott terleten, hisz olyan
gyorsan fejldik a humngenetika, hogy rvidesen elavulnak ezek is. A tudom
nyos folyiratok - pldul a New Scientist s a Scientific American folyamatosan
-

ismertetik a legjabb felfedezseket, s ha a flsleges sallangokat eltvoltjuk, tb


b-kevsb helytllak a sajtbeszmolk is.

LTALNOS OLVASMNYOK S BEVEZET

Sok kivJ m ll rendelkezsre a genetikrl. A legjobb A. J. F. Griffiths et al. An


Introduction to Genetic Analysis ( 6. kiad. W. H. Freeman, 1996) cm knyve. A hu
mngenetika terletn elssorban J. M. Connor s M. A. Ferguson-Smith Essential
Medical Genetics (4. kiad. Blackwell, 1993), valamint R. F. Mueller s I. D. Young
Emery's Elements of Medical Genetics (9. kiad. Churchill Livingstone, 1995) cm
munkja forgathat haszonnal. A genetika molekulris aspektusnak egyszer s
tfogbb megkzeltshez segtsget nyjt Paul Berg s Maxine Singer Dealing
with Genes: The Language ofHeredity (Blackwell, 1993) cm knyve.
Sajt The Language ofthe Genes (2. kiad. Flamingo & Anchor, 1994) cm munkm
ennl a knyvnl szlesebb kr s (elkerlhetetlenl) felletesebb kpet ad arrl, mit
is jelent a genetika. Richard Dawkins knyve, a River Out ofEden: A Darwinian View
ofIife (Basic Books & Weidenfeld and Nicolson, 1995) szoks szerint remek ttekintst
nyjt az evolcis gondolkods fejldsrl a herakleitoszi metaforbl kiindulva,
hogy az id, akr egy foly, mindig ugyanaz, de mindig vJtozik; a gneknek a mltbl
a jvbe raml eleven sodrba sem lphetnk be ktszer. Alex Shoumatoff munkja,

285
A VRNKBEN VAN

a The Mountin ofnames: A History ofthe Human Family (Simon and Schuster, 1985; j
kiad. Kodansha, 1995) szintn ennek az analginak az alapjn kveti nyomon a
mltba az emberi csaldft, a szrmazsrl, rokonsgrl s skrl szl anekdotk
nak a Salt Lake City-i mormon levltr kr pl lenygz gyjtemnye rvn.
R. Cole-Turner The New Genesis: Theology and the Genetic Revolution (Westmins
ter Press, 1993) cm knyve a gnterpirl, genetikai szrsrl s genetikai beavat
kozsrl vallott keresztny nzeteket ismerteti, s felveti a krdst, vltoztatnak-e a
gnek Isten s ember kapcsolatn. Azoknak, akik nem nagyon jratosak a teolgi
ban, a B. M. Metzger s M. D. Coogan szerkesztsben megjelent The Oxford Com
panion to the Bible (Oxford University Press, 1994) s a J. McManners szerkesztette
The Oxford Illustrated History ofChristianity (Oxford University Press, 1994) szolgl
hat nmi krptlssal a sok vasrnaprt, melyet nem a templomban tltttek.
Az rkldsrl kialaktott elkpzelsek fejldst mltatja R. C. Olby a
Companion Encyclopedia of the History of Medicine (szerk. W. F. Bynum s Roy
Porter; Routledge, 1993) cm ktetben, s Alexander Graham Bell s a sketsg kr
dst N. E. Groce Everyone Here Spoke Sign Language: Hereditary Deafness on
Martha's Vineyard (j kiad. Harvard University Press, 1988) cm knyvben; a leg
jabb kutatsokrl tudomnyos beszmolval szolgl K. Steele s S. D. M. Brown
Genes and deafness" cm rsa, amely a Trends in Genetics 10. szmban jelent
meg: 428-435. old. (1994).

1. FEJEZET: ARMAGEDDON ELLENTMONDSA

Adams, M. D. et al.: Initial assessment of human gene diversity and expression


patterns based on 83 million nucleotides of cDNA sequence", Nature 377 mell.,
1995. szeptember 28. 3-174. old.
Bittles, A. H., s Ncel, J. V.: The cost of human inbreeding and their implications
for variations at the DNA levei", Nature Genetics 8, 117-21 (1994).
Boyer, P.: When Time Shall Be no More: Prophecy Belief in Modern American
Culture, The Belknap Pss of Harvard University Press, 1992.
Cannon-Albright, L. A. et al.: Familiality of cancer in Utah", Cancer Research 54,
2378-85. old. (1994).
De la Chapelle, A.: Disease mapping in isolated human populations: thc example
of Finland", Journal ofMedical Genetic5 7, 169-75. old. (1994).
Newman, M. et al.: Structure of Bam H1 endonuclease bound to DNA: partial
folding and unfolding on DNA binding", Science269, 656-63. old. (1995).
Strucwing, J. P. et al.: Detection of eight BRCA1 mutations in 10 Breast/Ovarian
Cancer families, including l family with male breast cancer", American ]ournal
of Human Genetics 57, 1-7. old. (1996).
Varilo, T. et al.: The age of a human mutation: Genealogical and linkage disequi
librium analysis of the CLN5 mutation in the Finnish population", American
]ournal ofHuman Genetics 58, 506-12. old. (1996).

286
TOVBBI OLVASMNYOK

II. FEJEZET: NEMEK S ADK

Dorit, R. L. et al.: Absence of polymorphism at the ZFY locus on the human Y


chromosome", Science 268, 1183-5 (1995).
Heyer, E.: Mitochondrial and nuclear genetic contribution of female founders to a
contemporary population in North-East Quebec", American Journal of Human
Genetics 56, 1450-5. old. (1995).
Jobling, M. A. s Tyler-Smith, C.: Fathers and sons - the Y chromosome and
human evolution", Trends in Genetics 11, 449-56. old. (1995).
Torroni, A. et al.: mtDA variation of aboriginal Siberians rcveals distinct genetic
affinities with native Americans", American Journal of Human Genetics 53,
591-608. old. (1992).
Wallace, D. C. s Torroni, A.: ,,American Indian prehistory as written in the mito
chondrial DNA: a review", Human Biology 64, 403-16. old. (1992).
Wolff, G. et al.: On the genenetics of mandibular prognathism: analysis of large
European noble families", Journal ofMedical Genetics 30, 112-16 (1993).
Wright, R.: Stolen Continents: The lndian Story, Pimlico, 1993.

III. FEJEZET: AZ ELVESZETT TRZSEK

Nvtelen: Beyond the Sambatyon: the Myth of the Ten Lost Tribes, The Nahum
Goldmann Museum of the Jewish Diaspora, 1991.
Bonn-Tamir, B. s Adam, A. szerk.: Genetic Diversity among Jews: Disease and
Markers at the DNA leve Oxford University Press, 1992.
Cohn-Shcrbok, L. s Cohn Sherbok, D.: A Short History of Judaism, Oneworld
Publications, 1994
Garlake, P. S.: Great Zimbabwe. Thames and Hudson & Stein and Day, 1973.
Kerem, E. et al.: Highly variable incidence of cystic fibrosis and different mutation
distribution among different Jewish ethnic groups in lsrael", Human Genetics
95, 193-7. old. 1995.
MacDonald, K.: A People that Shall Dwell Alone: Judaism as a Group Evolutionary
Strategy, Praeger, 1994
Parfitt, T.: Journey to the Vanished City: The Search for a Lost Tribe ofIsrael, Hodder
and Stoughton, 1992.
Risch, N., et al.: Genetic analysis of idiopathic torsion dystonia in Ashkcnazi Jews
and their rccent descent from a small founder population", Nature Genetics 9,
i52-9. old. (1995).
Ritte, U. et al.: The differences among Jewish communites - Maternal
and paternal contributions", Journal of Molecular Evolution 37, 435-40. old.
(1993).
Weingarten, M. A.: Changing Health and Changing Culture: The Yemenite ]ews ln
lsrael, Praeger, 1992.
A VRNKBEN VAN

IV. FEJEZET: A BR ALATT A LLEK

Altick, R. D.: The Shows ofLondon, The Belknap Press of Harvard University Press,
1978.
Deacon, H. J.: "Southem Africa and modern hurnan origins", Proceedings of the
Royal Sciety Series B: 337, 117-83. old. (1992).
Fraser, S. szerk.: The Bell Curve Wars: Race, Intelligence and the Future ofAmerica,
Basic Books, 1995.
Gaston, R. S. et al.: Racial equality in renal transplantation: the disparate impact
of HLA-based allocation'', Journal of the American Medical Association 270,
1352-6. old. (1993).
Hacker, A.: Two Nations: Black and White, Separate, Hostile, Unequal, Ballantine
Books, 1995.
Hill, H. Z.: The function of melanin: or six: blind people examine an elephant",
BioEssays 14, 49-56. old. (1992).
Jorde, L. B. et al.: Origins and affinities of modern hurnans: a comparison of
mitochondrial and nuclear genetic data", American Journal ofHuman Genetics
57, 523-38. old. (1995).
Lapping, B.: Apartheid: A History, Grafton, 1986, & Braziller, 1990.
Malik, K.: The Meaning of Race: Race, History and Culture in Western Society,
Macmillan Press & NYU Press, 1996.
Ortiz de Montellano, B.: Melanin, Afrocentricity and pseudoscience", Yearbook of
PhysicalAnthropology36, 31-58. old. (1993).
Robins, A. H. szerk.: Biological Perspectives on Human Pigmentation, Cambridge
University Press, 1991.

V. FEJEZET: EREDEND BN

Comings, D. E. et al.: The Dopamine D2 receptor locus as a modifying gene in


neuro-psychiatric disorders", Journal of the American Medical Association 266,
1793-1800. old. (1991).
Chen, Z.-I. et al.: Norrie disease and MAO genes: nearest neighbors'', Human
Molecular Genetics 4, 1729-37 old. (1995).
Cohn, N.: The Pursuit of the Millennium: Revolutionary Millenarians and Mystical
Anarchists ofthe Middle Ages, j. kiad. Pimlico, 1993
Craig, I.: Misbehaving monoamine oxidase gene", Current Biology 4, 175-7. old.
(1994).
Dreyfuss, R. C. s Nelkin, D.: The Jurisprudence of genetics", Vanderbilt Law
Review 45, 313-48. old. (1992).
Farrington, D. P.: Implications of criminal career research for the prevention of
offending", Journal ofAdolescence 13, 93-113. old. (1992).
McGuffin, P. et al.: Genetic basis of schizophrenia", Lancer346, 678-82. old. (1995).

288
TOVBBI OLVASMNYOK

Mullett, M.: Calvin, Routledge, 1989.


Silbersweig, D. A. et al.: A functional neuroanatomy of hallucinations in schizo
phrenia", Nature 378, 176-9. old. (1995).
Thomson, 0.: A History ofSin, Canongate, 1993.

VI. FEJEZET: HALL VAGY FELTMADS

Anatorakis, S. E. et al.: Molecular etiology of Factor Vlll deficiency in hemophilia


A", Human Mutation 5, 1-22. old. (1995).
Kim, N. W. et al.: Specific association ofhuman telomerase activity with immortal
cells and cancer", Science 266, 2011-2105. old. (1994).
Michod, R.: Eros and Evolution: A Natural Philvsophy of Sex, Addison-Wesley
/Longman, 1995.
Neel, J. V.: New approaches of evaluating the genetic effects of the atomic bombs",
American Journal of Human Genetics 57, 1263-6. old. (1995).
Noel, G.: Ena: Spain's English Queen, Constable, 1984.
Nowak, R.: Discovery of AT gene sparks offbiomedical research bonanza", Science
268, 1700-1. old. (1995).
Potts, D. M. s Potts, W. T.W.: Queen Victoria's Gene, Alan Sutton, 1995.
Putnam, F. W.: Hiroshima and Nagasaki revisited: The Atomic Bomb Casualty
Commission and the Radiation Effects Research Foundation", Perspectives in
Biology and Medicine 37, 515-45. old. (1994).
Ricklefs, R. E. s Finch, C. E.: Aging, a Natural History, Scientific American Books,
1995.
Wallace, D. C.: Mitochondrial DNA sequence variation in human evolution and
disease", Proceedings of the National Academy ofScience 91, 8739-46. old. (1994).
Zakian, V. A.: Telomeres: beginning to understand the end", Science 270, 1601-7.
old. (1995).

AJNLOTT MAGYAR NYELV OLVASMNYOK

Blint Andor: Az rkls s szrmazstan alapjai. 3. td. bv. kiads. Bp., 1974. Me
zgazdasgi Kiad, 391 p.
Bereczkei Tams: A gnektl a kultrig. Szociobiolgia s Trsadalomtudomny.
Bp., 1992. Cserpfalvi Knyvkiad, 247 p.
Berend Mihly: Genetikai ABC. Bp., 1980. Gondolat, 128 p.
Czeizel Endre: Az rtk bennnk van. Bp., 1984. Gondolat, 284 p.
Czeizel Endre: Az emberi rklds. 2. jav. kiad. Bp., 1983. Gondolat, 498 p.
Czeizel Endre: Csaldfa. Honnan jvnk, mik vagyunk, hov megynk? Bp., 1992.
Kossuth Knyvkiad, 206 p.
Czeizel Endre: Jvnk titkai. Bp., 1984. RTV-Minerva, 186 p.
A VRNKBEN VAN

Czeizel Endre: Az rtk mindig bennnk van. Bp 1994 Akadmiai Kiad, 391 p.
Czeizel Endre: Az rklds titkai. Bp., 1976. RTV-Minerva, 215 p.
Czeizel Endre: Genetika s trsadalom. Bp 1977 Magvet, 179 p.
Czeizel Endre: A magyarsg genetikja. Debrecen, 1990. Csokonai Kiadvllalat,
262p.
Czeizel Endre: Az eufnika: A genetikai megelzs j lehetsge. Bp 1996. Balassi,
229 p.
Csaba Gyrgy-Vrs Lszl: Ma s holnap. Bioszocilis meditcik az ember jelen-
rl s jvjrl. Bp 1975 Medicina, 160 p.
Csnyi Vilmos: Magatartsgenetika. Bp i977. Akadmiai Kiad, 173 p.
Genetika: Kislexikon. (Mohay Joln) Bp i986. Natura, 170 p.
Koller, P. C.: Kromoszmk s gnek. Az rklds biolgiai alapjai. Bp 197i. Medici
na, 178 p.
Sain Bla-Erdei Sra: Gnsebszet ( j korszak a molekulris biolgiban) Bp 1985.
Gondolat, 277 p.
Svb Jnos: A populcigenetika alapjai. Bp 1971. Mezgazdasgi Kiad, 191 p.
Szende Klmn: A gn nyomban. Bp 1977. Natura, 123 p.
Szende Klmn: Molekulk, gnek, rklds. 2. tdolg. bv. kiads. Bp 1972. Mez
gazdasgi Kiad, 406 p.
Szebernyi Jzsef: rtem-e a molekulris genetikt? Bp 1982. Natura, 302 p.

290
KPEK F ORRSA

Ajellt oldalakon tallhat kpeketaz albbi intzmnyek, gynkiigek s magnszemlyek bo


cstottk rendelkezsnkre: xi Wellcome lnstitue Library, London; xi Punch Magazine, xii The
Library, Academy of Natural Scicnces of Philadelphia; xv British Film Institute; 3 AKG Lon
don; 4 David South; 7 Bibliotheque de la Ville dc Colmar; 8 CNRl/SPL; 10 P. Motta pro
fesszor/Anatmia Tanszk, La Sapienza Egyetem, Rma/SPL; 11 mindkett6 Biophoto Asso
ciates/SPL; 15 Range/Bettmann; 16 Image Select; 18 AKG London; 19 Mendclianum, Brno; 21
SCR Photo Library; 22 fnt Oscar Miller professzor/SPL, lent Biophoto Associates/SPL; 23
Oxford Mocelular Biophisycs Laboratory/SPL; 26 balra Hulton Deutsch Collection, jobbra
NlH/SPL; 33 Alfred Pasieka/SPL: 34 balra Dennis Stephenson, jobbra Jane Burton/Bruce
Coleman Ltd.; 35 in: 1. Winship et al., Clinical Genetics 39, i991; 37 Zev Radovan, Jeruzslem;
39 Bodleian Library/Robert Harding Picture Library; 41 Museum Pomorskie, Gdansk/AKG
London; 44 Church of Jesus Christ of Latter-Day Saints. Hozzjrultak a kzlshez; 46 in:
William Ellsworth Smythe: The Conquest ofArid America, 1899; 47 Robert Harding Picture
Library; 48 Range/Bett mann; 50 Aneel K. Aggarwal & M. Newman; 55 British Library; 57 fnt
James King-Holmes/SPL, lent Kings College School of Medicine/SPL; 58 Yann Layme; 59
Church of Jesus Christ of Latter-Day Saints. Hozzjrultak a kzlshez; 61 Steve Jones; 63 The
Independent!Philip Mcech; 66 Steve Jones; 68 balra Hulton Deutsch Collection, jobbra
National Portrait Gallery; 69 The College of Arms; 73 Bibliotheque Municipale de Grenoble;
76 CNRI/SPL; 78-9 mind Petit Format/Nestl/ Steiner/SPL; 85 J. D. A. Delhanty, University
College London; 88-9 httrben H. Sander, Humngenetikai Intzet, Freiburgi Egyetem; 88
bels6 kp Phillips, lnternational Fine Art Auctioneers/Bridgeman Art Library, London; 89
bels6kp Museo Real Academia de Bellas Artes, Madrid/Index/Bridgeman Art Library, Lon
don; 91 Muse Cond, Chantilly/Bridgeman Art Library, London; 93 K. R. Porter/SPL; 96
Peter Newark's Western Arnericana; 97 Culvcr Pictures; 102-3 mind in: J. W. Taylor: Mono
graph of the Land & Freshwater Mollusca of the British Isles 1907 & 1914/University College
London; 105 Peter Newark's Western Arnericana; 106 Western History Collections, Univer
sity of Oklahoma Library; 108 in: John Underhill: Newesfrom America, 1638; 110 mindkett6
Mashantucket Pequot Tribal Nation Public Relations; u3 Steve Jones; n5 David South; 116
Magngyjtemny/Bridgeman Art Library, London; 121 Tessa Livingstone; 122 Associated
Press; 125 mindkett6 Museum ofWelsh Life; 128 Sonia Halliday Photographs; 129 Scala; 130-1
a kzlshez szves hozzjrulst adta Durham pspke s az anglikn egyhz bizottsga; 132
Colin Clark; 133 Garo Nalbandian/ASAP; 134 Giraudon; 137 British Museum, London; 138 in:

29 1
A VRNKBEN VAN

A. ]. Ferris: Great Britan & the USA: Revealed as the New Order, 194i. Zsid Nemzeti & Egye
temi Knyvtr/Beth Hatefutsoth Fotarchvum; 140 Yivo lnstitute for Jewish Research; 141
BBC Television; 143 Associated Press; 144 Zsid Nemzeti & Egyetemi Knyvtr/Beth Hate
futsoth Fotarchvum; 145 British Library; 146 Comstock; 148 National Archives of Zimbab
we; 149 Colin Clark; 155 Popperfoto; 162 Ashmolean Museum, Oxford; 164 in: A. Piazza: Who

are The Europeans?" Science


26, 1993, a szerz engedlyvel; 166 University of Cambridge
Committee for Aerial Photography; 169 British Museum, London; 170 Muse de l'Homme,
Prizs; 171 South African Library, Cape Town; 174-5 London Topographical Society; 179
Omikro/SPL; 181 SPL; 182 balra
Bemard Vandermeersch, jobbra
Vronique Barriel; 184 H. L.
Pierce Fund, rendelkezsnkre bocstotta a Museum of Fine Arts, Boston; 186 Steve Jones;
188 Fitzwilliam Museum, University of Cambridge/Bridgeman Art Library, London; 189
jobbra John Burbridge/SPL, balra
Astrid & Hanns-Frieder Michler/SPL; 191 Nancy Kedersha/
Immunogen/SPL; 193 balra
Leonard lee Rue/Bruce Colcman Ltd., jobbraJohnny Johnson/
Bruce Coleman Ltd; 194 Klaus Paysan; 195 Biophoto Associates/SPL; 200 f kp fontHugh
Fears, bels kpfntJohan Binnemann, kzpenjobbra
H. L. Deacon, lentjobbra
South Africa
Museum/H. L. Deacon; 202 Mary Evans Picture Library; 203 Steve Jones; 205 J. L. Dubin; 208
Charles Taylor; 210 Brown Brothers; 211 Chris Hale; 216 Visible Human Project, National
Library ofMedicine, USA; 218 i m ndke
tt Museo di Psichiatria e Antropologia Criminale, Tu
rin/Deutsches Hygiene-Museum, Drezda; 223 P. Thomas/Explorer; 225 Nemzeti Mzeum,
Stockholm/Bridgeman Art Library, London; 229 David South; 230 Alfred Pasieka/SPL; 232
Betlehem Royal Hospital Archives & Museum; 233 mindkettD.A.
Silbersweig MD & E. Stern
MD; P. M. Motta professzor & T. Fujita /SPL; 241 David South; 244 Muse d'Unterlinden,
Colmar/Bridgeman Art Library, London; 247 mindkett Bildarchiv Photo Marburg; 248 fnt
balra Dr. P. Marazzi/SPL, font jobbra BSIP/SPL, lent balra CNRI/SPL, lent jobbra Custom
Medical Stock Photo/SPL; 251 Biophoto Associates/SPL; 254 balra National Portrait Gallery,
London, jobbra Wallace Collection, London/Bridgeman Art Library, London; 255 fnt Forbes
Magazine Collection, New York/Bridgeman Art Library, London, lent Hulton Deutsch
Collection; 258 William Sturgis Bigelow Collection, rendelkezsnkre bocstotta a Museum
of Fine Arts, Boston; 259 Hulton Deutsch Collection; 260 Radiation Effects Research
Foundation, Hiroshima; 264 Howard Hughes Medical Tnstitute; 265 Mari-Wyn Barley; 267
David South; 271 Egyptian Museum, Cairo/Werner Forman Archive; 273 J. C. Revy/SPL,
balra
jobbra Secchi, Lecaque, Roussel, UCLAF, CNRl/SPL: 274 balra
BSIP PIR/SPL, jobbra
Steven
Sheriff, Bristol-Myers Squibb PHarmaceutical Research Institute; 276 P. Motta professzor/
Anatmia Tanszk, La Sapienza Egyetem, Rma/SPL; 278 National Medical Slide Bank; 279
balra Philippe Plailly/ Eurelios/SPL, jobbra
Aziz Sancar, University of North Carolina; 280
David Kipling, MRC Human Genetics Unit, Edinburgh.

Rvidts: SPL = Science Photo Library (Tudomnyos Fnykptr)

A HarperCollins kiad mindent elkvetett, hogy felkutasson s rtestsen minden jogtulajdo


nost. Ahol ez mgsem sikerlt, elnzst krnk az esetleges tvedsekrt vagy mulasztsokrt.

292
INDEX

A dlt betas oldalszmok az illusztrcikra vonatkoznak

A alabamai baptistk 40 antitestek 8, 9, to, 196, 274, 274


A biolgiai tudomny helyzete 21 Albi katedrlisa 224, 241, 242 antropolgia 126, 153, 159, 180, 205
A fajok eredete (Darwin) xvi, 13, 15 albigensek 223-4 apai gi 87
A londoni munksok s a londoni albinizmus 34, 194, 194, 196 apartheid 170, 199
szegnyek (Mayhew) 173 Alexandra crn 252 apokalipszis 38, 40, 80
A melatonin csodja 193 Alekszej crevics 252 l. mg Annageddon
A nemutek gazdagodsa (Smith) 123 Alfonz spanyol kirly, Xlll. 249-51, arabok 158
A szpsg elemzse ( Hogarth) 168, 253--6, 255 Aragniai Katalin 73
204 Alfonz, Asztria hercege 250, 253--6, arc, bnz 218
A teremts bzonytkai
i (Palcy) 17 255 Arimtiai Jzsef 136
abortusz xiv, 75 alkmia 16 arisztokrcia:
brahm 127, 128 alkoholizmus 25, 234, 235, 236-8, 239 mint faji vltozat 172, 177
Account o[Travels into the Jnterior of llampolgrsg 13 rklds 87, 90, 94-5, 98
Southem Africa (Barrow) 171 als nposztly xiii, 173-7 si 60-2, 87
akondroplzia 271 Alzheimer-kr 217, 269 rokonhzassgok 70
dm s l?.va x, 91, 91, 94, 222, 245, Amerikai Tuds Trsasg 74 Arisztotelsz n, 220, 221
257 American Examiner250 rjk 153
adztats 83, 86, 100 amerikai forradalom 86, 95 Armageddon x, 37-45, 37, 39, 41,
adrenalin 231, 235 amerikai fggetlensgi hbor 120 80-2, 129, 148
adventistk 45 Amerikai Jogszok Egyeslete 241 Arszino 74
afgnok 142 Arnmon Trvnye 173 Arthur herceg 73-4
Afrika 42 amyloidosis 67 Aston, Ted 113
albinizmus 194, 194 anatmia 168-70, 172, 202-3 aszexualils
elszigetelds 161 anatmiai mzeum, Prizs 168, 203 a gazdasgban 83--6
elvndorls 163 Anderson, Anna 268 a szaporodsban 83-7, 90, 99,
judaizmus 147, 157-9 Anglia: 102, 104, 277

mint az emberisg szlfldje adzs 86 az rkldsben 86-7, 95, 97-8,


182, 199-201 hzassgi trvnyek 11 120
vrcsoportok 179, 180 monarchia 94-5 s a gnek tadsa 90-4, 101
Y-kromoszmk 94, 158 rkls 87, 94-5. 98 asszimilci 160, 163
afrikai indinok 109, 120 zsidk 135-8 asszrok 37, 38, 129, 140
afrikai szvetsg 202 angolkr 195, 195 atavizmus 15, 16, 36, 218
agresszi 213, 231 antignek 9, 180, 181, 274 ataxia telangiectasia 278
Agudah vallsi prt 135 antinomista eretneksg 227, 240 atombomba 40, 78, 258
agy 196, 197, 216, 219, 233, 269 antiszemitizmus 134, 160 Attakullakulla 95--6, 117
AIDS 181, 188 antiswcilis viselkeds 208, 231-2, ttrs, vallsi 43, 127, 139, 154-6, 157,
Akihito csszr 59 236, 238-40 159

293
A VRNKBEN VAN

Attucks, Crispus 120 Bogumilok Chilmark 30,32


autizmus 238 Bolyg Zsid 134 Chmielnicki 152
autonmia 214, 222 Booth, Charles 173-6, 174-5 Churchill, )ennie 17
Az amerikai indinok. . . (Noah) Bourbonok 24<)-50, 257 Churchill, Randolph 27
148 Bourdcl, Leon 5 Churchill, Winston 16, 127
Az Atombomba Sebesltjeinek Boxgrove-i sember xv Cicero 246
Bizottsga 260-1 Boyle, Robert 6 cmek 87-90, 94, 98
az egyn pratlan mivolta 9, 49 br 189 Cincinnati Trsasg 95, 96
Az ember szrmazsa (Darwin) xii brtltets 181 cionizmus 143
Az utols mohikn (Cooper) 112, 113 brrk 191, 192-4, 194 ciszts fibrzis 65-6, 141, 153, 157,
azonossg: brszn: 165
szrmazs rvn 63-4, 68, 70, 77 s faj 172 ciszts petefszek 84
aztkok 149 s gazdagsg 177-8 Claudius csszr 134
s intelligencia 183-7, 197 Colbert, Jean Baptiste 83
B s trsadalmi osztly 177-8 Collins, John 107
Baartman, Saartje 201-4, 202, 203 s vrmrsklet 190-2 Connecticut 107, 109
Babilon 38, 40, 129, 132 /. mg. faj Conrad, joseph 15
Bagdad 40 Brazlia 79 Cooper, James Fenimore 112, 113
Bagehot, Walter 70 brit birodalom 171 Correa, Domingo Faustino 87
Baker, John 126-7 Broca, Paul 170, 177, 206 Courd'Alen-i indinok u1
balfouri nyilatkozat 139 Brooke, Charles tiszteletes 74 clibtus 72, 104, 224, 245
Barrow, John 170 Brown, William 28-9 Crockett, Davy 106
Bassett-csald 87-90, 94 Bucephalus 16 Cromwell, Oliver 80, 138
Bates, Carol 187 Buckland, William xiv Crust csald 63, 63, 64, 72, 90
Bateson, WiUiam xiii Buffalo Bill 113 cukorbetegsg 126, 234
Bcda Venerabilis 126 Buffalo Child Long Lance cumberlandi Lowthersek 98
Bell Curve, The (Herrnstein & tnsfnk 113 Curie, Marie 261
Murray) xiii, 177 Burlington House xvi Cuvier (anatmus) 203
Bell, Alexander Graham 30, 32 burmaiak 142
Ben-Zvi, Yitzhak 142 brok 170 cs
Bene lsrael 142 Butler-trvny xv csald:
Benin-bronzszobrok 126 bGn 221-6, 228, 242 diszfunkcionlis 134
bennszlttek 190 bnzs 207-20, 22S-30, 239 s bnzs 10S-12
Bcntham, Jeremy 207 bnz gn 209, 218, 219-21, 22<)-30, csaldfa 28-j), 47, 55, 59-65, 68, 81, 87,
Bermudk 108, 121 232, 236, 138, 242 88-9
Bernardine, Threse 169 bnz osztlyok 173-6 az emberisg 126, 182
betegsg xiv, 9, 15, 48 Byron, Lord 52 irodalmi 246
/. mg: genetikai betegsg mormonok s 43, 47
Bevndorlsi s llampolgrsgi e nemzeti 127, 139
Trvny (1971) 13-14 Cahokia 44-45 nyelvi 161
Biblia vii, viii, xv, 3, 11, 37, 38, 43, 80, Caithness, Lord 100 zsid 150, 153
124, 136, 243 Camberwell 209-12, 239 Csernobil 40
Billie, Jamc 109 Cameron, Alexander 117 cseroki indinok 95-7, 96, 105-6, 105,
biolgia vi
ii, x, xiii, 4, 12, 24, 62 Centre des tudes des 112) 117, 121
s bGnzs 212, 219 Polymorphismes Humaines csigk 102-3
s faj 170 48-9 csraplazma 243, 245, 249
s osztlyhelyzet 1n. 176-7 Cervantes, Miguel de 83 cskkentett felelssg 114-15
Biological Fact and the Structure of Ceylon 59
Society (Bateson) xiii Characters of Worldly Young Men D
Blakc, William 135, 137, 139, 168 (Kiseki) 24 D-vitamin 195, 195
Blood (Vr) 11 Charlotte mexiki csszrn 257 dakota n
i dinok 111
Bockelson, John 127, 230, 240 Chauncy csald 136 Dniel38

294
INDEX

Darwin, Charles x, xi, xii, xvi, 11-15, Egyni Tulajdon Trvnye 96, 112 rtekezs az emberifaj sket
27' 34, 68, 182 egyenlsg 15, 87, 97 vltozatnak kialakulsrl (Bell)
a hasznlat s nemhasznlat'' egyenlsgre trekvs 96, 201 30
trvnye 12-13, 17, 24 egyenltlensg 86, 95, 98, 99 Erzsbet kirlyn, 1. 108
Dvid kirly 38, 81, 82, 128 Egyeslt llamok 74, 160 Erzsbet kirlyn, II. 81, 82, 95
Dawes, Henry L. 96, 97, 105, 123 als nposztly 176-7 eugenika vii, ix
De Libero Arbitrio (Pelagius) 221 benpestse 43-4, 114-15 Eugenikai Trsasg 252
Dl-Afrika 170-1, 172, 199-201 bnzs 213, 213, 236, 240 eurpai genetikai smk 164-5
dl-amerikai indinok 138, 147 s Armageddon 38-40 va 4, 46, 93, 94, 257
delawarc indinok 97 s az elveszett trzsek 147-8 evolci x, xi, xiv, xv, 13, i5, 38, 101,
demokrcia 95 feketk 14, 177-8, 185, 197 246, 249
dmoni megszllottsg 220, 232 gazdagsg 99-100, 177 a szervezeten bell 9, 173-4
depresszi 230, 231, 238 gazdasgi rendszer 86, 95-7, s erszak 212
Derbyshire 30, 31 104-5 faji 182, 184-5, 187, 195
Descartes, Ren 206 hallbntets 208, 210-ll vsl,lk-rtkenysgi depresszi
determinizmus 214, 225 jogrendszer 215-16 193
Devonshire hercege 98 szerencsejtkok 107 Ezkiel 38
Diana hercegn 63 1. mg indinok
diaszpra 127-38, 156, 160 Egyeslt Nemzetek !19 F
Dibblc, Philo 148 egyetemes s 94 fagys 196
Dickens, Charles 98 Egyiptom, si 74, 185, 186, 188, 271 faji besorols 119
Disraeli, Benjamin 160 lesztgombk 161 faji higinia 21
DNS (lemezlovas) 186-7, 186 letkor: fajkutats 169, 199, 201, 203, 206
DNS viii, xii, 8, q, 22, 22-3, 27, 219, regeds 24, 193, 266, 267-9, 280 fajok:
246, 261, 265, 267, 272 regkor 246, 248-9, 268-70, 272, s intelligencia 172, 183-7, 197-9.
Emberi Gnllomny Program 276,281 205
48, 126 szli 269-70, 271, 275 s osztlyok 172-3, 177-8
kijavts xii, 176-9 elkorcsosuls: s vr viii, 13-14, !17-18, 180
kivgs 50, 52, 57 s aszexualits 101 fajtipolgia 170, 172, 203, 204
sokflesge 10, 116 fizikai 243, 246-9, 267-9, 281 genetikai eltrsek 180, 183
ujjlenyomat 219, 265-6, 272 morlis 24-6, 30, 262 hierarchijuk xiv, 172, 177-8,
l. mg. gnek feltrkpezse Ellal, Martha Langevin 109, 120 204-5
dogonok 188 elmebaj 215-16,220 trtnelmk 182, 184-5
Domesday Book 90 elmebetegsg 215-20, 228, 232-6, 239 fajvdelem 177
dominns gnek 18-19, 28 elszigeteltsg 162 Faust (Goethe) 3-4, 3, 36, 281
Don Juan (Byron) 52 elveszett trzsek 126, 129, 135-6, FBI 117
Don Quijote (Cervantes) 83 139-49, 144, 158, 162, 163 fehr faj:
dopamin 238, 239 emberbartsg 123 genetikai felsbbrendsge
Dor Yeshorim 77, 141 Emberi Gnllomny Program 48, 170-2, 178, 183-4
Down -kr 217 126 genetikai fennmaradsa 187
Downing, Sir George 32 emberisg xiv, 178 melanista szemllete 185-7
druidk 124-6, 135, 167 emlrk 51-4, 56-7, 234. 278-9 fehrjk 10, 22, 263-5, 276
Duffy-vrcsoportrendszer 179-80 Ena spanyol kirlyn 249-57 fekete faj:
enzimek 9, 153, 157, 229, 231, 235, 236, amerikai 14-15, 177-8
E 281-2 a feketk felsbbrendsge 185-7,
ecetmuslica 20, 51, 84, 245 rdemtelen szegnyek 172-7 196
Edison, Thomas 210-11 eredend bn x, 222, 224, 242 s intelligencia 183-7, 197-8
Edward kenti herceg 45, 254, 255, eretneksg 223-4, 227, 242 Fekete Herceg 62
269, 272 erszakos bncselekmnyek 208, Fekete Jvorszarvas 112
Edward kirly, 1. 136 212-13 felelssgre vonhatsg 214, 221
Edward kirly, Ill. 62, 63-4 frtekezs afizikai s erklcsi felhguls, rkls s 14
ghajlat s szaporods 104 elkorcsosulsrl 31 feltmads x, 43, 243, 244, 247, 272

295
A VRNKBEN VAN

feltrkpezs I. gnek feltrkpezse a zsidknl 56, 74-7, 127, 141, hallucincik 233
fenilketonuria 159 151-3, 157, 159 halottak megkeresztelse 43, 54-5
frfi rksk 87-90, 98 ciszts fibrzis 65-6, 152-3, hamvaszts 124, 125
frfi: 157, 165 hanik59
evolcija 183 elmebetegsg 235 Hartfordi Egyezmny 108
genetikai egyntetsg 183 s bnzs 220 Harvey, William ll
legkorbbi 199-201 s DNS-kijavts 278-9 hast enzimek 50, 50, 52
fertzs 9, 25 Finnorszgban 64-s, 67 hatalom 86, 95
Fertz Betegsgek Trvnye (1864) hemofllia 9, 53, 249-56, 251 hawaiak 112
26 mitokondrilis betegsg 93, 268 Ha}'\vard, Richard 109, 110, 120
figyelemhinyos hiperaktivitsi nemisggel kapcsolatos 252, 255 hzassg:
rendellenessg 23S-40 rk 48, 51-4, 56-7, 264 Japnban 266, 270
Finnorszg 64-5, 67 sketsg 12, 29, 31-6 mormon 46-7, 78
fizikai lepls 243, 246-jl, 267-9, szvbetegsg 228-9 rokonhzassgok 6S-75,
281 Tay-Sachs-kr75-7 trvnyek u, 27, 72-4, 73
Foxwoods 107, 109-10, 110 torzis disztnia 151-2, 159 vegyeshzassgok m, 117, 118,
fldmvels 163-j, 162, 166 genetikai hibk 10, 80, 246-7, 277 120, 153, 157, 159, 160
Fvrosi Angol-Izraeli Trsasg genetikai program 24 hzatlan csigk 103, 104, 245
136 genetikai szrs xiii, 75-7 Hebron 128
Fracastoro, Girolamo 25 genetikai tvolsg 153 hemofilia 9, 53, 249-56, 251, 270
Franciaorszg 70-1, 71, 79, 160, 182 Genf 226 hemoglobin 8, 8, 141
Franklin, Benjamin 118 gnterpia xii Henrik, Vlll. 73-4
Freud, Sigmund 5, 74 Gergely ppa 72 here 273
fl33 Gerizim-hegy 132, 133 hermafroditizmus 18, 104
germn npek 154 Herrnstein, Richard 177
G Glastonbury 136 Hertrog, James 172
Gallon, Francis 68 Glin lovag 90 Hesketh-csald 55
Gates, Bill 100 Gobincau, Joscph Arthur de, grf Heyerdahl, Thor 126, 159
gazdasg 83-6, 100-1, 122 169-70, 172, 206 hinyz lncszem 171, 201
gnllomny 52-53 Goethe, Johann Wolfgang von 3-4, Hiawatha (Longfellow) 112
Program 48, 126 ll, J6, 281 Hirohito csszr 257
genealgia 60-3, 82 Gogol, Nyikolaj 54 Hirosima 78, 258-66, 259, 270-2
mormon 58-60 Goldstein, Baruch 128 Hitler, Adolf 24, 153
gnek feltrkpezse 34, 43, 53. gonosz 220, 221-2 "hobbiindin" mozgalom 113
126, 153, 159, 165 Gonzalo herceg 253 Hdt Vilmos 61-2, 87-90
gnek vii, x, 4, 5, 12, 24, 34 Hogarth, William 95, 168, 205
aszexulis trkts 90-2, 101 GY Hogg, James 227-8
s az elmebetegsg 219-20 gyerekek: antiszocilis viselkeds holland szrmazs dl-afrikaiak
s kzs sk 64 23S-40 172, 199
s npessg genetika 159 gyermekhalandsg 78-9 holocaust 129, 160, 167
s rklds 12, 16-19 gyilkossg 207-8, 212-13, 213, Holt lelkek (Gogol) 54
fennmaradsuk 246-7 215-16 homoszexulits x-xi
mint sors 177-8 hormonok 10, 31, 84, 212-13
mint rszecskk 16-17, 27, 28 H Hottentotta Kdex 171
genetika viii, x-xii, xiv, 9-10, 12, 16, hbor 214 hottentottk 170-2, 171, 201-2
83, 237 Hbor s bke (Tolsztoj) 80 hmrsklet 190-2
mormon47-8 Habsburgok 88-9 Hruscsov, Nyikita 24
szovjet 17-24 Haggard, Rider 145 Huckleberry Finn (Twain) 60-1
genetikai betegsgek viii, xiii. 27, hall 248 Huntington-kr 220-1, 228, 271
28-9, 48, 51, 53, 64, 70, 219, 228-9, s megjuls 243, 246, 249 Hurlbut, Philastus 45
229, 231 hallbntets 20S-u Huszein, Szaddm 40
Alzheimer-kr 217 halls 196 Huxley, julian 20
INDEX

Jnos pap 145, 145 kJnok72-3


ibolyntli fny 191, 192-4 Japn 4, 59, 79, 142-3, 198 K.lasies foly 199-201
identits: hzassg 266, 270 Knox, John 226
indin 111-21 Hiroshima 258-66 Kofitacsikvi hlgye 95
nemzeti 13-14 teremtsmtosz 257, 258 kokainfggsg 238
zsid 139-40 Jefferson, Thomas 117 kopaszsg 84
ideolgia 17-20 Jeffries, Lconard 186 kormny 86
ikrek 49, 104, 230, 234, 281 jemeni zsidk 156 krnyezet:
Ilisz207 Jeruzslem (Blake) 135, 137 s betegsgek 30-3, 229, 234
immunrendszer 9, 180-1, 261, 273, Jzus Krisztus 44, 54, 244 s bnzs 207-220, 228-30, 239
274 Jzus msodik eljvetele 135-6, 149 s rkls 17-20, 27, 101
lnce ppa, 111.222 j s rossz 4, 209, 214, 222 s intelligenciahnyados 198
Ince ppa, Vlll. 6 jd 31, J6 krlmetls 5, 9, 17, 250
lndia 77,79, 177, 214 Joseph Ekstein rabbi 75-7, 141, 141 kszvny 25
Indin Npmvszet Fejlesztsi Juds rabbi 9 Kzel-Keleti Kutatkzpont 149
Trvny 118 Jdeai Kirlysg 129, 140 Kzp-Kelct'6, 161-3
Indin gyek Hivatala 106 judaizmus /. zsidk kzs szrmazs 42, 62-8, 82, 94

K
indinok 105-6, 105-6, 154 kzssgen kvli hzassgok 72, 77
alkoholizmus 236 kromoszmk xi, 17, 22, 27, 263, 280,
identitstudat 111-21 kbtszerek 197, 234, 238, 239 281
intelligenciahnyados 198 Klvin Jnos 225-7, 225, 236, 240 /. mg: X-kromoszma;
nyilvntartsi rendszer 113, 118 kapitalizmus 86, 99, 100, 104-5 Y-kromoszma
szrmazs 43-4, 114, 116, 147-8 kapzsisg 105, i 23 kultra 126, 140, 158
szerencsejtkok 106-7, 109-11, Kroly herceg 62, 63
121-2 Kroly nmet-rmai csszr, V. 88, L
swcializmus 75-7, 105-6, 111, 89 Laosz 214
120 kaszink 107, 109-11, 121-2 Lapua 65
individualizmus 96 kasztrendszer 177 lts 196
indoeurpai nyelvek 161, 162 katharok 223-4, 223, 241-2 latens gnek 18-20, 28, 32, 65
inkvizci 20, 155, 224 Kauhajoki 65 legs 192
intelligencia xi kazrok 155 Lehi prfta 43, 44
s faj 172, 183-7, 197-9, 205 Kelet-Eurpa 60, 66 llek 243
s osztlyhelyzet 198 keltk 124, 167 lembk 147, 149, 156, 157-9, 163
s rklds 198 Kemmlcr, William 210-11 Lemkin, Raphael 119
IQ-tesztek 177, 197-9 Kennedy, John F. 80 Lengyelorszg 150, 152, 160
invzi 126, 153, 159 keresztnysg 257 Lenin Ossz-szvetsgi
!rorszg 192 a vr szimbolikja 5-6, 7 Mezgazdasgtudomnyi
Isten x, xvi, 17, 222, 224-5, 236, 245 ldozs 5,7 Akadmia21
iszlm 156, 158 ttrs 43, 139, 155 Leopold, Albany hercege 251-2, 255
ltasca-t 61 szabad akarat s bn 221-3 leszrmazs /. csaldfa
tletnap /. utols tlet utols itlet 42-3 Lesznek zsid unokink? 159
Izrael llam 127, 132-3, 135, 155, 166-7 ktdimenzis elektroforzis 263 leukmia 48, 262, 264
llampolgrsg 139 Ketzalcoatl 44 levltetvek 100
megalaptsa 138-9, 143 kevereds 157, 160 Linn 172
Visszatrs Trvnye 132, 139, kicserldsi hipotzis 126, 159 Linn Trsasg x, xvi
142-3 kimberek 126 Liszcnko, Trofim Gyenyiszovics
Izraeli Kirlysg x, 37-8 Kna xiv, 58, 60 20-4,21
King, Martin Luther 120 Lloyd George, David 139
kirlyi szemlyek /. monarchia Lloyd of Stockton csald 69
Jakub 187 Kiszeki, Ej ima 24 Lombroso, Cesare 218
Jnos jvendlsei 38 Kitchener fhadnagy 139 londoni nagy tzvsz 39
Jnos Pl ppa, II. xiv kiterjedt csald 62, 66, 67, 127, 157 Longfellow, HenryW. 112

297
A V RNKBEN VAN

Lordok Hza 95, 98 moheganok 108, 109 nedvek /. testnedvek


lfegyverek ellenrzse 213 monarchia 62-4, 95, 24g-57, 268-70 nemek 84-5
Luther Mrton 224 mono-amino-oxidz 229, 230, 231, ideolgija 245
235, 236, 240 nemessg /. arisztokrcia
M monoplium 104-5 Nmetorszg 24,74, 113, 119, 152, 159
M'Naghten, Daniel 215-16 Montaigne, Michel de 95 nemzeti lt viii, 13-14, 117-18, 126-7,
Mackay kln 72-3 Montsgur 223, 224 13g-40, 158
magzat 11, 31, 84 Morgan, David 60, 61 npcsoport-diffzi 160
majk 149 mormonok 43-59, 44, 48, 55, 78 npessg genetika 159
Major, John 63, 72, 90, 100 s az elveszett trzsek 148-50 Nefi knyve 148
makujo szekta 142 levltr 58-60, 59, 64 npirts 118-119
malria 141, 179 A mormonizmus leleplezse npvndorls 126, 159, 160, 164, 167
manicheusok 223 (Hurlbut) 45 ncuromelanin 197
Martha's Vineyard 30-3 Morral, Mateo 250 New Harmony, Jndiana 45
marxizmus 17, 20 Mountbatten grfn 117 New York-i City College 186
Masala, William mani tiszteletes 149 Mzes 74, 158 Newton, Sir lsaac 80
Mashantucket 107, 108 Mzes msodik knyve 128 Nlus foly 61
msolatok 246 Muller, H. ). 262 Noah, Mordcchai Manuel 148
Mathiva, M. professzor 149 munksosztly mint faji vltozat normalits 237
May, Karl 113 172-3 nosztratikus nyelvek 161-3
McDonald, John u7 munksprt, brit 135 nk s romls 245, 257, 266, 272, 277
megfiatal ts 6, 282 Murray, Charles xiii, 177
Megi ddo 37-8, 37, 40, 42, 82, 129 Muse de l'Homme, Prizs 203-5, NY
megvlts 43, 223-4, 226-7 203, 205 nyelv 161-3
melanin 34, 185, 188-97 Musschenbroek, Pieter van 210 nyiroksejtek 8, 9, 274, 274
melanin mozgalom 184, 185-7, 188, mutci 9, 27, 67,219, 250, 252
196 s regkor 246-7, 249, 270, 282 0
Melanin, a feketk nagysgnak s sejtosztds 264, 267-9, 273. Oklahoma 116
kmiai kulcsa (Bates) 185-7 281 Okonosztota 117
melanocitk 188-90 s sugr1.s 259, 262-6, 272 ondsejtek 11, 17
melanma 191 nemisg s 272-7, 280 Orkney pspke 72
melatonin 193 Mnster 227 osztly xiii, 24, 206
Melius, Joe 121 Mwene Mutapa 147 s biolgiai rdem 172-6
Menasseh ben lsrael 136 mystici csata 107, 108, 120 s intelligencia 198
Mendei, Gregor 16-19, 18, 24, 27, s szn 177-8
28-9. 32-3, 243 N korl<!ti>k 176-7
messis 38, 45, 135, 136-8 Nablus 132 osztrk rksdsi hbor 89
Mijadzsima 143 nacionalizmus xiv Owen , Robert 45, 269
Mikls cr, ll. 252, 268, 270 ncizmus vii, 113, 186, 223, 232
Miksa csszr, 1. 89, 89 Nagaszaki 78, 262, 270
Miksa mexiki csszr 257 Nagy-Britannia 45, 86, 99, 160 nrdek 104-5, 122-3
millenriusok 40, 138 llampolgrsgi trvnyek 13-14 rkhagys 83, 105
Millenial Star 45 brit izraelitk 135-8, lJ8 s gazdagsg 99-100
mirigyek 10 bnzs 213, 213, 216, 239 s jraeloszts 98-9
Mississippi foly 61 feketk 198 frfi gon 87-90, 94, 98
mitokondrilis va 94 hzassg 74 szexulis kontra aszexulis 83-7,
mitokondrium 90-4, 93, 114. 117, 167, rokonhzassgok 72, 78-9 97-9
268-9 Nagy-Zimbabwe 145-7, 146, 148-g, rklds xiii, 16-17, 24, 83
betegsgek 93, 268 157 bnzsi 209-12, 236, 238
Moblcy, Stephen 207-9, 208, 240 narraganscttck 108, 111 Darwin s 12-13
Mohamed 62, 156 Nauvoo45 s bnzs 29
mohawk indinok 121-2 Neander-vlgyi emberek 182 s gnek 12, 16-18
INDEX

s intelligencia 198 Polo, Marco 30 Salt Lake City 45, 47, 60


s krnyezet 17-20, 27, 101, 198 Portuglia 155 Szamria 38, 140
s nedvek 13-16 pozitronemisszis tomogrfia 233 S?ambation foly 140-2
genetikai 1. trkts predesztinci 225-6, 228, 229, 240 Sana'a 147, 156, 158
keveredsi elmlet 11, 12-16, 18, Price, Dr. William 124, 125, 136, 159, Sargon 38
26 167 Saul 243
pnzgyi 1. hagyomnyozs programozott sejthall 281 Sayuna 158
tvkpzetek 12-13 protestantizmus 224-6 Schneerson rabbi 75
vr s 9, 11-13, 17, 24-5 Ptolemaiosz, II. 74 Schubert, Franz 113
rkltt betegsgek 12, 25-6, 243 Punch xi Sconc-k 136
1. mg: genetikai betegsgek puritnok 136 Scopes, John T. xv
rksdsi ad 86 Pthagorasz 11, 12 sejt 28
sk 59, 80, 83, 90, 126, 243 elhals 280-2
a judaizmusban 127, 140, 150-7 Q mutci 264, 267-9, 273. 281
a mormon vallsban 43, 45-6, Qubec92 termszetes kivlasztds 273-4
54-62 Quinlan Evanglikus Baromtere Shaftcsbury, Lord 139
s az Utols ltlet 38, 40-2 226 Sienai Szt. Katalin 6
s nemzetfogalom 158 skizofrnia 228, 232-5, 232
kzs 42, 62-8, 82, 94 R Skcia 72-3, 87, 225-6
nemesi 60-2, 87 rabszolgasg 14, 171 Smith, Adam 101, 123
sokszorozds 42 rk 48, 56, 84, 193, 261, 262-4, 269, Smith, John szzados 117
Ossz-szvetsgi Genetikai 276, 278-9. 280, 282 Smith, Joseph 43-5, 54, 148-9
s Kivlasztsi Kutatintzet 20 1. mg: emlrk, brrk sokflesg 9-IO, 49, 50, 123, 153, 237-8
sszehzasods: Rashi rabbi 150 Somers Town 174-5, 176
indinok 109, 117, 118, 120 Reagan, Ronald 80 sors xiii, xii, 4, 5
zsidk 154, 157, 159-60 reformci 74, 224-5 Spanyolorszg 154, 1 55-6, 177
rekombinci 49, 51, 83, 89, 99, 101, monarchia 249-56, 255
p 102-3, 118, 120, 152, 277 Spekc, John 61
Paine, Tom 86 Rhodes, Cecil 145-6 Spes lsraeli (Menasseh ben lsracl)
Paisley, lan tiszteletes 226 Richelieu bboros 92 136
pajzsmirigy 10.31 Riebeeck, Jan van 170 spiritualizmus 45
pakisztniak, brit 78-9 RNS 22, 22 Squannit any 1 1 1
Pl, Szt. 54, 282 rokonhzassgok 32, 68, 69, 70-2, 71, steril izci 30
Palesltina 129, 134, 139 74, 77-9. 133 stigmk 6
Paley, William 17 rokonsg viii, xiii, 42-3, 48, 51, 64, 83 Sugrhats Kutatsi Alaptvny 260,
Ppua j-Guinea 167 s hzassg 68-75, 73, 77-9. 99, 263 261-3, 272
Parkinson-kr 197, 269 kzs szrmazs 62-8, 82, 94 sugrzs 261-7, 270-2
Ptrirkk srja 128 Rolfc, John 117 Summer, Daniel 208
pavil.in<li vrfo hlgy xv rmai katolicizmus 72, 155-6, 224, sketsg 12, 26-36, 196
Peel, Sir Roben 215 241-2 Svjqo, 31,32
Pelagius 221-2 rmaiak 5, 72, 129-35. 129 Symmes szzados 149
Pepys, Samuel 32 Romanovok 252
pequotok 107-11, io8, 118, 119, 121 Roosevelt, Theodore 112 sz
petefszek 273 Rosh Ha'ayin 156 szabad akarat viii, 36, 209, 214, 221-2,
Philadelphia-kromoszma 264, 264 Ross, John 117 226, 236, 240, 242
Pitts, Fountain 38 Rothschild csald 99, 104 szahad gykk 192, 193. i96
Pliniu, az idfebb 140 rntgensugrzs 261-2 szabadpiac 101
Plouffc, Elizabeth George 108, 120 szamaritnusok 132-3, 135, 150
Pocahontas 116, 117 s szaporods 83-7, 90, 99, 102-3, 104,
pogromok 5, 152 Saguenay 92-4 243-5
polgrsg mint faji vltozat 172 Salamon kirly 38, 156, 158 szegnysg 78, 99, 212, 242
politika 83, 86, 95, 104, 135 Salamon kirly kit1cse (Haggard) 145 szegregci 20

299
A VRNKBEN VAN

Szemlyi Tulajdon Trvny 117 trsadalmi normk 237 jraeloszts 83, 98-9, 101
szemlyisg 5, 172 trsadalom viii, xiii, xv, 20 Ulster 225-6
szeminolk 109 s bnzs 212, 213, 218, 219, Underhill, John szzados 108
szenvedlybetegsg 237-8 220,242 unokatestvr-hzassgok 68-9, 74,
Szp remnyek (Dickens) 98 Tay-Sachs-kr 75-7, 76,78--9, 141 77-9> 99, 263
szpsg 204, 205 Taylor, Charles 208 Ushcr-szindrma 35, 53
szerencsejtk 106-7, 109-u, 121-2 Tel-Aviv 140 Utah 46-8, 46, 54
Szerencss Leif 114 Tellez, Ballhazar 194 utahi egyetem 47, 54
szerotonin 230, 231 telomrk 281-2 Utahi Npessg Adatbzisa 47-8
szervtltets 180, 181, 183 Tenna 252 utols tlet x, 38-43, 41, 82, 124, 224,
szerzett tulajdonsgok 16-17, 20-1, teolgia 221-2, 240 241
21, 24, 30, 36 teremtsmiloszok 257, 258
szexulis S7porods 40, 90, 99, 222, Terz, vilai Szt. 245
245-t termszetes kivlasztds x, 38, zenet, genetikai 16, 18, 22, 24, 27,
s evolci 101 273-4 243, 246, 249, 268, 275-7
s melatonin 193 test rja 193
s mutci 272-7, 280, 281 testnedvek 11-17 v
fajok kzti 187 tesztoszteron 213 vagyon 24, 95, 99-101
mjnt gazdasgi problma 83-7 Thatcher, A. R. 42 s aszexualits 86-7, 97-8
Szibria u4-16 Thatcher, Margaret 63, 64, 72, 90 s brszn 177-8,
szifilisz 25-6, 26, 36, 224, 250 The Private memoirs and Confessions jraelosztsa 83, 86, 98-9
szv 248 ofa Justified Sinner (Hogg) 227-8 valls viii-x, xviii, 5
szvbetegsgek 228-9, 234. 269 Thba 59 a n 245, 257
szkiwfrnia 228, 232--s, 232 Tiglat Pils7.r kirly, III. 38 a vr szimbolikja 5-6
swcializmus 86, 95, 97, 99 Titus-djadaliv 129 ttrs 139, 154-5, 157, 159
az indinok kzt 95-7, 111, 120 TLC-gn 282 s feltmads 243
Szkratsz 218, 245 tobozmirigy 187, 193 s nemisg 245
szrna 243 Tocqueville, Alexis de 178 s szabad akarat 221-2
Swvjetuni 17-24 Tolsztoj, Lev 80 teremtsmtoswk 257
szvetegyeztets 180--1, 183 torzis disztnia 151-3, 151, 160 Varzssznyeg Hadmvelet 155
szvetsgi indin igazolvny LL3, 118 Toulouse-Lautrec, Herui de 70, 70 vrhat lellartam 247-8, 249, 281
Szt. goston 27, 72, 222 Tourette-szindrma 239 vgrendeletek 100
Sztlin, Joszif 20, 21 tbbalaksg 49 velcszletell betegsg 25-6
szteatopigia 202 tbbnejsg 45-6, 48, 154, 227 vr 7-LL
sztoicizmus 214, 222 Trkorszg 154 s nemzeti hovatartozs 13-14,
szlhely 13-14 trpesg 70, 271 JJ7-18
szlk kora 269-70, 271, 275 trtnelem xiv, 126, 159 s rklds 9, 11-13, 17, 24--5,
szlk szrse xiii faji 182, 184--s 27
Szmpozion (Szkratsz) 245 trvnyhozs 214-21, 225, 227, kevereds 11, 12-16, 26
228-30, 236-8,?40,242 mint az emberi lt esszencija
T trzsi npek 126 viii, 5, 8
T-sejtek t81 tudomny ix, xv-xvii, 4, 5, 12, 27, 36 szennyezds 24-6
Tacitus 154. 246 tudomnyos fajelmlet 170, 199, 201, szin1bolikja 3-6, 3, 7
Talmud30 203, 206 vrtmleszts 6, 9, 11, 256
Tamil Nadu 77 Turkesztn 30 vrcsoportok 7, 9-10, JJ, 116, 153, 157

s faj 179, 180


Tammany Trsasg 97 Twain, Mark 61 Duffy-rendszer l79-l8o
Tamy, Thomas 136
Tanulmny az afrikai-amerikai u s szemlyisgjegyek 4, 5
alapokrl 187 j-Gumea 31, 42 vrfertzs 11, 68, 74
Tanulmnyok afajok jts 101 vrhnyad 113, 117-19
egyenltlensgrl (Gobineau) 172 jkori szentek egyhza vrsejtek 7-9, 8, 219
trsadalmi helyzet l. osztly L: mormonok versengs 100, 101, 104--s, 109, 123

300
INDEX

Victoire leiningeni hercegn 269 Weizmann, Chaim 139 zs


Viktria kirlyn xiv, 112, 215, 249, Wells, H. G. 25 zsid hsvt 132
251, 252, 254, 255-7, 269-70, 272 Welsing, Frances Cress 188 Zsid gynksg 156
Viktria Eugnia hercegn Wcstinghouse, George 210-11 zsidk 5, 9. 17, 127, 186
1. Ena spanyol kirlyn WheweU, William xvi Angliban 135-8
Viktria korabeli faji s1,emllet 172 Wills csald 101-2 askenzik 56, 75, 141, 150-5
villamosszk 208, 210-11 Winnat-hg 104 ttrs 127, 139, 154-s
Vilmos herceg 17, 63 diaszpra x, 127-38, 156, 160
Vinland 114 x s a ni szrmazsi g 127,
Visszatrsi Trvny 132, 139, 142-3, X-kromoszma 84, 252 154
155 xeroderma pigmentosum 278 falask 158
vLINCL 65, 66, 67 genetikai betegsgek 56, 74-7,
Voltaire 80, 100 y 141, 151-3, 1 57, 159
Vrs Erik 114 Y-kromoszma 84, 85, 90, 92-4, 154, hfassg 74-7
Vrsbrllek Nemestett Rendje 97 158 identitsuk 139-40
vrshajak 192 az Y-kromoszma dmja 94 jemeni 156-7, 155
Young, Brigham 45-6, 149 kevereds 1 54, 157-61
w Yunnan tartomny 58, 59 lubavicsick 75-{i
Wales 98-9, 124-{i, 167 Nmetorszgban 74, 118, 152,
Wallace, Alfred Russel x z 159
Wardenburg-szindrma 35 Zaire 30,31 seik 1 27, 140, 150-5
Washington, George 62, 95, 107 Zevi, Sabbetai 142 sszetkzs Rmval 129-35
Weismann, August 243-5, 272 Zimbabwe 145-7, 148-9, 157 Talmud 27

30 1