Journal of Ethnopharmacology 179 (2016) 146155

Contents lists available at ScienceDirect

Journal of Ethnopharmacology
journal homepage: www.elsevier.com/locate/jep

Mosla scabra avonoids ameliorate the inuenza A virus-induced lung

injury and water transport abnormality via the inhibition of PRR and
AQP signaling pathways in mice
Chen-Huan Yu a, Wen-Ying Yu a, Jie Fang a, Huan-Huan Zhang a, Yue Ma a, Bing Yu b,
Fang Wu a,b, Xiao-Ning Wu c,n
a
Key Laboratory of Experimental Animal and Safety Evaluation, Zhejiang Academy of Medical Sciences, Hangzhou 310013, China
b
College of Pharmacy, Zhejiang Chinese Medical University, Hangzhou 310053, China
c
Pharmaceutical Department, Zhejiang Medical College, Hangzhou 310053, China

art ic l e i nf o a b s t r a c t

Article history: Ethnopharmacrological relevance: Mosla scabra (Thunb.) C.Y. Wu and H.W. Li has been used as a tradi-
Received 2 August 2015 tional medicinal herb for centuries in East Asian countries. It has antibacterial, antiviral, antioxidant, anti-
Received in revised form inammatory and immunomodulatory effects. In folk medicine, it is used as a remedy for the treatment
17 December 2015
of pulmonary diseases, such as fever, cold, cough, pulmonary edema and emphysema.
Accepted 20 December 2015
Available online 21 December 2015
Aim of the study: This study was to investigate the protective mechanism of total avonoids from M.
scabra (MF) in inuenza A virus (IAV)-infected mice.
Keywords: Materials and methods: The mice were infected with IAV and then were treated daily with MF for ve
Antiviral days. At the end of the experiment, the levels of inammatory-related cytokines (IFN-, IL-6, TNF- and
Aquaporin 5 IL-1) were determined by ELISA. Pathological changes of lung tissue were examined by H&E staining.
Vasoactive intestinal peptide
The protein expressions of AQP5, p-p38, caspase-3 and NF-B p65 were detected by western blot analysis
Apoptosis
while the gene expressions of key effectors in AQP5 and PRRs signaling pathways were detected by real-
Inammation
time Fluorescence Quantitative Polymerase Chain Reaction (RFQ-PCR) analysis.
Results: The results showed that treatment with MF at doses of 120360 mg/kg for ve days to IAV-
infected mice signicantly attenuated IAV-induced pulmonary injury and decreased the serum levels of
IL-6, TNF- and IL-1, but increased IFN- levels. MF treatment could up-regulate the mRNA expressions
of TLR-7, RIG-1, TRAF6, Bcl-2, Bax, VIPR1, PKC and AQP5 and down-regulate caspase-3 and NF-B p65
protein expression.
Conclusion: Treatment with MF could signicantly alleviate IAV-induced pulmonary inammation,
apoptosis and water transport abnormality, which was probably through the regulation of TLR7, RIG-1
and AQP5 signaling pathway.
& 2016 Elsevier Ireland Ltd. All rights reserved.

1. Introduction respiratory injury worldwide (Huang et al., 2015). The neur-

aminidase inhibitor oseltamivir has a lasting effect for treating the
Outbreaks of the inuenza A virus (IAV) often occur in various patients infected with the pandemic inuenza virus. However,
avian and mammalian species, including humans, causing serious drug-resistant mutants emerged rapidly with the increasing use of

Abbreviations: MF, total avonoids extracted from Mosla Scabra; IAV, inuenza A virus; LD50, 50% lethal dose; RFQ-PCR, Real-time Fluorescence Quantitative Polymerase
Chain Reaction; IC50, 50% inuenza virus-inhibitory concentration; HDF-1, 5-hydroxy-6,7-dimethoxyavone; HDF-2, 5-hydroxy-7,8-dimethoxyavone; HDF-3, 5-hydroxy-7-
methoxyavone; IFN-, interferon ; IL-6, interleukin 6; PVDF, polyvinylidene uoride; TBST, mixture of Tris-Buffered Saline and Tween 20; NF-B, nuclear factor-kappa B;
MAPK, mitogen-activated protein kinase; HPLC, High Performance Liquid Chromatography; NC, normal control group; MC, model control group; PC, positive control group;
MF40, MF low-dose group (40 mg/kg); MF120, MF middle-dose group (120 mg/kg); MF360, MF high-dose group (360 mg/kg); TNF-, tumor necrosis factor ; PRRs, pattern
recognition receptors; VIP, vasoactive intestinal peptide; pGLV-VIP, VIP gene cloned into pGLV giardiavirus lentiviral vector; VIPR1, vasoactive intestinal peptide receptor 1;
AQP5, aquaporin 5; TLR7, toll like receptor 7; RIG-1, retinoic acid-inducible gene 1; TRAF6, tumor necrosis factor receptor-associated factor 6; IRF3, IFN regulatory factor 3;
NF-B, nuclear factor kappa B; Caspase-3, cysteinyl aspartate specic proteinase 3; PKC, protein kinase C alpha subtype; Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X
protein; p-IB-, phosphorylation of inhibitor of nuclear factor-B alpha
n
Corresponding author.
E-mail address: Jellycook2002@163.com (X.-N. Wu).

http://dx.doi.org/10.1016/j.jep.2015.12.034
0378-8741/& 2016 Elsevier Ireland Ltd. All rights reserved.
 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155
oseltamivir and showed enhanced pathogenic properties (Sher-
bany et al., 2014). These statistics highlight the urgent need for
available anti-inuenza agents.
Mosla scabra (Thunb.) C.Y. Wu and H. W. Li is a tomentose and
aromatic plant belonging to the Lamiaceae family. This herb has
been used in traditional medicine for centuries and is widely
distributed in Korea, Japan, China, and other East Asian countries
(Chen et al., 2013). It is described as a basic component of antiviral,
antipyretic and antitussive medicines in the authoritative medical
book of Ancient China Compendium of Materia Medica and the
2012 version of the Chinese medicine processing regulations of
Zhejiang Province, of which the dose is 515 g daily. In folk
medicine, M. scabra has been used as a remedy for the treatment
of pulmonary diseases for thousands of years and ancient people
brewed its fresh leaves for tea to prevent colds (Yu et al., 2010).
Especially in Jiangsu, Zhejiang, Taiwan and other coastal areas,
leaves and spica of M. scabra and its kindred plants have been used
in popular medicine to treat cough, cold and u for centuries
(Chen et al., 1989; Je et al., 2013; Wang et al., 2000). Recently,
considerable attention has been given to the antibacterial, anti-
viral, anti-allergic, anti-inammatory and immunomodulatory
substances contained in these plants (Wang et al., 2000; Lee et al.,
2006; Kim et al., 2000; Wu et al., 2010; Yu et al., 2010). The main
polyphenolic compounds of the herb have been identied as ur-
solic acid, oleanolic acid, 5-hydroxy-6,7-dimethoxyavone (HDF-
1), 5-hydroxy-7,8-dimethoxyavone (HDF-2), 5-hydroxy-7-meth-
oxyavone (HDF-3), apigenin, acacetin (Wu et al., 2010) while the
aromatic compounds in the essential oils are elemicin, thymol, -
caryophyllene, asarone and -caryophyllene (Wu et al., 2012).
Previous reports have demonstrated that the aqueous extract from
M. scabra (AEMS) had low toxicity and could inhibit IAV replication
in embryonated eggs (Yu et al., 2010). Furthermore, the oral ad-
ministration of AEMS signicantly increased the interferon (IFN)-
and decreased the high levels of IL-6 on mouse serum after IAV
infection (Yu et al., 2010). Flavonoids from M. scabra signicantly
attenuated lipopolysaccharide- induced pulmonary inammation
in mice though suppressing the activation of TLR4/MAPK/NF-B
signaling (Chen et al., 2013). Those properties may be indicative of
the potential benet in the pulmonary tract. However, antiviral
properties and possible molecular mechanisms of M. scabra a-
vonoids (MF) against IAV-induced lung damage remain unknown.
In this study, protective effect of MF was evaluated on a mouse
model infected with IAV.
2. Materials and methods
2.1. Virus and reagents
The inuenza A/PR/8/34 virus (H1N1 subtype) was donated by
Professor Yi-yu Lu from the Zhejiang Center for Disease Control
and Prevention (China). The infection was induced under ether
anesthesia by intranasal inoculation of IAV, which was adapted to
mouse lungs with tissue culture infective dose (TCID50) 10
3.5.
This virus caused pneumonia in mice.
2.2. MF preparation and quality control
The leaves of the plant were obtained from Linan planting base
(Zhejiang, China), and identied by Dr. Wei Cai, Zhejiang Chinese
Medical University. The voucher specimen (Reference number
Y20141012-2) has been deposited at Pharmaceutical Department,
Zhejiang Medical College, Zhejiang, China.
The dried plant material (5.0 kg) was extracted once with water
(10 L) at 100 C for 60 min. The ltrates were dried to one tenth of
initial volume under reduced pressure for later use. Preprocessed AB-
147
8 resins (wet weight 200 g) were used to adsorb avonoids from the
aqueous extract at room temperature (25 C) for 24 h. The resins
were eluted with water to eliminate water-soluble ingredients and
then eluted with 80% ethanol to separate total avonoids. The eluted
solution in 80% ethanol fractions was concentrated and dried for
further study. MF used in the study was endotoxin free.
The concentrations of the markers HDF-1, HDF-2, and HDF-3 in
MF were also determined by high-performance liquid chromato-
graphy (HPLC) as previously described (Chen et al., 2013). HPLC
experiments were performed on an Agilent 1200 HPLC system
equipped with Hypersil BDS C18 (250 mm  4.6 mm, 5 m) col-
umn, vacuum degasser, binary pump and UVvis detector. Me-
thanol-0.1% phosphoric acid (70:30, v/v) was used as the mobile
phase with a ow rate of 1 ml/min. The column temperature was
set at 20 C and detection wave length at 254 nm. The injection
volume was 20 l. All samples were ltered through 0.45 m
membrane before injection.
2.3. Animal experiments
2.3.1. Pharmacodynamic experiment
Male ICR mice (5-week-old, 20 72 g) were obtained from
Zhejiang Laboratory Animal Centre (Zhejiang, China). Mice were
housed in an air-conditioned room (temperature of 2272 C, re-
lative humidity of 5575%) with a 12 h light and 12 h dark cycle
environment and with free access to food and water. The mice
were allowed to acclimatize for 3 days before the experiments. The
experiments were carried out following protocols approved by the
Anima Ethics Committee, Zhejiang Academy of Medical Sciences.
All experiments were performed in accordance with the Guide for
the Care and Use of Laboratory Animals.
The mice were intranasally challenged with ten times of the
50% lethal dose (LD50) for the inuenza A virus (IAV) (Wan et al.,
2014) and randomly divided into ve groups: model control group
(MC), ribavirin-treated group (as the positive control, PC; 100 mg/
kg), MF low-dose group (MF40, 40 mg/kg MF), MF middle-dose
group (MF120, 120 mg/kg MF), and the MF high-dose group
(MF360, 360 mg/kg MF). Each group had ten animals. Ten addi-
tional mice were intranasally challenged with a saline solution and
treated as the normal control group (NC). MF and ribavirin were
intragastrically administered once daily for 5 d, starting from 2 h
after infection. The mice in NC and MC were given only the saline
solution at the same intervals. All the mice had free access to food
and water during the experimental period.
2.3.2. Verication of the vasoactive intestinal peptide (VIP)
To verify the pharmacodynamic targets of MF, the VIP levels of
the IAV-infected mouse lung were over-expressed using re-
combinant lentivirus vectors. A total of 50 mice were intranasally
challenged with IAV and then divided randomly into ve groups.
Each group had ten mice. Mice in the normal group were orally
administered with saline once daily for ve consecutive days. In
the model group, infected mice were treated with a saline solution
once daily for ve consecutive days. In the VIP group, infected
mice were intravenously injected with 80 ng/kg of the pGLV-VIP
recombinant lentivirus vector (Shanghai Xinji Biotech Co., Ltd.,
China) on days 1, 3, and 5. In the VIP negative control (VIPcon)
group, infected mice were intravenously injected with 80 ng/kg of
the blank recombinant lentivirus vector (Shanghai Xinji Biotech
Co., Ltd., China) on days 1, 3, and 5. In the MF group, infected mice
were orally administered with 360 mg/kg MF (dissolved in 0.9%
saline) once daily for ve consecutive days. In the MF VIP co-
treated group, infected mice were intravenously injected with
80 ng/kg of the pGLV-VIP recombinant lentivirus vector on days 1,
3, and 5 and were orally administered with 360 mg/kg MF (dis-
solved in 0.9% saline) once daily for ve consecutive days.
148 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155

Table 1
Sequences of primers used for the RFQ-PCR assays.

Gene Primer sequences (5 to 3) Size (bp) Annealing (C)

TLR7 F: GGCATTCCCACTAACACCACCAA 143 63

R: GCTTTGGACCCCAGTAGAACAGG
TRAF6 F: GAATCACTTGGCACGACACTT 227 63
R: GAGTTTCCATTTTGGCAGTCA
VIP F: TCTCGGAAGATCCTGTGCCAATC 77 63
R: TTGCTTTCTGAGGCGGGTGTAG
PKCa F: CCACCAAGGGATGAAATGTGACA 81 63
R: ATTCCGCAGAGGCTAGGGACAT
AQP5 F: GCTGGAGAGGCAGCATTGGAT 125 62
R: GTCTGAGCTGTGGCAGTCGTT
RIG-I F: CAGCTACATGAGTTCCTGGCTCGA 180 63
R: CAAAGTCCACAGTAACCTGCATGGT
Bcl-2 F: GCTGGGATGCCTTTGTGGAACT 71 62
R: CAGAGACAGCCAGGAGAAATCAAAC
Bax F: GGAGATGAACTGGACAGCAATATGG 155 63
R: CTAGCAAAGTAGAAGAGGGCAACCA
18S (internal reference) F: CGGACACGGACAGGATTGACA 94 62
R: CCAGACAAATCGCTCCACCAACTA

2.4. Serum cytokine analysis
After 5 d of treatment, the body weight of the animals was
measured before they were sacriced. Blood samples were collected
and centrifuged at 3000g for 20 min to obtain the serum, which
was stored at 4 C until use. The serum levels of IFN-, IL-6, tumor
necrosis factor (TNF)-, and IL-1 were determined by enzyme
linked immunosorbent assay (ELISA). The ELISA kits used in this
study were obtained from Biovol Technologies (Shanghai, China).
2.5. Histopathology
The whole lungs of ten mice in each group were removed. A
portion of each lung was dissected and xed in a 10% neutral
buffered formalin solution. The remaining lung tissue was quickly
frozen and kept at
80 C for biochemical analysis. The xed
tissues were routinely processed, embedded in parafn, sectioned
into 4-m-thick sections, deparafnized, and rehydrated according
to standard techniques. All the tissue sections were stained with
hematoxylin and eosin.
2.6. Immunohistochemistry analysis
The protein expression levels of aquaporin (AQP) 5, Toll-like
receptor (TLR) 7, and retinoic acid-inducible gene 1 (RIG-1) were
detected with the corresponding immunohistochemistry detection
kit and the enhanced kit (Biovol Technologies, Shanghai, China).
The percentage areas of the positive protein staining slides were

mAU

S1
S2

Time (min)

A B C
Fig. 1. HPLC chromatographic proles of standards (S1) and MF (S2). The isolated compounds were identied in the extract by comparing their retention times. The
chromatograms were obtained at a wavelength of 254 nm. (A) 5-hydroxy-6,7-dimethoxyavone (B) 5-hydroxy-7,8-dimethoxyavone (C) 5-hydroxy-7-methoxyavone.
 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155 149

Table 2 reverse primers (i.e., nal concentration of each, 0.5 M), 12.5 L
The inhibition of MF or ribavirin on lung index of IAV-infected mice. 2  SYBR Green, and nuclease-free water for a nal volume of
Group Dose (mg/kg) Lung index (mg/g) Inhibitory rate (%) 25 L for each reaction. The following thermal prole for the RFQ-
PCR assays was used in all the primer sets: 95 C for 1 min, fol-
NC 7.357 0.68d lowed by 40 cycles of denaturation at 95 C for 10 s, annealing at
MC 19.26 7 4.67a
PC 100 15.127 3.60b 21.50
55 C for 25 s, and elongation at 64 C for 25 s with the acquisition
MF40 40 17.337 4.76 ab 10.02 of uorescent data. The relative expression levels of the genes
MF120 120 12.80 7 4.45b 33.54 were calculated using the 2
Ct  106 method.
MF360 360 9.167 2.80c 52.44

NC, normal control group; MC, model control group; PC, positive control group
(treatment with ribavirin); MF40, IAV-infected mice treated with MF (40 mg/kg);
MF120, IAV-infected mice treated with MF (120 mg/kg); MF360, IAV-infected mice
treated with MF (360 mg/kg).
Data denoted were means 7 SD (n 10). Different letters indicate statistically sig-
nicant differences, Po 0.05 (Tukey's test).
analyzed with Image Pro Plus version 6.0. Ten discontinuous his-
tological elds were randomly chosen under a 200  magnica-
tion objective lens for each slide.
2.7. RFQ-PCR analysis
The mouse lung samples were homogenized and extracted
with Trizol reagents to obtain the total RNAs (Biotechnology Co.,
Ltd., Shanghai, China). The cDNA was synthesized according to the
kit protocol (TaKaRa, Dalian, China). The specic primer pairs
[vasoactive intestinal peptide receptor 1 (VIPR1), tumor necrosis
factor receptor-associated factor 6 (TRAF6), AQP5, protein kinase C
alpha subtype (PKC), TLR-7, RIG-1, Bcl-2-associated X protein
(Bax), B-cell lymphoma-2 (Bcl-2), and 18sRNA] were designed and
used for the analysis as shown in Table 1. These primers were
synthesized by the Shanghai Biotechnology Co., Ltd. (China). The
eukaryotic 18S rRNA was primarily selected as the housekeeping
gene in this study because of the limited change in its expression
under different experimental conditions.
The amplication reaction was conducted in a 25 L glass ca-
pillary containing 2 L of cDNA, 0.5 L of each of the forward and
2.8. Western blot analysis
Briey, the proteins were extracted from the lung tissue of each
mouse and the protein levels in the supernatants were determined
by using commercial kits (Jiancheng Biotechnology Institute,
Nanjing, China). Each sample (60 g) was separated by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and transferred onto PVDF membranes by electrophoretic transfer
(Bio-Rad Laboratories, USA). The membranes were then probed
with an antibody reactive with VIP, AQP5, IFN regulatory factor 3
(IRF3), nuclear factor kappa B subunit p65 (NF-B p65), cysteinyl
aspartate specic proteinase 3 (caspase-3) or phosphorylation of
inhibitor of nuclear factor-B alpha (p-IB-) (Santa Cruz, USA) at
4 C overnight. After washed with TBST, the blots were incubated
with horseradish peroxidase-conjugated secondary antibodies for
s
one hour. The blots were developed by a SuperSignal West Dura
Extended Duration Substrate (Pierce, USA). -Actin (Santa Cruz,
USA) was used as the loading control.
2.9. Statistical analysis
All values were expressed as mean values 7standard deviation
(SD). All statistical analyses were performed using one-way AN-
OVA followed by the Turkey's post hoc test. Po 0.05 was con-
sidered statistically signicant.

A B C

100 m 100 m 100 m

D E F

100 m 100 m 100 m

Fig. 2. Effects of MF on IVA-infected lung histopathogic changes. Lungs from each experimental group were processed for histological evaluation: (A) the lung section from
the normal control group; (B) the lung section from model control group; (C) the lung section from IVA-infected and treated with Ribavirin (100 mg/kg). (D, E and F) the lung
section from the IVA-infected and treated with 40, 120 and 360 mg/kg of MF, respectively. Representative histological section of the lungs was stained by hematoxylin and
eosin.
150 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155

Table 3
Effects of MF on serum cytokines in IAV-infected mice.

group Dose (mg/kg) IFN- (pg/mL) IL-6 (pg/mL) TNF- (pg/mL) IL-1 (pg/mL)

NC 45.317 7.16c 39.487 3.86c 17.357 1.69b 24.357 3.71c

MC 63.36 7 7.83b 94.32 7 22.04a 35.29 7 4.18a 48.107 5.13a
PC 100 50.067 7.50c 33.82 7 5.99c 15.517 2.66c 23.247 3.40c
MF40 40 59.42 7 7.73bc 87.83 7 14.60a 22.28 7 1.88b 45.777 4.30a
MF120 120 75.81 7 8.37a 83.09 7 16.81a 18.277 2.50b 37.187 4.42b
MF360 360 86.80 7 7.68a 62.317 12.81b 17.08 7 2.76bc 28.687 5.03c

NC, normal control group; MC, model control group; PC, positive control group (treatment with ribavirin); MF40, IAV-infected mice treated with MF (40 mg/kg); MF120, IAV-
infected mice treated with MF (120 mg/kg); MF360, IAV-infected mice treated with MF (360 mg/kg).
Data denoted were means 7 SD (n 10). Different letters indicate statistically signicant differences, P o 0.05 (Tukey's test).

(A) 3.3. Effects of MF on inammatory cytokine production

35.0
a The serum levels of IFN-, IL-1, IL-6 and TNF- were measured
Relative expression of target genes

30.0 a to observe the inammatory cytokine levels of peripheral blood

b TLR7
during IAV infection. As shown in Table 3, above cytokines in the
25.0 b a e RIG-1
b
MC group were dramatically increased compared with those in the
a
NC group (P o0.05). Treatment with MF at the doses of 120
(2- Ct108)

TRAF6
20.0
Bcl-2 360 mg/kg prevented the release of IL-1, IL-6, and TNF-, but
c c d
c a c b
15.0 ac c b
c c Bax promoted the levels of IFN- (P o0.05), whereas the IFN- levels
a
d
b d b b VIPR1 decreased in the PC group.
10.0 a b
a c c a PKC
d d b
5.0 e c AQP5 3.4. Effects of MF on the expression of mRNAs in the AQP5 and PRR
e dd d
signaling pathways in the lung tissue of IAV-infected mice
0.0
NC MC MF40 MF120 MF360
After ve days of IAV infection, the functional genes (the
(B) adaptor VIPR1 and its downstream genes PKC and AQP5) in the
AQP5 signaling pathway were decreased signicantly in the MC
Caspase-3 compared with those in the NC (P o0.05; Fig. 3). By contrast, the
expression of TLR7, RIG-1, TRAF6, Bax, and Bcl-2 mRNA in the PRR
NF-B p65
pathway was signicantly increased in MC (P o0.05).
-actin After ve days of oral MF administration, the mRNA expressions
of VIPR1, PKC, and AQP5 in the lung tissues of the MF-treated mice
Fig. 3. Levels of key gene mRNA in AQP5 and PRRs signaling pathways by RT-PCR were signicantly increased than those in MC (Po0.05). The ex-
analysis. Data denoted were means7 SD (n 10). NC, normal control group; MF40,
pressions of TLR7, RIG-1, and TRAF6 mRNAs were also signicantly
IAV-infected mice treated with MF (40 mg/kg); MF120, IAV-infected mice treated
with MF (120 mg/kg); MF360, IAV-infected mice treated with MF (360 mg/kg). increased than in the MC group. Moreover, the ratios of Bcl-2 to Bax
Different letters indicate statistically signicant differences, Po 0.05 (Tukey's test). in MC (1.5170.37) signicantly decreased compared with those in
NC (2.3070.56; Po0.05). However, the ratios of Bcl-2 to Bax in the
3. Results MF-treated groups signicantly increased compared with that in
MC. More interestingly, the ratios that remained at 2.070.22 did
3.1. Quality evaluation of MF not increase as the MF dose was increased.

The three marker compounds in MF shown in Fig. 1 were well 3.5. Effects of MF on the expression of key proteins in the AQP5 and
identied by comparing their retention times and UV spectra with PRR signaling pathways in the lung tissue of IAV-infected mice
the reference standards. HPLC analysis revealed that the HDF-1,
HDF-2, and HDF-3 concentrations in the extract were 145.4, 85.1, The photomicrographs in Fig. 4 showed the protein expression
and 36.3 mg/g, respectively. levels of TLR7, RIG-1 and AQP5 in the lung tissues. The expression
of these proteins was barely detected in the lung tissue of normal
3.2. Histological analysis mice, whereas their expression obviously increased in the MC
group. After treatment with MF, the average integral optical den-
The histological changes in the lungs of the mice were noted sities of the TLR7, RIG-1, and AQP5 proteins were much higher
with the aggravation of the infection. Compared with those in the (P o0.05) than those in the MC (Fig. 4D), thereby indicating that
NC group, the mouse lung index in the MC group was signicantly MF could up-regulate the expression of the TLR7, RIG-1, and AQP5
increased as shown in Table 2, and the acute lung injury char- proteins. These ndings were consistent with the above-men-
acterized by the presence of interstitial edema, hemorrhage and tioned mRNA expression as shown in Fig. 3.
inltration of inammatory cells could also be observed in the tis-
sues (Fig. 2). However, the lung indexes of the MF-treated groups 3.6. Effects of MF on AQP5 expression in VIP over-expressing lung
(120 and 360 mg/kg) was signicantly decreased compared with cells
those of the MC group (Po0.05), and the histological damages were
improved by the MF treatment (120 and 360 mg/kg). These results As shown in Fig. 5A, the VIP gene expression signicantly
indicated that the daily administration of MF for ve days could increased (P o 0.05) after the intravenous injection of the pGLV-
effectively reduce the IAV-induced acute lung injury and prevent VIP recombinant lentivirus vectors. By contrast, the blank vectors
IAV-induced pneumonia in a dose-dependent manner. did not cause VIP gene expression in the lung cells of infected
 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155 151

(A) TLR-7

NC MC MF40 MF120 MF360

(B) RIG-I

NC MC MF40 MF120 MF360

(C) AQP5

NC MC MF40 MF120 MF360

(D)
6.0
Average integral optical densities

TLR7 RIG-1 AQP5

5.0
a
4.0
a a a
3.0 b
b b b
bc
c c
2.0
c d e d

1.0

0.0
NC MC MF40 MF120 MF360
Fig. 4. Immunostaining microphotographs of TLR-7 (A), RIG-I (B) and AQP5 proteins (C) in the lung tissues of IAV-infected mice (  200). (D) Average integral optical
densities. Data denoted were means 7 SD (n 10). Different letters indicate statistically signicant differences, Po 0.05 (Tukey's test).

mice. Therefore, the specic vectors could effectively up-regulate
VIP gene expression without aggravating the IAV-induced acute
lung injury.
Furthermore, the results of the western blot analysis showed
that the expression levels of p-p38 and AQP5 proteins in MC were
signicantly decreased (Po 0.05). After treatment with the VIP-
recombinant lentivirus vectors or MF, the expression levels of
p-p38 and AQP5 signicantly increased compared with those in
MC (P o0.05). These results agreed with the observed expression
of these genes as determined by RFQ-PCR. However, when co-
treated with the VIP vector and MF, the increased expression of
p-p38 and AQP5 was relatively lower than with the VIP vector
treatment alone but higher than with MF alone. Therefore, both
the VIP vector and MF could act on the VIP receptor (VIPR) and
activate the downstream targets.
4. Discussion
Flavonoids are found abundantly in vegetables, fruits, and
herbs (Terahara, 2015), which possess various pharmacological
effects, which are attributed to their direct antioxidant properties
and inhibition of inammatory mediator production (Shalini et al.,
2012; Duarte et al., 2014; Hou et al., 2015; Shen et al., 2015). In this
152 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155

(A) effectiveness against inuenza viruses (Wu et al., 2010); these

compounds can prevent the LPS-induced pulmonary histopatho-
logical changes and the suppressed secretion of pro-inammatory
VIP mediators by inhibiting the NF-B and p38 pathways (Chen et al.,
2013). However, the traditional use of M. scabra against IAV-in-
duced inammation and dysfunctional water metabolism has not
-actin been fully understood. Given that the pathology of inuenza virus
infection involves several aspects, we evaluated the protective
NC MC VIP VIPcon MF MF+VIP effects of MF on a mouse model infected with IAV.
Innate immunity is the primary line of antiviral defense (Faure
0.6 and Rabourdin-Combe, 2011). This type of immunity allows the
infected and neighboring cells to establish an early antiviral state
a in the host after virus exposure. Innate immunity also prepares the
0.5
Relative expression

b adaptive immune response and recognizes viral components

0.4 through PRRs during infection (Gerlier and Valentin, 2009; Ta-
c c keuchi and Akira, 2009). IAV infection is recognized through two
0.3 classic adaptors of PRRs to induce robust type I IFN (IFN-/) re-
sponses; these PRR pathways involve TLR7 in the endosome and
0.2 RIG-I in the cytosol. Both of them (Fig. 6) converge on TRAF6, IRF3
d d and IRF7 to induce the production of proinammatory cytokines
0.1 and type I IFNs, respectively (Iwasaki and Pillai, 2014; Ramirez-
Ortiz et al., 2015). The induction of pro-inammatory cytokines
0 and IFNs is important to induce antiviral gene expression, which
interfere with viral replication, recruit leukocytes and lympho-
NC MC VIP VIPcon MF MF+VIP
cytes to the infection part, and provide the requisite signals,
thereby activating the adaptive immune response for efcient viral
(B) clearance (Zhao et al., 2014).
In this study, we showed that the administration of MF can
AQP5 signicantly increase the serum levels of IFN- but decrease the
levels of other pro-inammatory cytokines (IL-6, TNF- and IL-1).
Previous studies have shown that IFN- has an important role in
the control of inuenza infection (James et al., 2007; Wei et al.,
p-p38 2010). By contrast, the gene expression of TLR7 and RIG-I is ob-
viously up-regulated compared with the MC group, which in-
dicates that both of the abovementioned pathways are activated.
-actin Simultaneously, the IRF3 protein levels remain high, whereas
p-IB- and NF-B p65 have a lower expression. These ndings are
also consistent with above analysis of serum pro-inammatory
NC MC MF VIP VIPcon MF+VIP cytokines. These results are noteworthy because p-IB- and NF-
B p65 are known to have crucial functions in the inammatory
0.6 response (Caposio et al., 2007; Rahman et al., 2009; Hang et al.,
p-p38 AQP5 aa 2011; Dong et al., 2013). Therefore, these combined results sug-
Relative expression

0.5
c b
0.4 c c c
c
0.3 d
d Apoptosis in the lung epithelial cells is closely related to IAV
d infection and reproduction compared with other types of patho-
0.2
0.1
0 cells, which leads to tissue damage (including multiple organ
NC MC MF VIP VIPcon MF+VIP
Fig. 5. Effects of MF on AQP5 protein expression in lung tissues of IAV-infected
mice. (A) Evaluation of recombinant lentivirus vector for mouse VIP gene over-
expression. (B) Western blot analysis of p-p38, and AQP5 protein expressions.
Values indicated fold changes compared with internal control (-actin). Data de-
noted were means 7SD (n 10). Different letters indicate statistically signicant
differences, Po 0.05 (Tukey's test). NC, normal control group; MF, IAV-infected
mice treated with MF (360 mg/kg); VIP, IAV-infected mice treated with re-
combinant lentivirus vectors of VIP (80 ng/kg); VIPcon, IAV-infected mice treated
with blank recombinant lentivirus vectors; MF VIP, IAV-infected mice treated with
recombinant lentivirus vectors of VIP (80 ng/kg) and MF (360 mg/kg).
study, the main bioactive components in MF were HDF-1, HDF-2,
and HDF-3 by the HPLC analysis. Our previous studies demon-
strated that these avonoids from M. scabra have a similar
b gested that the effects of MF during IAV infection is partially de-
pendent on the activation of IRF3 and IRF7 via the TLR7 and RIG-I
pathways to induce the type I IFNs production, rather than via the
NF-B pathway.
genesis (Liu et al., 2014). Apoptotic induction in mammals is pri-
marily a host defense mechanism of maintaining homeostasis.
However, apoptosis causes the excessive removal of virus-infected
dysfunction) and conversely causes effective IAV replication
(Herold et al., 2012; Tripathi et al., 2013; Ke et al., 2014; Pei et al.,
2014). The up-regulation of Bcl-2 prevents the cytochrome c re-
lease, thereby inhibiting the caspase cascade activation and in-
ducing cell apoptosis. By contrast, Bax reverses the process (Nen-
cioni et al., 2009). Although the mRNA levels of Bcl-2 and Bax both
increase during IAV infection, the ratio of both proteins sig-
nicantly decrease in infected individuals compared with those in
NC. This trend implies that the severity of IAV infection is closely
related to the excessive regulation of apoptosis. However, the ratio
of Bcl-2/Bax is much higher after MF treatment than that in MC
but lower than that in NC, indicating the anti-apoptotic effects of
MF do not show a dosage-effect relationship. Therefore, MF can
inhibit the apoptosis caused by IAV infection.
 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155 153

Fig. 6. Two classes of pattern-recognition receptors (PRRs) for RNA virus recognition. ssRNA from viruses is recognized by Toll-like receptor 7 (TLR7), whereas dsRNA is
detected by Retinoic acid-inducible gene I (RIG-I). Both TLR7 and RIG-I signaling pathways can induce the activation of IRF3/7, which results in the production of type I
interferons (IFN-/) and NF-B, which induces the expression of pro-inammatory cytokines.

VIP is one of the most abundant neuropeptides, which is in-
volved in numerous biological functions of the respiratory system,
including the smooth muscle layers of the pulmonary trachea,
bronchus, pulmonary vessel, bronchial wall, and submucosal
glands (Busto et al., 2000; Said, 2007). VIP causes the relaxation of
airway smooth muscles and inhibits the proliferation of the
smooth muscle cells of the airway (Zhilinskaia et al., 1991; Szema
et al., 2011). It is the initial target of the inuenza virus because of
its synthesis and secretion by alveolar epithelial cells (Ke et al.,
2014). When asthma, acute lung injury, and other respiratory
diseases occur, the epithelial cells of the airway can excite in-
trapulmonary nonadrenergic and noncholinergic vasodilator
nerves via the axon reex to release a large quantity of VIP (St
Hilaire et al., 2009). This neuropeptide can constrict blood vessels,
reduce the release of inammatory mediators, and scavenge for
oxygen free radicals (Jiang et al., 2012; Carrion et al., 2013; Askar
et al., 2015). Therefore, this neuropeptide has an important part in
the outcome of u symptoms. In this study, pGLV3-VIP re-
combinant lentivirus vectors were administered to IAV-infected
mice to increase the VIP expression in pulmonary epithelial cells
and to investigate its regulation of AQP5 expression. However,
these effects cannot be observed through the direct administration
of VIP because of its short half-life period (Busto et al., 2000). The
biological effects of VIP depend on its content and the expression
of its receptor. However, observing the overall effects in an animal
disease model is difcult. We ligated the coding sequence of VIP to
the lentivirus vector pGLV3 and obtained the pGLV3-VIP re-
combinant lentivirus vector through packing as a substitute for VIP
in the in vivo experiment. RFQ-PCR analysis showed that, after the
administration of pGLV3-VIP vectors to infected mice, the VIP
mRNA expression in lung tissue signicantly increased. Moreover,
the administration of negative vectors could not increase the VIP
mRNA expression. The abovementioned ndings prove that the
proposed method is feasible. The subsequent pharmacodynamic
experiments of RFQ-PCR detection showed that the VIPR1 mRNA
expression in the MF and VIP groups increased. However, the in-
crement of VIPR1 mRNA expression in the MF VIP group was not
the sum of the MF and VIP increments. Instead, an intermediate
level of expression was observed; this level was higher than that in
the MF group but lower than that in the VIP group. These results
suggested that MF and VIP act on VIPR. In addition, the afnity
between MF and VIPR is larger than that between VIP and VIPR.
However, given the observed low intrinsic activity, the increment
of VIP mRNA expression with the combined use of MF and VIP
cannot reach the increment caused by simple use of the VIP agent.
Therefore, MF may be a competitive agonist of VIPR.
The water channel protein, also known as AQP, is a membrane
protein with a specic permeability to water (Murakami et al.,
2006). To date, thirteen types of water channel proteins have al-
ready been discovered in mammals. The four AQPs in lung tissues
are AQP1, AQP3, AQP4, and AQP5. AQP5 alone is found in the al-
veolar epithelial cell membrane, which mainly covers type I al-
veolar cells. Type I alveolar cells are known to cover 95% of the
total alveolar area as the major space for gaseous exchange; these
cells mainly determine the water permeability. Therefore, AQP5
removes the moisture in the alveolar cavity and has a central role
in regulating interstitial pulmonary edema (Zhang et al., 2009; Jin
et al., 2013a; Jin et al., 2013b). The reduced quantity or functional
downregulation of AQP5 can limit the ability of an organism to
remove excess liquid in lung tissues, thereby inducing or
154 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155
aggravating alveolar and interstitial edema (Towne et al., 2000;
Han et al., 2015). The results of RFQ-PCR and im-
munohistochemistry in our study showed that the expression of
AQP5 mRNA and protein are signicantly reduced in the lung
tissues of MC, whereas a signicant increase is observed in the
MF- and VIP-treated groups. Therefore, MF can promote water
metabolism by increasing AQP5 expression to ease interstitial
pulmonary edema and improve physical damage.
VIP is closely related to AQP5 activation during viral infection.
VIP can combine with the Gs protein receptor on the cell surface to
activate adenylate cyclase, increase the concentration of in-
tracellular cyclic AMP, and activate protein kinases (PKC) and p38
MAPK phosphorylation (p-p38 MAPK) (Fernandez et al., 2005).
The activation of PKC and p-p38 MAPK promotes the insertion of
water channel proteins in the cytoplasm into the cell membrane of
alveolar epithelial cells to improve the water metabolism in lung
tissues during viral infection and to ease the pathological symp-
toms of viral lung injury. Consequently, VIP, PKC, and p-p38
MAPK are considered key regulatory targets for AQP5 activation
(Shen et al., 2010; Sun et al., 2011; Wang and Zheng, 2011). In the
present study, the RFQ-PCR results showed that the expression of
VIP, PKC, and AQP5 mRNA increases in the MF-treated group. In
addition, the increased expression of the p-p38 MAPK and AQP5
proteins is determined by western blot analysis. These results are
consistent with the histopathogical changes in lung tissues in-
duced by IAV. Therefore, MF may have a key role in the VIP/PKC/
AQP5 pathway.
5. Conclusion
In summary, treatment of MF signicantly alleviated pulmon-
ary inammation in IAV-infected mice, and protective effects of
MF might be related to its activation of TLR7 and RIG-I to induce
the production of type I IFNs but to inhibit NF-B activation and
cell apoptosis. Moreover, it could also ameliorate water transport
abnormality via regulating AQP5 signaling pathway during the
IAV-infection period. These ndings suggested that MF may war-
rant further evaluation as a possible agent for the treatment of
inuenza.
Conict of interest
The authors declare that there are no conicts of interest.
Acknowledgments
This work is funded by National Natural Science Foundation of
China (No. 81202977), Zhejiang Provincial Natural Science Foun-
dation (Nos. LQ15H280007, LY14H280007, and LY13H280002) and
Zhejiang Medical College Foundation (No. 2013B05).
References
Askar, B., Ibrahim, H., Barrow, P., Foster, N., 2015. Vasoactive intestinal peptide (VIP)
differentially affects inammatory immune responses in human monocytes
infected with viable Salmonella or stimulated with LPS. Peptides 71, 188195.
Busto, R., Prieto, J.C., Bodega, G., Zapatero, J., Carrero, I., 2000. Im-
munohistochemical localization and distribution of VIP/PACAP receptors in
human lung. Peptides 21, 265269.
Caposio, P., Musso, T., Luganini, A., Inoue, H., Gariglio, M., Landolfo, S., Gribaudo, G.,
2007. Targeting the NF-kappaB pathway through pharmacological inhibition of
IKK2 prevents human cytomegalovirus replication and virus-induced in-
ammatory response in infected endothelial cells. Antivir. Res. 73, 175184.
Carrion, M., Perez-Garcia, S., Jimeno, R., Juarranz, Y., Gonzalez-Alvaro, I., Pablos, J.L.,
Gutirrez-Caas, I., Gomariz, R.P., 2013. Inammatory mediators alter inter-
leukin-17 receptor, interleukin-12 and -23 expression in human osteoarthritic
and rheumatoid arthritis synovial broblasts: immunomodulation by vasoac-
tive intestinal Peptide. Neuroimmunomodulation 20, 274284.
Chen, C.P., Lin, C.C., Namba, T., 1989. Screening of Taiwanese crude drugs for anti-
bacterial activity against Streptococcus mutans. J. Ethnopharmacol. 27,
285295.
Chen, J., Wang, J.B., Yu, C.H., Chen, L.Q., Xu, P., Yu, W.Y., 2013. Total avonoids of
Mosla scabra leaves attenuates lipopolysaccharide-induced acute lung injury
via down-regulation of inammatory signaling in mice. J. Ethnopharmacol. 148,
835841.
Dong, X.Y., Liu, W.J., Zhao, M.Q., Wang, J.Y., Pei, J.J., Luo, Y.W., Ju, C.M., Chen, J.D.,
2013. Classical swine fever virus triggers RIG-I and MDA5-dependent signaling
pathway to IRF-3 and NF-kappaB activation to promote secretion of interferon
and inammatory cytokines in porcine alveolar macrophages. Virol. J. 10, 286.
Duarte, J., Francisco, V., Perez-Vizcaino, F., 2014. Modulation of nitric oxide by a-
vonoids. Food Funct. 5, 16531668.
Faure, M., Rabourdin-Combe, C., 2011. Innate immunity modulation in virus entry.
Curr. Opin. Virol. 21, 612.
Fernandez, M., Sanchez-Franco, F., Palacios, N., Sanchez, I., Cacicedo, L., 2005. IGF-I
and vasoactive intestinal peptide (VIP) regulate cAMP-response element-
binding protein (CREB)-dependent transcription via the mitogen-activated
protein kinase (MAPK) pathway in pituitary cells: requirement of Rap1. J. Mol.
Endocrinol. 34, 699712.
Gerlier, D., Valentin, H., 2009. Measles virus interaction with host cells and impact
on innate immunity. Curr. Top. Microb. 329, 163191.
Han, G., Ma, L., Guo, Y., Li, L., Li, D., Liu, H., 2015. Hyperbaric oxygen therapy palliates
lipopolysaccharide-induced acute lung injury in rats by upregulating AQP1 and
AQP5 expression. Exp. Lung Res. 41, 444449.
Hang, do T.T., Song, J.Y., Kim, M.Y., Park, J.W., Shin, Y.K., 2011. Involvement of NF-
kappaB in changes of IFN-gamma-induced CIITA/MHC-II and iNOS expression
by inuenza virus in macrophages. Mol. Immunol. 48, 12531262.
Herold, S., Ludwig, S., Pleschka, S., Wolff, T., 2012. Apoptosis signaling in inuenza
virus propagation, innate host defense, and lung injury. J. Leukoc. Biol. 92,
7582.
Hou, X.L., Tong, Q., Wang, W.Q., Shi, C.Y., Xiong, W., Chen, J., Liu, X., Fang, J.G., 2015.
Suppression of inammatory responses by dihydromyricetin, a avonoid from
Ampelopsis grossedentata, via inhibiting the activation of NF-kappaB and MAPK
signaling pathways. J. Nat. Prod. 78, 16891696.
Huang, W., Li, X., Cheng, Y., Tan, M., Guo, J., Wei, H., Zhao, X., Lan, Y., Xiao, N., Wang,
Z., Wang, D., Shu, Y., 2015. Characteristics of oseltamivir-resistant inuenza A
(H1N1) pdm09 virus during the 20132014 inuenza season in Mainland
China. Virol. J. 12, 96.
Iwasaki, A., Pillai, P.S., 2014. Innate immunity to inuenza virus infection. Nat. Rev.
Immunol. 14, 315328.
James, C.M., Abdad, M.Y., Manseld, J.P., Jacobsen, H.K., Vind, A.R., Stumbles, P.A.,
Bartlett, E.J., 2007. Differential activities of alpha/beta IFN subtypes against
inuenza virus in vivo and enhancement of specic immune responses in DNA
vaccinated mice expressing haemagglutinin and nucleoprotein. Vaccine 25,
18561867.
Je, I.G., Shin, T.Y., Kim, S.H., 2013. Mosla punctulata inhibits mast cell-mediated al-
lergic reactions through the inhibition of histamine release and inammatory
cytokine production. Indian J. Pharm. Sci. 75, 664671.
Jiang, X., McClellan, S.A., Barrett, R.P., Zhang, Y., Hazlett, L.D., 2012. Vasoactive in-
testinal peptide downregulates proinammatory TLRs while upregulating anti-
inammatory TLRs in the infected cornea. J. Immunol. 189, 269278.
Jin, L.D., Wang, L.R., Wu, L.Q., Shan, Y.L., Zhao, X.Y., Xiong, X.Q., Zhou, J.H., Lin, L.N.,
Jin, L.L., 2013a. Effects of COX-2 inhibitor on ventilator-induced lung injury in
rats. Int. Immunopharmacol. 16, 288295.
Jin, Y., Yu, G., Peng, P., Zhang, Y., Xin, X., 2013b. Down-regulated expression of AQP5
on lung in rat DIC model induced by LPS and its effect on the development of
pulmonary edema. Pulm. Pharmacol. Ther. 26, 661665.
Ke, X.F., Fang, J., Wu, X.N., Yu, C.H., 2014. MicroRNA-203 accelerates apoptosis in
LPS-stimulated alveolar epithelial cells by targeting PIK3CA. Biochem. Biophys.
Res. Commun. 450, 12971303.
Kim, T.H., Thuy, N.T., Shin, J.H., Baek, H.H., Lee, H.J., 2000. Aroma-active compounds
of miniature beefsteak plant (Mosla dianthera Maxim). J. Agric. Food Chem. 48,
28772881.
Lee, D.H., Kim, S.H., Eun, J.S., Shin, T.Y., 2006. Mosla dianthera inhibits mast cell-
mediated allergic reactions through the inhibition of histamine release and
inammatory cytokine production. Toxicol. Appl. Pharmacol. 216, 479484.
Liu, B., Meng, D., Wei, T., Zhang, S., Hu, Y., Wang, M., 2014. Apoptosis and pro-
inammatory cytokine response of mast cells induced by inuenza A viruses.
PLoS One 9, e100109.
Murakami, M., Murdiastuti, K., Hosoi, K., Hill, A.E., 2006. AQP and the control of
uid transport in a salivary gland. J. Membr. Biol. 210, 91103.
Nencioni, L., De Chiara, G., Sgarbanti, R., Amatore, D., Aquilano, K., Marcocci, M.E.,
Serano, A., Torcia, M., Cozzolino, F., Ciriolo, M.R., Garaci, E., Palamara, A.T.,
2009. Bcl-2 expression and p38MAPK activity in cells infected with inuenza A
virus: impact on virally induced apoptosis and viral replication. J. Biol. Chem.
284, 1600416015.
Pei, X.D., Zhai, Y.F., Zhang, H.H., 2014. Inuenza virus H1N1 induced apoptosis of
mouse astrocytes and the effect on protein expression. Asian Pac. J. Trop. Med.
7, 572575.
Rahman, M.M., Mohamed, M.R., Kim, M., Smallwood, S., McFadden, G., 2009. Co-
regulation of NF-kappaB and inammasome-mediated inammatory responses
 C.-H. Yu et al. / Journal of Ethnopharmacology 179 (2016) 146155
by myxoma virus pyrin domain-containing protein M013. PLoS Pathog. 5,
e1000635.
Ramirez-Ortiz, Z.G., Prasad, A., Grifth, J.W., Pendergraft 3rd, W.F., Cowley, G.S.,
Root, D.E., Tai, M., Luster, A.D., El Khoury, J., Hacohen, N., Means, T.K., 2015. The
receptor TREML4 amplies TLR7-mediated signaling during antiviral responses
and autoimmunity. Nat. Immunol. 16, 495504.
Said, S.I., 2007. The discovery of VIP: initially looked for in the lung, isolated from
intestine, and identied as a neuropeptide. Peptides 28, 16201621.
Shalini, V., Bhaskar, S., Kumar, K.S., Mohanlal, S., Jayalekshmy, A., Helen, A., 2012.
Molecular mechanisms of anti-inammatory action of the avonoid, tricin from
Njavara rice (Oryza sativa L.) in human peripheral blood mononuclear cells:
possible role in the inammatory signaling. Int. Immunopharmacol. 14, 3238.
Shen, R., Deng, W., Li, C., Zeng, G., 2015. A natural avonoid glucoside icariin in-
hibits Th1 and Th17 cell differentiation and ameliorates experimental auto-
immune encephalomyelitis. Int. Immunopharmacol. 24, 224231.
Shen, Y., Chen, Z., Wang, Y., Song, Z., Zhang, Z., Jin, M., Wang, X., Bai, C., 2010.
Aquaporin 5 expression inhibited by LPS via p38/JNK signaling pathways in
SPC-A1 cells. Respir. Physiol. Neurobiol. 171, 212217.
Sherbany, H., McCauley, J., Meningher, T., Hindiyeh, M., Dichtiar, R., Markovich, M.P.,
Mendelson, E., Mandelboim, M., 2014. Return of pandemic H1N1 inuenza
virus. BMC Infect. Dis. 14, 710.
St Hilaire, R.C., Kadowitz, P.J., Jeter Jr., J.R., 2009. Adenoviral transfer of vasoactive
intestinal peptide (VIP) gene inhibits rat aortic and pulmonary artery smooth
muscle cell proliferation. Peptides 30, 23232329.
Sun, G.Y., Guan, C.X., Zhou, Y., Liu, Y.P., Li, S.F., Zhou, H.F., Tang, C.Y., Fang, X., 2011.
Vasoactive intestinal peptide re-balances TREM-1/TREM-2 ratio in acute lung
injury. Regul. Pept. 167, 5664.
Szema, A.M., Hamidi, S.A., Koller, A., Martin, D.W., 2011. Vasoactive Intestinal
Peptide Knockout (VIP KO) mouse model of sulte-sensitive asthma: up-reg-
ulation of novel lung carbonyl reductase. BMC Immunol. 12, 66.
Takeuchi, O., Akira, S., 2009. Innate immunity to virus infection. Immunol. Rev. 227,
7586.
Terahara, N., 2015. Flavonoids in foods: a review. Nat. Prod. Commun. 10, 521528.
Towne, J.E., Harrod, K.S., Krane, C.M., Menon, A.G., 2000. Decreased expression of
aquaporin (AQP) 1 and AQP5 in mouse lung after acute viral infection. Am. J.
155
Respir. Cell Mol. 22, 3444.
Tripathi, S., Batra, J., Cao, W., Sharma, K., Patel, J.R., Ranjan, P., Kumar, A., Katz, J.M.,
Cox, N.J., La, R.B., Sambhara, S., La, S.K., 2013. Inuenza A virus nucleoprotein
induces apoptosis in human airway epithelial cells: implications of a novel
interaction between nucleoprotein and host protein Clusterin. Cell Death Dis. 4,
e562.
Wan, Q., Wang, H., Han, X., Lin, Y., Yang, Y., Gu, L., Zhao, J., Wang, L., Huang, L., Li, Y.,
Yang, Y., 2014. Baicalin inhibits TLR7/MYD88 signaling pathway activation to
suppress lung inammation in mice infected with inuenza A virus. Biomed.
Rep. 2, 437441.
Wang, Q., Terreaux, C., Marston, A., Tan, R.X., Hostettmann, K., 2000. Lignans from
Mosla scabra. Phytochemistry 54, 909912.
Wang, W., Zheng, M., 2011. Role of cAMP-PKA/CREB pathway in regulation of AQP
5 production in rat nasal epithelium. Rhinology 49, 464469.
Wei, J., Waithman, J., Lata, R., Mifsud, N.A., Cebon, J., Kay, T., Smyth, M.J., Sadler, A.J.,
Chen, W., 2010. Inuenza A infection enhances cross-priming of CD8 T cells to
cell-associated antigens in a TLR7- and type I IFN-dependent fashion. J. Im-
munol. 185, 60136022.
Wu, Q., Yu, C., Yan, Y., Chen, J., Zhang, C., Wen, X., 2010. Antiviral avonoids from
Mosla scabra. Fitoterapia 81, 429433.
Wu, Q.F., Wang, W., Dai, X.Y., Wang, Z.Y., Shen, Z.H., Ying, H.Z., Yu, C.H., 2012.
Chemical compositions and anti-inuenza activities of essential oils from Mosla
dianthera. J. Ethnopharmacol. 139, 668671.
Yu, C., Yan, Y., Wu, X., Zhang, B., Wang, W., Wu, Q., 2010. Anti-inuenza virus effects
of the aqueous extract from Mosla scabra. J. Ethnopharmacol. 127, 280285.
Zhang, Y.W., Bi, L.T., Hou, S.P., Zhao, X.L., Song, Y.L., Ma, T.H., 2009. Reduced lung
water transport rate associated with downregulation of aquaporin-1 and
aquaporin-5 in aged mice. Clin. Exp. Pharmacol. Physiol. 36, 734738.
Zhao, Z., Fan, C., Duan, Y., Zhang, L., Li, M., Yang, X., Li, R., Yang, P., Wang, X., 2014.
Protection from infection with inuenza A H7N9 virus in a mouse model by
equine neutralizing F(ab)2. Int. Immunopharmacol. 23, 134138.
Zhilinskaia, I.N., Brodskii, L.I., Alekseenko, L.V., Kiselev, O.I., 1991. Detection in the
structure of inuenza viral proteins of sequences similar to vasoactive intestinal
peptide. Biull Eksp. Biol. Med. 111, 371373.