Water Air Soil Pollut (2017) 228:101
DOI 10.1007/s11270-017-3251-6
Early Heat Shock Protein Response and Selection of Reference
Genes in Arabidopsis thaliana Seedlings Subjected to Marine
Fuel Contamination
Sarah Muniz Nardeli & Bruna Palma Matta &
Carolina Farias Saad & Fernanda Reinert &
Raquel S. Peixoto & Marcio Alves-Ferreira
Received: 10 May 2016 / Accepted: 4 January 2017
# Springer International Publishing Switzerland 2017
Abstract Strategies for management of damaged
environments can benefit from understanding of
how early petrochemical pollution affect living or-
ganisms. One of the general responses to environ-
mental stress in plants is mediated by the regulatory
network of heat shock proteins (HSP). Arabidopsis
thaliana is a model plant for genetic studies, and
laboratory experiments with this species might be
informative for predicting analogous responses to
toxicants in other species. Here, Arabidopsis seed-
lings were exposed to time-varying contamination
(up to 24 h) with the water soluble fraction of
Sarah Muniz Nardeli and Bruna Palma Matta contributed equally
to this work.
S. M. Nardeli : C. F. Saad : M. Alves-Ferreira (*)
Laboratrio de Gentica Molecular Vegetal, Department of
Genetics, Institute of Biology, Universidade Federal do Rio de
Janeiro, Rua Professor Rodolpho Paulo Rocco s/n, CCS, Bloco A,
Sala A2-93, Rio de Janeiro, Brazil
e-mail: alvesfer@uol.com.br
S. M. Nardeli
e-mail: snardeli@gmail.com
C. F. Saad
e-mail: carolina.saad@gmail.com
B. P. Matta
Laboratrio de Evoluo de Caracteres Complexos, Department of
Genetics, Institute of Biology, Universidade Federal do Rio de
Janeiro, Rua Professor Rodolpho Paulo Rocco s/n, CCS, Bloco A,
sala A2-109, Rio de Janeiro, Brazil
e-mail: bpmatta@gmail.com
MF380 marine fuel (WSF-MF380). An accurate es-
timation of expression differences in HSP genes was
obtained by real-time quantitative polymerase chain
reaction (qPCR). After a thorough selection and
validation of reference genes, two gene pairs were
found to be stably expressed across control and
WSF-MF380-treated samples and were used as nor-
malization factors. Next, we evaluated the normal-
ized expression of five HSP genes in response to the
time-varying WSF-MF380 contamination. Four
HSPs presented a significant increase in gene ex-
pression, which suggests that they might be tested as
F. Reinert
Laboratrio de Ecofisiologia Vegetal, Department of Botany,
Institute of Biology, Universidade Federal do Rio de Janeiro, Rua
Professor Rodolpho Paulo Rocco s/n, CCS, Bloco A, Sala
A1-102, Rio de Janeiro, Brazil
e-mail: freinert@biologia.ufrj.br
R. S. Peixoto
Laboratrio de Ecologia Microbiana Molecular, Department of
Microbiology, Prof. Paulo de Ges, Universidade Federal do Rio
de Janeiro, Rua Professor Rodolpho Paulo Rocco s/n, CCS, Bloco
E, Sala E0-08, Rio de Janeiro, Brazil
e-mail: raquelpeixoto@micro.ufrj.br
101 Page 2 of 11
biomarkers for early exposure to petrochemical
compounds. While a nearly immediate response
(3 h after contamination) was found for HSP90.1
and two small HSP genes localized in the mitochon-
dria (sHSP23.5 and sHSP26.5), a slightly later re-
sponse (20 h) was observed for a third small HSP
with a cytoplasmic/nuclear localization (sHSP18.2).
Overall, these expression changes suggest the exis-
tence of a genetic cross-talk between canonical reg-
ulatory networks of HSPs and the cellular response
to non-heat stress factors, such as marine oil
contamination.
Keywords Marine oil pollution . Stress response . Heat
shock protein . Real-time quantitative PCR . Gene
expression . Ecotoxicology
1 Introduction
The worldwide demand for oil represents a major risk to
the environment, from the processes of extracting,
transporting, and refining to the end consumer. Most
accidents occur during transport in oil tankers and cause
major environmental damage that affects the local fauna
and flora (ITOPF 2015). These accidents highlight the
need for investments in safety and in studies on the
effects of oil pollution in different species and ecosys-
tems. In 2000, approximately 1300 m3 of the marine
fuel MF380 (Petrobrs) was released into the Guanabara
Bay (Rio de Janeiro, Brazil) after the pipeline ruptured
at the Duque de Caxias Refinery. The oil was
transported by tidal current and wind, was spread over
the water, and reached islands, beaches, and mangroves
(Meniconi et al. 2002). Using a model species, like
Arabidopsis thaliana, might contribute to our under-
standing of the consequences of exposure to petrochem-
ical compounds in living organisms. Because its seed-
lings can initially develop in aquatic environments, lab-
oratory experiments with A. thaliana might also be
informative for predicting analogous responses to toxi-
cants in other species, including strictly aquatic plants.
Moreover, vast available expression data of Arabidopsis
to various abiotic stresses has been crucial for bringing
light to the molecular mechanisms which underline the
response of plants to organic pollution compounds such
as TNT (Beynon et al. 2009), but also complex mix-
tures, such as marine oil (Nardeli et al. 2016). Such
Water Air Soil Pollut (2017) 228:101
findings might lead to more successful damage control
of affected areas.
Petroleum is a complex mixture of different compo-
nents, including several organic compounds (Steffens
et al. 2011). Approximately 75% (v/v) of the organic
compounds are hydrocarbons, such as alkanes,
cycloalkanes, and aromatics (Ralph and Burchett
1998; Youssef 2002). Polycyclic aromatic hydrocarbons
found in crude oil represent a constant menace to living
organisms due to their highly toxic, mutagenic, and
carcinogenic properties (Muratova et al. 2003). The
primary phytotoxic effect of the exposure to petrochem-
ical compounds is the absorption of the water soluble
fraction of the oil followed by the incorporation of
sublethal quantities of hydrocarbons (Ralph and
Burchett 1998; Youssef 2002). The consequences of
oil pollution in plants have been studied in several
species with varying results as a consequence of differ-
ent aspects, such as the physicochemical characteristics
of the oil, contamination intensity, and seasons
(Hershner and Lake 1980), as well as environmental
conditions (Proffitt et al. 1995) and the affected parts
of the plants (Pezeshki et al. 2000). The only clearly
common consequence is that the exposure to polycyclic
aromatic hydrocarbons reduces the tolerance of plants to
other stresses (Ralph and Burchett 1998), an outcome
that might increase the overall impact of oil pollution in
damaged ecosystems.
The heat shock response to environmental stress is
one of the most general responses among environmental
stress factors (Roelofs et al. 2008). A. thaliana is a
model plant species for gene expression studies, and
the heat shock response of A. thaliana depends upon a
complex regulatory network that involves 21 known
transcriptional factors and four heat shock proteins fam-
ilies. Heat shock transcriptional factors (HSF) and heat
shock proteins (HSP) are involved in the cellular re-
sponse to various forms of stress aside from heat
(Swindell et al. 2007). In addition, different stress treat-
ments can interact with the HSP and HSF response
pathways, which suggests that there is considerable
genetic crosstalk between heat and non-heat stress reg-
ulatory networks (Swindell et al. 2007). In this scenario,
we asked whether the expression of HSP genes might
change in response to the stress caused by the exposure
to petrochemical compounds. HSP genes are usually
expressed after heat shock through the action of heat
shock transcription factors that bind to heat shock ele-
ments or promoters. Likewise, HSPs function as
Water Air Soil Pollut (2017) 228:101
chaperones that support protein folding and block per-
manent protein aggregation (Tyedmers et al. 2010).
Despite their close working correlation within the cell,
the HSP90, HSP70, and sHSPs (small HSPs) families
are evolutionarily unrelated to each other in plants
(Waters 2013). In addition, HSPs have been used as
biomarkers for environmental pollution in a range of
animal species, such as copepod Tigriopus japonicus
(Kim et al. 2014), persian sturgeon Acipenser persicus
(Safari et al. 2014), and wild crucian carp Carassius
auratus (An et al. 2014). However, their use as bio-
markers for pollution in plants has not been explored.
A highly sensitive and specific technique for measur-
ing the changes in gene expression is reverse transcrip-
tion followed by real-time quantitative polymerase
chain reaction (qPCR) (Huggett et al. 2005). However,
normalization is critical for the correction of the vari-
ability that arises and accumulates throughout the dif-
ferent technical steps. For instance, technical variations
in qPCR can be related to the different enzymatic effi-
ciencies of reverse transcription or of qPCR itself
(Guenin et al. 2009). Biological variations should also
be taken into account, such as variation in the overall
transcriptional activity among tissues, cells, and treat-
ments (Remans et al. 2008). The widely accepted nor-
malization strategy for qPCR consists of measuring the
mRNA levels of the target gene in relation to the mRNA
levels of one or more reference genes (Guenin et al.
2009; Huggett et al. 2005). In theory, the expression of a
bonafide reference gene should be stable (not vary)
across the tissues or treatments under investigation.
Nevertheless, Btraditional^ housekeeping genes are
still used as a reference without any validation of their
stability across the conditions being compared
(Gutierrez et al. 2008a). When such Bnon-validated^
genes are used for normalization in qPCR experiments,
opposite and misleading results are often observed, as
shown by Dheda et al. (2005), Gutierrez et al. (2008a),
and Matta et al. (2011). To maximize the chances of
finding reliable reference genes for our experimental
conditions, we took special care in choosing the initial
subset of putative reference genes (validation set). In-
stead of testing only Btraditional^ housekeeping genes,
our validation set included genes found by Czechowski
et al. (2005). These authors used Affymetrix ATH1
probe sets to identify hundreds of putative reference
genes for A. thaliana, through comparison of different
experimental conditions, stress treatments, or develop-
mental stages.
Page 3 of 11 101
Here, we report an evaluation of the stability of six
putative reference genes in samples of A. thaliana seed-
lings that were early exposed to time-varying contami-
nation (up to 24 h) with the water soluble fraction
(WSF) of marine fuel 380 (MF380), as well as the
possible changes in the normalized expression of five
A. thaliana HSP genes in response to the same petro-
chemical contamination.
2 Materials and Methods
2.1 Marine Fuel Preparation
Glassware was cleaned with EXTRAN detergent,
soaked in 2 M HNO3 acid-bath for 24 h, and rinsed in
distilled water (Ralph and Burchett 1998). The marine
fuel MF380 has a density of 0.9878 g mL1 and viscos-
ity of 380 mm2 s1 at 50 C (Petrobrs). MF380 was
mixed with MilliQ water 20% (v/v) in a beaker sealed
with parafilm (adapted from (Anderson et al. 1974;
Baden 1982). The mixture was rapidly agitated on a
magnetic stirrer for 24 h, in a chapel to ensure a uniform
oil-water mixture. The mixture was allowed to settle for
1 h to separate the oil and water phases, the oil phased
was removed using a syringe and only then was the
water soluble fraction (WSF-MF380) obtained
(adapted from Ralph and Burchett 1998).
2.2 Growth Conditions and WSF-MF380 Treatment
of A. thaliana Seedlings
Seeds of A. thaliana ecotype Columbia were surface-
sterilized with 1 mL of 70% ethanol plus 0.05% of
TWEEN 20 for 10 min and washed in 100% ethanol.
Fifty seeds were transferred to 250 mL conical glass
flasks containing 50 mL autoclaved half-strength
Murashige and Skoog (MS) liquid m edium
(Murashige and Skoog 1962) with 45 mM sucrose and
vitamins (pH 5.8). The seeds were stratified (3 days at
4 C) before they were transferred to a growth room at
23 C and 16/8 h photoperiod (100 mol m2 s1).
Flasks were maintained on a rotary shaker at 125 rpm
(Certomat MOII, B. Braun Biotech International, Ger-
many) throughout the experiment. After 10 days of
culturing, half of the flasks received 50 mL of half-
strength MS liquid medium with 45 mM sucrose and
vitamins, i.e., the control treatment. The other flasks
received 25 mL of MS liquid medium with 45 mM of
101 Page 4 of 11
sucrose and vitamins and 25 mL of the water soluble
fraction of MF380 (20% (v/v)), i.e., WSF-MF380 treat-
ment. The entire experiment was performed in two
independent biological replicates. Ten-day-old seed-
lings (50 in total) were collected from each biological
replicate of the control and the WSF-MF380 treatments
at 1, 3, 9, 20, and 24 h after the initial time of exposure to
WSF-MF380 contamination (Nardeli et al. 2016).
2.3 Total RNA Isolation and cDNA Synthesis
Frozen samples were ground to a fine powder in liquid
nitrogen. Total RNA extractions from 100 mg of starting
material were performed using a Qiagen RNeasy Plant
Mini Kit (manufacturers protocol, final volume of
50 L). RNA concentration and purity were determined
via NanoDrop Spectrophotometer ND-2000 (Thermo
Scientific): the RNA amounts varied from 20.5 to
106.2 g, and the 260/280 absorbance ratios ranged
from 2.05 to 2.14, which indicates high-quality RNA
purification, without (or with trace of) protein contam-
ination. The integrity was assessed by 1% agarose gel
electrophoresis, and no signs of RNA degradation were
observed. The first-strand cDNA was synthesized by
adding 50 M of Oligo (dT24V) and 10 mM of each
deoxyribonucleoside 5-triphosphate (dNTPs) to 1 g of
total RNA. This mixture was incubated at 65 C for
5 min and briefly chilled on ice. Then, 200 units of
SuperScript III reverse transcriptase (Invitrogen), 5
first-strand buffer and 20 mM of dithiothreitol (DTT)
were added to the mixture. The final reaction volume
was 20 L, and it was incubated at 50 C for 1 h.
Enzyme inactivation was performed at 70 C for
15 min. All steps were performed accordantly with
SuperScript III reverse transcriptase manufacturers
instructions, and the resulting cDNA solution was stored
at 20 C. The presence of contaminant genomic DNA
in the original RNA samples was tested with a standard
PCR using primers spanning two exons and the cDNA
samples as template; no DNA contamination was ob-
served. The presence of spurious amplification products
was also continuously assessed through the verification
of qPCR dissociation profiles.
2.4 Validation Set and qPCR
Our validation set consisted of five candidate reference
(REF) genes selected from Czechowski et al. (2005) and
one Btraditional^ REF gene (ADH2), an alcohol
Water Air Soil Pollut (2017) 228:101
dehydrogenase enzyme (Dolferus et al. 1997) (details
in Table 1). We note that ADH2 (a.k.a. FDH1) was used
as a putative REF gene because, unlike ADH1, its ex-
pression does not seem to be altered by different stress
conditions (Dolferus et al. 1997). Primers for the six
REF genes and five HSP genes are also shown in
Ta b l e 1 a n d w e r e d e s i g n e d w i t h P r i m e r 3
(http://primer3plus.com/) using the following criteria:
primer length between 20 and 26 bp, amplicon size
between 61 and 221 bp, and melting temperature of
60 1 C. The qPCRs were carried out in optical 96-
well plates with a 7500 Fast Real-Time PCR system
(Applied Biosystems), using SYBR Green I (Molec-
ular Probes) to monitor the dsDNA synthesis. The reac-
tion mixtures contained 10 L of diluted cDNA (1:50),
0.2 M of each primer, 25 M of each dNTP, 1 PCR
buffer (Invitrogen), 3 mM MgCl2, 2 L of SYBR
Green I water diluted (1:10000) and 0.25 units of Plat-
inum Taq DNA polymerase (Invitrogen) in a final vol-
ume of 20 L. The reaction mixtures were incubated for
5 min at 94 C, followed by 40 amplification cycles of
15 s at 94 C, 10 s at 60 C, and 15 s at 72 C. As a part
of the qPCR quality control, no template control reac-
tions were prepared for each gene, and none reached the
exponential phase, as expected.
2.5 Quantification Cycles, Efficiencies, and Outlier
Detection
The PCR efficiencies and the optimal quantification
cycle (Cq values) were estimated using the online soft-
ware Real time PCR Miner (Zhao and Fernald 2005)
version 4.0 (http://www.miner.ewindup.info/). The
average amplification efficiency (E) of each primer set
is shown in Table 1. The complete data set consisted of
660 qPCR reactions: 11 genes (six REF and five HSP),
10 experimental samples (groups) from control and
WSF-MF380 treatments at 1, 3, 9, 20, and 24 h after
WSF-MF380 contamination, two biological replicates
(subgroups) for each sample, and technical triplicates of
each qPCR condition. The repeatability of the technical
triplicates was assessed through an approach similar to
that of Karlen et al. (2007). Using standard deviation of
Cq values in a large data set, these authors estimated an
empirical value of 0.4 SD, at which Cq measurements
were considered of good repeatability. Here, when the
triplicates showed a SD > 0.35 (a more conservative cut
off), the replicate that departed the most from the tripli-
cate Cq average was excluded from further analyses
Water Air Soil Pollut (2017) 228:101 Page 5 of 11 101

Table 1 Primers and average efficiencies (E) of HSP and putative reference (REF) genes

Locus Coding protein (symbola) Type Primers 53 (forward/reverse) E SD

At1g13320 Protein phosphatase 2A subunit A3 (PP2AA3) REF TAACGTGGCCAAAATGATGC / 1.070 0.008

GTTCTCCACAACCGCTTGGT
At1g58050 RNA helicase family protein REF CCATTCTACTTTTTGGCGGCT / 1.119 0.008
TCAATGGTAACTGATCCACTCTGATG
At2g28390 SAND family protein REF GCGTTAAGGCAAGCTACAGG / 1.118 0.015
TTTCTGTGCACCAGCAAGAC
At4g34270 TIP41-like family protein REF GTGAAAACTGTTGGAGAGAAGCAA / 1.091 0.008
TCAACTGGATACCCTTTCGCA
At5g15710 F-box domain; oxidase/kelch repeat superfamily protein REF CGCTCAGACAAATCGTTCAA / 1.078 0.008
AGTTCACCGCAGGCATTATC
At5g43940 Alcohol dehydrogenase 2 (ADH2) REF TGGGAAACCCATTTATCACTTCAT / 1.030 0.006
CAGCAAGTCCAACAGTGCCAAG
At1g16030 Heat shock protein 70B (HSP70B) HSP TGGACTTGAGACAGCAGGTG / 1.104 0.009
GATCAGAACGCCTGGTTGAT
At1g52560 Heat shock protein 26.5 (sHSP26.5) HSP CCGACGATCATGGCTACTTC / 1.052 0.006
CCCTGGAACCTCGTATCTGA
At5g51440 Heat shock protein 23.5 (sHSP23.5) HSP CTGCTTCATCTCGCCTCTTC / 1.037 0.009
GCATCTGGCTCAAGCTTCTC
At5g52640 Heat shock protein 90.1 (HSP90.1) HSP TGGTGGTTCCTTCACTGTCA / 1.094 0.012
GGTTTTCTCGGTCCAAAGGT
At5g59720 Heat shock protein 18.2 (sHSP18.2) HSP CATTTTTGGAGGACGCAGAT / 0.96 0.012
TCCTTCCAATCCACTCTTGC
a
Not all the genes have official coding protein symbols

because it was considered to be a potential outlier; in NER = (EGOI)CqGOI/(EREF)CqREF. However, in this

total, 26 cases were excluded (3.9% of the complete data
set).
2.6 Stability Evaluation of Putative Reference Genes
For each putative REF gene, Cq values were converted
into linear relative quantities Q = ECq, where E is the
average amplification efficiency, and Cq is the average
Cq of technical triplicates in the sample with the highest
concentration (the lowest average Cq) minus the average
Cq of technical triplicates in the sample in question. Q
values by group (experimental samples in each contam-
ination time) and subgroup (biological replicates) were
analyzed with NormFinder (Andersen et al. 2004) ver-
sion 0.953 (http://www.mdl.dk/publicationsnormfinder.
htm). Q values by group were also analyzed with
geNorm (Vandesompele et al. 2002) version 3.4
(http://medgen.ugent.be/~jvdesomp/genorm/).
2.7 Normalized Relative Expression of HSP Genes
The relative expression of each HSP was estimated
through a normalized expression ratio (NER) using an
efficiency-(E)-calibrated model (Pfaffl et al. 2002), i.e.,
case, Cq is the average Cq in the control group minus
the average Cq in the treatment group. When more than
one REF gene was used as reference, the normalization
factors can be obtained by the geometric average of the
(EREF)CqREF terms. The experimental significance of
NER was estimated through 2000 randomizations of Cq
data in each experimental comparison using REST
(Pfaffl et al. 2002) version MCS (http://rest.gene-
quantification.info/). Further details on all the qPCR
methods and analyses can be found in Matta et al.
(2011).
3 Results and Discussion
3.1 Validation of Reference Genes
The stability of the putative REF genes at different times
of exposure to WSF-MF380 treatment was assessed
with NormFinder and geNorm algorithms. The results
are shown in order of increasing stability (progressively
smaller values in Fig. 1). The two most stable genes
indicated by geNorm (PP2AA3 and At4g34270) have
the same stability value and cannot be individually
101 Page 6 of 11
Fig. 1 Stability of putative reference (REF) genes. Stability was
assessed across all control and WSF-MF380-treated samples at 1,
3, 9, 20, and 24 h following WSF-MF380 contamination, using
two algorithms: geNorm (circles, straight line) and NormFinder
(diamonds, dashed line). Results were ranked in order of increas-
ing stability. Regardless the algorithm, more stable genes present
smaller stability values. The two most stable genes indicated by
geNorm (PP2AA3 and At4g34270) have the same stability value
and cannot be individually ranked (see text)
ranked. The reason for this outcome is that geNorm uses
a pairwise approach where REF genes are ranked
through successive stepwise exclusion of the least stable
gene followed by a re-estimation of the pairwise stabil-
ity values until the most stable pair is identified and
cannot be further separated (Vandesompele et al.
2002). In turn, NormFinder uses a model-based ap-
proach that takes into account both the inter- and
intragroup variation when calculating the stability value
for each REF gene separately (Andersen et al. 2004).
Figure 2 shows that the top-four genes indicated by
NormFinder, which include geNorms most stable pair
(At4g34270 and PP2AA3), presented small intergroup
variation (close to zero) and small intragroup variation
(small error bars) when compared to the remaining less
stable genes (At2g28390 and At5g15710). This result
suggests that the top-four genes suffered from minor
expression changes between the control and the WSF-
MF380-treated samples averaged across all the times of
WSF-MF380 contamination (intergroup variation) as
well as small expression changes across biological rep-
licates (intragroup variation). Such small expression
changes within and across conditions indicate that these
putative REF genes might be considered bonafide REF
genes.
The greatest stability difference across algorithms
was for ADH2 gene, which is the second most stable
gene in the NormFinder ranking and the least stable
Water Air Soil Pollut (2017) 228:101
Fig. 2 Intergroup variation of putative REF genes, as estimated
by NormFinder. Intergroup variation was averaged across contam-
ination times for all WSF-MF380-treated samples relative to con-
trol samples. Error bars correspond to the respective intragroup
variation (across biological replicates); all values are in log2.
Stable genes should present minimal intergroup variation (close
to zero) and small error bars. Genes that compose NormFinders
most stable pair are indicated by asterisks
gene in the geNorm ranking. Large ranking differences
across algorithms are not uncommon (Andersen et al.
2004; Cruz et al. 2009). The caveat of pairwise ap-
proaches, such as the one used by geNorm, is that less
stable but co-regulated genes might show smaller
pairwise variation and be up-ranked because they vary
similarly across conditions. Consequently, when a vali-
dation set inadvertently has co-regulated genes, a gene
with small expression changes across conditions (more
stable) might be down-ranked in the pairwise approach
(Andersen et al. 2004).
To alleviate the occasional bias caused by subop-
timal REF gene choice, the use of a normalization
factor composed of two or more genes is highly rec-
ommended. The reasoning is that the intergroup var-
iation in the geometric average of different genes
should be smaller than the intergroup variation of a
single one (Vandesompele et al. 2002). Moreover,
geNorm uses a stepwise approach to estimate the
change in the pairwise variation (V) when the subse-
quent most stable gene is included in the normaliza-
tion factor (Vn/Vn+1). Here, the V2/V3 value (0.065)
was smaller than the empirical cut-off of 0.150 below
which the inclusion of a third REF gene should have
no significant contribution in minimizing the inter-
group variation (Vandesompele et al. 2002). Thus, in
our experimental conditions, a normalization factor
composed by two genes might be sufficient for an
accurate normalization of the target genes.
Water Air Soil Pollut (2017) 228:101
Andersen et al. (2004) argued that an ideal normali-
zation factor should be composed by a pair of REF
genes with small intragroup variation and opposite in-
tergroup variation to minimize the combined intergroup
variation. Figure 2 shows that this seems to be the case
for At1g58050 and ADH2 because their respective pos-
itive and negative values for intergroup variation can
result in a normalization factor with intergroup variation
approaching zero (minimal change across experimental
conditions, greater stability). PP2AA3 and At4g34270,
which were indicated by geNorm as the most stable pair,
also have small intergroup variation and might compose
a relatively stable normalization factor (see the next
section).
Likewise, all the genes in our validation set presented
relatively small stability values (0.30, Fig. 1) when
compared to the values found in the literature (e.g., in
different environmental conditions for Coffea arabica)
(Cruz et al. 2009). We are restricting this comparison to
NormFinder results because they might be less affected
by co-regulated genes. The validation set of Cruz et al.
(2009) was limited to orthologues of Btraditional^
housekeeping genes because they were working with a
non-model species with no previous work on reference
genes. Here, we tried to improve the chances of finding
bonafide REF genes by mostly using putative REF
genes already tested in A. thaliana in a transcriptomic
analysis with different stresses and developmental con-
ditions (Czechowski et al. 2005). This strategy seems to
be effective because the stability values we found were
close to those observed by Andersen et al. (Andersen
et al. 2004), who performed a transcriptomic analysis
before composing their validation set (NormFinder
Fig. 3 Normalized expression ratio of HSP genes by time of
exposure to WSF-MF380. Fold-change values (FC) were estimat-
ed for WSF-MF380-treated samples relative to control samples at
each time (1, 3, 9, 20, and 24 h) following the initial exposure time
of A. thaliana seedlings to WSF-MF380. Standard errors are also
shown (error bars). Normalization was performed using the stable
Page 7 of 11 101
stability values up to 0.30). Thus, whenever possible,
the initial validation set should be composed of genes
already validated as stable in transcriptomic analyses
using conditions analogous to the questions being
asked. Such genes might perform better than Btradition-
al^ housekeeping genes (Gutierrez et al. 2008b).
3.2 HSP Expression Changes After Marine Fuel
Contamination
Figure 3 shows the expression changes of the genes
encoding HSPs in A. thaliana seedlings after the stress
caused by WSF-MF380 contamination. The differential
gene expression was estimated for the WSF-MF380-
treated samples relative to the control samples using
normalization factors from the stable pairs of REF genes
indicated by NormFinder (At1g58050 and ADH2) and
geNorm (PP2AA3 and At4g34270). The results did not
change when all the five HSP target genes were normal-
ized to each normalization factor, which suggest that
both pairs perform similarly well and can be considered
stable pairs of REF genes. These four REF genes
(At1g58050, ADH2, PP2AA3, and At4g34270), or their
orthologues, might then be used as good candidate
genes for validation tests set under experimental condi-
tions analogous to ours, such as chemically induced
stress situations in aquatic environments. Nevertheless,
the validation procedure for the condition in question
must not be skipped to avoid obtaining faulty results, as
shown by Gutierrez et al. (2008a) in A. thaliana and
hybrid Populus as well as by Matta et al. (2011) in
Drosophila melanogaster.
pairs indicated by NormFinder (At1g58050 and ADH2) and
geNorm (PP2AA3 and At4g34270), but only the first case is
presented, since results did not change. Differentially expressed
genes should have FC 0. Significance of FC values was estimat-
ed through 2000 randomizations of the original Cq data. Signifi-
cant cases are indicated by asterisks and presented P values <0.006
101 Page 8 of 11
Regarding a possible response of the HSP genes to
petrochemical contamination, a nearly immediate expres-
sion change was observed for HSP90.1 (At5g52640) and
the two small HSP genes: sHSP23.5 (At5g51440) and
sHSP26.5 (At1g52560; see Fig. 3). These three HSP
genes were significantly upregulated (up to 3.16 times)
in the WSF-MF380-treated samples relative to control
samples at 3 h after the initial exposure to WSF-MF380.
In addition, these genes seem to experience an upregula-
tion trend that lasted until 20 h, followed by a seemingly
downregulation at the end of the exposure time (24 h of
WSF-MF380 contamination). However, such downregu-
lation at 24 h is not statistically significant and cannot be
clearly inferred. Tissue level experiments have demon-
strated that some stresses can generate fast changes in
respiratory rates of excised tissues, possibly mediated
through thermal effects on the kinetics of the electron
tissue capacity (Armstrong et al. 2006; Kurimoto et al.
2004). In this context, the early response of the two
mitochondrial sHSPs (sHSP23.5 and sHSP26.5) leads
to a tentative hypothesis that warrants further investiga-
tion, i.e., the exposure to marine fuel might also trigger a
fast mitochondrial Bsense^ of stress, perhaps through
electron tissue capacity modulation.
The three small HSP genes evaluated in this study
belong to different subfamilies: subfamily MI
(sHSP23.5), subfamily MII (sHSP26.5), and subfamily
CI (sHSP18.2) (Siddique et al. 2008). All the plant
sHSPs have a highly conserved C-terminal region, often
referred to as the -crystallin domain. However, unlike
sHSP23.5 and sHSP26.5, which are localized in mito-
chondria, sHSP18.2 is predicted to have a cytoplasmic/
nuclear localization (E. R. Waters 2013). Indeed, an
opposite pattern of gene expression in response to
WSF-MF380 contamination was observed for the
cytoplasmic/nuclear localized sHSP18.2. This gene
showed a significant upregulation response at a later
time (20 h), which seems to be maintained at 24 h after
the initial exposure to WSF-MF380 treatment. Previous
studies on the sHSP18.2 gene (formerly named
sHSP18.1) have shown that it is not developmentally
expressed but presents high heat shock expression
(Siddique et al. 2008; Elizabeth R. Waters et al. 2008).
Likewise, this gene does not share similar expression
patterns with other cytoplasmic/nuclear-localized sub-
families and not even with other members of its own
subfamily. Therefore, it is not surprising that sHSP18.2
presented a different expression pattern in response to
WSF-MF380 exposure.
Water Air Soil Pollut (2017) 228:101
The fact that four HSP genes, out of the five
tested here, clearly responded to the stress caused
by the early contamination (up to 24 h) suggests the
existence of a genetic cross-talk between the HSP
regulatory pathways and genes or gene networks
that regulate the cellular response to non-heat stress-
es, such as petrochemical compounds. Only the
HSP70B gene (At1g16030) had no significant mod-
ulation and no clear pattern of genetic response to
WSF-MF380 contamination. Interestingly, the
HSP70 gene has been proposed as a potential bio-
marker for stresses because it has the largest specific
activity out of stress-related proteins (Lewis et al.
1999). However, our results indicate that this might
not be the case for stress caused by petrochemical
pollution. Instead, the four HSPs responsive to ma-
rine oil exposure found here (HSP90.1, sHSP23.5,
sHSP26.5, and sHSP18.2) might be better candi-
dates to be tested as biomarkers for oil-
contaminated mangrove flora.
Studies using a model terrestrial species that can
initially develop in aquatic-like environments, such as
A. thaliana, might contribute to the understanding of
the consequences of petrochemical contamination in
terrestrial and aquatic plants. Large amounts of
knowledge and resources are available for
A. thaliana, and growth conditions can be strictly
controlled during experiments. Regarding efforts
and costs, gene expression studies and whole genome
approaches (genomics and transcriptomics) can be
more easily performed in A. thaliana than in target
species. For instance, results of a microarray experi-
ment using A. thaliana exposed to phenanthrene (a
polycyclic aromatic hydrocarbon) revealed numerous
perturbations in the signaling and metabolic pathways
that regulate reactive oxygen species (ROS), as well
as correlated responses to pathogen defense
(Weisman et al. 2010). Knowledge obtained from
such studies, including the present one, can be used
in the search for orthologous genes in target species
(Regier et al. 2013, 2015). It can also be used to
generate hypothesis about the kind of gene expression
changes that might be expected to occur in response to
oil contamination in target species. Collaborative ef-
forts and the parallel use of model and target species
might contribute to better understanding of traditional
ecotoxicological problems (Snape et al. 2004), such
as direct and indirect effects of petrochemical pollu-
tion in living organisms.
Water Air Soil Pollut (2017) 228:101
4 Conclusions
Here, we found that two pairs of reference genes
(At1g58050 + ADH2 or PP2AA3 + At4g34270) can be
considered to be bonafide reference pairs for normaliza-
tion of gene expression in A. thaliana seedling exposed
to WSF-MF380 contamination. These four REF genes
(or their orthologues) might also be used for the selec-
tion of stable reference genes in experimental conditions
analogous to ours, even in other plant species or in cases
of contamination with different petrochemical com-
pounds. A possible genetic modulation of heat shock
proteins by the stress caused after a petrochemical con-
tamination was also reported: we found a nearly imme-
diate significant increase in the expression of three HSP
genes (HSP90.1 and two mitochondrial sHSPs:
sHSP23.5 and sHSP26.5), as well as a later upregulation
of a fourth HSP gene (sHSP18.2). These results suggest
the existence of a genetic cross-talk between the regu-
latory pathways of heat shock proteins and genes or
networks involved with cellular response to non-heat
stress factors, such as the stress induced by petrochem-
ical compounds in aquatic environments.
Acknowledgements We thank Msc. Jorge Eduardo Santos Paes
for kindly providing the marine oil used in this work and Dr.
Vanessa Santana for the help with growth conditions and marine
fuel treatment. This work was supported by Petrobras, Conselho
Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq),
Coordenao de Aperfeioamento de Pessoal de Nvel Superior
(CAPES), and Fundao de Amparo Pesquisa do Estado do Rio
de Janeiro (FAPERJ).
Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no
conflict of interest.
References
An, L., Lei, K., & Zheng, B. (2014). Use of heat shock protein
mRNA expressions as biomarkers in wild crucian carp for
monitoring water quality. Environmental Toxicology and
P h a r m a c o l o g y, 3 7 ( 1) , 2 4 8 2 5 5 . d o i : 1 0. 1 0 1 6/ j .
etap.2013.11.019.
Andersen, C. L., Jensen, J. L., & Orntoft, T. F. (2004).
Normalization of real-time quantitative reverse
transcription-PCR data: a model-based variance estimation
approach to identify genes suited for normalization, applied
Page 9 of 11 101
to bladder and colon cancer data sets. Cancer Research,
64(15), 52455250. doi:10.1158/0008-5472.CAN-04-0496.
Anderson, J. W., Neff, J. M., Cox, B. A., Tatem, H. E., &
Hightower, G. M. (1974). Characteristics of dispersions and
water-soluble extracts of crude and refined oils and their
toxicity to estuarine crustaceans and fish. Marine Biology,
27(1), 7588. doi:10.1007/BF00394763.
Armstrong, A. F., Logan, D. C., Tobin, A. K., OToole, P., &
Atkin, O. K. (2006). Heterogeneity of plant mitochondrial
responses underpinning respiratory acclimation to the cold in
Arabidopsis thaliana leaves. Plant, Cell and Environment,
29(5), 940949. doi:10.1111/j.1365-3040.2005.01475.x.
Baden, S. P. (1982). Oxygen consumption rate of shrimp exposed
to crude oil extract. Marine Pollution Bulletin, 13(7), 230
233. doi:10.1016/0025-326X(82)90344-7.
Beynon, E. R., Symons, Z. C., Jackson, R. G., Lorenz, A., Rylott,
E. L., & Bruce, N. C. (2009). The role of oxophytodienoate
reductases in the detoxification of the explosive 2,4,6-trini-
trotoluene by Arabidopsis. Plant Physiology, 151(1), 253
261. http://www.pubmedcentral.nih.gov/articlerender.
fcgi?artid=2735992&tool=pmcentrez&rendertype=abstract.
Cruz, F., Kalaoun, S., Nobile, P., Colombo, C., Almeida, J.,
Barros, L. M. G., et al. (2009). Evaluation of coffee reference
genes for relative expression studies by quantitative real-time
RT-PCR. Molecular Breeding, 23(4), 607616. doi:10.1007
/s11032-009-9259-x.
Czechowski, T., Stitt, M., Altmann, T., & Udvardi, M. K. (2005).
Genome-wide identification and testing of superior reference
genes for transcript normalization. Society, 139(September),
517. doi:10.1104/pp.105.063743.1.
Dheda, K., Huggett, J. F., Chang, J. S., Kim, L. U., Bustin, S. A.,
Johnson, M. A., et al. (2005). The implications of using an
inappropriate reference gene for real-time reverse transcrip-
tion PCR data normalization. Analytical Biochemistry,
344(1), 141143. doi:10.1016/j.ab.2005.05.022.
Dolferus, R., Osterman, J. C., Peacock, W. J., & Dennis, E. S.
(1997). Cloning of the Arabidopsis and rice formaldehyde
dehydrogenase genes: implications for the origin of plant
ADH enzymes. Genetics, 146(3), 11311141.
Guenin, S., Mauriat, M., Pelloux, J., Van Wuytswinkel, O., Bellini,
C., & Gutierrez, L. (2009). Normalization of qRT-PCR data:
the necessity of adopting a systematic, experimental condi-
tions-specific, validation of references. Journal of
Experimental Botany, 60(2), 487493. doi:10.1093
/jxb/ern305.
Gutierrez, L., Mauriat, M., Gunin, S., Pelloux, J., Lefebvre, J.-F.,
Louvet, R., et al. (2008a). The lack of a systematic validation
of reference genes: a serious pitfall undervalued in reverse
transcription-polymerase chain reaction (RT-PCR) analysis
in plants. Plant Biotechnology Journal, 6(6), 60918.
doi:10.1111/j.1467-7652.2008.00346.x.
Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., & Van
Wuytswinkel, O. (2008b). Towards a systematic validation
of references in real-time RT-PCR. The Plant Cell, 20(7),
17341735. doi:10.1105/tpc.108.059774.
Hershner, C., & Lake, J. (1980). Effects of chronic oil pollution on
a salt-marsh grass community. Marine Biology, 56(2), 163
173. doi:10.1007/BF00397133.
Huggett, J., Dheda, K., Bustin, S., & Zumla, A. (2005). Real-time
RT-PCR normalisation: strategies and considerations. Genes
and Immunity, 6(4), 27984. doi:10.1038/sj.gene.6364190.
101 Page 10 of 11
ITOPF. (2015). Oil tanker spill statistics 2014. The International
Tanker Owners Pollution Federation Limited, (January),
12p.
Karlen, Y., McNair, A., Perseguers, S., Mazza, C., & Mermod, N.
(2007). Statistical significance of quantitative PCR. BMC
Bioinformatics, 8, 131. doi:10.1186/1471-2105-8-131.
Kim, B.-M., Rhee, J.-S., Jeong, C.-B., Seo, J. S., Park, G. S., Lee,
Y.-M., & Lee, J.-S. (2014). Heavy metals induce oxidative
stress and trigger oxidative stress-mediated heat shock pro-
tein (HSP) modulation in the intertidal copepod Tigriopus
japonicus. Comparative Biochemistry and Physiology Part
C: Toxicology & Pharmacology, 166, 6574. doi:10.1016/j.
cbpc.2014.07.005.
Kurimoto, K., Day, D. a., Lambers, H., & Noguchi, K. (2004).
Effect of respiratory homeostasis on plant growth in cultivars
of wheat and rice. Plant, Cell and Environment, 27(7), 853
862. doi:10.1111/j.1365-3040.2004.01191.x.
Lewis, S., Handy, R. D., Cordi, U. B., Billinghurst, Z., &
Depledge, M. H. (1999). Stress proteins (HSPs): methods
of detection and their use as an environmental biomarker.
Ecotoxicology, 8, 351368.
Matta, B. P., Bitner-Math, B. C., & Alves-Ferreira, M. (2011).
Getting real with real-time qPCR: a case study of reference
gene selection for morphological variation in Drosophila
melanogaster wings. Development Genes and Evolution,
221(1), 4957. doi:10.1007/s00427-011-0356-6.
Meniconi, M. D. G., Gabardo, I. T., Carneiro, M. E. R., Barbanti,
S. M., da Silva, G. C., & Massone, C. G. (2002). Brazilian oil
spil ls chem ica l c ha rac teri za tion ca se st u di es.
Environmental Forensics, 3(34), 303321. doi:10.1006
/enfo.2002.0101.
Murashige, T., & Skoog, F. (1962). A revised medium for rapid
growth and bio assays with tobacco tissue cultures.
Physiologia Plantarum, 15(3), 473497. doi:10.1111
/j.1399-3054.1962.tb08052.x.
Muratova, A., Hbner, T., Tischer, S., Turkovskaya, O., Mder,
M., & Kuschk, P. (2003). Plant-rhizosphere-microflora asso-
ciation during phytoremediation of PAH-contaminated soil.
International Journal of Phytoremediation, 5(2), 137151.
Nardeli, S. M., Saad, C. F., de Rossetto, P. B., Caetano, V. S.,
Ribeiro-Alves, M., Paes, J. E. S., et al. (2016).
Transcriptional responses of Arabidopsis thaliana to oil con-
tamination. Environmental and Experimental Botany, 127,
6372. doi:10.1016/j.envexpbot.2016.03.007.
Pezeshki, S. R., Hester, M. W., Lin, Q., & Nyman, J. A. (2000).
The effects of oil spill and clean-up on dominant US Gulf
coast marsh macrophytes: a review. Environmental Pollution,
108(2), 129139.
Pfaffl, M. W., Horgan, G. W., & Dempfle, L. (2002). Relative
expression software tool (REST) for group-wise comparison
and statistical analysis of relative expression results in real-
time PCR. Nucleic Acids Research, 30(9), e36. doi:10.1093
/nar/30.9.e36.
Proffitt, C. E., Devlin, D. J., & Lindseyt, M. (1995). Effects of oil
on mangrove seedlings grown under different environmental
conditions. Marine Pollution Bulletin, 30(12), 788793.
doi:10.1016/0025-326X(95)00070-4.
Ralph, P. J., & Burchett, M. D. (1998). Impact of petrochemicals
on the photosynthesis of Halophila ovalis using chlorophyll
fluorescence. Marine Pollution Bulletin, 36(6), 429436.
doi:10.1016/S0025-326X(97)00207-5.
Water Air Soil Pollut (2017) 228:101
Regier, N., Baerlocher, L., Mnsterktter, M., Farinelli, L., &
Cosio, C. (2013). Analysis of the Elodea nuttallii tran-
scriptome in response to mercury and cadmium pollution:
development of sensitive tools for rapid ecotoxicological
testing. Environmental Science and Technology, 47(15),
88258834. doi:10.1021/es401082h.
Regier, N., Cosio, C., von Moos, N., & Slaveykova, V. I. (2015).
Effects of copper-oxide nanoparticles, dissolved copper and
ultraviolet radiation on copper bioaccumulation, photosyn-
thesis and oxidative stress in the aquatic macrophyte Elodea
nuttallii. Chemosphere, 128, 5661. doi:10.1016/j.
chemosphere.2014.12.078.
Remans, T., Smeets, K., Opdenakker, K., Mathijsen, D.,
Vangronsveld, J., & Cuypers, A. (2008). Normalisation of
real-time RT-PCR gene expression measurements in
Arabidopsis thaliana exposed to increased metal concentra-
tions. Environmental and Experimental Botany, 13431349.
doi:10.1007/s00425-008-0706-4.
Roelofs, D., Aarts, M. G. M., Schat, H., & Straalen, N. M. Van.
(2008). Functional ecological genomics to demonstrate gen-
eral and specific responses to abiotic stress. Functional
Ecology, (Figure 1), 818. doi:10.1111/j.1365-
2435.2007.01312.x.
Safari, R., Shabani, A., Ramezanpour, S., Imanpour, M. R., &
Rezvani, S. (2014). Alternations of heat shock proteins (hsp
70) gene expression in liver and gill of Persian sturgeon
(Acipenser persicus Borodin, 1987) exposed to cadmium
chloride, 13(4), 979997.
Siddique, M., Gernhard, S., von Koskull-Dring, P., Vierling, E.,
& Scharf, K.-D. (2008). The plant sHSP superfamily: five
new members in Arabidopsis thaliana with unexpected prop-
erties. Cell Stress and Chaperones, 13(2), 183197.
doi:10.1007/s12192-008-0032-6.
Snape, J. R., Maund, S. J., Pickford, D. B., & Hutchinson, T. H.
(2004). Ecotoxicogenomics: the challenge of integrating ge-
nomics into aquatic and terrestrial ecotoxicology. Aquatic
toxicology (Amsterdam, Netherlands), 67(2), 14354.
doi:10.1016/j.aquatox.2003.11.011.
Steffens, J., Landulfo, E., Courrol, L. C., & Guardani, R. (2011).
Application of fluorescence to the study of crude petroleum.
Journal of Fluorescence, 21(3), 859864.
Swindell, W. R., Huebner, M., & Weber, A. P. (2007).
Transcriptional profiling of Arabidopsis heat shock proteins
and transcription factors reveals extensive overlap between
heat and non-heat stress response pathways. BMC Genomics,
8(1), 125. doi:10.1186/1471-2164-8-125.
Tyedmers, J., Mogk, A., & Bukau, B. (2010). Cellular strategies
for controlling protein aggregation. Nature Reviews
Molecular Cell Biology, 11(11), 777788. doi:10.1038
/nrm2993.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy,
N., De Paepe, A., & Speleman, F. (2002). Accurate normal-
ization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome
Biology, 3(7), RESEARCH0034. doi:10.1186/gb-2002-3-7-
research0034.
Waters, E. R. (2013). The evolution, function, structure, and
expression of the plant sHSPs. Journal of Experimental
Botany, 64(2), 391403. doi:10.1093/jxb/ers355.
Waters, E. R., Aevermann, B. D., & Sanders-Reed, Z. (2008).
Comparative analysis of the small heat shock proteins in
Water Air Soil Pollut (2017) 228:101
three angiosperm genomes identifies new subfamilies and
reveals diverse evolutionary patterns. Cell Stress and
Chaperones, 13(2), 127142. doi:10.1007/s12192-008-
0023-7.
Weisman, D., Alkio, M., & Coln-Carmona, A. (2010).
Transcriptional responses to polycyclic aromatic
hydrocarbon-induced stress in Arabidopsis thaliana reveal
the involvement of hormone and defense signaling pathways.
BMC Plant Biology, 10(1), 59. http://www.ncbi.nlm.nih.
gov/pubmed/20377843.
Page 11 of 11 101
Youssef, T. (2002). Physiological responses of Avicennia marina
seedlings to the phytotoxic effects of the water-soluble frac-
tion of light Arabian crude oil. Environmentalist, 22(2), 149
159. doi:10.1023/A:1015385700669.
Zhao, S., & Fernald, R. D. (2005). Comprehensive algorithm for
quantitative real-time polymerase chain reaction. Journal of
Computational Biology, 12(8), 10471064. doi:10.1089
/cmb.2005.12.1047.