University of Iowa

Iowa Research Online

Theses and Dissertations

Fall 2016

PCB126-induced metabolic disruption: effects on

liver metabolism and adipocyte development
Gopi Srinivas Gadupudi
University of Iowa

Copyright © 2016 Gopi Srinivas Gadupudi

This dissertation is available at Iowa Research Online: http://ir.uiowa.edu/etd/2208

Recommended Citation
Gadupudi, Gopi Srinivas. "PCB126-induced metabolic disruption: effects on liver metabolism and adipocyte development." PhD
(Doctor of Philosophy) thesis, University of Iowa, 2016.
http://ir.uiowa.edu/etd/2208.

Follow this and additional works at: http://ir.uiowa.edu/etd

Part of the Toxicology Commons

PCB126-INDUCED METABOLIC DISRUPTION: EFFECTS ON LIVER
METABOLISM AND ADIPOCYTE DEVELOPMENT

by

Gopi Srinivas Gadupudi

A thesis submitted in partial fulfillment

of the requirements for the Doctor of Philosophy
degree in Human Toxicology in the
Graduate College of
The University of Iowa

December 2016

Thesis Supervisors: Professor Larry W Robertson

Associate Professor Aloysius J Klingelhutz.
 Copyright by

Gopi Srinivas Gadupudi

2016

All Rights Reserved

 Graduate College
The University of Iowa
Iowa City, Iowa

CERTIFICATE OF APPROVAL

____________________________

PH.D. THESIS

_________________

This is to certify that the Ph.D. thesis of

Gopi Srinivas Gadupudi

has been approved by the Examining Committee for

the thesis requirement for the Doctor of Philosophy degree
in Human Toxicology at the December 2016 graduation.

Thesis Committee: ____________________________________________

Larry W Robertson, Thesis Supervisor

____________________________________________
Aloysius J. Klingelhutz, Thesis Supervisor

____________________________________________
Gabriele Ludewig

____________________________________________
Justin L Grobe

____________________________________________
Katherine Gibson-Corley
To my parents and grandparents, for their unyielding love and belief in me, and in
memory of my beloved sister Alekhya!!

ii
 ACKNOWLEDGEMENTS

I would like to sincerely thank my major professor, Dr. Larry Robertson for

accepting me into his lab and providing me with immense support and genuine

guidance throughout my work for accomplishing this thesis as well as my career

goals. I would also like to thank Dr. Aloysius Klingelhutz for his invaluable and

timely advices that not only have helped me with this work but would also will

help me throughout my career. Working with them has made me realize the

value of patience, hard work, honesty and confidence to attain success in my

career. I would also like to thank my committee members Drs. Gabriele Ludewig,

Justin L Grobe and Katherine Gibson-Corley for serving on my committee and for

all their suggestions that have helped me shape this project and mold my

scientific thinking.

I also like to thank Dr. Francoise Gourronc for supporting me with her

suggestions that helped me to organize myself while working in the lab. A special

thanks also goes to Susanne Flor for her support and patience in helping and

hearing me out in the lab. I would also like to thank all my lab members and

fellow students (Miao Li and Bill Klaren) of the human toxicology program, who

were not only supportive but also were great friends.

I feel grateful for all my friends for their extreme support and constant

encouragement throughout my time as a graduate student. I have great respect

and gratitude for Dr. Hemachand Tummala, Vijaya garu and their family for the

extreme love and friendship they have provided to me over the years. I specially

thank Drs. Senthil Kumar Kuppusamy, Rahul Vijay, Rama Krishna Sompallae

iii
and their families for being my punch bags during times of frustration and

providing support for me all the time. I am particularly fortunate to have gained

constant encouragement, invaluable friendship and brotherly love from Drs Sai

Kumar Ramadugu, Sandeep Bodduluri and their better halves. It would be

remiss, if I don’t thank my friends Dr. Shivangi Inamdar, Bhanu, Bharat, Sai

Kishore, Aditya, Uma Shankar, Chaitanya and Vivek for being great friends and

bearing with me during graduate school. I will also have to thank Dr. Jean

Sathish for not only providing me with timely advises, but also being a good

friend.

I should also thank my excellent “Saikorian” friends (Suri, Deepu, Dinu, VY

and the whole band) for the sense of brotherhood and encouragement they have

provided to me during extremely challenging situations. I also thank Swathi for

her sisterly love and constant appreciation for my hard work during graduate

studies. I also have to thank my engineering friends (Kondal, Srikanth, Mahesh,

Shanthi) for talking to me and being great friends. I also wish to show gratitude to

my great friends Hari, Ramjee and Keerthi for their best wishes.

Finally, I would like to thank my family: my parents; Venkata Ratnam and

Uma, my grand-parents; Venkata Rayudu and Venkata Ratnam. They have been

incredibly supportive of me and were very understanding of me throughout my

graduate school. They have taught me great responsibility, dedication, patience

and hard work as well as sincerity. I am extremely grateful to my grandfather for

raising me, helping me understand the value of education. My family and friends

iv
have been the greatest pillars of my support and it is their confidence in me, love

and support that made this accomplishment possible for me!

v
 ABSTRACT

Recently, persistent organic pollutants such as polychlorinated biphenyls

(PCBs) were classified as “metabolic disruptors” for their suspected roles is

altering metabolic and energy homeostasis through bioaccumulation in liver and

adipose tissues. Among PCBs, a specific congener, 3,3',4,4',5-

pentachlorobiphenyl (PCB126), is a potent arylhydrocarbon receptor (AhR)

agonist and elicits toxicity similar to the classic dioxin, 2,3,7,8-tetrachlorodibenzo-

p-dioxin (TCDD). PCB126 levels found in human blood are particularly

associated with diabetes and nonalcoholic fatty liver disease (NAFLD) in

humans, however the mechanisms are unclear.

We hypothesized that the accumulation of PCB126 disrupts carbohydrate

and lipid metabolism by altering the functions of liver and adipose tissues.

Hence, our objective was to characterize PCB126 induced-metabolic disruption

and the underlying molecular mechanisms that cause toxicity. Separate animal

studies were performed using a rat model to understand the time- and dose-

dependent effects after PCB126 administration. The chronology of PCB126

toxicity showed early decreases in serum glucose level at 9 h, worsened in a

time-dependent way until the end of the study at 12 d. Lipid accumulation and the

liver pathology also worsened over time between 3 d and 12 d post

administration. These observed effects in the liver were also found to be dose-

dependent. The decrease in serum glucose was a result of a decrease in the

transcript levels of gluconeogenic and glycogenolytic enzymes, necessary for

hepatic glucose production and hence the maintenance of steady glucose levels

vi
in the blood. Phosphoenolpyruvate carboxykinase (PEPCK-C), the rate limiting

enzyme of gluconeogenesis, was found to be significantly decreased upon

exposure to PCB126. The expression levels of peroxisome proliferator-activated

receptor alpha (Pparα) and some of its targets involved in fatty acid oxidation

were also found to be time and dose-dependently decreased upon exposure to

PCB126. In an attempt to understand the molecular targets that may cause these

dual effects on both gluconeogenic and fatty acid oxidation, we found that

PCB126 significantly decreases phosphorylation of the cAMP response element-

binding protein (CREB). CREB is a nuclear transcription factor that is activated in

the liver through phosphorylation; to switch-on the transcription of enzymes that

catalyze gluconeogenesis and fatty acid oxidation, in order to meet energy

demands, especially during fasting.

Further, to understand the toxicity of PCB126 on adipose tissue, a human

pre-adipocyte model that can be differentiated into mature adipocytes was used.

In these studies, we found that exposure of preadipocytes to PCB126 resulted in

a significant reduction in their ability to differentiate into adipocytes. This results

in decreased lipid accumulation in the adipocyte. Reduction in the differentiation

by PCB126 was associated with down regulation in transcript levels of a key

adipocyte transcription factor, PPARγ and its transcriptional targets necessary for

adipogenesis and adipocyte function. These inhibitory effects of PCB126 on the

regulation of PPARγ and the initiation of adipogenesis were mediated through

activation of AhR.

vii
 Overall, this work shows that, exposures to environmental pollutants such

as PCB126 can disrupt nutrient homeostasis and cause disease, through its

effects on the function of target tissues; liver and adipose. PCB126 significantly

alters the nutrient homeostasis through its effects on gluconeogenesis and fatty-

acid oxidation necessary for glucose and energy regulation during fasting. In

addition, PCB126 interrupts the storage functions of adipose tissue by inhibiting

adipogenesis and thus disrupts lipid storage and distribution to cause ectopic

lipid accumulation.

viii
 PUBLIC ABSTRACT

Contamination of food, air and water with certain “legacy chemicals” such

as polychlorinated biphenyls (PCBs) released into the environment is of great

concern for public health. PCBs were previously suggested to increase the risk of

adverse health effects such as cancer and endocrine disruption in humans.

Recently, PCBs are also emerging as “metabolic disruptors” for their possible

roles in increasing the risk of silent metabolic epidemics such as obesity,

diabetes and fatty liver.

Studies described in this work investigate the specific effects of PCBs on

the function of liver and adipose tissues, which also happen to be their storage

sites. PCB126 serves as representative chemical, whose mode of action is also

similar to the chemicals like dioxin, present in the herbicide Agent Orange. Using

PCB126, the primary effects on the functions of liver and adipose tissue to

balance the normal sugar and fat metabolism, were assessed. PCB126 disrupts

the ability of liver to produce glucose. Liver plays an important role in

replenishing the blood glucose levels during fasting, by converting other stored

nutrients into glucose. A disruption in this process by PCB126 leads to low blood

glucose, and hence shrinks the primary source of energy for other organs. In

addition to effects on glucose production, PCB126 also interferes with the

capacity of liver to break-down fat for energy. This interruption leads to fat

accumulation in the liver and hence results in fatty liver. PCB126 seems to cause

these effects by interfering with the function of a certain protein called cAMP

response element-binding protein (CREB), needed to relay a hormonal signal

ix
produced during fasting process. Thus, PCB126 causes a double-blow on the

functions of liver in generating energy from both glucose and fat.

PCB126 also shows its effects on the functions of adipocytes. Adipose

tissue plays a regulatory role in the storage of excess fat and releasing it into the

blood during fasting. The released fat is then processed in the liver to generate

energy. PCB126 inhibits the ability of the adipocyte to accumulate fat by

interfering with their development. This diminished storage function of adipocyte

leads to disorganization in the fat storage, necessary for proper fat distribution

during need (eg. fasting) and may play a role is causing ectopic fat accumulation

in the liver. The inability of the adipose tissue to store lipids may also further lead

to inappropriate accumulation of fat in the other organs such as liver. In

conclusion, this dissertation creates new insights into our understanding of the

modes of action of pollutants such as PCB126 and their roles in causing

metabolic disease.

x
 CONTENTS

List of Figures ....................................................................................................................xv

List of Tables .................................................................................................................. xvii
Chapter I : Background and Significance ............................................................................1

Polychlorinated biphenyls (PCBs) .................................................................................. 1

Dioxin-like PCBs and toxic equivalency factor (TEF) ................................................... 2
Aryl hydrocarbon receptor .............................................................................................. 4
Exposure to PCB126 and its general toxicity ................................................................. 6
Dioxin-like PCBs are associated with metabolic disease in humans.............................. 9
Liver metabolic homeostasis ........................................................................................ 13
Adipose tissue and metabolic homeostasis ................................................................... 15
Liver-adipose tissue crosstalk ....................................................................................... 18
PCB induced disruption in the metabolic functions of liver and adipose tissue........... 19
Statement of the problem and overview of the thesis ................................................... 20

Chapter II : PCB126-induced disruption in gluconeogenesis and fatty acid oxidation

precedes fatty liver in male rats .........................................................................................22

Abstract ......................................................................................................................... 22
Introduction ................................................................................................................... 23
Materials and methods .................................................................................................. 26

Chemicals and reagents ............................................................................................. 26

Animal studies .......................................................................................................... 27
Blood collection and serum analysis ......................................................................... 28
Histology and special stains ...................................................................................... 29
Lipid staining and quantification .............................................................................. 29
Hepatocyte culture .................................................................................................... 29
Gene expression analysis .......................................................................................... 30
Statistics .................................................................................................................... 31

Results ........................................................................................................................... 31

Effects of PCB126 on body weight, feed consumption and liver weight ................. 31

xi
 PCB126 time dependently increases the lipid accumulation in the liver.................. 32
Effect of PCB126 on the levels glucose and triglycerides in the serum ................... 33
Effect of PCB126 on liver glucose metabolism ........................................................ 34
Effect of PCB126 on lipid metabolism in the liver................................................... 35
PCB126 induced effects on Pepck are mediated by Aryl hydrocarbon receptor
(AhR) ........................................................................................................................ 36

Discussion ..................................................................................................................... 37
Supporting data description .......................................................................................... 43
Figures .......................................................................................................................... 44

Chapter III : Diminished phosphorylation of CREB is a key event in the dysregulation

of gluconeogenesis and glycogenolysis in PCB126 hepatotoxicity .................................51

Abstract ......................................................................................................................... 51
Introduction ................................................................................................................... 52
Materials and methods: ................................................................................................. 53

Animal studies .......................................................................................................... 53

Serum preparation and glucose measurements ......................................................... 54
Gene expression analysis .......................................................................................... 54
Protein isolation and semi-quantitative analysis ....................................................... 55
Statistics .................................................................................................................... 56

Results and discussion: ................................................................................................. 57

Supporting information ................................................................................................. 63
Figures .......................................................................................................................... 64

Chapter IV : PCB126 Inhibits Adipogenesis of Human Preadipocytes ............................69

Abstract ......................................................................................................................... 69
Introduction ................................................................................................................... 70
Materials and methods .................................................................................................. 75

Preadipocyte culture and differentiation ................................................................... 75

Reagents and treatment ............................................................................................. 76
Assessment of NPAD proliferation and growth ....................................................... 76

xii
 Assessment of NPAD viability using MTT assay .................................................... 77
Triglyceride staining and microscopy ....................................................................... 77
Quantification of differentiation using flow cytometry ............................................ 78
Quantification of differentiation markers using quantitative RT-PCR: .................... 78
Quantification of Adiponectin using ELISA ............................................................ 79
Statistics .................................................................................................................... 80

Results ........................................................................................................................... 80

Effects of PCBs on adipocyte differentiation ........................................................... 80

Reduced differentiation on PCB126 exposure is independent of effects on
proliferation............................................................................................................... 82
PCB126 pre-exposure reduces expression of adipocyte marker genes and
increases expression of CYP1A1 .............................................................................. 83
PCB126 induced AhR activity reduces differentiation of preadipocytes ................. 84

Discussion ..................................................................................................................... 85
Supporting information ................................................................................................. 90
Figures .......................................................................................................................... 91

Chapter V : Overall Conclusions and Future directions ....................................................97

General conclusions ...................................................................................................... 97

Future directions ......................................................................................................... 101

AhR- dependent target organ toxicity of PCB126 in liver and adipose.................. 101
Effect of obesogenic diets on PCB126-induced toxicity ........................................ 102

Concluding remarks .................................................................................................... 103

APPENDIX A ..................................................................................................................104

Supplementary data for chapter II .............................................................................. 104

Supplementary data for chapter III ............................................................................. 106
Supplementary data for chapter IV ............................................................................. 108

APPENDIX B ..................................................................................................................114

Supporting table for the primer sequences (Chapter II) ............................................. 114

xiii
 Supporting table for the primer sequences (Chapter III) ............................................ 115
Supporting table for the primer sequences (Chapter IV). ........................................... 116

References ........................................................................................................................117

xiv
 LIST OF FIGURES

Figure I-1. Structure of PCBs. ............................................................................................ 1

Figure II-1. Effects of PCB126 on body weight gain, feed consumption and liver
weight. ............................................................................................................................... 44

Figure II-2. PCB126 exposure increased lipid content in the livers. ................................ 45

Figure II-3. PCB126 decreased serum glucose and triglyceride levels. ........................... 46

Figure II-4. PCB126 causes decrease in the transcript levels of Pepck-c and Glut2 in
the liver. ............................................................................................................................ 47

Figure II-5. PCB126 causes decrease in the transcript levels of Pparα and its target
genes. ................................................................................................................................ 48

Figure II-6. AhR antagonist CH223191 mitigates the inhibitory effects of PCB126 on
Pepck-c. ............................................................................................................................. 49

Figure II-7. The scheme depicts the effects of PCB126 on the transcript levels of
various enzymes in the liver. ............................................................................................ 50

Figure III-1. PCB126 decreases serum glucose and the protein levels of PEPCK-C. ...... 64

Figure III-2. PCB126 downregulates the transcript levels of genes involved in

glycogenolysis and gluconeogenesis. ............................................................................... 65

Figure III-3. PCB126 downregulates the transcript levels necessary transcriptional

coactivators during gluconeogenesis. ............................................................................... 66

Figure III-4. PCB126 dose-dependently inhibits the activation of hepatic CREB1. ........ 67

Figure III-5. Decreased CREB activation during PCB126-induced hepatotoxicity

downregulates gluconeogenesis. ....................................................................................... 68

Figure IV-1. Preadipocytes show reduced ability to differentiate after pre-exposure to

PCB126. ............................................................................................................................ 91

Figure IV-2. Exposure to PCB126 causes a dose-dependent reduction in the number

of differentiated adipocytes............................................................................................... 92

Figure IV-3. Effects of PCB126 on differentiation are independent of the cell

proliferation....................................................................................................................... 93

Figure IV-4. PCB126 exposure decreases transcript levels of adipogenic markers and
increases transcript levels of CYP1A1. ............................................................................. 94

xv
Figure IV-5. The AhR antagonist CH223191 partially blocks the inhibitory effects of
PCB126 on adipocyte differentiation................................................................................ 95

Figure IV-6. PCB126 inhibits adipogenesis (schematic). ................................................. 96

Figure A-1. Effects of PCB126 on glycogen content in the liver. .................................. 104

Figure A-2. Effects of PCB126 on Cyp1a1 transcript levels in the rat hepatocytes ....... 105

Figure A-3. PCB126 causes a dose-dependent decrease in the expression of

PEPCK-C. ....................................................................................................................... 106

Figure A-4. PCB126 inhibits the phosphorylation of CREB in the liver. ...................... 107

Figure A-5. Preadipocytes show a dose-dependent reduction in differentiation of

pre-exposure to PCB126. ................................................................................................ 108

Figure A-6. Effects of PCB126 on differentiation are independent of the cell viability. 109

Figure A-7. PCB126 dose dependently decreases the secretion of adiponectin

(protein levels) ................................................................................................................ 110

Figure A-8. PCB126 exposure increases transcript levels of CYP1A1 in

undifferentiated preadipocytes ........................................................................................ 111

Figure A-9. Inhibition of differentiation by PCB126 in human preadipocytes is AHR

dependent. ....................................................................................................................... 112

Figure A-10. Silencing of AhR mitigates PCB126-induced alterations in the

transcript levels of various genes involved in adipogenesis. .......................................... 113

xvi
 LIST OF TABLES

Table B-1. List of primers used to measure transcript levels of genes (Chapter II) ....... 114

Table B-2. List of primers used to measure transcript levels of genes (Chapter III) ...... 115

Table B-3. List of primers used to measure transcript levels of genes (Chapter IV) ..... 116

xvii
 CHAPTER I :

BACKGROUND AND SIGNIFICANCE

Polychlorinated biphenyls (PCBs)

Polychlorinated biphenyls (PCBs) were commercially manufactured in

1970s as commercial mixtures and used in many industrial applications. They

were later banned for their toxicity. Historically, commercial mixtures of PCBs

were manufactured in the US and sold by the Monsanto Company under the

brand name Aroclor. Although prohibited to be directly manufactured, they still

continue to be released into the environment as byproducts of industrial

processes or through waste (Koh et al., 2015). Aroclor mixtures were highly

appreciated for their chemical resistance, insulating, and non-flammable

properties (Hansen L.G., 1987). PCBs are toxicants that persist in the

environment and bio-accumulate in humans and many other organisms because

of their lipophilicity and resistance to degradation (Risebrough et al., 1968).

Figure I-1. Structure of PCBs.

PCBs have biphenyl core (center) with chlorines attached to it. PCBs without chlorines
at ortho positions (2, 2', 6, 6') are called as “dioxin-like” PCBs (left) and PCBs with
chlorines in ortho position are “non-dioxin-like” (right) PCBs

1
Exposure to PCBs occurs through multiple routes such as the ingestion of food

(especially animal fat), inhalation and dermal contact (Carpenter, 2006).They

induce hepatic enzymes, especially xenobiotic metabolizing enzymes (Silberhorn

et al., 1990). Certain PCBs, especially the lower chlorinated ones, may be bio-

activated to either hydroxylated or other metabolites that can be found in the

human blood and many tissue samples (Bergman et al., 1994; Dhakal et al.,

2012). PCBs and their metabolites can cause a variety of health effects such as

cancer, developmental, endocrine and metabolic defects (Longnecker et al.,

1997). Structurally, PCBs are a group of 209 congeners with a core biphenyl ring

(Figure I-1), attached to varying numbers of chlorine between 1 and 10

(Ballschmiter and Zell, 1980). Structural variation in these congeners and their

metabolites leads to differential interactions with various biological targets that

leads to diverse profiles of toxicity.

Dioxin-like PCBs and toxic equivalency factor (TEF)

PCBs with 4 or more chlorine atoms are broadly classified as “dioxin-like”

and “non-dioxin-like” compounds. A third category of PCBs, those with less than

4 chlorine atoms are rapidly metabolized and have shorter residence times and

lower body burdens (Grimm et al., 2015). PCBs that can bind to aryl hydrocarbon

receptor (AhR) and induce toxic effects, mechanistically similar to the prototypic

ligand 2,3,7,8-tetrachlorodibenzodioxin (TCDD) are called “dioxin-like” PCBs

(Barnes et al., 2003).

The ligand binding activity of dioxin-like PCBs with AhR occurs due to lack

of steric hindrance caused by chlorine(s) at the ortho- position of the biphenyl

2
ring (2, 2', 6, 6' positions), which allows a more planar structure, similar to dioxin.

Hence, these PCBs are also called co-planar PCBs or non-ortho substituted

PCBs (Figure I-1). Often, the toxic potency of dioxin-like chemicals is

represented relative to TCDD and expressed as a toxic equivalency factor (TEF)

(Ahlborg et al., 1992). Among PCBs, 3,3',4,4',5-pentachlorobiphenyl (PCB126)

has the highest potency with a TEF of 0.1 (Birnbaum and DeVito, 1995; Van den

Berg et al., 1998). TEF is routinely and extensively used in predicting the risk and

toxicity associated with dioxin-like PCBs such as PCB77 (TEF of 0.0005),

PCB169 (TEF of 0.01) and PCB126 (Ahlborg et al., 1994). Although there is

broad consensus over the use TEF factor in predicting toxicity, various reports

and experimental studies indicate disparities in a TEF value for a given

compound on a particular toxicity endpoint or a response (Van den Berg et al.,

2006). The differences mostly arise due to deviation from the generally assumed

additive responses in calculating a given TEF for a chemical (Safe, 1997). The

four criteria for a compound to be considered as a dioxin-like chemical are: 1)

structural similarity with dioxin, 2) bind to AhR 3) elicit dioxin-specific

biochemical/toxicological response and 4) should persist and bioaccumulate in

the environment (Ahlborg et al., 1994; Ahlborg and Hanberg, 1994). Inadequacy

in the assigned TEF values are due to the non-additive toxic effects of PCB126

or any dioxin like chemical (Walker et al., 2005). The non-additive effects stem

from differences in binding affinity due to structural variations in the chemical and

their binding avidity to AhR, activation of AhR and the toxic responses that are

elicited (Ahlborg and Hanberg, 1994; Harper et al., 1995).

3
Aryl hydrocarbon receptor

Aryl hydrocarbon receptor is a nuclear transcription factor, when bound to

the agonistic ligand, translocates into the nucleus and transcribes genes that are

mostly involved in biotransformation (Okey, 2007). Under normal conditions, AhR

acts as a xenobiotic sensor that induces the transcription of enzymes necessary

for biotransformation of a toxicant. However, the toxicity expressed during

exposure to dioxin-like compounds such as PCB126 stems from sustained and

unwarranted alteration in the protein and transcript levels of enzymes involved in

cellular and xenobiotic metabolism. Excessive induction of xenobiotic metabolic

enzymes (XMEs) results in the production of oxidative stress and toxic

metabolites through bio-activation (Hassoun et al., 2000; Hassoun et al., 2002).

On the other hand, alteration in the enzymes involved in cell metabolism results

in the disruption of nutrient homeostasis and cellular signal transduction (Denison

et al., 2011). The dioxin-like toxicity is mostly AhR dependent, however AhR

independent effects were also described (Tanos et al., 2012). In its inactive state,

AhR forms a multi protein complex with other proteins such as heat shock protein

(hsp90) in the cytosol. Ligand activation by various endogenous and xenobiotic

agonists such as PCB126 causes a conformational change in AhR that

dissociates it from other proteins in the complex and exposes its nuclear

localization signal (NLS). Consequently, AhR translocates into the nucleus and

forms a heterodimer with another protein aryl hydrocarbon receptor nuclear

translocator (ARNT). The heterodimer recognizes xenobiotic recognition

elements (XREs) in the promoter regions of responsive genes and thus

4
modulates their transcription (Swanson, 2002a). The XREs recognized by this

AhR-ARNT complex may vary across species and cell types because of

epigenetic plasticity that determines the promoter accessibility of transcription

factors to induce gene expression. This confers variability in the transcriptional

targets of AhR across various tissues within a single species as well as the same

tissue across various species. Additionally, the affinity of the ligand to AhR and

its ability to be metabolized by the bio-transformative enzymes also influence the

variance in transcriptional targets (Denison et al., 2011). Ovando et al have

reported a differential expression of genes in the livers of rats separately

exposed to dioxin and PCB126 for chronic time periods (Ovando et al., 2010).

AhR activation is known to interfere with the signaling functions of the

other nuclear transcription factors that control the regulation of their own battery

of genes (regulon). Safe and coworkers showed that binding of AhR complexes

to random XREs can stall the transcription of other relevant genes due to

inabilities in the formation of transcription complex (Safe et al., 1998). These

DNA binding elements are called ‘inhibitory xenobiotic recognition elements’

(iXREs) (Krishnan et al., 1995; Safe et al., 1998; Duan et al., 1999). AhR was

reported to alter estrogenic receptor (ER) activity by unwarranted binding to the

transcriptional targets of ER; thus resulting in stalled ER transcriptional

machinery (Safe et al., 1998). Recently, AhR was reported to interact with

glucocorticoid receptor to increase the transcription of metallothionein, and

disrupt metal homeostasis (Sato et al., 2013). Using AhR knockout mice treated

with an AHR agonist β-naphthoflavone (BNF), Wang et al have demonstrated

5
AhR dependent changes in the transcription of peroxisome proliferator activated

receptor (PPARα) (a liver specific isoform) and alter insulin sensitivity (Wang et

al., 2011). AhR activation could cause cellular toxicity by competitively interacting

with the common transcriptional coactivators and repressors that are also

necessary for other nuclear signaling pathways. This unwarranted competition for

recruiting transcriptional coactivators, necessary for the recruitment of RNA

polymerase to transcribe genes is defined as “squelching” (Cahill et al., 1994).

The mechanisms of AhR-induced toxicity discussed above generate disparate

toxicity patterns based on ligand, tissue and species differences, add complexity

and eludes the generalization of the mechanism.

Exposure to PCB126 and its general toxicity

For most people, the exposure to PCBs in general and PCB126

specifically occurs through food. The levels of PCB126 in various food

specimens containing PCB residues range from 0.05 to 0.83 pg/g. PCB126

intake through food accounts to 60% of the total consumption of dioxin like

chemicals (DLCs) per day per person (NTP, 2006). Historically there is no

evidence of direct exposure to PCB126 alone in humans, however its ubiquitous

occurrence in commercial mixtures of PCBs (Aroclors) released into

environment, makes it difficult to avoid low and chronic exposures to PCB126.

Upon exposure PCB126 is not known to be metabolized by the liver, instead gets

sequestered inside the liver, partly because of its lipophillicity and the tendency

to occupy the active site of CYP1A2 enzyme without undergoing metabolism. Un-

6
metabolized PCB126 is transported through blood and accumulates in the

adipose tissue during both acute and chronic exposures (NTP, 2006).

Accidental or occupational exposure of humans to DLCs including

PCB126 is linked to several health effects including chloracne, reproductive

deficits, developmental defects, rectal cancer, stomach cancer, skin cancer, lung

cancer, Hodgkins disease, non-Hodgkins lymphoma, multiple myeloma, myeloid

leukemia and liver cancer (Silberhorn et al., 1990; Robertson and Hansen, 2001).

In order to study the causal relationships between DLCs and the observed health

effects in humans, several animal studies were performed using the model

compound TCDD. The classic toxicity of TCDD involves mortality that results

from progressive wasting of fat and muscle (referred as wasting syndrome).

Some other common symptoms of toxicity include suppression of body weight

gain, loss of appetite, increase in the liver weight, thymic atrophy, immune and

reproductive defects (NTP, 2006). A two year chronic exposure study performed

by the National Toxicology Program (NTP), with PCB126 on female Sprague

Dawley rats has also shown a similar spectrum of toxicity, compared to TCDD

(NTP, 2006). Rats, mice, guinea pigs, hamsters and minks were some of

important animal models used to understand dioxin-like toxicity. An unusually

high variation has been observed in the sensitivity of various animal models to

TCDD. Based on lethality, the guinea pig is the most sensitive species tested and

hamsters seem to be among the most resistant. Among the more generally used

rodent models, rats are more sensitive compared to mice. In addition to species

differences between rats and mice, strain specific differences were also observed
7
in both the rats and mice exposed to TCDD. Among rats, Han/Wistar (H/W)

Kuopio strain seems to more resistant compared to the generally used Sprague-

Dawley rats (Pohjanvirta and Tuomisto, 1987; Pohjanvirta et al., 1987). Among

the mice, DBA/2 mice seem to more resistant compared to C57BL/6J mice

(Robertson et al., 1984). These species differences are attributed to the

sequence and structural variations of AhR across various species. Based on data

from the NTP and several other studies performed with rat model, the TEF of

PCB126 has been validated to be 0.1 in multiple tumor promotion studies and

some other generic endpoints such as cytochrome P450, Family 1, Subfamily A,

Polypeptide 1 (CYP1A1) induction (Walker et al., 2005; Haws et al., 2006). On

the other hand, limited data from mice and human in vitro studies suggest TEF

value of PCB126 to be less than 0.1 (Harper et al., 1993; Birnbaum and DeVito,

1995; vanBirgelen et al., 1996; Zeiger et al., 2001). Thus, more data across

multiple endpoints are needed to address the concern of interspecies variability.

Apart from their well-studied carcinogenic effects, PCB126 and DLCs

induce a wide spectrum of non-carcinogenic effects as well. These effects are

manifested across laboratory animals, domestic, wildlife and humans. Although

these non-carcinogenic endpoints are not uniformly manifested across all

species, some of the effects appear to be found in most of the models. This also

limits the TEF approach. Some of the non-carcinogenic effects widely found

across various studies, include non-alcoholic fatty liver and multiple changes in

the hormones involved in endocrine, growth and cellular metabolism (Birnbaum

and Tuomisto, 2000). A clear knowledge gap exists in our understanding of the
8
mechanisms of this toxicity. Thus, the subsequent chapters of this dissertation

(chapters 2 and 3) aim to improve our understanding of the underlying

mechanisms of PCB126-induced disruption in metabolism and the progression of

non-alcoholic fatty liver disease.

Dioxin-like PCBs are associated with metabolic disease in humans

Emerging scientific evidence shows that increased exposure to several

synthetic chemicals is associated with increase in the incidence of metabolic

diseases such as diabetes, obesity, dyslipidemia, hypertension and NAFLD (Neel

and Sargis, 2011; Thayer et al., 2012). This is because of the interference of

these chemicals with several agonistic and antagonistic activities of hormones

that regulate energy homeostasis. This concept of hormonal disruption is not new

according to the endocrine disruptor theory (Colborn et al., 1993). However, the

recognition of new chemicals that exclusively alter energy and metabolic

homeostasis and contribute to the increase in the obesity epidemic led to coining

of “the obesogen hypothesis” (Grun and Blumberg, 2009). According to this

hypothesis, an endocrine disruptor that alters metabolism and increases

adiposity by increasing the fat mass, can be sub-grouped as obesogen (Grun

and Blumberg, 2009; Janesick and Blumberg, 2016). Recently, the definition of

“obesogen” has been broadened to “metabolic disruptor”, to encompass a

comprehensive array of chemicals that play a role in the etiology of a variety of

other metabolic diseases along with obesity. As metabolic syndrome includes

several diseases that result from pathogenesis across various target organs and

the disruption of their endocrine functions, the definition of “metabolic disruptor”

9
seems more reasonable and comprehensive (Heindel et al., 2015b). Identifying

the potential risk of chemical exposures in causing metabolic disease, led to

changes in the old toxicology paradigm, which was mostly focused on evaluating

the risk of a chemical in terms of causing acute toxicity or cancer (Neel and

Sargis, 2011). To address the concerns, a workshop was hosted in Parma, Italy,

and a consensus statement from a group of multidisciplinary scientists was

released. This workshop reviewed the new data on emerging “metabolic

disruptors” and identified critical knowledge gap in the understanding of their

mechanisms and risk. PCBs and polybrominated flame retardants were

prioritized into the list of recognized “metabolic disruptors” for their particular

associations with diabetes, obesity and NAFLD (Heindel et al., 2015a).

Adipose tissue, because of its volume and distribution is a principal

contributor to the body burden of persistent organic pollutants (POPs) such as

PCBs. (Sargis and Brady, 2010). Body burden can be defined as the total

amount of pollutant in the body. Valvi et al have reported significant associations

between obesity risk and the total PCB burden in adipose tissue. These risks

could be dependent on additional cofactors such as sex and diet (Valvi et al.,

2012). Another cross sectional study has reported the prevalence of PCBs with

fewer than 5 chlorines on the biphenyl ring in human blood to correlate with

abdominal obesity (Lee et al., 2012). Many PCBs including PCB126 are being

understood as diabetogenic endocrine disruptors after the recent health survey in

the Anniston Community, AL (Anniston was the primary PCB manufacturing site

of Monsanto Industrial Chemicals Co) (Grun and Blumberg, 2009; Casals-Casas

10
and Desvergne, 2011; Decherf and Demeneix, 2011; Silverstone et al., 2012a).

These studies have reported significant associations between elevated PCB

levels and diabetes in the individuals aged less than 55 years (Silverstone et al.,

2012a). Similarly, studies in cohorts exposed to TCDD (Henriksen et al., 1997)

and contaminated oil comprised of the dioxin-like PCBs were reported to have an

increased risk of type II diabetes (Henriksen et al., 1997; Everett et al., 2011). A

study by Uemura and co-workers on body burden of PCB congeners reported

that dioxin-like PCBs (PCB 77, 81, 126) were associated with the risk of

metabolic disorders in the Japanese population (Uemura et al., 2009). In the

above mentioned studies, associations with diabetes were non-monotonic and

hence were only speculated to have a causative role with the disease. Finally,

Everett et al. conclusively reported a positive correlation between serum

concentrations of PCB126 and the risk of diabetes after measuring

glycohemoglobin levels (HbA1c) in the exposed populations based on the (2003-

2004) NHANES study (Everett et al., 2007; Everett et al., 2011). Excessive

plasma glucose levels in the blood over long term cause glycation of hemoglobin,

which serves as a metabolic marker for chronic glucose intolerance found in

diabetes (Everett et al., 2007; Little et al., 2011).

PCB exposure in humans is associated with impaired liver function and

diverse hepatic effects ranging from lipid infiltration (fatty liver), hepatitis, and

cholestasis to cirrhosis (Pond, 1982; Cotrim et al., 1999; Cotrim et al., 2004).

Maroni et al. reported that occupational exposure to PCBs is positively

associated with hepatomegaly and increased gamma-glutamyl transferase

11
(GGT), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and

ornithine carbamoyltransferase (OCT) values; indicating liver damage (Maroni et

al., 1981a; Maroni et al., 1981b). A mass poisoning that resulted from exposure

to cooking oil contaminated with PCBs in Yuchen, Taiwan (refered as “Yucheng”

cohort), resulted in an increased mortality rate from chronic liver disease and

cirrhosis (Yu et al., 1997). Cave et al. have reported a general dose-dependent

association between the total PCB levels and NAFLD in a cross-sectional cohort

that participated in the NHANES study (2003-2004). In the same study, congener

specific analysis has showed significant associations between the levels of

PCB126 and “suspected NAFLD”. To distinguish the NAFLD that occurs in

patients with metabolic disease, Cave et al. termed the NAFLD associated with

industrial or occupational exposures as toxicant associated steatohepatitis

(TASH) (Wahlang et al., 2013a; Al-Eryani et al., 2015). Although this TASH

phenotype is reproduced in several animal models upon exposure to PCB126

and other dioxin-like compounds, the mechanisms that cause lipid accumulation

are unclear. Cave et al. propose that incidence of TASH may follow a two hit

model, the results from the secondary hit by toxicant, in addition to primary

predisposing factors such as diet, genetic back ground and insulin resistance

(Cave et al., 2007; Wahlang et al., 2013a; Al-Eryani et al., 2015).

Both liver and adipose tissue play a very important role in maintaining the

energy homeostasis. In order to understand the mechanisms that lead to dioxin-

like toxicity, the disruption in the specific functions of target organs liver and

adipose, needs to be further characterized.

12
Liver metabolic homeostasis

Liver is a well-known for its ability to reduce the bio availability of a

toxicant by detoxifying it through the action of several XMEs. Apart from

detoxification, liver has a major role in performing, endogenous carbohydrate,

lipid and amino acid metabolism, necessary for nutrient availability and the

maintenance of energy homeostasis. In vertebrates, the liver functions to

maintain a steady supply of energy to other organs of the body during feed and

fasting. In a fed state (energy rich conditions), glucose is catabolized to generate

energy through the tricarboxylic acid cycle (TCA) in mitochondria. Excess

glucose is polymerized into glycogen and stored in the hepatocytes

(“glycogenesis”) or converted to free fatty acids (FFA) through de novo

lipogenesis. The synthesized FFA are assembled into very low density

lipoproteins (VLDLs) and delivered to adipose tissue for further storage. During

fasting (energy deprived conditions), glucose necessary for other organ systems

is produced by the liver. This process is called “hepatic glucose production”

(HGP). The synthesis of glucose in the hepatocytes from other substrates which

include, lactate, glycerol and amino-acids (gluconeogenic) is called

gluconeogenesis. HGP occurs through glycogenolysis of stored glycogen or

through gluconeogenesis. It is noteworthy that liver contributes up to 90% of

gluconeogenesis. While the energy requirements during shorter fasting durations

can be readily met by gluconeogenesis, longer fasting periods (starvation)

require oxidation of fat. FFA mobilized from adipose are thus β-oxidized to

generate energy. The β-oxidation occurs across multiple organelles that include
13
peroxisomes, mitochondria and endoplasmic reticulum of the hepatocyte.

Carbohydrate and lipid metabolism in fed and fasted states are regulated by the

counter regulatory actions of insulin and glucagon secreted by the pancreas.

Insulin is regarded as an anabolic hormone for its pro-synthesis and storage

effects on lipids and glucose. In other words, insulin increases lipid (de novo

lipogenesis) and glycogen synthesis (glycogenesis) in the liver. In contrast,

glucagon promotes glucose production (gluconeogenesis) and fatty acid

breakdown (β-oxidation) to meet the energy requirements.

Diverse actions of insulin and glucagon on various metabolic pathways

are orchestrated by multiple enzymes that need to be tightly regulated based on

the hormonal stimuli at the cellular surface. The diverse effects on insulin and

glucagon on carbohydrate and lipid metabolism occurs through the transcription

of appropriate genes necessary for the production of enzymes involved in

nutrient metabolism. Activation of various nuclear transcription factors during

their signal transduction is responsible for the identification of specific DNA

recognition motifs in the promoters of the genes that produce these enzymes.

Additional specificity in the transcription of these target genes according to

particular hormonal stimuli is achieved by the necessary recruitment of

coactivator or co-regulatory proteins. The use of cofactors to induce specificity in

the transcription of certain target genes despite having the same signal is often

referred as “signal discrimination”. Homeostatic glucose and lipid metabolism in

the liver involves complex orchestration across multiple nuclear transcription

factors and coactivators. During fasting, glucagon activates the nuclear

14
transcription factor cAMP response element-binding protein (CREB) and its co-

activator proteins peroxisome proliferator-activated receptor gamma coactivator

1-α (PGC1α) and forkhead box protein O1 (FOXO-1), in order to increase

glucose production. Activation of CREB through phosphorylation causes the

transcription of the genes phosphoenolpyruvate carboxykinase (Pepck-c) and

glucose 6-phosphatase (G6Pase), necessary for glucose production. Prolonged

fasting activates the nuclear transcription factor peroxisome proliferator activated

receptor alpha (PPARα), necessary for β-oxidation of fatty acids to generate

energy. The PGC1α also has co-activator and co-regulatory roles along with

PPARα during β-oxidation of fatty acids. In contrast, during the fed state, the

insulin counteracts glucagon by diminishing the transcriptional activities of both

CREB and PPARα, thereby inhibiting gluconeogenesis and fatty acid oxidation.

In addition to its inhibitory effects, insulin activates the transcription factors

carbohydrate response element binding protein (ChREBP) and sterol regulatory

element-binding proteins (SREBP), in order to transcribe genes involved in

glycogenesis and lipogenesis, necessary to conserve energy through nutrient

storage (Rui, 2014).

Adipose tissue and metabolic homeostasis

Adipose tissue is a complex matrix composed of significant populations of

mesenchymal stem cells, further committed progenitor preadipocytes and

differentiated adipocytes along with other cells. Adipose tissue is dynamic and

alters its mass by increasing or decreasing adipocyte size and/or numbers in

response to various hormonal stimuli. The adipocyte size increases by

15
accumulation/synthesis of lipids caused by adipogenesis during differentiation

(hypertrophy). The adipocyte number is increased by the proliferation of

preadipocytes that later differentiate into adipocytes (hyperplasia). Upon

physiological and nutritional demand, various hormones and growth factors

(growth hormone, insulin, glucocorticoids, and many cytokines) initiate a

transcriptional cascade across nuclear receptors that program adipogenesis in

the preadipocytes (Gregoire et al., 1998). The most important event in this

cascade is the transcriptional activation of a nuclear receptor peroxisome

proliferator-activated receptor-γ (PPARγ); also called the master regulator of

adipogenesis. PPARγ by itself is an orphan nuclear transcription factor which

further transcribes functional proteins that characterize the phenotype of a

mature adipocyte. During commitment, extensive genomic reprogramming with

histone modifications and chromosomal repositioning set the stage for the

transcriptional machinery to transcribe PPARγ (Kuroda et al., 2004; Zhang et al.,

2012). This epigenetic plasticity (histone modifications) on the PPARγ promoter

has been found to be regulated by glucocorticoid receptor (GR) and other

transcriptional coactivators after adipogenic stimuli (Cristancho and Lazar, 2011;

Zhang et al., 2012). In addition to differentiation, the PPARγ functions

multimodally in a mature adipocyte. It responds to insulin by enhancing lipid

synthesis and fatty acid uptake into a mature adipocyte. Loss of function in the

PPARγ mutants resulted in insulin resistance and lipid dystrophies due to

inadequate fatty acid uptake into an adipocyte (Anghel and Wahli, 2007;

Tontonoz and Spiegelman, 2008). Mature adipocytes; perform classic roles in the
16
storage and supply of energy resources by the uptake and secretion of FFA

during satiation (fed) and starvation (fasted), respectively. Insulin plays a

significant role in controlling these metabolic responses in an adipocyte. Insulin

facilitates glucose uptake into adipocytes through glucose transporters (GLUT4).

The glucose is converted to FFA through de novo lipogenesis (Summers et al.,

2000; Rowland et al., 2011). Another function of insulin in an adipocyte is to

inhibit lipolysis and reduce the release of stored triglycerides in the form of FFA

during the post-prandial state. Normal insulin signaling in an adipocyte inhibits

the actions of hormone sensitive lipase (HSL), an enzyme which catalyzes

hydrolysis of triglycerides into FFA (Botion and Green, 1999; Arner, 2005).

Glucagon secreted by pancreas has counter-regulatory effects on adipocytes by

increasing lipolysis to release FFA into blood during fasting state (Campbell and

Drucker, 2015).

Adipocytes exclusively secrete hormones such as leptin and adiponectin

(adipokines). These adipokines interact mainly with peripheral tissues (liver,

brain, muscle, and pancreas) and regulate carbohydrate, lipid metabolism,

energy expenditure, and feeding behaviors (Fasshauer and Blüher, 2015).

Insensitivity or inability to produce leptin leads to increased fat mass whereas

adiponectin leads to decreased insulin sensitivity and increases free fatty acid

circulation. Adipocytes producing normal levels of both leptin and adiponectin are

thus essential for effective insulin signaling (Mlinar and Marc, 2011). Both obesity

and lipid dystrophies have been reported to cause insulin resistance suggesting

the critical need for functional adipocyte mass.

17
Liver-adipose tissue crosstalk

Liver and adipose tissue steadily interact with each other in order to

maintain fuel homeostasis. FFAs released from the adipocytes during fasting are

the main source of fatty acid oxidation in liver. On the other hand during the fed

state, liver esterifies FFA into triacyl glycerol (TAG) and transports them to

adipose tissue for further storage. The TAG in VLDLs are lipolyzed by the action

of lipoprotein lipase (LPL) in the endothelial stroma of the adipose tissue in order

release FFA and glycerol. The FFA are then imported into adipose tissue for

storage (Reynisdottir et al., 1997). Adipose tissue also exhibits endocrine effects

through adiponectin and leptin. While adiponectin is known to increase β-

oxidation of fatty acids and also improve liver insulin sensitivity, leptin indirectly

effects liver metabolism through its effects on brain (Yamauchi et al., 2002; Xu et

al., 2003; Morris and Rui, 2009). The adiponectin regulates liver through the

activation of adiponectin receptors in the liver (adipoR) (Combs and Marliss,

2014). Although the effects of adiponectin on liver are characterized, the

mechanisms that activate adipoR2 signaling in liver need to be further

characterized. Aberrations of the adiponectin signaling in liver are reported to

cause hepatic insulin resistance and NAFLD (Finelli and Tarantino, 2013;

Polyzos et al., 2015).

The liver also exhibits its endocrine effects on adipose tissue through a

hormone called FGF21 (Kliewer and Mangelsdorf, 2010). FGF21 is under the

transcriptional control of PPARα and aids gluconeogenesis in the liver and

lipolysis in the adipocytes (Potthoff et al., 2009; Cheung and Deng, 2014).
18
Disruption in the functions of FGF21 is associated with several metabolic

diseases including NAFLD (Li and Tang, 2015).

PCB induced disruption in the metabolic functions of liver and adipose

tissue

Epidemiological studies now show that PCB exposure is associated with

the risk of metabolic diseases such as diabetes and NAFLD (Cave et al., 2010;

Everett et al., 2011). Despite the emerging evidence, very little is known on the

underlying mechanisms that cause metabolic disruption upon exposure to PCBs.

Several other POPs such as Bisphenol A and organotin compounds have shown

to disrupt metabolic homeostasis through induction of adipogenesis that further

leads to obesity (Grun et al., 2006; Grün and Blumberg, 2009; Somm et al.,

2009; Ohlstein et al., 2014). This increased adipogenesis results from

unwarranted increase in the activity of PPARγ that skews the developmental

programming of mesenchymal stem cells into mature adipocytes (Janesick and

Blumberg, 2011b; Janesick and Blumberg, 2011a). PCB153, a non-dioxin like

PCB was reported to be a diet dependent obesogens that worsens the NAFLD in

mice (Wahlang et al., 2013b). PCB153 was also reported to reduce the protein

levels and activity of CYP2B1 and CYP2B2 enzymes in the livers of

phenotypically obese zucker rat model (Zannikos et al., 1994)

Animal studies with the TCDD have reported hypoglycemia, altered lipid

homeostasis, dyslipidemia and ectopic lipid deposition in liver (Seefeld et al.,

1984a; Seefeld et al., 1984b; Weber et al., 1995; Viluksela et al., 1998). Some of

the previous studies with dioxin have implicated the role of PEPCK in the
19
observed hypoglycemia, but the causal or consequential mechanisms that lead

to observed toxicity is not known (Viluksela et al., 1995; Viluksela et al., 1999).

PCB126 and other coplanar PCBs have demonstrated impaired glucose

tolerance (increased glucose levels in blood) in lean mice and obese mice

subject to weight loss (Baker et al., 2013). PCB 77, a coplanar PCB was reported

to cause AhR-dependent inflammation in adipose tissue and impair glucose

homeostasis (increased glucose levels in blood) (Baker et al., 2013).

Comparative microarray studies across human hepatocytes, rats and mice livers,

treated with PCB126 showed alterations of genes in the lipid and glucose

homeostasis but the pathological relevance or mechanistic significance behind

these changes or their AhR dependence still remains elusive (Boverhof et al.,

2005; Boverhof et al., 2006; Swedenborg et al., 2009; Ovando et al., 2010;

Forgacs et al., 2013).

Statement of the problem and overview of the thesis

Understanding metabolic disruption caused by PCBs is a long overlooked

problem. The rediscovery of POPs as potential “metabolic disruptors” and

considerable knowledge gap in the understanding of role of PCBs in causing

metabolic disease, provides the rationale for this study. PCB126 was used as the

model toxicant for performing this study because of its 1) association with

metabolic disease and NAFLD in humans 2) high potency among PCBs, 3)

resistance to biotransformation and excretion and its 3) relevance in TEF based

risk assessment of DLC mixtures.

20
 The overarching goal of this work was to understand the PCB126 induced

metabolic disruption and the underlying mechanisms in its target organs; liver

and adipose tissue. Understanding these mechanisms would provide further

insights for managing the risk of metabolic disease associated with PCBs.

Our initial studies (Chapter 2) were focused on understanding the time

course of metabolic disruption after exposure to PCB126. These studies provided

us with an understanding of the course of metabolic disruption observed during

PCB126 toxicity. This study has established that PCB126 disrupts several

important functions of liver, necessary for maintaining metabolic homeostasis.

Further, the underlying molecular mechanisms and their dose-dependent effects

that alter hepatic metabolism have been investigated (Chapters 2 and 3). These

studies have identified novel molecular targets in the liver toxicity caused by

PCB126. To understand PCB126-induced toxicity in adipocyte function, an

extended human preadipocyte model that can be differentiated into adipocyte

(Chapter 4) was used. This study pointed us to the effects of AhR-induced

toxicity on functions of adipocyte. Finally, the overall conclusions and the

implications of PCB126 induced toxicity on the functions of liver and adipose

tissue are discussed (Chapter 5).

21
 CHAPTER II :

PCB126-INDUCED DISRUPTION IN GLUCONEOGENESIS AND FATTY

ACID OXIDATION PRECEDES FATTY LIVER IN MALE RATS 1

Abstract

3,3',4,4',5-Pentachlorbiphenyl (PCB126), a dioxin-like PCB and a potent

aryl hydrocarbon receptor (AhR) agonist, is implicated in the disruption of both

carbohydrate and lipid metabolism which ultimately leads to wasting disorders,

metabolic disease, and non-alcoholic fatty liver disease (NAFLD). However, the

mechanisms are unclear. Since liver is the target organ for PCB toxicity and

responsible for metabolic homeostasis, we hypothesized that early disruption of

glucose and lipid homeostasis contributes to later manifestations such as hepatic

steatosis. To test this hypothesis, groups of male Sprague-Dawley rats, fed a

AIN-93G diet, were injected (i.p) with a single bolus of PCB126 (5 µmol/kg) at

various time intervals between 9 h and 12 days prior to euthanasia. An early

decrease in serum glucose and a gradual decrease in serum triglycerides were

observed over time. Liver lipid accumulation was most severe at 6 and 12 days

of exposure. Transcript levels of cytosolic phosphoenol-pyruvate carboxykinase

(Pepck-c/Pck1) and glucose transporter (Glut2/Slc2a2) involved in

1
The content of this chapter has been published as a research article. The full reference
to the article is: Gadupudi, G.S., Klaren, W.D., Olivier, A.K., Klingelhutz, A.J., Robertson, L.W.,
2016. PCB126-induced disruption in gluconeogenesis and fatty acid oxidation precedes fatty liver
in male rats. Toxicological Sciences. Volume 149, Issue 1, January 2016, Pages 98-110; PMID:
26396156
G. S. Gadupudi and W. D. Klaren conducted the study and design. Histological analysis
was performed by A.K. Olivier.
22
gluconeogenesis and hepatic glucose transport, were time-dependently

downregulated between 9 h and 12 d of PCB126 exposure. Additionally,

transcript levels of Pparα, and its targets acyl-CoA oxidase (Acox1) and hydroxy-

3-methylglutaryl-CoA synthase 2 (Hmgcs2), were also downregulated, indicating

changes in peroxisomal fatty acid oxidation and ketogenesis. In a separate

animal study we found that the measured changes in the transcript levels of

Pepck-c, Glut2, Pparα, Acox1 and Hmgcs2 were also dose-dependent. Further,

PCB126-induced effects on Pepck-c were demonstrated to be AhR dependent in

rat hepatocytes. These results indicate that PCB126 induced wasting and

steatosis are preceded initially by a) decreased serum glucose caused by

decreased hepatic glucose production, followed by b) decreased peroxisomal

fatty acid oxidation.

Keywords: PCB126, gluconeogenesis, peroxisomes, fatty acid oxidation, PPAR,

steatosis.

Introduction

Polychlorinated biphenyls (PCBs) are persistent organic pollutants (POPs)

that continue to bioaccumulate because of their lipophillicity and resistance to

metabolic breakdown. PCBs are known to exert several biological and toxic

effects. Emerging evidence that exposure to PCBs and other POPs are strongly

associated with metabolic disease suggests a great threat to public health

(Ruzzin et al., 2010; Ruzzin, 2012; Thayer et al., 2012). The body burden of

PCBs is significantly associated with obesity, diabetes, hypertension and non-

alcoholic fatty liver disease (NAFLD) (Everett et al., 2007; Cave et al., 2010;
23
Everett et al., 2011; Silverstone et al., 2012b; Donat-Vargas et al., 2014;

Gauthier et al., 2014). However, the causal mechanisms are unclear. The toxicity

of PCBs vary greatly across the 209 structurally diverse congeners. Further

toxicity also arises from the metabolites generated from some of the PCB

congeners (Grimm et al., 2015). PCBs are broadly classified as dioxin-like and

non-dioxin-like congeners based on their similarities in toxicity to 2,3,7,8-

tetrachlorodibenzo-p-dioxin (TCDD). Structurally, dioxin-like PCBs are non-ortho

or mono-ortho chlorine substituted on the biphenyl ring. There are 12 such

dioxin-like congeners, often called co-planar PCBs, because of the fewer ortho

chlorine atoms that allow a more co-planar configuration. (Safe et al., 1985; Safe,

1993).

PCB126 (3,3′,4,4′,5-pentachlorobiphenyl) is the most potent dioxin-like

toxicant among PCBs. PCBs were recently upgraded to a Group 1 Human

Carcinogen by the International Agency for Research on Cancer (IARC) (Lauby-

Secretan et al., 2015; IARC, 2016). Exposure to PCB126 occurs through food,

water, and air (Hu et al., 2010; Ampleman et al., 2015; Grimm et al., 2015).

PCB126 and similar structures bind to the aryl hydrocarbon receptor (AhR), a

cytosolic ligand activated nuclear transcription factor that translocates into the

nucleus to induce changes in expression of genes and proteins that eventually

cause toxicity (Bandiera et al., 1982; Okey, 2007). The most studied genes

induced by PCBs are the cytochrome P450s, which respond rapidly to the

presence of pollutants (Dalton et al., 2002; Swanson, 2002a; Puga et al., 2009).

PCB126 also alters the expression of a broad range of other genes, which may
24
well lead to endocrine and metabolic disruption (Safe et al., 1998; NTP, 2006; Lo

et al., 2011; Forgacs et al., 2013; Gadupudi et al., 2015). The serum levels of

PCB126 and other dioxins are positively correlated with altered blood glucose

levels and risk of diabetes (Henriksen et al., 1997; Everett et al., 2007; Uemura

et al., 2009; Everett et al., 2011).

Apart from detoxification, liver is one of the principal organs involved in

glucose and lipid homeostasis during feeding and starvation. Liver responds to

complex hormonal stimuli to maintain energy homeostasis. In a fed state, the

liver synthesizes glycogen as a reserve for glucose. During brief starvation, the

liver produces glucose from glycogen through glycogenolysis. However, during

prolonged starvation, the liver generates glucose from other sources such as

lactate, a process referred to as gluconeogenesis. Liver is the only organ that

can produce glucose and export it in order to meet the energy requirements of

other tissues such as brain that cannot synthesize glucose. Thus, liver plays a

very important role in maintaining normal blood glucose levels through glucose

production. The glucose generated from the liver is also referred to as hepatic

glucose output. When the glucose stores are completely exhausted, the liver

meets the energy demands by oxidation of fatty acids (Rui, 2014). Toxicant

induced changes in the expression or activities of the enzymes involved in liver

metabolism may lead to metabolic disruption and liver disease (Wahlang et al.,

2013a; Al-Eryani et al., 2015).

Most of the available information on metabolic ramifications caused by

dioxin-like chemicals is from studies with dioxin and rodent models. Exposure to
25
dioxin leads to wasting effects, dyslipidemia, hypoglycemia and hepatic steatosis

(Seefeld et al., 1984a; Seefeld et al., 1984b; Seefeld and Peterson, 1984;

Christian et al., 1986). Results from studies with dioxin have indicated disruption

in intermediate metabolism and gluconeogenesis (Weber et al., 1991; Viluksela

et al., 1995; Weber et al., 1995). Although PCB126 is a dioxin-like chemical, its

ability to activate the AhR and its transcriptional targets vary across various

animal models (Forgacs et al., 2012; Forgacs et al., 2013). These differences

generate disparate toxicity patterns among different dioxin-like chemicals

(Ovando et al., 2010). It is therefore important to understand the specific effects

of PCB126, especially because of its prevalence and distribution in the

environment (Hu et al., 2010; Grimm et al., 2015). Except for the ability of

PCB126 to induce steatosis, very little information exists on its role in the

disruption of hepatic metabolism in vivo. Hence, to understand these effects on

liver glucose and lipid metabolism, we have analyzed the time dependent

changes in the liver of rats acutely exposed to PCB126.

Materials and methods

Chemicals and reagents

PCB126 prepared by improved Suzuki-coupling method was obtained

from the Synthesis Core, University of Iowa Superfund Research Program (Luthe

et al., 2009). The final purity of the obtained compound was determined by

GC/MS analysis to be >99.8%. The synthesized crude product was purified by

aluminum oxide column and flash silica gel column chromatography and

recrystallized in methanol. The AhR antagonist, CH223191 and all other

26
chemicals used in the cell culture experiments were obtained from Sigma-Aldrich

Chemical Co. (St. Louis, MO) unless otherwise mentioned. Appropriately

calculated amounts of PCB126 were mixed thoroughly in tocopherol stripped soy

oil (vehicle) using a sonication bath. The prepared solutions were stored at room

temperature until injection. For cell culture studies, both PCB126 and CH223191

were dissolved in dimethylsulfoxide (DMSO). Equivalent volumes of DMSO

(0.1% v/v) were used as negative controls.

Animal studies

All animal experiments were conducted with approval from the Institutional

Animal Care and Use Committee of the University of Iowa. Male Sprague-Dawley

(SD) rats weighing between 75-100 g at an age of 4-5 weeks were purchased

from Harlan laboratories (Indianapolis, IN) and housed in individual wire hanging

cages at a controlled environment of 22 0 C with a 12 h light-dark cycle with free

access to feed and water. For the “time-course study”, animals were randomly

divided into seven groups (3 rats per each time point) that received a single i.p

injection of vehicle (tocopherol-stripped soy oil; 5 ml/kg body weight) or PCB126

at 5 µmol/ kg body weight (1.63 mg/ kg body weight) at various time points before

euthanasia. All animals were fed a modified AIN-93G diet with total fat content of

10% by weight from soy oil. After three week acclimatization, the designated

animal groups received an injection of PCB126 at the appropriate time points

before being euthanized, without fasting. Feed consumption and weights of the

animals were determined every 4 days. Six groups of PCB126 exposed animals

and one control group (soy oil at 288 h) were euthanized at 288 h (12 d), 144 h
27
(6 d), 72 h (3 d), 36 h (1.5 d), 18 h, 9 h post injection. The 12 day time period and

the dose was chosen based on a previous study in which this time period was

shown to be sufficient to elicit liver pathology in PCB126-treated rats (Lai et al.,

2010). All the animals were euthanized using carbon dioxide asphyxiation

followed by cervical dislocation. Livers and other organs were excised, weighed

and processed for further analysis.

A second animal study was conducted to further investigate dose

dependent effects. In this study, all the animals were also male SD rats weighing

75-100 g and maintained at similar conditions on AIN-93G diet (7% fat by

weight). After acclimatization, animals (6 rats per dose) were given a single i.p of

vehicle (stripped corn oil; 5ml/ kg body weight) or PCB126 in oil at a dose of

either 1 µmol/ kg body weight (326 µg/ kg body weight) or 5 µmol/ kg body weight

(1.63 mg/ kg body weight) two weeks before euthanasia (Lai et al., 2012). Flash

frozen livers were subject to RNA extraction and included into the analysis where

appropriate. Please note the percentage of soy oil in this diet (7%) was slightly

different from that used (10%) in the time course study.

Blood collection and serum analysis

Whole blood samples from the hearts were collected into non-

anticoagulant coated tubes after euthanasia. The blood was allowed to clot in the

tubes and the serum fractions was separated by centrifugation at 1500 g for 10

min. The serum samples were aliquoted and frozen at -80 C for further analysis.

Serum glucose, triglyceride levels, non-esterified fatty acids (NEFA) and other

predictors for general liver function (total protein, albumin, alkaline phosphatase
28
(ALP), alanine amino transferase (ALT), gamma-glutamyl transferase (GGT),

total bilirubin, blood-urea-nitrogen (BUN)) were measured by the Veterinary

Diagnostic Laboratory at the University of Illinois, Urbana-Champaign.

Histology and special stains

Sections of liver were fixed in 10 % neutral buffered formalin, processed,

and embedded in paraffin and stained with hematoxylin and eosin (H & E).

Additional sections were also stained with period acid-Schiff (PAS) for measuring

changes in glycogen (Sheehan and Hrapchak, 1987).

Lipid staining and quantification

Formalin fixed liver sections were stained for lipid using osmium tetroxide

(LG, 1992). Briefly, liver sections were placed in potassium dichromate

(5%)/osmium tetroxide (2%) solution in water overnight. The samples were

washed for 2 h in tap water and then routinely processed and embedded in

paraffin. Sections were cut at 4 μm thickness and baked in a 60 °C oven

overnight. Slides were cooled, deparaffinized and counterstained with nuclear

fast red for 5 min. Slides were then dehydrated and coverslipped. Osmium-

stained slides were examined (BX51, Olympus) and digital images collected at

100× magnification.

Hepatocyte culture

Cell culture experiments were performed using rat hepatoma cells (H4IIE

cells) with passage numbers less than 30 (Pitot et al., 1964) . H4IIE cells were

cultured as a monolayer in Dulbecco's modified Eagle’s medium (DMEM)

29
supplemented with 10% fetal bovine serum (FBS), L-glutamine and penicillin-

streptomycin. The cells were uniformly seeded into 6 wells plates and allowed to

grow until confluence. The cells were treated for one day with PCB126 or

CH223191 mixed into the medium at various concentrations. Equivalent volumes

of DMSO, used to dissolve the test chemicals, were used as controls.

Gene expression analysis

Total RNA of each rat liver sample or cell fraction was extracted using the

RNeasy extraction kit from Qiagen Inc. (Valencia, CA). Briefly, 20–30 mg of liver

tissue or cell lysate was homogenized and subjected to RNA extraction as

described in the manufacturer's protocol. Absorbance of the isolated RNA was

determined spectrophotometrically at 260 and 280 nm. RNA samples with purity

ratios (A260/A280) between 1.8 and 2.0 were used for generating cDNA samples

with a high-capacity cDNA reverse transcription kit from Applied Biosystems Inc.

(Foster City, CA) as described in their protocol. Consequently, the real-time

qPCR analysis was performed at an optimized cDNA template concentration of

50 ng. The reaction was performed using a SYBR Green Master Mix kit supplied

by Applied Biosystems Inc. (Foster City, CA). The primers used to measure the

transcript levels of various genes are listed in Appendix B (Table B-1) and were

synthesized by Integrated DNA Technologies Inc. (Coralville, IA). Each sample

was analyzed in duplicate. The amplification reaction was performed with an

Eppendorf RealPlex2 Mastercycler® (Hamburg, Germany) using a program that

started at 95° for 10 min followed by 40 cycles of two step PCR cycle at 95° for

15 s and 60° for 1 min. Subsequently, a melting curve analysis was also
30
performed. The transcript levels of all the quantified genes were normalized to

the transcript levels of the reference gene hypoxanthine-guanine phospho-ribosyl

transferase (Hprt1). The expression level of each gene in a given sample was

normalized to the mean of the biological control group of each study (oil vehicle

5 ml/kg) or DMSO in cell culture studies. The final transcript levels were

quantified relative to the normalized transcript levels of the control group, using

the Pfaffl method (Pfaffl, 2001).

Statistics

The differences across the control and various treatment groups were

analyzed using a one-way ANOVA followed by Tukey’s post-hoc test. The

interaction between CH223191 and PCB126 during co-treatment on H4IIE cells

was assessed using two-way ANOVA. Only results with significant differences

(P-value < 0.05) were reported. All the error bars represent standard error (SE) of

the mean. All the statistical analyses were performed using GraphPad Prism

software (GraphPad Software Inc., CA).

Results

Effects of PCB126 on body weight, feed consumption and liver weight

The percentage of weight gain in the rats injected with PCB126 (5 µmol/

kg) at various time points and the control animals (vehicle) were recorded over

the course of the experiment (Figure II-1A). No significant changes in body

weights were observed after PCB126 injection. No significant changes were

observed in the total feed efficiency (total body weight gain/total feed consumed)

31
or feeding behavior (Figure II-1B). Exposure to PCB126 significantly increased

both absolute (data not shown) and relative liver weight in a time dependent

manner (Figure II-1C). Significant increases in relative liver weight were

observed after 144 h (6 d) of injection which further increased at 288 h (12 d)

post exposure. PCB126 is a potent AhR agonist and classically induces

cytochrome P450, family 1, subfamily A, polypeptide 1 (Cyp1a1) along with other

transcriptional targets (Hennig et al., 2002). PCB126 significantly induced the

transcript levels of Cyp1a1 (>1000 fold) in the liver as early as 9 h post injection.

These effects remained high throughout the remaining time points of the study

(Figure II-1D).

PCB126 time dependently increases the lipid accumulation in the liver

Histological evaluations of H & E stained liver sections showed a time

dependent increase in vacuolation of hepatocytes, with increased severity at 6

and 12 days after exposure (data not shown). To further evaluate the

composition of the vacuoles, an osmium tetroxide staining was performed to

check for lipid accumulation (Figure II-2). Vacuolar changes consisting of

cytoplasmic clearing was first observed in a subset (1/3rd) of rat livers as early as

9 h post exposure. Mild lipid accumulation was observed at 18 h and 36 h with

extensive lipid accumulation at 144 h (6 d) and 288 h (12 d). Lipid accumulation

was localized within periportal hepatocytes at early time points with an increased

distribution towards the central vein at later time points. The longer time of

exposure (288 h) showed a more diffuse pattern of lipid accumulation (Figure

II-2). To confirm any changes in glycogen content, random liver sections from
32
each group were stained with a PAS stain. Glycogen was present in all treatment

groups except in the areas of cytoplasmic clearing and areas of lipid

vacuolization, indicating PCB126 treatment did not lower liver glycogen levels.

(Figure A-1).

Effect of PCB126 on the levels glucose and triglycerides in the serum

Previous studies in several rodent models have demonstrated changes in

blood glucose levels after exposure to dioxin-like chemicals (Viluksela et al.,

1998; Baker et al., 2013; Nash et al., 2013). Hence, the serum fractions were

prepared and analyzed for unfasted glucose and triglyceride levels. Exposure to

PCB126 resulted in a severe drop in the serum glucose levels inducing a

hypoglycemia (Figure II-3A). A significant drop in serum glucose levels was

observed as early as 9 h post exposure. The glucose levels in control animals

remained normal (Harlan Laboratories, 2014). PCB126 and other dioxins have

been reported to induce steatosis however, the source and nature of the lipid

accumulation is not well understood. Serum triglycerides were analyzed to

understand the changes in lipid transport that may lead to steatosis. PCB126

exposure resulted in an immediate increase in the serum triglycerides at early

time-points (9 h, 18, 36 h). However, serum triglyceride levels gradually

decreased at later time points in PCB126 exposed animals (Figure II-3B). The

control animals had normal triglyceride levels.

33
Effect of PCB126 on liver glucose metabolism

The liver plays a critical role in maintaining homeostatic glucose levels by

regulating glucose storage or secretion during fed and starved states. Since

there were no changes in feed consumption (Figure II-1B), the effects of PCB126

on the transcript levels of the genes involved in gluconeogenesis were analyzed.

Early studies using TCDD have reported decreased PEPCK activity in rodent

livers over time (Viluksela et al., 1995; Weber et al., 1995). However,

physiological effects of other potent dioxin-like chemicals have not been well

characterized. Transcript levels of Pepck-c also referred to as Pck1 were

measured throughout the time course of PCB126 exposure, and found to be

significantly decreased by ~85% with increased duration of exposure to PCB126

(Figure II-4A). The dose dependent effects were evaluated in the rat livers

exposed to 1 and 5 µmol/kg of PCB126. Significant dose-dependent decrease in

Pepck-c transcription was also observed with increased PCB126 dose (Figure

II-4B). To further examine the effects of decreased Pepck-c expression on

hepatic glucose output, the transcript levels of the major glucose transporter in

the liver (Slc2a2) were measured (Thorens and Mueckler, 2010). Slc2a2, more

commonly referred as Glut2 is a bidirectional transporter that is a predictor for

glucose output of the liver (Thorens, 1996). We found that the levels of Glut2

were significantly decreased in both a dose and time dependent manner after

exposure to PCB126 (Figure II-4C and 4D), possibly resulting from decreased

gluconeogenesis.

34
Effect of PCB126 on lipid metabolism in the liver

Exposure to PCB126 for longer times of exposure resulted in increased

lipid accumulation in the liver leading to steatosis indicates that PCB126

fundamentally alters liver lipid metabolism (Figure II-2). Our laboratory previously

reported that liver homogenates from PCB126 treated rats showed diminished β-

oxidation of fatty acids in peroxisomes due to decreased activity of Acox1 (fatty

acyl-CoA oxidase) ex vivo (Lazarow, 1981; Poosch and Yamazaki, 1986;

Robertson et al., 2007). Peroxisome proliferator activated receptor alpha

(PPARα) is a key transcription factor that regulates fatty acid metabolism in

peroxisomes and mitochondria. We found that PCB126 diminishes the transcript

levels of Pparα in a both time and dose-dependent manner (Figure II-5A and 5B).

Therefore, we measured levels of several transcriptional targets of PPARα

involved in metabolic pathways of fatty acid metabolism. PCB126 decreased the

transcript levels of Acox1 and 3-hydroxy-3-methylglutaryl-CoA synthase 2

(Hmgcs2), key enzymes involved in peroxisomal β-oxidation and ketogenesis,

respectively (Figure II-5C, 5D, 5E and 5F). It is noted that time-dependent

downregulation of Pparα and it’s target Hmgcs2 only showed a downward trend

that did not reach statistical significance. The lack of significance is attributed to

the lower number of animals in each group (n=3). Surprisingly, despite

downregulation of Pparα, there were no detectable changes in the transcript

levels of some of its targets such as carnitine palmitoyl-transferase Ia (Cpt1a)

and cytochrome P450, family 4, subfamily A, polypeptide 2 (Cyp4a2 ), enzymes

35
involved in mitochondrial β-oxidation and ω-oxidation of fatty acids (data not

shown).

PCB126 induced effects on Pepck are mediated by Aryl hydrocarbon receptor

(AhR)

To further investigate whether the observed effects of PCB126 in the rat

liver are AhR mediated, we used a well-established and available rat H4IIE liver

cell line (Benedict et al., 1973; Bradlaw and Casterline, 1979). Cells were

exposed to PCB126 at concentrations that ranged between 3 pM and 300 nM

and analyzed for the classic AhR mediated induction of Cyp1a1. A dose

dependent increase in the induction of Cyp1a1 with maximal induction at

concentrations over 3 nM of PCB126 was observed (Figure A-2). As previously

described in other studies, no significant cytotoxicity or changes in doubling time

were found on H4IIE cells when treated with PCB126 at doses as high as 5µM

(Knutson and Poland, 1980). To determine whether the effects of PCB126 on

Pepck-c levels were dependent on AhR activation, we performed studies with the

AhR antagonist CH223191. The minimum concentration of PCB126 (3 nM) that

induced maximum Cyp1a1 induction was chosen to co-incubate with CH223191

(Choi et al., 2012). The increase in transcript levels of Cyp1a1 by PCB126 was

effectively inhibited by CH223191, verifying its antagonistic effects (Figure II-6A).

Similar to the decreased expression pf Pepck-c in rat livers, decreased

expression of Pepck-c in the presence of PCB126 at concentrations as low as 3

nM was observed in these cells. The diminished expression of Pepck-c was

36
mitigated by the AhR antagonist CH223191, indicating that Pepck-c

downregulation is mediated by AhR activation (Figure II-6B).

Discussion

The current study was performed to understand the early time course of

metabolic disruption caused by the dioxin-like PCB, PCB126. PCB126 caused

significant alterations in glucose and lipid metabolism that lead to hypoglycemia

followed by hepatic steatosis. Previous studies with dioxins have reported

wasting disorders that lead to weight and appetite loss after long-term exposure

in rats and other animal models (Hsia and Kreamer, 1985; Weber et al., 1991;

Viluksela et al., 1995; Viluksela et al., 1999). The doses and the length of time

tested in this study for PCB126 toxicity did not elicit any observable wasting, but

caused significantly altered transcript levels of the genes important for hepatic

glucose production during gluconeogenesis and fatty acid oxidation. Importantly,

these observed early effects suggest that the precedent metabolic disruption

caused by PCB126 then leads onto overt toxicity that includes classic wasting

and appetite loss.

The current study demonstrates that the transcript levels of Pepck-c, the

rate limiting enzyme in gluconeogenesis, are sensitive to dose and time-

dependent exposure of PCB126. The AhR-dependent downregulation of Pepck-c

provides further understanding on the mechanistic role of AhR in regulating the

transcription of Pepck-c and gluconeogenesis. Similar AhR dependent effects on

PEPCK-C and gluconeogenesis were also previously shown in primary mouse

hepatocytes in vitro (Zhang et al., 2012), however the role of AhR in vivo is not
37
understood. Although the time dependent effects of PCB126 on PEPCK-C have

not been reported previously, other dioxin-like chemicals have shown effects on

PEPCK activity (Viluksela et al., 1995; Viluksela et al., 1999; Nash et al., 2013).

The concomitant decrease in Glut2 transcript levels along with a decrease in

Pepck-c emphasizes the underlying role of reduced gluconeogenesis in

decreasing the hepatic glucose output thereby leading to hypoglycemia in rats.

Besides glucose production through gluconeogenesis, PEPCK-C is also

important for glyceroneogenesis in adipose, skeletal muscle and liver tissues

(Hanson and Reshef, 2003). Glyceroneogenesis is the de novo synthesis of

glycerol-3-phosphate (G-3-P) from precursors other than glucose and glycerol

(Martins-Santos et al., 2007). The G-3-P generated is used in the

estertification/resterification of fatty acids during triglyceride synthesis (Reshef et

al., 2003; Martins-Santos et al., 2007; Nye et al., 2008). Reduced levels or

activity of PEPCK-C in the liver, caused by toxicant exposure may thus lead to

reduced esterification of free fatty acids. The loss of esterification could impair

the assembly of triglycerides into lipoproteins, thereby obstructing the lipid

transport out of the liver and increase the accumulation of fatty acids. The

glyceroneogenesis pathway is physiologically important and well conserved

across mice, rats and humans (Gorin et al., 1969; Brito et al., 1992; Kalhan et al.,

2001). In light of current findings with PCB126, future studies aimed to

understand it’s effects on PEPCK and glyceroneogenesis will be important for

elucidating the mechanisms by which PCBs cause metabolic disruption. The

expression of Pepck-c is controlled by the differential hormonal activation of

38
nuclear receptors present in various tissues; especially by the PPARs. Ablation

of the PPAR dependent expression of PEPCK-C in adipose and liver of mice has

been reported to cause lipodystrophy and decreased hepatic glucose production,

respectively (Olswang et al., 2002; Xu et al., 2002).

Initial disruption of gluconeogenesis observed in this study was followed

by increased accumulation of lipid in the liver. Liver specific knock out mice of

Pepck-c were previously reported to develop steatosis due to impaired lipid

metabolism (She et al., 2000). Additional studies showed that these mice

develop steatosis due to impaired β-oxidation caused by disruption in hepatic

tricarboxylic acid (TCA) cycle (Burgess et al., 2004). Previous studies with

PCB126 and other dioxin-like PCBs demonstrated decreased activity of

peroxisomal β-oxidation on long chain fatty acids in rats, however, the role of

PEPCK-C in peroxisomal β-oxidation was not examined (Robertson et al., 2007).

Peroxisomes are the sites for oxidation of branched and long chain fatty acids

and can be subject to increased biogenesis or altered activity of their enzymes

upon exposure to xenobiotics (Glauert et al., 1990; Hennig et al., 1990; Borges et

al., 1993; Espandiari et al., 1995). The genes encoding the enzymes involved in

the peroxisomal β-oxidation pathway are transcriptionally regulated by PPARα

(Reddy and Hashimoto, 2001). However, the regulatory role of PPARα is not

restricted to peroxisomes. PPARα has a pan regulatory effect in controlling the

transcription of enzymes involved in other metabolic processes which include

mitochondrial and microsomal fatty acid oxidation, lipogenesis and ketogenesis

(Mandard et al., 2004; Kersten, 2014). In our study, time and dose dependent
39
decreases in the transcript levels of Pparα and its targets Acox1 and Hmgcs2

were observed. Acox1 is the initial and rate limiting enzyme involved in

peroxisomal β-oxidation of long chain fatty acids. Our results showing decreased

transcript levels of Acox1 support our previous studies that indicate suppression

of peroxisomal activities and a decrease in the protein levels of Acox1 in the rat

liver extracts (Robertson et al., 2007). Surprisingly, we did not detect any

changes in the mRNA levels of CPT1a or CYP4A2, enzymes involved in

mitochondrial and microsomal fatty acid oxidation. This could be due to

compensatory mechanisms that may occur within the times used in this study.

We and others have previously reported that TCDD and PCB126 decrease the

expression of CD36 in rat livers, a fatty acid transporter involved in lipid transport

into the liver (Forgacs et al., 2012; Lai et al., 2012). Despite the decrease of

Pparα and its targets in vivo, no significant changes in Pparα transcript levels

were found in the H4IIE cells exposed to PCB126 in vitro. This disparity could be

due to the complexity of feeding and starvation cycles that are required for the

activation of Pparα in vivo. Regardless, the constitutive expression of AhR in

transgenic mice livers was associated with a decrease in the expression of Pparα

and fatty acid oxidation, providing further support for AhR mediated

downregulation of Pparα in the liver (Lee et al., 2010).

Our findings of PCB126 induced hypoglycemia and decreased expression

of hepatic Pepck-c are consistent with previous studies using TCDD and other

dioxins (Weber et al., 1991; Weber et al., 1995; Viluksela et al., 1997; Viluksela

et al., 1998; Viluksela et al., 1999). Reduced liver gluconeogenic activities were
40
also noted in the livers of various other animal models such as chicken and fish

(rainbow trout and arctic char) when administered the PCB mixture Aroclor 1254

(Srebocan et al., 1977; Vijayan et al., 2006). This observed effect could be due to

the AhR activity caused by the dioxin-like PCBs present in Aroclor 1254

(Silkworth et al., 2008). In contrast to our studies, exposure to DE-71, a

commercial polybrominated diphenyl ester (PBDE) did not lower blood glucose of

Wistar rats despite a decrease in the PEPCK-C activity (Nash et al., 2013).

Similar observations with decreased PEPCK-C activity with no changes in blood

glucose levels were found in female SD rats exposed to TCDD and 1,2,3,4,7,8-

hexachlorodibenzo-p-dioxin (HxCDD) (Croutch et al., 2005). These differences in

altered blood glucose levels may be attributed to the differences in the potency of

dioxin-like chemicals on PEPCK during fed and fasted states, dosage and

treatment regimens, age and gender of the models used.

Our findings on altered metabolic homeostasis of the liver after PCB126

exposure have been illustrated in a schematic (Figure II-7). The disruption in liver

metabolism is principally through reduced hepatic glucose production caused by

an AhR-dependent decrease in the expression of Pepck-c, which results in

reduced gluconeogenesis. During glucose deprivation, Pepck-c catalyzes a

critical step that involves conversion of TCA cycle intermediate oxaloacetate into

phosphoenolpyruvate that is later converted into glucose by a series of enzymes

in the gluconeogenic pathway. The produced glucose is exported by glucose

transporters (Glut2) into the blood to meet the energy requirements of other

organs. Further, reduced glucose availability results in Pparα mediated induction

41
of fatty acid β-oxidation and ketogenesis to meet energy requirements. After

immediate effects on gluconeogenesis, PCB126 also decreases the transcription

of Pparα and its targets involved in peroxisomal β-oxidation (Acox1) and

ketogenesis (Hmgcs2). The role of AhR on Pparα and its targets however need

to be further clarified. The decrease in Pparα and its targets especially during

glucose deprived conditions appears to increase lipid accumulation and further

exacerbate metabolic disruption in the liver and its energy production.

Recently, Cave et al. reported a dose dependent association with PCBs

and unexplained incidence of NAFLD in US populations (Cave et al., 2010). The

effects of PCBs on gluconeogenesis, glyceroneogenesis and fatty acid

metabolism warrant further exploration in order to understand their potential role

in metabolic disorders, such as diabetes and NAFLD. Exposure or accumulation

of such PCBs in humans may impair hepatic functions during glucose handling,

especially during fasting and starvation. Additionally, chronic exposures to

PCB126 and other dioxin-like PCBs induced effects may interfere with the

efficacy of the medications used to treat metabolic disease or even predispose

individuals to liver disease according to their dietary composition and habits.

In summary, the results of these studies indicate that PCB126-induced

wasting and NAFLD are preceded by reduced hepatic glucose output and

decreased fatty acid oxidation in peroxisomes. The time course of metabolic

disruption involved decreased gluconeogenesis followed by decrease in

peroxisomal fatty acid oxidation. The gene expression studies show that reduced

glucose production in the liver is caused by AhR dependent decrease in the

42
transcript levels of Pepck-c. In the event of reduced gluconeogenesis, it is likely

that liver metabolism shifts to fatty acid oxidation controlled by the Pparα.

PCB126 also decreases the transcription of Pparα and it targets involved in fatty

acid metabolism, especially peroxisomal β-oxidation. Based on these

observations, one may conclude that PCB126 induced metabolic disruption

results from the livers inability to meet physiological energy demand by reducing

glucose production and fatty acid oxidation.

Supporting data description

The supplementary data section in Appendix A and B contain extended

data showing the effects of PCB126 on liver glycogen (Figure A-1), CYP1

transcript levels after exposure to PCB126 at various concentrations (Figure A-2)

the primers used for qRT-PCR (Appendix B, Table B-1).

43
Figures

Figure II-1. Effects of PCB126 on body weight gain, feed consumption and
liver weight.
Body weight gain percentage (A), total feed efficiency (total Body weight
gain/total Feed consumed) (B) and the relative liver weight % (C) were measured
in SD rats (n=3-4 animals/group) injected with PCB126 (5 µmol/Kg) . Transcript
levels of Cyp1a1 (D) were measured.). PCB126 treated groups (grey bar) were
compared to oil vehicle treated (white bar) controls (* represents P<0.05; one-
way ANOVA).

44
Figure II-2. PCB126 exposure increased lipid content in the livers.
Liver sections were stained with osmium tetroxide stain for lipid (black). The
vehicle treated rats do not show any lipid accumulation in both periportal and
centrilobular regions (A, B). Mild periporatal accumulation of lipids at 9 h (C, D).
Increased periportal to mid-zonal accumulation of lipids with exposure time18 h
(E, F), 36 h (G, H), 72 h (I, J). More diffuse hepatic lipid accumulation was
observed at 144 h (K, L) and 244 h (M, N) post exposure. The images were taken
at a magnification of 100X.

45
Figure II-3. PCB126 decreased serum glucose and triglyceride levels.
Significant changes in glucose levels (A) and triglycerides (B) of PCB126 (5 µmol/Kg)
treated rats (n=3-4 animals/group) were compared to the vehicle control (n=3
animals/group). (* represents P < 0.05; one-way ANOVA).

46
Figure II-4. PCB126 causes decrease in the transcript levels of Pepck-c and
Glut2 in the liver.
Time dependent (A,C) changes in mRNA levels of Pepck-c (A) and Glut2 (B) in
the rats (n=3) injected with PCB126 (5 µmol/Kg) were compared to the oil
vehicle control (n=3). Dose dependent (B, D) changes in mRNA levels of Pepck-
c (B) and Glut2 (D) in the rats (n=6) injected with PCB126 (1 or 5 µmol/Kg)
were compared to the oil vehicle control (n=6). (* represents P < 0.05; one-way
ANOVA).

47
Figure II-5. PCB126 causes decrease in the transcript levels of Pparα and
its target genes.
Time dependent (A, C, E) changes in mRNA levels of Pparα (A), Acox1 (C),
Hmgcs2 (E) in the rats (n=3) injected with PCB126 (5 µmol/Kg) were
compared to the oil vehicle control (n=3). Dose dependent (B, D, F) changes in
mRNA levels of Pparα (B), Acox1 (D), Hmgcs2 (F) in the rats (n=6) injected
with PCB126 (1 or 5 µmol/Kg) were compared to the oil vehicle control (n=6).
(* represents P < 0.05; one-way ANOVA).

48
Figure II-6. AhR antagonist CH223191 mitigates the inhibitory effects of PCB126
on Pepck-c.
Rat hepatocytes (H4IIE cells) were exposed to PCB126 (10 µM), DMSO, CH223191 or
con-incubated with PCB126 and CH223191 and the relative transcript levels of (A)
Cyp1a1 and (B) Pepck-c were normalized to DMSO control. (* represents P < 0.05; one-
way ANOVA).

49
Figure II-7. The scheme depicts the effects of PCB126 on the transcript levels of
various enzymes in the liver.
PCB126 exposure results in the decrease of glucose output (red) from the liver due to AhR-
dependent (red oval) decrease in the transcription of Pepck-c (orange oval). Decreased
glucose output is accompanied by a decrease in the transcription of hepatic glucose
transporter Glut2 (red). PCB126 decreases β-oxidation (red) in the peroxisomes (blue) and
the transcript levels of Pparα, Acox1, Hmgcs2 (orange ovals). Decreases in the peroxisomal
β-oxidation may lead to lipid accumulation (yellow) in hepatocytes. The general pathways
of gluconeogenesis and fatty acid oxidation are outlined (black).

50
 CHAPTER III :

DIMINISHED PHOSPHORYLATION OF CREB IS A KEY EVENT IN THE

DYSREGULATION OF GLUCONEOGENESIS AND GLYCOGENOLYSIS

IN PCB126 HEPATOTOXICITY 2

Abstract

The dioxin-like PCB126 elicits toxicity in various target organs. In the rat

liver an alteration in the transcript levels of several genes involved in glucose and

fatty acid metabolism provides in-sights into the origin of its hepatotoxicity. To

explore these, male Sprague-Dawley rats, fed AIN-93G diet, were injected with

PCB126 (1 or 5 µmol/kg) or corn oil and euthanized after 2 weeks. PCB126

significantly decreased serum glucose levels and the transcript levels of genes of

many gluconeogenic and glycogenolytic enzymes under the transcriptional

control of a nuclear transcription factor, cAMP response element-binding protein

(CREB). As a novel finding, we show that PCB126 significantly decreases CREB

phosphorylation, which is important for regulating both gluconeogenesis and fatty

acid oxidation in the liver and explains CREB’s integrative effects on both

carbohydrate and lipid metabolism in PCB126 toxicity.

Keywords: (PCB126, dioxin, CREB, gluconeogenesis, glycogenolysis, metabolic

disruptor, hepatotoxicity, fatty liver, glucose)

2
The content of this chapter has been published as a research article. The full reference
to the article is: Gadupudi, G.S., Klingelhutz, A.J., Robertson, L.W., 2016. Diminished
Phosphorylation of CREB Is a Key Event in the Dysregulation of Gluconeogenesis and
Glycogenolysis in PCB126 Hepatotoxicity. Chemical Research in Toxicology. DOI:
10.1021/acs.chemrestox.6b00172; PMID: 27509375
G. S. Gadupudi designed and performed the study.
51
Introduction

Exposure and serum levels of a PCB (Polychlorinated biphenyl) congener,

PCB126 and other dioxin-like compounds in human populations are positively

correlated with altered blood glucose levels, risk of diabetes and non-alcoholic

fatty liver disease (NAFLD).(Everett et al., 2007; Cave et al., 2010; Silverstone et

al., 2012a) PCB126 is resistant to biotransformation, accumulates in the liver and

causes dioxin-like toxicity through activation of nuclear transcription factor aryl

hydrocarbon receptor (AhR).(NTP, 2006) PCB126 binds to AhR and trans-

activates the expression of genes and proteins that possess xenobiotic

recognition elements (XREs) in their promoters.(Bandiera et al., 1982) The rapid

transcription of enzymes involved in xenobiotic metabolism and the associated

oxidative stress, does not completely explain the observed metabolic disruption

and fatty liver in PCB126 exposure.(Dalton et al., 2002; Swanson, 2002b) We

and several others have reported alterations of genes involved in

gluconeogenesis and fatty acid oxidation.(Forgacs et al., 2012; Nault et al., 2013)

Despite the indication of effects of dioxin-like chemicals on intermediary

metabolism and gluconeogenesis in early reports, very little is known about the

mechanisms.(Weber et al., 1991; Viluksela et al., 1998; Nash et al., 2013)

Hence, to study the genes that are involved in hepatic glucose production and

consequent hypoglycemia, we have analyzed dose-dependent changes in the

livers of rats acutely exposed to PCB126.

52
Materials and methods

Animal studies

All experiments were conducted with the approval from Institutional Animal

Care and Use Committee of the University of Iowa. Male Sprague-Dawley (SD)

rats weighing 75-100 g at an age of 4-5 weeks were fed a defined AIN-93G diet

purchased from Harlan Laboratories (Indianapolis, Indiana) and acclimatized for

three weeks. The animals were housed individually in wire hanging ages with

free access to feed and water and in a controlled environment of 220C in a 12 h

light-dark cycle. Animals were randomly divided in 3 groups (6-7 rats per group)

that received a single i.p. injection of vehicle (corn oil; 5 ml/kg body weight) or

PCB126 at a dose 1 µmol/kg (326 µg/ kg body weight) or 5 µmol/kg (1.63 mg/ kg

body weight) body weight. The PCB126 used in the injections was prepared by

an improved Suzuki-coupling method as previously described.(Luthe et al., 2009)

The tocopherol stripped corn oil used to prepare PCB126 and vehicle injections

was purchased from Acros Chemical Company (Pittsburgh, Pennsylvania). Two

weeks after injection, all the animals were euthanized at the same time without

fasting, using carbon-dioxide asphyxiation followed by cervical dislo-cation.

Serum fractions separated from the whole blood obtained from the heart and the

livers were harvested and flash frozen in liquid nitrogen and stored at – 800C

until further analysis.

53
Serum preparation and glucose measurements

The collected blood was allowed to clot in the non-anticoagulant coated

tubes and the se-rum fractions were separated by centrifugation at 1500 x g for

10 min. The glucose levels in the serum were measured by using Glucose

hexokinase (HK) assay reagent kit (G 3293) purchased from Sigma-Aldrich;

glucose measurements were performed as described by the manufacturer.

Briefly, the frozen serum was thawed on ice and diluted (1:10) with 1X PBS. 100

µl of each sample was added to clear bottom microtiter plate along with HK

reagent and was incubated for 15 min on shaker. Absorbance of the samples

was measure at 340 nm us-ing a plate reader.

Gene expression analysis

Total RNA of each rat liver sample or cell fraction was extracted using the

RNeasy extraction kit from Qiagen Inc (Valencia, California). Briefly, 20–30 mg of

liver tissue or cell lysate was homogenized and subjected to RNA extraction as

described in the manufacturer’s proto-col. Absorbance of the isolated RNA was

determined spectrophotometrically at 260 and 280 nm. RNA samples with purity

ratios (A260/A280) between 1.8 and 2.0 were used for generating

complementary DNA (cDNA) employing a high-capacity cDNA reverse

transcription kit from Applied Biosystems Inc. (Foster City, California), as

described. The real-time quantitative PCR analysis was performed at an

optimized cDNA template concentration of 50 ng, using an SYBR Green Master

Mix kit supplied by Applied Biosystems Inc. The primers used to measure the

transcript levels of various genes are listed in Supplementary Table 1 and were
54
synthesized by Integrated DNA Technologies Inc. (Coralville, Iowa). Each sample

was analyzed in duplicate. The amplification reaction was carried out with an

Eppendorf RealPlex2 Mastercycler (Hamburg, Germany) using a program that

started at 95 for 10 min followed by 40 cycles of 2 step PCR cycle at 950 C for 15

s and 600 C for 1 min. Subsequently, a melting curve analysis was also

performed. The transcript levels of all the quantified genes were normalized to

the transcript levels of the reference gene hypoxanthine-guanine phosphoribosyl

transferase (Hprt1). The expression level of each gene in a given sample was

normalized to the mean of the biological control group of each study (oil vehicle 5

ml/kg). The final transcript levels were quantified relative to the normalized

transcript levels of the control group, using the Pfaffl method.

Protein isolation and semi-quantitative analysis

Liver snippets (~ 50 mg) were homogenized in lysis buffer (500 µl)

containing phosphatase and protease inhibitors. The homogenates were

sonicated for 2 min (in rounds of 10 s sonication/20 sec rest cycle) and incubated

on ice for 30 min. Supernatants were collected after centrifugation at 10000 rpm

for 20 min at 40C and stored at -200C. Total protein was quantified by the

Bradford assay as described by the manufacturer (Biorad, CA). Proteins were

resolved by denaturing 10% SDS-polyacrylamide gel electrophoresis and

transferred by wet blotting onto PVDF membranes (Millipore, MA). The

membranes were blocked with 5% non-fat milk or 5% BSA in 25 mm Tris-HCl

(pH 7.4), 150 mm NaCl and 0.1% Tween-20 (TBST) at room temperature for 1 h,

and incubated with primary antibody (overnight) and with secondary antibody (1
55
h) diluted in non-fat milk or BSA, as recommended by the supplier. The

secondary antibodies conjugated with HRP were used to visualize the blots with

a chemiluminescence Supersignal West Pico and West Femto kit (Pierce

Chemical Co.) and observed on a LI-COR Odyssey chemiluminescent imager.

For stripping of the antibodies bound to the blot, the blots were incubated with

RestoreTM western blot stripping buffer (Thermo scientific, MA) for 30 min at

60°C with agitation and then washed liberally five times with TBST. The

membranes were probed with the primary antibodies to the following: Rabbit

monoclonal antibody against CREB phosphorylated at S133 (9198; Cell

signaling), Rabbit monoclonal antibody against CREB (9197; Cell signaling), goat

polyclonal antibody against PEPCK-C (gift of Dr. Daryl J. Granner), rabbit

polyclonal antibody against the β-actin (ab8227; abcam). The specificity of

pCREB and CREB antibodies was validated by probing for the protein levels of

CREB and pCREB in unstimulated (-ve control) and stimulated (+ve control)

neuronal cell extracts from SK-N-MC cells, untreated or treated with Forskolin

(30 µM), IBMX (0.5 mM) for 30 min to enhance CREB phosphorylation. The band

intensities of all the probed proteins were analyzed with ImageJ analysis

software.

Statistics

The differences across the control and various treatment groups were

analyzed using a one-way ANOVA followed by Tukey’s post hoc test. The

outliers in the sample distribution were determined using Grubs test and

eliminated. Only results with significant differences (P < .05) were reported. All
56
the error bars represent standard deviation (SD) of the mean. All the statistical

analyses were performed using GraphPad Prism software (GraphPad Software,

Inc, CA).

Results and discussion

Serum glucose levels in rats treated with PCB126 were significantly

decreased (Figure III-1A) at the higher (5 µmol/kg) dose, but no changes were

seen at lower dose (1 µmol/kg). The liver plays an important role in maintaining

glucose homeostasis by producing glucose especially in fasted states. This is

achieved through glycogenolysis and gluconeogenesis.(Rui, 2014) The rate

limiting enzyme necessary for gluconeogenesis is phosphoenol-pyruvate

carboxykinase (PEPCK-C/PCK1). (Pilkis and Granner, 1992; Yang et al., 2009a;

Yang et al., 2009b; Granner, 2015). PEPCK-C catalyzes the conversion of

oxaloacetate (OAA), a tricarboxylic acid (TCA) cycle intermediate into

phosphoenolpyruvate (PEP) which is subsequently converted into glucose and

exported out of the liver. The rate of gluconeogenesis in the liver is regulated by

modulating the expression of PEPCK-C through transcription.(Quinn et al., 1988)

Exposure to PCB126 results in significant dose-dependent decrease in the pro-

tein levels of PEPCK-C (Figure III-1B) by at least 80% (Figure III-1C), compared

to the control animals (n=4). The effects of PCB126 on decreasing the transcript

levels of PEPCK-C were previously reported to occur as early as 9

hrs.(Gadupudi et al., 2016) The protein levels of PEPCK-C and transcript levels

of several other enzymes such as glucose-6-phosphatase (G6pase) that play an

important role in hepatic glucose production during gluconeogenesis were also

57
down-regulated in a dose-dependent fashion (Figure III-2B).(Nordlie et al.,

1999)Despite the decreasing trend in these enzymes, the lack of reduction in

serum glucose levels at lower dose of PCB126 may be explained by the

compensatory replenishment of glucose that results from feeding (feed was

available at all times).

During shorter durations of fasting, the demand for glucose is fulfilled by

catabolizing the stored glycogen and converting it into glucose through

glycogenolysis. Glycogen phosphorylase (Pygl) that catalyzes the glycogenolysis

by releasing glucose-1-phosphate from the polymeric glycogen stored in the liver

is also decreased during PCB126 exposure (Figure III-2A). An interesting finding

from the current and previous studies that corroborates the decrease of Pygl, is

the presence of glycogen in the livers of PCB126-treated animals despite the

physio-logical demand for glucose during the observed hypoglycemia.(Lai et al.,

2012; Gadupudi et al., 2016)

In prolonged starvation depleted glycogen or inefficient glycogen

metabolism, the liver shifts into gluconeogenesis to replenish glucose. While

cataplerotic conversion of the TCA cycle intermediate OAA into PEP by PEPCK

supports gluconeogenesis, the regeneration of OAA through anaplerosis of

various substrates such as pyruvate and certain gluconeogenic amino acids,

such as serine, is equally important to meet the demand for glucose

production.(Kornberg, 1966) Anaplerotic conversion of pyruvate during

gluconeogenesis is catalyzed by pyruvate carboxylase (Pc), to generate

OAA.(Owen et al., 2002) More complex substrates such as serine, involve a

58
sequential two-step conversion of free amino acid serine into pyruvate by an

initial action of the enzyme serine dehydratase (Sds).(Su et al., 1990) Along with

PEPCK-C and G-6-Pase, that have well-known roles in hepatic glucose

production, exposure to PCB126 also significantly reduces the transcript levels of

the enzymes Pc (Figure III-2C) and Sds (Figure III-2D), involved in anaplerotic

conversion of pyruvate and serine in-to OAA during gluconeogenesis. These

observations show that PCB126-induced decrease in hepatic glucose production

occurs due to its effects on PEPCK-C and multiple enzymes in the

gluconeogenic pathway.

Glucose production in the liver is tightly regulated by selective

transcription of target enzymes necessary to metabolize the gluconeogenic

substrates. The selectivity is attained by activation of specific nuclear receptors

(NR) that interact with specific transcriptional co-activator proteins, necessary to

recruit the RNA polymerase II. The transcription of distinct tar-get genes during

gluconeogenic signal transduction is thus achieved through inclusion of

transcription coactivators such as peroxisome proliferator-activated receptor

gamma coactivator 1-alpha (PGC-1α). (Mayr et al., 2001; Altarejos and

Montminy, 2011) Previous studies have illustrated that PGC-1α, a transcriptional

coactivator is highly induced during fasting and regulates gluconeogenesis.(Yoon

et al., 2001) The expression of PGC-1α is controlled by transcriptional activation

of cAMP response element binding protein1 (CREB1), in response to various

hormonal stimuli that increase the cAMP levels in the cell.(Herzig et al., 2001;

Puigserver and Spiegelman, 2003) The increased cAMP levels activate the
59
phosphorylation of CREB1 (pCREB), which renders the assembly of PGC1α and

the transcription initiation complex necessary for the specific transcription of

gluconeogenic genes during fast-ing.(Puigserver and Spiegelman, 2003) We

found that PCB126 treated animals have significant reduction in the transcript

levels of Pgc1α, necessary for gluconeogenesis (Figure III-3A). In addition to

PGC1α, another transcriptional coactivator that is important for hepatic

gluconeogenesis is Forkhead box protein O1 (FOXO1). Liver specific deletion of

Foxo1 results in reduced blood glucose levels, decreased hepatic glucose

production and reduced expression of gluconeogenic genes including Pepck-c,

G6Pase and even Pgc1α. (Puigserver et al., 2003; Puigserver and Spiegelman,

2003; Matsumoto et al., 2007) Although the mechanisms are unclear, several

studies have demonstrated that the conjunction of FOXO1 and PGC1α is critical

in mediating the transcription of gluconeogenic genes during

starvation.(Puigserver et al., 2003; Matsumoto et al., 2007; Haeusler et al., 2014)

The livers of PCB126-treated rats with decreased expression of functional

gluconeogenic enzymes in this study, also show a dose-dependent decrease in

the transcript levels of both the transcriptional co-activators, Foxo1 (Figure III-3A)

and Pgc1α. (Figure III-3B).

Despite the necessity of several transcriptional coactivators such as

Foxo1 and Pgc1α for the specificity and signal discrimination during cell signaling

and transcriptional targeting of gluconeogenic genes, an upstream activation of

CREB is necessary to activate hepatic glucose production.(Oh et al., 2013)

Activation of CREB is regulated through phosphorylation of a critical serine

60
residue (S133) by protein kinase A (PKA) in the presence of cAMP.(Mayr and

Montminy, 2001) pCREB, localized on the promoters of genes with the cAMP

response element (CRE), enables the recruitment of the transcriptional

coactivators PGC1α and FOXO1. We have probed for the activity of CREB1 by

using a specific antibody against pCREB1 (S133) and found that PCB126

significantly decreases the phosphorylation of CREB1 (Figure III-4). The effects

of PCB126 on phosphorylation were dose-dependent (Figure III-4A and 4B) and

did not alter the total protein levels (Figure III-4A) nor the transcript levels of

CREB1 (supplementary figure 2B). The phosphorylation of CREB1 is the

hallmark of cAMP-stimulated signaling necessary for the activation of distinct

programs of gene expression across various cell types un-der different hormonal

stimuli.(Shaywitz and Greenberg, 1999; Mayr and Montminy, 2001) CREB acts

as a metabolic sensor that precisely controls the expression of several genes in

the liver, in response to feeding and fasting signals.(Altarejos and Montminy,

2011) Phosphorylation thus facilitates a reversible mechanism to regulate genes

involved in gluconeogenesis and fatty acid oxidation, in order to provide

metabolic homoeostasis of carbohydrate, lipid and amino-acid nutrients. Several

studies performed by inactivation of genes encoding Creb or its coactivator

Pgc1α and Foxo1 have demonstrated dyshomeostasis in liver metabolism

through impaired glucose production and non-alcoholic fatty liver.(Matsumoto et

al., 2007; Haeusler et al., 2010; Haeusler et al., 2014) While pCREB directly

interacts with PGC1α to transcribe gluconeogenic genes, it also plays an indirect

role on lipid metabolism by prolonging the transcription of Pgc1α during extended

61
fasting or starvation. The translated PGC1α hetero-dimerizes with another

nuclear receptor PPARα, to transcribe genes necessary for β-oxidation of fatty

acids during energy deprivation. PPARα is regarded as the master regulator of

fatty acid oxidation (Kersten et al., 1999) (Vega et al., 2000).

The transcriptional changes in genes that occur after AhR binding to XREs

in their promoters may explain certain mechanisms of PCB126 toxicity, but the

alterations in the expression of genes, that lack XREs or functional AhR binding,

adds complexity to the understanding of PCB126-induced liver pathology. AhR-

activity has been previously reported to disrupt other signaling pathways by

interfering with the transcriptional programming of NRs such as PPAR, Nrf2 and

estrogen receptor; by altering their expression levels or increase the competition

across their coactivators through “squelching”.(Safe and Wormke, 2003;

Robertson et al., 2007; Puga et al., 2009; Gadupudi et al., 2015; Gadupudi et al.,

2016) In light of these novel findings of PCB126-induced effects on CREB

phosphorylation, further research is warranted on understanding the cross-talk

between AhR activation and CREB signaling.

In conclusion, these studies suggest that exposure to PCB126 causes a

decrease in serum glucose levels by impeding the expression of enzymes

necessary for gluconeogenesis and glycogenolysis. The decrease in transcription

of these enzymes, critical in carbohydrate and lipid metabolism in PCB126

toxicity, is regulated at the level of CREB phosphorylation.

62
Supporting information

The supplementary data section in Appendix A and B contain extended

data showing the biological replicates (n=4) contains extended data showing the

biological replicates (n=4) of i) decreased protein levels of PEPCK-C (Figure A-3)

and ii) decreased levels of pCREB (n=3) after administration of PCB126 at

various doses (Figure A-4A). The transcript levels of Creb1 were measured

(Figure A-4B). The primers used for qRT-PCR are provided in Table B-2

(Appendix B)

63
Figures

Figure III-1. PCB126 decreases serum glucose and the protein levels of PEPCK-C.
Exposure to PCB126 caused a (A) decrease in serum glucose levels and a (B) dose-dependent reduction in protein levels of
PCK1/PEPCK-C. The dose-dependent (C) decrease in PEPCK-C/PCK1 levels was quantified by densitometry using ImageJ analysis (*
represents P < 0.05; one-way ANOVA).

64
Figure III-2. PCB126 downregulates the transcript levels of genes involved in
glycogenolysis and gluconeogenesis.
PCB126 dose-dependently down regulates the transcription of (A) Glycogen phosphorylase
(Pygl) involved in glycogenolysis and (B) Glucose-6-phosphotase (G6Pase), (C) Pyruvate
carboxylase (Pc), (D) Serine dehydratase (Sds) involved in gluconeogenesis (* represents P <
0.05; one-way ANOVA).

65
Figure III-3. PCB126 downregulates the transcript levels necessary transcriptional coactivators during gluconeogenesis.
PCB126 decreases the transcript levels of (A) proliferator-activated receptor gamma coactiva-tor 1-alpha (Pgc1α) and (B)
forkhead box protein O1 (Foxo1), necessary for transcription of functional genes involved in gluconeogenesis (* represents P <
0.05; one-way ANOVA).

66
Figure III-4. PCB126 dose-dependently inhibits the activation of hepatic CREB1.
Exposure to PCB126 results in reduced CREB phosphorylation (pCREB) on serine (S133) (A; center panel), but does not change
the total protein levels of CREB (A; top panel). ACTB (A; bottom panel) represents the β-actin (control). The (B) ratio of
pCREB/CREB were normalized to ACTB and found to be significantly decreased. Neuronal SK-N-MC cells stimulated with
forskolin were used as a control for (A; left panel) specific recognition of pCREB during CREB activation.

67
Figure III-5. Decreased CREB activation during PCB126-induced hepatotoxicity downregulates
gluconeogenesis.
CREB is activated through cAMP dependent phosphorylation of a serine residue S133 on the enzyme.
PCB126-induced decrease in phosphorylation leads to decreased transcription of enzymes necessary
for hepatic glucose production

68
 CHAPTER IV :

PCB126 INHIBITS ADIPOGENESIS OF HUMAN PREADIPOCYTES 3

Abstract

Emerging evidence indicates that persistent organic pollutants (POPs),

including polychlorinated biphenyls (PCBs), are involved in the development of

diabetes. Dysfunctional adipocytes play a significant role in initiating insulin

resistance. Preadipocytes make up a large portion of adipose tissue and are

necessary for the generation of functional mature adipocytes through

adipogenesis. PCB126 is a dioxin-like PCB and a potent aryl hydrocarbon

receptor (AhR) agonist. We hypothesized that PCB126 may be involved in the

development of diabetes through disruption of adipogenesis. Using a newly

developed human preadipocyte cell line called NPAD (Normal PreADipocytes),

we found that exposure of preadipocytes to PCB126 resulted in significant

reduction in their subsequent ability to fully differentiate into adipocytes, more so

than when the cells were exposed to PCB126 during differentiation. Reduction in

differentiation by PCB126 was associated with downregulation of transcript levels

of a key adipocyte transcription factor, PPARγ, and late adipocyte differentiation

genes. An AhR antagonist, CH223191, blocked this effect. These studies

indicate that preadipocytes are particularly sensitive to the effects of PCB126 and

3
The content of this chapter has been published as a research article in Toxicology in
vitro. The full reference to the article is: G. S. Gadupudi, F A. Gourronc, G Ludewig, L W.
Robertson and A J. Klingelhutz. PCB126 Inhibits Adipogenesis of Human Preadipocytes.
Toxicology in Vitro 29, 132-41 (2015), PMID: 25304490
G. S. Gadupudi performed the study. F.A. Gourronc performed qPCR analysis. A. J.
Klingelhutz measured the levels of adiponectin.
69
suggest that AhR activation inhibits PPARγ transcription and subsequent

adipogenesis. Our results validate the NPAD cell line as a useful model for

studying the effects of POPs on adipogenesis.

Keywords: Adipocyte, Preadipocyte, PCB126, Adipogenesis, AhR, PPARγ,

Diabetes, Metabolic Syndrome

Introduction

There is now compelling evidence that exposure to persistent organic

pollutants (POPs) is associated with an increased risk of developing metabolic

syndrome and its associated pathologies, including diabetes and hypertension

(Hotamisligil, 2006; Ruzzin et al., 2010; Boekelheide et al., 2012). One group of

POPs, the Polychlorinated Biphenyls (PCBs), was originally manufactured for

industrial applications because of their insulating and flame retardant properties.

PCBs are biphenyls with 1 to 9 chlorines; PCB mixtures can contain up to 209

individual congeners, which differ in the number and pattern of chlorines on the

biphenyl rings. While intentional commercial production of PCBs was

discontinued in the late 1970s, PCBs are considered significant POPs that

continue to accumulate in the environment because of their lipophilicity and

persistence (Ward et al., 2010; Alonso-Magdalena et al., 2011; Everett et al.,

2011; Tang-Peronard et al., 2011; Choi et al., 2012; Silverstone et al., 2012a;

Roos et al., 2013; Narbonne and Robertson, 2014). Toxic and biological effects

of PCB congeners can vary widely depending on chlorination patterns. Exposure

to certain PCB congeners is associated with the development of metabolic

syndrome (Everett et al., 2011; Boekelheide et al., 2012; Silverstone et al.,

70
2012a). The coplanar PCBs, PCB77 and PCB126, have been associated with

the development of glucose intolerance in mice (Baker, 2013). However, the

mechanisms by which these PCBs potentially cause metabolic syndrome are

unknown.

Adipocytes provide a link between obesity and the insulin resistance that

occurs in type II diabetes (Mlinar and Marc, 2011). Adipocytes are critical players

in energy storage and metabolism. It is becoming clear that adipocyte

dysfunction, rather than adipocyte number, is causally associated with the

development of metabolic syndrome (Guilherme et al., 2008; Harwood, 2012).

Adipocytes in diabetic patients exhibit aberrant production of adipokines,

including reduction in secretion of adiponectin, a hormone that modulates a

number of metabolic processes (Dunmore and Brown, 2013). Both obesity and

lipodystrophies have been reported to cause insulin resistance, suggesting the

critical need for functional adipocyte mass.

The mechanisms by which dysfunctional adipocyte tissue plays a role in

the development of insulin resistance and diabetes are now beginning to be

understood. Adipokines interact mainly with peripheral tissues (liver, brain,

muscle, and pancreas) and regulate carbohydrate and lipid metabolism, energy

expenditure, and feeding behaviors. Insensitivity or inability to produce leptin

leads to increased fat mass whereas decreased adiponectin causes insulin

resistance and increases free fatty acid circulation. Adipocytes producing normal

levels of both leptin and adiponectin are thus essential for effective insulin

signaling, and their dysfunction leads to disruption of insulin signaling (Mlinar and
71
Marc, 2011). Adipocytes and fat tissue in general accumulate lipophilic toxicants

such as PCBs and thus are likely to be affected by them (Regnier and Sargis,

2014).

Adipose tissue is comprised of progenitor preadipocytes and differentiated

adipocytes along with other cells which include multipotent mesenchymal stem

cells (MSCs) also referred as adipose tissue stem cells (ASCs) (Cawthorn et al.,

2012). Although both ASCs and preadipocytes can be differentiated into white

adipocytes, the latter are more committed down the lineage to form adipose

(Hausman et al., 2001; Cinti, 2012). Preadipocytes also make up a significant

portion of fat tissue (15 to 50%) (Tchkonia et al., 2010). Under normal conditions,

adipocyte tissue development begins during gestation and proceeds until

adolescence by increased proliferation of preadipocytes and their subsequent

differentiation into adipocytes (Knittle et al., 1979). After adolescence, the

changes in fat mass are mostly attributed to changes in lipid accumulation with

very little change in total cell number (Spalding et al., 2008). During adulthood,

adipocyte death is balanced by proliferation and differentiation of preadipocytes

to adipocytes (Tchkonia et al., 2010). Adipose tissue alters its mass by an

increase or decrease in adipocyte size and/or numbers in response to various

stimuli. Adipocyte size increases by synthesis and accumulation of lipids. Too

much lipid accumulation can lead to hypertrophy and dysfunction. Adipocyte

number is increased by the proliferation of preadipocytes that later differentiate

into adipocytes.

72
 On physiological and nutritional demand, the preadipocytes are modulated

by various hormones and growth factors to initiate a transcriptional cascade that

programs adipogenesis (Gregoire et al., 1998). The most important event in this

cascade is the transcription and activation of the nuclear receptor peroxisome

proliferator-activated receptor-γ (PPARγ), also called the master regulator of

adipogenesis (Rosen et al., 1999). PPARγ activates the transcription of genes

that are involved in the development of mature functional adipocytes. Alterations

in adipogenesis would be expected to lead to adipocyte dysfunction and thus

increase the likelihood of developing insulin resistance and, subsequently, type II

diabetes (Mlinar and Marc, 2011).

While primary preadipocytes can be isolated from adipose tissue and

differentiated into mature adipocytes, they can be expanded for only a very short

time in vitro, a characteristic that makes it difficult to assess the effects of

environmental factors on adipocyte differentiation and function. Most studies

have been limited to the use of immortal mouse preadipocytes called 3T3-L1 that

differentiate into adipocytes (Green and Kehinde, 1975). Employing this model,

certain POPs including PCB congeners were shown to alter adipocyte

differentiation and fatty acid and cytokine release when applied to cells during the

differentiation process (Arsenescu et al., 2008; Taxvig et al., 2012). Mouse cells

provide one means by which the effects of PCBs on adipocytes can be tested.

However, there are significant species-to-species variations in their sensitivity

and in how PCBs affect physiology and fatty acid metabolism across rodents and

humans (Forgacs et al., 2012). Studies using primary human MSCs to assess
73
the effects of POPs on adipogenesis have been described (Li et al., 2008) but

they are uncommon, most likely because primary MSCs are difficult to isolate

and have a limited lifespan in culture. There have been reports on the

immortalization of human MSCs or preadipocytes that retain the ability to

differentiate into adipocytes (Darimont et al., 2003; Rodriguez et al., 2004; Terai

et al., 2005; Zhang et al., 2006). Immortal MSCs can be differentiated into

osteocyte, chondrocyte, or adipocyte lineages and are difficult to maintain in a

preadipocyte state (Rodriguez et al., 2004; Terai et al., 2005; Zhang et al., 2006).

An immortal human preadipocyte line, referred to as Chub-S7, was reported but,

for unknown reasons, has not been widely used (Darimont et al., 2003).

We have recently developed an immortal human preadipocyte cell line

from primary subcutaneous preadipocytes that can be readily differentiated into

mature adipocytes that accumulate lipid droplets and express all the expected

normal markers of adipocyte differentiation (Bastos Sales et al., 2013). This

provides a valuable tool for the assessment of how POPs such as PCBs affect

adipocyte differentiation and function in human cells. In the current study, we

were interested in determining how adipogenesis was affected by PCB126, a

PCB that has been implicated in the development of diabetes and metabolic

disorders. We hypothesized that pre-exposure of human preadipocytes to

PCB126 would subsequently reduce their ability to differentiate into mature,

properly functioning adipocytes. Our results indicate that exposure of

preadipocytes to PCB126 is effective at inhibiting subsequent adipocyte

differentiation. We also found that activation of AhR by PCB126 was associated

74
with reduction in PPARγ transcript levels. These results suggest that

preadipocytes may be an important target for POPs and point to a potential

mechanism in which disruption of adipogenesis could lead to the development of

metabolic syndrome.

Materials and methods

Preadipocyte culture and differentiation

All experiments were performed with extended lifespan Normal

PreADipocytes (NPADs) developed from primary human preadipocytes that were

derived from the subcutaneous fat tissue of a non-diabetic donor as recently

described (Bastos Sales et al., 2013). The NPADs were cultured as a monolayer

in Preadipocyte Basal Medium 2 (PBM-2) (Lonza, MD) supplemented with 10%

fetal bovine serum (FBS), L-glutamine, gentamycin, and amphotericin according

to the manufacturer's instructions. This medium is referred to as preadipocyte

growth medium 2 (PGM-2). For differentiation, the NPADs were seeded into 35

mm tissue culture plates at 30,000 cells/plate and allowed to grow in PGM-2 until

confluent (usually 5-6 days). The cells were then induced to differentiate into

adipocytes with differentiation medium consisting of PGM-2 plus

dexamethasone, 3-isobutyl-1-methyl-xanthine, indomethacin, and extra insulin

prepared according to the manufacturer’s instructions (Lonza, MD). The cells

were left in the differentiation medium for 11 days until full development of lipid

droplets occurred. Comparative control groups of confluent NPADs

(preadipocytes) were cultured in normal PGM-2 without any differentiation factors

for the duration of the normal time required for differentiation.

75
Reagents and treatment

PCB126 was obtained from the Synthesis Core of the Iowa Superfund

Research Program (courtesy of Dr. Hans Joachim-Lehmler). The AhR

antagonist, CH223191, and all other chemicals were purchased from Sigma

unless otherwise specified. PCB126 or CH223191 were dissolved in

dimethylsulfoxide (DMSO) to a final concentration less than 0.01% (v/v) unless

otherwise stated. Equivalent volumes of DMSO were used in treatments and

negative controls. NPADs were treated with PCB126 mixed into PGM-2 in the

pre-differentiation phase until confluence (5-6 days) after which the PCB was

removed and the cells were differentiated into mature adipocytes without

PCB126 for 11 days. We refer to this exposure regimen as “pre-exposure”. To

assess the effects of PCB126 during differentiation, cells received PCB126 only

during differentiation for 11 days. In the pre-exposure regimen, preadipocytes

(NPADs) are treated with PCB126 while they are still dividing, before addition of

differentiation inducing agents. This is in contrast to exposure during the course

of differentiation that occurs for 10-11 days after confluence and induction of

differentiation.

Assessment of NPAD proliferation and growth

In order to assess the effects of PCB126 on cell proliferation, NPADs were

seeded into 6 well plates at a density of 20, 000 cells per well. On the following

day (day 1), the cells were treated with the stated concentrations of PCB126

dissolved in DMSO (0.01% v/v final). The treatments were removed on day 6 and

the media was changed with regular PGM-2 media or differentiation media. Cell
76
growth was assessed by counting the number of cells at various time points (1, 3,

6 and 17 days) using a Z1 Coulter Counter (Beckman Coulter, CA). Cells treated

with DMSO (0.01%) were used as a comparative negative control.

Assessment of NPAD viability using MTT assay

In order to determine the effects of PCB126 on cell viability, NPADs were

seeded into 24 well plates at a density of 10,000 cells per well. On the following

day, the cells were treated with the noted concentrations of PCB126 dissolved in

DMSO (0.01% v/v). Cell viability was assessed at various time points (1, 3 and 6

days) using MTT assay. Briefly, the cells were incubated with 3-(4,5-

dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) mixed into the media

for 4 hrs (Mosmann, 1983). After 4hrs, the formazan was extracted into acidified

isopropanol and incubated on the shaker for 15 min. Absorbance was measured

at 570 nM using micro plate reader (Biotek, VT).

Triglyceride staining and microscopy

Differentiated cultures from various treatment groups were visualized by

microscopy for lipid droplet formation. The cells were stained with Adipored™

(Lonza, MD) for 15 min. as described by the manufacturer and then washed with

phosphate-buffered saline (PBS; 0.005 M NaPO4, 0.15 M NaCl). Adipored™ is a

fluorescent dye that binds to triglycerides. The photomicrographs of the stained

cells were taken using a fluorescent microscope (Nikon) at 200X magnification.

The images post-acquisition were processed using the Image J software

package.

77
Quantification of differentiation using flow cytometry

The treated and differentiated cultures were quantified on a single cell

basis by a flow cytometric approach as previously described (Bernstein et al.,

1989; Barnes et al., 2003; Lee et al., 2004) with slight modifications. Cells were

trypsinized by Trypsin-EDTA (0.25%) for 10 min and the trypsin was inhibited by

adding an equal volume of 2% FBS in PBS. The cells were pelleted by

centrifugation at 450 g (RCF) for 10 min., washed with PBS and re-suspended in

10% neutral buffered formalin (NBF). The fixed cells were washed with PBS and

incubated with Adipored™ in PBS (0.025% v/v) for 15 min. The excess unbound

dye after the staining was thoroughly washed with PBS and the cells were finally

suspended in PBS for flow cytometry using a BD Accuri™ C6 machine (BD

biosciences, CA). A total of 25,000 cells (events) were counted. Cells were gated

based on cellular triglyceride fluorescence stained by Adipored™ (excitation at

488 nm and emission at 530 nm). The mature/differentiated cell populations were

identified based on the Adipored™ fluorescence (lipid content) and side scatter

(complexity) caused by the lipid accumulation inside the cell. The flow cytometry

analysis and gating were performed with BD Accuri C6 Software. Samples were

analyzed in triplicate.

Quantification of differentiation markers using quantitative RT-PCR

RNA was collected from various treatment groups with and without

induction of differentiation for analysis of RNA transcript levels. Briefly, cells were

washed with PBS and the total RNA was extracted into 1 ml of Trizol reagent

(Invitrogen, NY) and treated with DNAse (Qiagen, CA) as described by the
78
manufacturers. The mRNA was purified with RNeasy Mini Columns (Qiagen, CA)

and was reverse transcribed to cDNA using a Retroscript kit (Ambion, CA) as

described in the manufacturer’s protocol. The relative quantification of gene

transcripts was performed by quantitative reverse transcriptase polymerase chain

reaction (q-RT-PCR) in triplicate as described (Taura et al., 2009; Gourronc et

al., 2010; Bastos Sales et al., 2013). The primers used for the quantification of

selected genes are listed in Appendix-B (Table B-3). The transcript levels of the

analyzed genes in each sample were normalized to the transcript levels of a

house keeping gene glyceraldehyde-3-phosphate-dehydrogenase (GAPDH),

which we found to be at consistent levels across treatments. For graphing, the

transcript levels were calculated relative to the normalized transcript levels of in

undifferentiated NPADs treated with DMSO.

Quantification of Adiponectin using ELISA

Secreted adiponectin (ADIPOQ) was measured by using an enzyme-

linked immunosorbent assay (ELISA) kit (R&D Systems) according to the

manufacturer’s protocol. Briefly, preadipocytes were pre-exposed to PCB126 or

vehicle as described previously, allowed to become confluent, and differentiated

for nine days. Consequently, the media was changed and four days later the

whole media aliquots were collected and frozen at -80o C. ELISA was performed

in replicate using the media supernatants. The unknown concentrations of

adiponectin (ng/ml) were calculated using standards supplied by the

manufacturer.

79
Statistics

The effects of PCB 126 treatment on NPADs at various concentrations

and treatment groups across this study were compared with respect to vehicle

control using one-way ANOVA. The possible interaction of both CH223191 and

PCB126 during their co-incubation in the antagonist study was tested using two-

way ANOVA. In two-way ANOVA, the interaction term was not reported if not

significant (P<0.05). All the error bars represent standard deviations (SD) from

the mean in triplicate assays. All the statistical analyses were performed using

GraphPad Prism (GraphPad Software Inc, CA)

Results

Effects of PCBs on adipocyte differentiation

Previously reported studies (using mouse or human adipocytes) have

mostly assessed the effects of various test chemicals, including PCBs, on

adipocyte differentiation by treating cells with compounds during the

differentiation process. To test our hypothesis that certain compounds might be

active during the preadipocyte stage (before differentiation), causing changes

that are revealed upon subsequent differentiation, we used a “pre-exposure”

regimen of treatment and compared exposure during differentiation (see

Materials and Methods). For both treatments, we used a higher dose of 10 µM to

ensure maximum changes in differentiation if it occurred. After 11 days in

differentiation media, both the cultures were stained with Adipored™ for the

visualization of lipid droplets by microscopy (Figure IV-1). Interestingly, pre-

exposure of preadipocytes to 10 µM PCB126 resulted in reduced differentiation

80
compared to exposure during differentiation (Figure IV-1). The pre-exposure of

NPADs to PCB126 caused a clear dose-dependent effect on differentiation

(Figure A-5. Preadipocytes show a dose-dependent reduction in differentiation of

pre-exposure to PCB126.

Preadipocytes were exposed to increasing concentrations of PCB126 (0-

20 μM) for 5 days until cultures reached confluency; the PCBs were removed,

and the cultures were induced to differentiate. After 11 days, the differentiated

cultures were stained for triglycerides with AdipoRed™ (red fluorescence). The

fluorescent images along with the bright field images are shown in the left panels.

The differentiated adipocytes were quantified by flow cytometry as described in

the Materials and Methods and the plots are shown in the right panels.). Because

of the non-homogenous distribution of differentiation in culture plates, it was

difficult to precisely quantify levels of differentiation by microscopy alone. In

order to better quantify differentiation, we analyzed the cells by flow cytometry.

The differentiated cultures were trypsinized, stained with Adipored™, and the

number of mature adipocytes in the suspension were identified by fluorescence

and side scatter (SSC). As was found with microscopy, pre-exposure of the

preadipocytes to PCB126 resulted in a significant, dose-dependent reduction in

their differentiation compared to vehicle control (DMSO), and the decrease in

differentiation was greater than that observed in cultures that had been treated

with PCB126 during differentiation (Figure IV-2A and 2C). Even the low

concentration of 0.5 µM caused a significant reduction in differentiation compared

to DMSO-treated controls (Figure IV-2C). These results suggest that the

81
preadipocytes are profoundly sensitive to PCB126 compared to cells that are

exposed during differentiation. This finding emphasizes that preadipocytes might

be an important target for POPs. Because of these results, subsequent

experiments were carried out using the pre-exposure regimen only.

Reduced differentiation on PCB126 exposure is independent of effects on

proliferation

To rule out the possibility that the effects we observed were due to the

selective cytotoxicity or growth inhibitory effects of PCB126 on preadipocyte

proliferation, we performed cell counts at various time points during our pre-

exposure treatment period while the cells were still proliferating. We found no

significant differences in preadipocyte growth during pre-exposure to PCB126 at

the concentrations used (Figure IV-3). These results indicate that the reduced

differentiation caused by PCB126 is due to intrinsic changes in cell function(s)

rather than selective inhibition or killing of specific cell subpopulations. In addition

to no changes in cell counts from PCB exposure, we also did not observe

significant changes in cell viability, as measured by the MTT assay (Figure A-6).

It has been previously reported that murine preadipocytes undergo mitotic clonal

expansion, even after they have reached confluence, after induction of

differentiation during adipocyte development (Tang and Lane, 2012). Similar

effects in human preadipocytes have not been yet reported. To determine

whether pre-exposure to PCB126 affected any further clonal expansion during

differentiation, the cells were trypsinized and counted after they had fully

differentiated (11 days after differentiation induction). While we observed an

82
increase in the number of the cells after differentiation compared to their

numbers at confluence after 6 days, no significant difference was observed in the

PCB126 treated cultures compared to untreated controls (Figure IV-3). These

results indicate that the immortal human preadipocytes behave similarly to what

has been observed for mouse preadipocytes in that they approximately double

after induction of differentiation, but that PCB126 treatment does not affect this

process.

PCB126 pre-exposure reduces expression of adipocyte marker genes and

increases expression of CYP1A1

To further examine how PCB126 affects adipocyte differentiation, we

examined the transcript levels of specific genes important for adipocyte

differentiation and function. Adiponectin (ADIPOQ) is an important hormone

specifically secreted by functionally differentiated adipocytes. Lower levels of

adiponectin are strongly associated with the development of insulin resistance

caused by adipose tissue dysfunction (Ye and Scherer, 2013). Quantitative RT-

PCR analysis of differentiated adipocytes pre-exposed to PCB126 demonstrated

a dose-dependent reduction in transcript levels of adiponectin (Figure IV-4A). We

also found that the protein levels of adiponectin secreted into the medium were

also reduced in PCB126 treated cultures (Figure A-7). In addition to adiponectin,

another adipocyte specific gene FABP4 (fatty acid binding protein 4) also showed

a similar dose dependent decrease in transcript levels after exposure to PCB126

(Figure IV-4B). The most important event during the adipocyte differentiation is

the transcriptional activation of PPARγ, and it has been demonstrated that

83
activation of PPARγ is necessary and sufficient for induction of adipogenesis

(Rosen et al., 1999). We found that PPARγ transcript levels were downregulated

by pre-exposure to PCB126 (Figure IV-4C), indicating a possible mechanism by

which PCB126 modulates differentiation.

To confirm the known AhR agonist activity of PCB126, we measured the

transcript levels of CYP1A1, a classic downstream target of AhR which is

activated by dioxin-like compounds (Mimura and Fujii-Kuriyama, 2003). CYP1A1

levels increased dose dependently in the PCB126 pre-exposed cells, both in

differentiated cultures and undifferentiated cultures (Figure IV-4D and Figure

A-8). Notably, the CYP1A1 induction persisted over an 11-day period after the

PCB126 pre-exposure.

PCB126 induced AhR activity reduces differentiation of preadipocytes

In addition to AhR mediated toxicity, PCB126 and other dioxin-like

compounds have also been implicated in causing several AhR independent

effects in various tissues (Patel et al., 2009). To determine whether the observed

inhibition of differentiation by PCB126 was through the AhR, we utilized an AhR

antagonist CH223191 (Choi et al., 2012)4. Co-incubation of pre-adipocytes

during the PCB126 pre-exposure period with CH223191 prevented upregulation

of CYP1A1 transcript levels, determined at the end of the differentiation period

4
In addition to the use of AhR antagonist to inhibit AhR activity, a short hairpin RNA
(shAHR) was also used to silence or knock down the AhR. Silencing the expression of AhR,
mitigated the effects of PCB126 on the transcript levels of CYP1A1, PPARγ, and ADIPOQ. These
results are furnished in supplemtary data (Figure A-10). Knock down of AhR in the NPADs was
performed by F.A. Gourronc.
84
(Figure IV-5C,). This indicated that AhR activation was effectively inhibited by the

antagonist. CH223191 also partly hindered the ability of PCB126 to inhibit

adipocyte differentiation as assessed by flow cytometry (Figure IV-5A) and

microscopy (Figure A-9). The reduction in transcript levels of both the early

differentiation marker PPARγ (Figure IV-5B) and late differentiation marker

ADIPOQ by PCB126 was also mitigated on co-treatment with CH223191

(Figures 5B and 5D). Interestingly, CH223191 treatment alone increased

adipocyte differentiation, suggesting that it has effects on its own or, possibly,

that a low level of endogenous AhR activation exists at baseline that partially

inhibits or regulates differentiation. The exposure to CH223191 alone may be

preventing this activation. Overall, our results indicate that the effect of PCB126

on adipocyte differentiation is at least partly mediated through the AhR.

Discussion

The current studies demonstrate that pre-exposure of human

preadipocytes to PCB126 significantly affects the ability of these cells to

differentiate into mature adipocytes. The PCB126 treated cells showed

decreased transcript levels of PPARγ, a key regulator of adipogenesis/adipocyte

differentiation, concomitant with reduction in transcript levels of adipogenic

marker genes such as ADIPOQ and FABP4. These studies, using a newly

developed human preadipocyte cell line, identify preadipocytes as important,

sensitive targets for environmental toxicants such as PCBs and point to a

potential mechanism by which PCB exposure can lead to the development of

metabolic disorders such as diabetes.

85
 Epidemiological studies provide a link between PCB exposure and the

development of diabetes (Silverstone et al., 2012a). Elevated PCB levels in

serum were found to be associated with a higher incidence of diabetes in

individuals of the Anniston, AL community that were subjected to high level PCB

exposures due to their historic release into the environment from a nearby

Monsanto chemical factory (Silverstone et al., 2012a). Other cohorts exposed to

contaminated oil comprised of dioxins and dioxin-like PCBs were reported to

have an increased risk of type II diabetes (Henriksen et al., 1997; Everett et al.,

2011). Body burden of dioxin-like PCB congeners (PCB 77, 81, 126) along with

other PCBs were also found to be associated with increased risk of metabolic

disorders in an exposed Japanese population (Uemura et al., 2009). A significant

positive correlation between serum concentrations of PCB126 and the risk of

diabetes was demonstrated in a U.S. study (National Health and Nutrition

Examination Survey) (Everett et al., 2007; Everett et al., 2011). In addition to

epidemiological evidence, mouse studies support a role for coplanar PCBs such

as PCB126 and PCB77 in the impairment of glucose homeostasis along with

elevation of inflammatory cytokine TNFα, specifically in adipose tissue (Baker,

2013).

Compromising the ability of preadipocytes to differentiate into functional

adipocytes, either during development or later in life, would be expected to

disrupt insulin signaling and metabolism, thus potentially leading to the

development of diabetes. Adipose tissue development can be affected by various

factors including genetics, diet, lifestyle and environment and POPs such as
86
PCB126 (Knittle et al., 1979; Spalding et al., 2008; Tchkonia et al., 2010).

Changes in the ability of preadipocytes to differentiate or proliferate in children

and adolescents put them at risk for altered adipose tissue development caused

by POP exposure. However, chronic exposure to POPs in adults may also lead

to dysfunctional adipose tissue because of the need for replacement of mature

adipocytes caused by cell death.

POPs, such as PCBs, can accumulate in lipophilic tissues and thus the

adipose tissue is considered to be the principal contributor to the total body

burden of these accumulated compounds (La Merrill et al., 2013). Uptake of

PCBs into adipocytes is dependent on their lipophilicity and the concentration of

PCBs that accumulate is proportional to the triglyceride (TG) content of the

adipocytes (Bourez et al., 2013). In vitro studies with mouse adipocytes have

demonstrated that lipophilic congeners such as PCB126 can reach

concentrations as high as 15 mol PCB/mol TG in mature adipocytes (Bourez et

al., 2012). There is evidence that accumulated toxicants can be released from

triglyceride storage pools during weight loss and thus may be released into the

adipose tissue cellular microenvironment. This would further expose

preadipocytes and potentially disrupt proper differentiation into adipocytes. In

addition, the release of PCBs from adipose tissue into the blood may further

affect other tissues and organs in the body (Choi et al., 2012).

How preadipocyte exposure to PCBs disrupts subsequent adipocyte

differentiation is not entirely clear. Circulating levels of PCBs have been related

to changes in visceral and subcutaneous fat mass (Roos et al., 2013). Previous
87
studies with both dioxin-like and other PCBs have reported inhibition of adipocyte

differentiation in mouse 3T3-L1 adipocytes in vitro (Shimba et al., 2001;

Arsenescu et al., 2008; Hsu et al., 2010; Taxvig et al., 2012). Dioxin treatment of

mouse embryonic fibroblasts inhibits lipid metabolism and adipogenesis and,

using cells from AhR knockout mice, it has been shown that much of this effect is

mediated by AhR (Alexander et al., 1998). While not previously characterized for

its ability to inhibit adipogenesis, PCB126's main mechanism of action is thought

to be through activation of AhR (Safe, 1994; Safe et al., 1998; Hestermann et al.,

2000; Ovando et al., 2010). Our experiments using the AhR antagonist,

CH223191, would support a model in which AhR activation by PCB126 causes a

reduction in adipocyte differentiation. On ligand binding, AhR changes its

conformation in the cytosol to expose a nuclear localization signal (NLS) and

thus translocates into the nucleus of a cell where it forms a heterodimer with Aryl

hydrocarbon Receptor Nuclear Translocator (ARNT) to recognize xenobiotic

recognition elements (XREs) in the promoter regions of responsive genes and

activate their expression (Denison and Nagy, 2003; Okey, 2007). The

transcriptional response mediated by AhR is regulated by various other

coactivators and repressors in a cell-type specific manner (Beischlag et al., 2008;

Puga et al., 2009). PCB126 and other dioxin-like molecules have been shown to

induce expression of a number of genes including CYP1A1(Mimura and Fujii-

Kuriyama, 2003). We found that PCB126 exposure caused downregulation of

PPARγ, which would be expected to limit activation of adipocyte specific genes

during the differentiation process. The downregulation of PPARγ suggests that

88
AhR inhibits PPARγ transcription or activity, either directly or indirectly, or

through activity of an upstream inhibitor of PPARγ (Tontonoz and Spiegelman,

2008). Interestingly, the AhR antagonist alone caused some increase in the

differentiation of preadipocytes, suggesting either that endogenous levels of AhR

activity play a repressive role in adipocyte differentiation or that the antagonist

has other targets. Another possibility is that PCB126 also affects adipocyte

differentiation through AhR independent mechanisms. Further studies will be

needed to clarify these issues.

Regardless of the mechanism of inhibition of adipocyte differentiation by

PCB126, it would appear that the effect is relatively persistent in that pre-

exposure of preadipocytes to PCB126, followed by removal of the medium, still

results in subsequent down-regulation of adipocyte specific transcripts. It is

interesting to note that in our studies CYP1A1 transcripts were found to be up-

regulated long after PCB126 removal, thus suggesting persistent AhR activation.

The effects of PCB126 on adipocyte differentiation could be mediated by

relatively transient epigenetic alterations such as histone modifications or by

more permanent epigenetic alterations such as DNA methylation. Such

mechanisms would not be unexpected for dioxin-like compounds. Dioxin

exposure is associated with DNA hyper-methylation and certain effects of dioxin

have been linked to epigenetic changes that are trans-generational (Manikkam et

al., 2012; Lind et al., 2013). Interestingly, studies using the pluripotent mouse cell

line, C3H10T1/2, have also indicated that dioxin exposure of these cells before

differentiation inhibits their subsequent ability to differentiate into adipocytes,

89
suggesting that dioxin induces sustained epigenetic alterations (Cimafranca et

al., 2004). In addition, it has been demonstrated that exposure of mouse 3T3-L1

preadipocytes to the flame retardant BDE-47, another POP, resulted in changes

in methylation, specifically at the PPARγ promoter (Kamstra et al., 2014).

Considering the potential long-term consequences of early life exposure to PCBs

on future health, it will be of significant interest to determine whether PCB126

exposure of human preadipocytes causes persistent epigenetic alterations.

Because of their significantly extended lifespan compared to primary

preadipocytes, the immortal NPAD cells may allow such an assessment using

human cells.

Supporting information

The supplementary data section in the appendix contains extended data

showing a more complete dose response to PCB126 pre-exposure (Figure A-5),

the MTT assay that confirms no significant cytotoxicity (Figure A-6), the protein

levels of adiponectin on PCB126 treatment (Figure A-7), the qRT-PCR data from

the non-differentiated cultures (Figure A-8), the micrographs and FACS plots

from the antagonist studies (Figure A-9). And the gene expression data from AhR

knockdown studies (Figure A-10).

90
Figures

Figure IV-1. Preadipocytes show reduced ability to differentiate after pre-exposure

to PCB126.
NPADs were exposed to PCB126 (10 μM) or DMSO before induction of differentiation
(pre-exposure) (A) or during differentiation (B). After the differentiation period, the cells
in both treatment regimens were stained for triglycerides with AdipoRed™ (red
fluorescence). Fluorescent images are shown in the bottom panels and comparative bright
field images are shown in the top panels.

91
Figure IV-2. Exposure to PCB126 causes a dose-dependent reduction in the
number of differentiated adipocytes.
Preadipocytes were treated with PCB126 at the concentrations of 0,0.5 and 10 μM
before differentiation (pre-exposure) (A) or during differentiation (B) and the
differentiated cultures were analyzed by flow cytometry. Differentiated cells were
gated based on fluorescence and side scatter (represented as red dots). (C) The
number of differentiated adipocytes is represented as the percentage of
differentiated cells in a total of 25,000 events. Readings were performed on
triplicate cultures. Preadipocytes that were pre-exposed to PCB126 before
differentiation (black bars) exhibited significantly less differentiation than
preadipocytes exposed during differentiation (grey bars).Pre-exposure to PCB126
resulted in a statistically significant reduction in differentiated cells compared to
vehicle control (* represents P <0.05; ANOVA) and compared to exposure to the
same concentrations during differentiation (# represents P <0.05; ANOVA).

92
Figure IV-3. Effects of PCB126 on differentiation are independent of the cell
proliferation.
Cells were counted on days 1, 3, and 6 during the pre-exposure regimen to PCB126
concentrations of 0.5, 2 and 10 μM. The cultures were confluent after 6 days and were
subsequently induced to differentiate for 11 days and counted at 17 days post-seeding.
DMSO was used as a vehicle control. All counts were performed on triplicate cultures.
No significant variation in cell number (ANOVA, one-way; P<0.05) due to PCB126
exposure

93
Figure IV-4. PCB126 exposure decreases transcript levels of adipogenic markers
and increases transcript levels of CYP1A1.
Preadipocytes were pre-exposed to PCB126, allowed todifferentiate, and analyzed for
expression of adipogenic markers and CYP1A1 expression using quantitative reverse
transcriptase PCR (qRT-PCR). The transcript levels of both late adipogenic markers
ADIPOQ (A) and FABP4 (B) and the early adipogenic marker PPARγ (C) were
decreased in a dose-dependent manner by exposure to PCB126 (ADIPOQ: adiponectin;
FABP4: fatty acid binding protein; and PPARγ: proliferator activated receptor gamma).
(D) PCB126 induced a sustained and dose-dependent increase in transcript levels of
CYP1A1. Transcript levels are expressed relative to the housekeeping gene GAPDH and
normalized to undifferentiated preadipocytes treated with DMSO and cultured for the
same period of time as the differentiated cultures (Supplementary Fig 2).

94
Figure IV-5. The AhR antagonist CH223191 partially blocks the inhibitory
effects of PCB126 on adipocyte differentiation.
Preadipocytes were treated with 2 μM PCB126 (grey bars) or DMSO (black bars)
and concurrently co-incubated with the AhR antagonist CH223191 (10 μM) or
DMSO and subsequently allowed to differentiate. (A) The percentage of
differentiated cells was quantified using flow cytometry. There was no significant
interaction between CH223191 and PCB126 during co-incubation and hence not
reported (ANOVA, two-way; P<0.05). The relative transcript levels of adipogenic
markers PPARγ (B) and ADIPOQ (D) in each condition were measured using qRT-
PCR. (C) Transcript levels of CYP1A1 were measured to validate the efficiency of
the CH223191 antagonist. Transcript levels are represented as relative to GAPDH
and normalized to cultures treated with DMSO only

95
Figure IV-6. PCB126 inhibits adipogenesis (schematic).

96
 CHAPTER V :

OVERALL CONCLUSIONS AND FUTURE DIRECTIONS

General conclusions

There is enough mechanistic evidence to classify PCBs as carcinogens or

promoters of carcinogenesis in humans, however their role in the etiology of

metabolic disease is less studied (Lauby-Secretan et al., 2015; IARC, 2016). The

goal of this study was to understand the role of PCBs in causing metabolic

disruption using the prototypic dioxin-like PCB, PCB126. PCB126 has been

historically shown to induce metabolic changes through wasting, starvation and

liver pathologies that include fatty liver in both acute and chronic exposure

studies with rodent models (Robertson et al., 1984; Van Birgelen et al., 1994;

NTP, 2006). While lipid accumulation in the liver is known to occur early in the

toxicity of PCB126, starvation, the resultant hypoglycemia and wasting were

regarded as later endpoints of toxicity. Although the overt toxicity of PCB126 is

known, the underlying mechanisms or the sequence of the events that lead to

observed metabolic disorders is unknown.

The initial time course study performed to understand the time course of

changes (Chapter 2) demonstrated the chronology of metabolic disruption that

occurs after exposure to PCB126. The hallmark of PCB126 exposure involves

AhR activation that leads increased transcript levels of CYP1A1 (Whitlock, 1989).

Confirming the disposition of PCB126 into the liver, CYP1A1 levels were

significantly induced as early as 9 hours post injection and continued to persist

until 2 weeks after exposure. With regard to the incidence of pathological events
97
upon exposure, PCB126 elicits a robust decrease in the serum glucose levels at

9 hours which continues to worsen at the later time points of the study.

Consequent to the initial effects of PCB126 on glucose levels, the lipid begins to

accumulate in the livers of rats at 3 days post administration and continues to

worsen into more profound steatosis at later time points. Increase in hepatic

reactive oxygen species (ROS) and alterations in the micronutrients of the liver

only began to occur after 3 days post exposure (Klaren et al., 2015). There were

no significant changes in body weight gain of the animals treated with PCB126 at

the doses listed, compared to the vehicle treated animals, however the animals

just started to lose weight indicating the onset of wasting observed during dioxin-

like toxicity. There were no signs of abstinence from food or self-starvation within

the time-intervals used in this study. The hypoglycemic effects of PCB126 may

be seen as an early event and not a sequela of wasting and starvation observed

during dioxin-like toxicity. In an attempt to investigate the causal mechanisms

that lead to PCB126-induced hypoglycemia, we found a significant decrease in

the protein and transcript levels of the rate limiting enzyme PEPCK-C, necessary

for the hepatic glucose production through gluconeogenesis. Our initial studies to

view gluconeogenic pathway as target of PCB126 induced toxicity were based on

a conjecture, but the results of the study indeed showed inhibitory effects on

hepatic glucose generation through gluconeogenesis. There is neither

abstinence from feed consumption nor weight loss within the time frame.

Additionally, the stored glycogen levels meant to replenish the transient decrease

in glucose levels were also not exhausted in PCB126 treated rat livers (Lai et al.,
98
2012; Gadupudi et al., 2016). Along with PEPCK-C, the transcript levels of

several key enzymes that catalyze anaplerotic and cataplerotic reactions during

gluconeogenesis and glycogenolysis, necessary for hepatic glucose production,

were are also significantly down regulated (Chapters 1 and 2).

PCB126 is well known to induce changes in the transcript levels of various

genes after trans-activation of AhR. However, several genes that are altered

during dioxin-like toxicity may not possess XREs. The alteration of gluconeogenic

genes is clearly consistent with the observed hypoglycemia, but the mechanism

of their regulation is unclear. Further complexity arises from the lack of previous

evidence for the role of AhR in direct regulation of the genes measured in this

study. In Chapter 2, we have demonstrated that exposure to PCB126 leads to

decrease in the phosphorylated levels of CREB in the liver, without changes in its

total protein levels or transcript levels. CREB is an important transcription factor

that plays a key role in regulating fuel homeostasis in liver and adipose tissue

(Altarejos and Montminy, 2011). Although the role of AhR in the regulation of

CREB may be implied from AhR antagonist studies performed on rat hepatocytes

in vitro, further studies are needed to conclude its role in decreasing CREB

phosphorylation. Regardless, these findings identify CREB as a molecular target

in dioxin-like toxicity, bridge the gap underlying the molecular mechanisms

involved in decreased gluconeogenesis and the observed hypoglycemia.

PCB126-induced insufficiency of glucose levels deprives a readily

metabolizable energy source required to meet the energy requirements of other

organs, more so in organs such as brain which cannot synthesize glucose. To

99
compensate for this fasting-like condition, the liver resorts to use of lipids as a

source of energy. This happens mainly through β-oxidation of fatty acids in

organelles such as peroxisomes, mitochondria and endoplasmic reticulum. The

enzymes involved in fatty acid oxidation are under the transcriptional control of

PPARα. PCB126 exposure results in decreased transcript and protein levels of

both PPARα and its gene targets (Robertson et al., 2007; Gadupudi et al., 2016).

Considering the time course of PCB126 toxicity, the lipid accumulation in the liver

follows after its effects on gluconeogenesis. The serial effects of PCB126 on

energy generation from both the carbohydrate and lipid sources causes a double

blow on the maintenance of metabolic homeostasis (Chapter 1). The effects of

PCB126 on phosphorylation of CREB (Chapter 2) also partly explain these dual

effects, because of the well-established roles of CREB in interacting with signal

discriminating coactivators such as PGC1α and FOXO1 in order to regulate both

glucose and lipid homeostasis.

In addition to the liver, adipose tissue also plays an important role in

metabolic homeostasis through its endocrine and storage functions. The adipose

tissue acts as a reservoir that supplies free fatty acids to the liver for energy

generation during fasting. The adipocytes also secrete several hormones that

regulate liver metabolism. Adipose tissue is the target organ for accumulation of

PCB126, however its effects on the functions of adipocyte are less characterized.

Using an in vitro human preadipocyte model, we demonstrated that PCB126

inhibits the differentiation of preadipocytes into mature adipocytes. The effects of

PCB126 on adipogenesis results from the AhR dependent decrease in the

100
transcription of PPARγ and its targets that turn on adipogenesis program for lipid

storage. These studies identify that PCB126 targets human adipocyte function

through its effects on lipid accumulation in preadipocytes and thus impedes its

storage functions in vitro (Chapter 3). However a more extensive characterization

is needed to understand the effects of PCB126 on adipose tissue function in the

physiological milieu. A failure in the lipid storage functions of adipose tissue in

the integrative physiology may compel ectopic lipid accumulation in other organs

such as liver. These findings thus warrant further studies on understanding the

effects of PCB126 and induced AhR activation on the functions adipose tissue.

Future directions

AhR- dependent target organ toxicity of PCB126 in liver and adipose

The use of high-throughput transcriptomics has identified the transcription

of novel gene targets in the liver after exposure to TCDD and other dioxin-like

ligands (Vezina et al., 2004; Ovando et al., 2010; Forgacs et al., 2013; Nault et

al., 2013). In spite of the fact that the molecular initiating event in dioxin-like

toxicity is the activation of AhR, the specific mechanisms and the key events that

explain the altered signaling and consequent organ dysfunction are not

characterized. Further the identification of role of other nuclear receptors such as

the CREB and PPAR in PCB126-toxicity; questions the direct involvement of the

AhR in the alteration of several gene targets and the resultant pathology. Further

studies using AhR knockout rats exposed to PCB126 would aid in i) delineating

the role of AhR and ii) the identifying any other molecular initiating events (MIE)

that characterize the adverse outcome pathways (AOP) observed during toxicity.
101
The nuclear translocation of AhR results in transcription of several genes and

production of several proteins that leads to altered signaling events in the cell.

Recent development of homozygous knockout rat model on Sprague-Dawley

outbred background would further assist in the understanding the organ specific

toxicity of PCB126-inuced AhR activation and the disruption in physiological

interactions (cross-talk) across principal target organs such as liver and adipose

(Harrill et al., 2013).

Effect of obesogenic diets on PCB126-induced toxicity

These and various other studies have clearly demonstrated disruption of

nutrient homeostasis, in glucose and lipid metabolism, upon exposure to dioxin

and dioxin-like PCBs (Ariyoshi et al., 1998; Angrish et al., 2012; Angrish et al.,

2013; Baker et al., 2013; Forgacs et al., 2013; Gadupudi et al., 2016). An

important question raised from these observations is: Does the composition of

the diet alter the toxicity profile of PCB126 or other dioxin-like toxicants? Future

studies should be aimed at understanding the interactions of PCB126 and diet

induced toxicity. Given the effects of PCB126 on both glucose and lipid

metabolism, it is important to compare the toxicity of PCB126 and normal diet

(AIN93G) against obesogenic diets formulated with high fat in them. In order to

understand the interaction of diet and PCB126, lower doses that do not cause

significant changes in serum glucose levels or lipid accumulation in the liver

should be chosen. The adipose tissue from the animals fed on obesogenic diets

should be analyzed for any inflammation. This would enhance our understanding

of the combined toxicity of PCB126 and the specific diet. Similar increases in
102
liver toxicity was observed in mice fed on a high fat diet and exposed to Aroclor

1260. Chronic exposure to Aroclor 1254 has been shown to exacerbate insulin

resistance in diet induced obesity of mice (Gray et al., 2013). Coplanar PCBs

have been recently shown to alter the potential benefits of weight loss through

diet restriction in mice (Baker et al., 2013). Disruption of adipocyte function

caused by accumulation of coplanar PCBs and their release into the blood during

weight loss have been shown to compromise the glucose metabolism (Baker et

al., 2015). Emerging evidence thus directs us to, further understand the role of

organic pollutants and dietary factors in the etiology of increasing metabolic

disease.

Concluding remarks

This work demonstrates that dioxin-like PCB126, in addition to the

accumulation in target tissues such as liver and adipose, also disrupts their

normal function. In particular, PCB126 significantly inhibits the fasting response

by decreasing CREB phosphorylation and its gluconeogenic regulation. Further,

PCB126 also impairs the fatty acid oxidation that is particularly necessary during

longer periods of fasting or energy deprivation. In addition to liver, PCB126 also

targets the adipocyte development and its function through its AhR dependent

effects on the PPARγ and its targets. Under this premise, further understanding

of the i) mechanisms underlying the effects of PCB126 on liver and adipose

physiology and ii) the additive role of diet besides the direct toxicity; would aid in

strategizing the intervention and management of metabolic risks associated with

exposures to dioxin-like pollutants and PCBs.

103
 APPENDIX A

Supplementary data for chapter II

Figure A-1. Effects of PCB126 on glycogen content in the liver.

The liver sections were stained with PAS stain to evaluate glycogen content (purple staining).
Glycogen content was present in livers of PCB126 treated animals (B, C, D, E) except in the
regions of vaculoation. Control animals had some mild glycogen accumulation (A). All the
images were taken at 100X magnification.

104
 CYP1A1

R e l. tr a n s c r ip t le v e l o f C Y P 1 A 1 300

* *
*

200
*

100

0
)

)
M

M
M

M
M

M
%

%
p

n
p

n
p

n
.1

.1

3
3

0
0

0
(0

(0
3

3
0

0
-
-

3
3
-

-
6
6
O

O
-

-
2
2

6
S

1
1

6
6
M

M
1

2
2

B
B

1
1
B

B
D

C
C

B
C

C
P

P
C

C
P

P
P

Figure A-2. Effects of PCB126 on Cyp1a1 transcript levels in the rat hepatocytes
Rat hepatocytes (H4IIE cells) were exposed to various concentrations of PCB126
between 3 pM to 300 nM. The Cyp1a1 induction after PCB126 exposure was measured
using qRT-PCR and compared to the respective DMSO controls in various experiments.
PCB126 significantly induced Cyp1a1 transcript levels at PCB126 concentrations greater
than 300 pM. (* represents P < 0.05; one-way ANOVA).

105
Supplementary data for chapter III

Figure A-3. PCB126 causes a dose-dependent decrease in the expression of

PEPCK-C.
The protein levels of (A) PCK1/PEPCK-C (n=4) were normalized to β-actin
(ACTB) levels and quantified by measuring band intensities using ImageJ
analysis (Figure III-1).

106
Figure A-4. PCB126 inhibits the phosphorylation of CREB in the liver.
A decrease in the (A) phosphorylation of CREB (pCREB) at S133 was observed (n=4).
There were no changes on total protein or (B) transcript levels of Creb1. The band
intensities of pCREB across all the groups were normalized against β-actin (ACTB) and
quantified using ImageJ analysis (Figure III-4).

107
Supplementary data for chapter IV

Figure A-5. Preadipocytes show a dose-dependent reduction

in differentiation of pre-exposure to PCB126.
Preadipocytes were exposed to increasing concentrations of
PCB126 (0-20 μM) for 5 days until cultures reached confluency;
the PCBs were removed, and the cultures were induced to
differentiate. After 11 days, the differentiated cultures were
stained for triglycerides with AdipoRed™ (red fluorescence). The
fluorescent images along with the bright field images are shown
in the left panels. The differentiated adipocytes were quantified
by flow cytometry as described in the Materials and Methods and
the plots are shown in the right panels.

108
Figure A-6. Effects of PCB126 on differentiation are independent of the cell
viability.
Cells were counted on days 1, 3, and 6 during the pre-exposure regimen to PCB126
concentrations of 0.5, 2 and 10 μM. The cultures were confluent after 6 days post-
seeding. DMSO was used as a vehicle control. The cell viability on the respective
days was measured using an MTT assay as described in Materials and Methods.
There was no significant variation in cell viability (ANOVA, one-way; P<0.05) due
to PCB126 exposure. The error bars represent the standard deviation from the mean
of 4 replicates.

109
Figure A-7. PCB126 dose dependently decreases the secretion of adiponectin
(protein levels)
Preadipocytes exposed to PCB126 until confluence were differentiated for 9 days. The
cultures were changed with new medium and the adiponectinreleased into it was
quantified after 4 days. The concentration of adiponectin (ng/ml) released into medium
was calculated from standard curve as described in Materials and Methods. There was a
significant dose-dependent decrease in the quantity of adiponectin released after PCB126
treatment (* represents P<0.05; one-way ANOVA). The error bars represent standard
deviation from the mean of the samples.

110
Figure A-8. PCB126 exposure increases transcript levels of CYP1A1 in
undifferentiated preadipocytes
Preadipocytes exposed to PCB126 until confluence were incubated in non-differentiating
growth media as internal controls for the observed effects after differentiation (see Figure
IV-4) and analyzed for transcript levels of ADIPOQ, FABP4, PPARγ and CYP1A1 using
qRT-PCR. The transcript levels are expressed relative to the housekeeping gene GAPDH
and normalized to undifferentiated preadipocytes treated with DMSO. Error bars represent
standard error of the mean of triplicate assays. Note that transcript levels of adipocyte
specific genes are much lower in the non-differentiated cultures as compared to
differentiated cultures (Figure IV-4) but are still reduced by PCB126 treatment.

111
Figure A-9. Inhibition of differentiation by PCB126 in human preadipocytes
is AHR dependent.
Preadipocytes were treated with PCB126 or DMSO and concurrently co-
incubated with the AHR antagonist CH223191 or DMSO at the noted
concentrations, the compounds were removed, and the cultures were
subsequently differentiated. After 11 days differentiation, the cultures were
stained for triglycerides with AdipoRed™ and the fluorescent and bright field
images were taken using microscopy (left panels). Flow cytometry analysis was
used to assess levels of differentiation in the cultures (right panels).

112
Figure A-10. Silencing of AhR mitigates PCB126-induced alterations in the
transcript levels of various genes involved in adipogenesis.
Preadipocytes transfected with ShAHR and the comparative ShSCR were treated with
PCB126 (0.5-10µM) or DMSO (0) and subsequently allowed to differentiate. The
relative transcript levels of adipogenic markers PPARγ (C) and ADIPOQ (D) in each
condition were measured using qRT-PCR. (C) Transcript levels of CYP1A1 (B) and
AHR (A) were measured to validate the knock down of AhR. Transcript levels are
represented as relative to GAPDH and normalized to cultures treated with DMSO only.
Significant effects upon treatment with PCB126 are represented * and significant effects
of AhR knockdown are represented by # (ANOVA, two-way; P<0.05).Two way
ANOVA showed no interaction between treatment and downregulation of AhR for the
transcript levels of PPARγ. The interaction between treatment and AhR knockdown
while inducing the following genes are listed as AhR (P=0.0004), CYP1A1 (P<0.0001)
ADIPOQ (P=0.011), PPARγ (not significant)

113
 APPENDIX B

Supporting table for the primer sequences (Chapter II)

Table B-1. List of primers used to measure transcript levels of genes (Chapter II)
Gene NCBI Accession Forward primer (5´-3´) Reverse primer (5´-3´)

Number

Acyl-CoA oxidase 1 (Acox1) NM_017340.2 TGCTCAGCAGGAGAAATGGAT TCTTGGGGTCATATGTGGCAG

Cytochrome P450, family 1, subfamily a, NM_012540.2 GGGTCCTAGAGAACACTCTTCA CAAGGCAGAATGTGGTGACG

polypeptide 1 (Cyp1a1)

Solute carrier family 2 (facilitated glucose NM_012879.2 AGACAACAACTCCGCACG TCCAGAGGAACACCCAAAAC

transporter), member 2 (Glut2/Slc2a2)

3-hydroxy-3-methylglutaryl-CoA synthase 2 NM_173094.2 GATCTTCCACACACCCTTTTGC GCAGAGCCTTGTCAACATCCT

(Hmgcs2)

Hypoxanthine phosphoribosyl transferase-1 NM_012583.2 TCAAGCAGTACAGCCCCAA GCCTGTATCCAACACTTCGAG

(Hprt1)

Phosphoenol pyruvate carboxykinase-1 NM_198780.3 GCCGACCTCCCTTACGAAAT TTGTGCTTGCTGGTTTGCTC

(soluble) (Pepck-c)

Peroxisome proliferator activated receptor NM_013196.1 TCGGGGATCTTAGAGGCGA GCTCTCTGTGTCCACCATGT

alpha (Pparα)

114
Supporting table for the primer sequences (Chapter III)

Table B-2. List of primers used to measure transcript levels of genes (Chapter III)

Gene NCBI Accession Number Forward primer (5´- Reverse primer (5´-3´)

3´)

Glycogen phosphorylase (Pygl) NM_022268.1 CGAAGCCTATGTCAAGTGT CCATGTTCCAGATGTCCTTG

Glucos-6-phosphotase (G6Pase) NM_013098.2 GGACACTGACTATTACAGC AGATAGCGAGAGTAGAAGTA

AAC ACC

Pyruvate carboxylase (Pc) NM_012744.2 TTGTGCCATTCAGTGTCG GCAGGGAGTCATAGTGGG

Serine dehydratase (Sds) NM_053962.3 AGGTTGGGTGTACATCTCC TGTCTCCTTCAGCTCCTTC

Forkhead box protein O1 (Foxo1) NM_001191846.2 ACCTCATGGACGGAG ATA ATGTTGCCTGCT CACTAAC

Peroxisome proliferator-activated NM_031347.1 AGCCAAGACTCTGTATGGA TGTACTGGTTGGATATGATTT

receptor gamma coactivator 1-alpha G CTG

(Pgc1α)

cAMP responsive element binding NM_134443.1, GCTGGCTAACAATGGTACC GCTGTGCGAATCTGGTATG

protein 1 (Creb1) NM_031017.1

115
Supporting table for the primer sequences (Chapter IV)

Table B-3. List of primers used to measure transcript levels of genes (Chapter IV)
Gene name Forward primer (5′–3′) Reverse primer (5′–3′)

Peroxisome proliferator activated receptor GCC CAG GTT TGC TGA ATG TG TGAGGACTCAGGGTGGTTCAG

gamma (PPARγ)

Adiponectin (ADIPOQ) GCTCAGCATTCAGTGTGGGA GTACAGCCCAGG AATGTTGC

Fatty acid binding protein (FABP4/ap2) AACTGGTGGTGGAATGCGTC TGCGAACTTCAGTCCAGGTC

Cytochrome P450, family 1, subfamily A, CCTTGGAACCTTCCCTGATCC CGTGGCCGACATGGAGATTG

polypeptide 1 (CYP1A1)

Glyceraldehyde-3-phosphate dehydrogenase AAGGTCATCCATGACAACTTTG GTAGAGGCAGGGATCATCTTCT

(GAPDH)

116
 REFERENCES

Ahlborg, U.G., Becking, G.C., Birnbaum, L.S., Brouwer, A., Derks, H., Feeley, M.,
Golor, G., Hanberg, A., Larsen, J.C., Liem, A.K.D., Safe, S.H., Schlatter,
C., Waern, F., Younes, M., Yrjanheikki, E., 1994. Toxic equivalency
factors for dioxin-like PCBs - report on WHO-ECEH and IPCS
consultation, December 1993. Chemosphere 28, 1049-1067.

Ahlborg, U.G., Brouwer, A., Fingerhut, M.A., Jacobson, J.L., Jacobson, S.W.,
Kennedy, S.W., Kettrup, A.A., Koeman, J.H., Poiger, H., Rappe, C., et al.,
1992. Impact of polychlorinated dibenzo-p-dioxins, dibenzofurans, and
biphenyls on human and environmental health, with special emphasis on
application of the toxic equivalency factor concept. European journal of
pharmacology 228, 179-199.

Ahlborg, U.G., Hanberg, A., 1994. Toxic equivalency factors for dioxin-like PCBs.
Environmental science and pollution research international 1, 67-68.

Al-Eryani, L., Wahlang, B., Falkner, K.C., Guardiola, J.J., Clair, H.B., Prough,
R.A., Cave, M., 2015. Identification of Environmental Chemicals
Associated with the Development of Toxicant-associated Fatty Liver
Disease in Rodents. Toxicologic pathology 43, 482-497.

Alexander, D.L., Ganem, L.G., Fernandez-Salguero, P., Gonzalez, F., Jefcoate,

C.R., 1998. Aryl-hydrocarbon receptor is an inhibitory regulator of lipid
synthesis and of commitment to adipogenesis. Journal of cell science 111
(Pt 22), 3311-3322.

Alonso-Magdalena, P., Quesada, I., Nadal, A., 2011. Endocrine disruptors in the
etiology of type 2 diabetes mellitus. Nature reviews. Endocrinology 7, 346-
353.

Altarejos, J.Y., Montminy, M., 2011. CREB and the CRTC co-activators: sensors
for hormonal and metabolic signals. Nature reviews. Molecular cell biology
12, 141-151.

Ampleman, M.D., Martinez, A., DeWall, J., Rawn, D.F., Hornbuckle, K.C.,
Thorne, P.S., 2015. Inhalation and dietary exposure to PCBs in urban and
rural cohorts via congener-specific measurements. Environmental science
& technology 49, 1156-1164.

Angrish, M.M., Dominici, C.Y., Zacharewski, T.R., 2013. TCDD-elicited effects on

liver, serum, and adipose lipid composition in C57BL/6 mice. Toxicol Sci
131, 108-115.

117
Angrish, M.M., Mets, B.D., Jones, A.D., Zacharewski, T.R., 2012. Dietary fat is a
lipid source in 2,3,7,8-tetrachlorodibenzo-rho-dioxin (TCDD)-elicited
hepatic steatosis in C57BL/6 mice. Toxicol Sci 128, 377-386.

Ariyoshi, N., Iwasaki, M., Kato, H., Tsusaki, S., Hamamura, M., Ichiki, T., Oguri,
K., 1998. Highly toxic coplanar PCB126 reduces liver peroxisomal enzyme
activities in rats. Environ Toxicol Pharmacol 5, 219-225.

Arsenescu, V., Arsenescu, R.I., King, V., Swanson, H., Cassis, L.A., 2008.
Polychlorinated biphenyl-77 induces adipocyte differentiation and
proinflammatory adipokines and promotes obesity and atherosclerosis.
Environ Health Perspect 116, 761-768.

Baker, N.A., 2013. Polychlorinated biphenyl ligands of the aryl hydrocarbon

receptor promote adipocyte-mediated diabetes.

Baker, N.A., Karounos, M., English, V., Fang, J., Wei, Y., Stromberg, A.,
Sunkara, M., Morris, A.J., Swanson, H.I., Cassis, L.A., 2013. Coplanar
polychlorinated biphenyls impair glucose homeostasis in lean C57BL/6
mice and mitigate beneficial effects of weight loss on glucose homeostasis
in obese mice. Environ Health Perspect 121, 105-110.

Baker, N.A., Shoemaker, R., English, V., Larian, N., Sunkara, M., Morris, A.J.,
Walker, M., Yiannikouris, F., Cassis, L.A., 2015. Effects of Adipocyte Aryl
Hydrocarbon Receptor Deficiency on PCB-Induced Disruption of Glucose
Homeostasis in Lean and Obese Mice. Environ Health Perspect 123, 944-
950.

Ballschmiter, K., Zell, M., 1980. Analysis of polychlorinated biphenyls (PCB) by

glass capillary gas chromatography. Fresenius' Zeitschrift für analytische
Chemie 302, 20-31.

Bandiera, S., Safe, S., Okey, A.B., 1982. Binding of polychlorinated biphenyls
classified as either phenobarbitone-, 3-methylcholanthrene- or mixed-type
inducers to cytosolic Ah receptor. Chem Biol Interact 39, 259-277.

Barnes, D.M., Hanlon, P.R., Kircher, E.A., 2003. Effects of inorganic HgCl2 on
adipogenesis. Toxicol Sci 75, 368-377.

Bastos Sales, L., Kamstra, J.H., Cenijn, P.H., van Rijt, L.S., Hamers, T., Legler,
J., 2013. Effects of endocrine disrupting chemicals on in vitro global DNA
methylation and adipocyte differentiation. Toxicol In Vitro 27, 1634-1643.

Beischlag, T.V., Luis Morales, J., Hollingshead, B.D., Perdew, G.H., 2008. The
aryl hydrocarbon receptor complex and the control of gene expression.
Crit Rev Eukaryot Gene Expr 18, 207-250.

118
Benedict, W.F., Gielen, J.E., Owens, I.S., Niwa, A., Bebert, D.W., 1973. Aryl
hydrocarbon hydroxylase induction in mammalian liver cell culture. IV.
Stimulation of the enzyme activity in established cell lines derived from rat
or mouse hepatoma and from normal rat liver. Biochem Pharmacol 22,
2766-2769.

Bergman, A., Klasson-Wehler, E., Kuroki, H., 1994. Selective retention of

hydroxylated PCB metabolites in blood. Environ Health Perspect 102,
464-469.

Bernstein, R.L., Hyun, W.C., Davis, J.H., Fulwyler, M.J., Pershadsingh, H.A.,
1989. Flow cytometric analysis of mature adipocytes. Cytometry 10, 469-
474.

Birnbaum, L.S., DeVito, M.J., 1995. Use of toxic equivalency factors for risk
assessment for dioxins and related compounds. Toxicology 105, 391-401.

Birnbaum, L.S., Tuomisto, J., 2000. Non-carcinogenic effects of TCDD in

animals. Food additives and contaminants 17, 275-288.

Boekelheide, K., Blumberg, B., Chapin, R.E., Cote, I., Graziano, J.H., Janesick,
A., Lane, R., Lillycrop, K., Myatt, L., States, J.C., Thayer, K.A., Waalkes,
M.P., Rogers, J.M., 2012. Predicting Later-Life Outcomes of Early-Life
Exposures. Environmental Health Perspectives 120, 1353-1361.

Borges, T., Glauert, H.P., Robertson, L.W., 1993. Perfluorodecanoic acid

noncompetitively inhibits the peroxisomal enzymes enoyl-CoA hydratase
and 3-hydroxyacyl-CoA dehydrogenase. Toxicol Appl Pharmacol 118, 8-
15.

Bourez, S., Joly, A., Covaci, A., Remacle, C., Larondelle, Y., Schneider, Y.J.,
Debier, C., 2012. Accumulation capacity of primary cultures of adipocytes
for PCB-126: influence of cell differentiation stage and triglyceride levels.
Toxicol Lett 214, 243-250.

Bourez, S., Van den Daelen, C., Le Lay, S., Poupaert, J., Larondelle, Y., Thome,
J.P., Schneider, Y.J., Dugail, I., Debier, C., 2013. The dynamics of
accumulation of PCBs in cultured adipocytes vary with the cell lipid
content and the lipophilicity of the congener. Toxicol Lett 216, 40-46.

Boverhof, D.R., Burgoon, L.D., Tashiro, C., Chittim, B., Harkema, J.R., Jump,
D.B., Zacharewski, T.R., 2005. Temporal and dose-dependent hepatic
gene expression patterns in mice provide new insights into TCDD-
mediated hepatotoxicity. Toxicological Sciences 85, 1048-1063.

119
Boverhof, D.R., Burgoon, L.D., Tashiro, C., Sharratt, B., Chittim, B., Harkema,
J.R., Mendrick, D.L., Zacharewski, T.R., 2006. Comparative
toxicogenomic analysis of the hepatotoxic effects of TCDD in Sprague
Dawley rats and C57BL/6 mice. Toxicol Sci 94, 398-416.

Bradlaw, J.A., Casterline, J.L., Jr., 1979. Induction of enzyme activity in cell
culture: a rapid screen for detection of planar polychlorinated organic
compounds. Journal - Association of Official Analytical Chemists 62, 904-
916.

Brito, M.N., Brito, N.A., Migliorini, R.H., 1992. Thermogenic capacity of brown
adipose tissue is reduced in rats fed a high protein, carbohydrate-free diet.
Journal of Nutrition 122, 2081-2086.

Burgess, S.C., Hausler, N., Merritt, M., Jeffrey, F.M., Storey, C., Milde, A., Koshy,
S., Lindner, J., Magnuson, M.A., Malloy, C.R., Sherry, A.D., 2004.
Impaired tricarboxylic acid cycle activity in mouse livers lacking cytosolic
phosphoenolpyruvate carboxykinase. J Biol Chem 279, 48941-48949.

Cahill, M.A., Ernst, W.H., Janknecht, R., Nordheim, A., 1994. Regulatory
squelching. FEBS Lett 344, 105-108.

Campbell, J.E., Drucker, D.J., 2015. Islet [alpha] cells and

glucagon[mdash]critical regulators of energy homeostasis. Nature
reviews. Endocrinology 11, 329-338.

Carpenter, D.O., 2006. Polychlorinated biphenyls (PCBs): routes of exposure

and effects on human health. Reviews on environmental health 21, 1-23.

Casals-Casas, C., Desvergne, B., 2011. Endocrine disruptors: from endocrine to

metabolic disruption. Annu Rev Physiol 73, 135-162.

Cave, M., Appana, S., Patel, M., Falkner, K.C., McClain, C.J., Brock, G., 2010.
Polychlorinated biphenyls, lead, and mercury are associated with liver
disease in American adults: NHANES 2003-2004. Environ Health
Perspect 118, 1735-1742.

Cave, M., Deaciuc, I., Mendez, C., Song, Z., Joshi-Barve, S., Barve, S., McClain,
C., 2007. Nonalcoholic fatty liver disease: predisposing factors and the
role of nutrition. The Journal of nutritional biochemistry 18, 184-195.

Cawthorn, W.P., Scheller, E.L., MacDougald, O.A., 2012. Adipose tissue stem
cells: the great WAT hope. Trends in endocrinology and metabolism: TEM
23, 270-277.

120
Cheung, B.M., Deng, H.B., 2014. Fibroblast growth factor 21: a promising
therapeutic target in obesity-related diseases. Expert review of
cardiovascular therapy 12, 659-666.

Choi, E.Y., Lee, H., Dingle, R.W., Kim, K.B., Swanson, H.I., 2012. Development
of novel CH223191-based antagonists of the aryl hydrocarbon receptor.
Mol Pharmacol 81, 3-11.

Christian, B.J., Menahan, L.A., Peterson, R.E., 1986. Intermediary metabolism of

the mature rat following 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment.
Toxicol Appl Pharmacol 83, 360-378.

Cimafranca, M.A., Hanlon, P.R., Jefcoate, C.R., 2004. TCDD administration after
the pro-adipogenic differentiation stimulus inhibits PPARgamma through a
MEK-dependent process but less effectively suppresses adipogenesis.
Toxicol Appl Pharmacol 196, 156-168.

Cinti, S., 2012. The adipose organ at a glance. Disease models & mechanisms 5,
588-594.

Colborn, T., Saal, F.S.V., Soto, A.M., 1993. DEVELOPMENTAL EFFECTS OF

ENDOCRINE-DISRUPTING CHEMICALS IN WILDLIFE AND HUMANS.
Environmental Health Perspectives 101, 378-384.

Combs, T.P., Marliss, E.B., 2014. Adiponectin signaling in the liver. Reviews in
endocrine & metabolic disorders 15, 137-147.

Cotrim, H.P., Andrade, Z.A., Parana, R., Portugal, M., Lyra, L.G., Freitas, L.A.,
1999. Nonalcoholic steatohepatitis: a toxic liver disease in industrial
workers. Liver 19, 299-304.

Cotrim, H.P., De Freitas, L.A., Freitas, C., Braga, L., Sousa, R., Carvalho, F.,
Parana, R., Santos-Jesus, R., Andrade, Z., 2004. Clinical and
histopathological features of NASH in workers exposed to chemicals with
or without associated metabolic conditions. Liver international : official
journal of the International Association for the Study of the Liver 24, 131-
135.

Croutch, C.R., Lebofsky, M., Schramm, K.W., Terranova, P.F., Rozman, K.K.,
2005. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and 1,2,3,4,7,8-
hexachlorodibenzo-p-dioxin (HxCDD) alter body weight by decreasing
insulin-like growth factor I (IGF-I) signaling. Toxicol Sci 85, 560-571.

Dalton, T.P., Puga, A., Shertzer, H.G., 2002. Induction of cellular oxidative stress
by aryl hydrocarbon receptor activation. Chem Biol Interact 141, 77-95.

121
Darimont, C., Zbinden, I., Avanti, O., Leone-Vautravers, P., Giusti, V.,
Burckhardt, P., Pfeifer, A.M., Mace, K., 2003. Reconstitution of telomerase
activity combined with HPV-E7 expression allow human preadipocytes to
preserve their differentiation capacity after immortalization. Cell death and
differentiation 10, 1025-1031.

Decherf, S., Demeneix, B.A., 2011. The obesogen hypothesis: a shift of focus
from the periphery to the hypothalamus. Journal of toxicology and
environmental health. Part B, Critical reviews 14, 423-448.

Denison, M.S., Nagy, S.R., 2003. Activation of the aryl hydrocarbon receptor by
structurally diverse exogenous and endogenous chemicals. Annual review
of pharmacology and toxicology 43, 309-334.

Denison, M.S., Soshilov, A.A., He, G., DeGroot, D.E., Zhao, B., 2011. Exactly the
same but different: promiscuity and diversity in the molecular mechanisms
of action of the aryl hydrocarbon (dioxin) receptor. Toxicol Sci 124, 1-22.

Dhakal, K., He, X., Lehmler, H.J., Teesch, L.M., Duffel, M.W., Robertson, L.W.,
2012. Identification of sulfated metabolites of 4-chlorobiphenyl (PCB3) in
the serum and urine of male rats. Chem Res Toxicol 25, 2796-2804.

Donat-Vargas, C., Gea, A., Sayon-Orea, C., Carlos, S., Martinez-Gonzalez, M.A.,
Bes-Rastrollo, M., 2014. Association between dietary intakes of PCBs and
the risk of obesity: the SUN project. Journal of epidemiology and
community health 68, 834-841.

Duan, R., Porter, W., Samudio, I., Vyhlidal, C., Kladde, M., Safe, S., 1999.
Transcriptional Activation of c-fos Protooncogene by 17β-Estradiol:
Mechanism of Aryl Hydrocarbon Receptor-Mediated Inhibition. Molecular
Endocrinology 13, 1511-1521.

Dunmore, S.J., Brown, J.E., 2013. The role of adipokines in beta-cell failure of
type 2 diabetes. The Journal of endocrinology 216, T37-45.

Espandiari, P., Thomas, V.A., Glauert, H.P., O'Brien, M., Noonan, D., Robertson,
L.W., 1995. The herbicide dicamba (2-methoxy-3,6-dichlorobenzoic acid)
is a peroxisome proliferator in rats. Fundamental and applied toxicology :
official journal of the Society of Toxicology 26, 85-90.

Everett, C.J., Frithsen, I., Player, M., 2011. Relationship of polychlorinated

biphenyls with type 2 diabetes and hypertension. J Environ Monit 13, 241-
251.

122
Everett, C.J., Frithsen, I.L., Diaz, V.A., Koopman, R.J., Simpson, W.M., Jr.,
Mainous, A.G., 3rd, 2007. Association of a polychlorinated dibenzo-p-
dioxin, a polychlorinated biphenyl, and DDT with diabetes in the 1999-
2002 National Health and Nutrition Examination Survey. Environmental
research 103, 413-418.

Fasshauer, M., Blüher, M., 2015. Adipokines in health and disease. Trends in
pharmacological sciences 36, 461-470.

Finelli, C., Tarantino, G., 2013. What is the role of adiponectin in obesity related
non-alcoholic fatty liver disease? World journal of gastroenterology 19,
802-812.

Forgacs, A.L., Dere, E., Angrish, M.M., Zacharewski, T.R., 2013. Comparative
analysis of temporal and dose-dependent TCDD-elicited gene expression
in human, mouse, and rat primary hepatocytes. Toxicol Sci 133, 54-66.

Forgacs, A.L., Kent, M.N., Makley, M.K., Mets, B., DelRaso, N., Jahns, G.L.,
Burgoon, L.D., Zacharewski, T.R., Reo, N.V., 2012. Comparative
metabolomic and genomic analyses of TCDD-elicited metabolic disruption
in mouse and rat liver. Toxicol Sci 125, 41-55.

Gadupudi, G., Gourronc, F.A., Ludewig, G., Robertson, L.W., Klingelhutz, A.J.,
2015. PCB126 inhibits adipogenesis of human preadipocytes. Toxicol In
Vitro 29, 132-141.

Gadupudi, G.S., Klaren, W.D., Olivier, A.K., Klingelhutz, A.J., Robertson, L.W.,
2016. PCB126-Induced Disruption in Gluconeogenesis and Fatty Acid
Oxidation Precedes Fatty Liver in Male Rats. Toxicol Sci 149, 98-110.

Gauthier, M.S., Rabasa-Lhoret, R., Prud'homme, D., Karelis, A.D., Geng, D., van
Bavel, B., Ruzzin, J., 2014. The metabolically healthy but obese
phenotype is associated with lower plasma levels of persistent organic
pollutants as compared to the metabolically abnormal obese phenotype.
The Journal of clinical endocrinology and metabolism 99, E1061-1066.

Glauert, H.P., Hennig, B., Chow, H.S., 1990. Induction of peroxisomal enzymes
in cultured porcine endothelial cells by the hypolipidemic drug ciprofibrate.
J Biochem Toxicol 5, 115-118.

Gorin, E., Tal-Or, Z., Shafrir, E., 1969. Glyceroneogenesis in Adipose Tissue of
Fasted, Diabetic and Triamcinolone Treated Rats. European Journal of
Biochemistry 8, 370-375.

123
Gourronc, F.A., Robertson m, M., Herrig, A.K., Lansdorp, P.M., Goldman, F.D.,
Klingelhutz, A.J., 2010. Proliferative defects in dyskeratosis congenita skin
keratinocytes are corrected by expression of the telomerase reverse
transcriptase, TERT, or by activation of endogenous telomerase through
expression of papillomavirus E6/E7 or the telomerase RNA component,
TERC. Experimental dermatology 19, 279-288.

Granner, D.K., 2015. In Pursuit of Genes of Glucose Metabolism. Journal of

Biological Chemistry 290, 22312-22324.

Gray, S.L., Shaw, A.C., Gagne, A.X., Chan, H.M., 2013. Chronic exposure to
PCBs (Aroclor 1254) exacerbates obesity-induced insulin resistance and
hyperinsulinemia in mice. J Toxicol Environ Health A 76, 701-715.

Green, H., Kehinde, O., 1975. An established preadipose cell line and its
differentiation in culture. II. Factors affecting the adipose conversion. Cell
5, 19-27.

Gregoire, F.M., Smas, C.M., Sul, H.S., 1998. Understanding adipocyte

differentiation. Physiol Rev 78, 783-809.

Grimm, F.A., Hu, D., Kania-Korwel, I., Lehmler, H.J., Ludewig, G., Hornbuckle,
K.C., Duffel, M.W., Bergman, A., Robertson, L.W., 2015. Metabolism and
metabolites of polychlorinated biphenyls. Crit Rev Toxicol 45, 245-272.

Grun, F., Blumberg, B., 2009. Endocrine disrupters as obesogens. Mol Cell
Endocrinol 304, 19-29.

Grün, F., Blumberg, B., 2009. Endocrine disrupters as obesogens. Molecular and
cellular endocrinology 304, 19-29.

Grun, F., Watanabe, H., Zamanian, Z., Maeda, L., Arima, K., Cubacha, R.,
Gardiner, D.M., Kanno, J., Iguchi, T., Blumberg, B., 2006. Endocrine-
disrupting organotin compounds are potent inducers of adipogenesis in
vertebrates. Molecular endocrinology (Baltimore, Md.) 20, 2141-2155.

Guilherme, A., Virbasius, J.V., Puri, V., Czech, M.P., 2008. Adipocyte
dysfunctions linking obesity to insulin resistance and type 2 diabetes.
Nature reviews. Molecular cell biology 9, 367-377.

Haeusler, R.A., Han, S., Accili, D., 2010. Hepatic FoxO1 Ablation Exacerbates
Lipid Abnormalities during Hyperglycemia. Journal of Biological Chemistry
285, 26861-26868.

124
Haeusler, R.A., Hartil, K., Vaitheesvaran, B., Arrieta-Cruz, I., Knight, C.M., Cook,
J.R., Kammoun, H.L., Febbraio, M.A., Gutierrez-Juarez, R., Kurland, I.J.,
Accili, D., 2014. Integrated control of hepatic lipogenesis versus glucose
production requires FoxO transcription factors. Nature communications 5,
5190.

Hansen L.G., 1987. Food chain modification of the composition and toxicity of
PCB residues. Rev Environ Toxicol 3, 149-212.

Hanson, R.W., Reshef, L., 2003. Glyceroneogenesis revisited. Biochimie 85,

1199-1205.

Harlan Laboratories, I., 2014. Outbred rats - Sprague Dawley® Outbred Rat.
www.harlan.com, Indianapolis, IN, pp.

Harper, N., Connor, K., Safe, S., 1993. Immunotoxic potencies of polychlorinated
biphenyl (PCB), dibenzoifuran (PCDF) and dibenzofuran (PCDF) and
dibenzo-P-dioxin (PCDD) congeners in C57BL/6 and DBA/2 mice.
Toxicology 80, 217-227.

Harper, N., Connor, K., Steinberg, M., Safe, S., 1995. Immunosuppressive
activity of polychlorinated biphenyl mixtures and congeners: nonadditive
(antagonistic) interactions. Fundamental and applied toxicology : official
journal of the Society of Toxicology 27, 131-139.

Harrill, J.A., Hukkanen, R.R., Lawson, M., Martin, G., Gilger, B., Soldatow, V.,
LeCluyse, E.L., Budinsky, R.A., Rowlands, J.C., Thomas, R.S., 2013.
Knockout of the aryl hydrocarbon receptor results in distinct hepatic and
renal phenotypes in rats and mice. Toxicology and Applied Pharmacology
272, 503-518.

Harwood, H.J., Jr., 2012. The adipocyte as an endocrine organ in the regulation
of metabolic homeostasis. Neuropharmacology 63, 57-75.

Hassoun, E.A., Li, F., Abushaban, A., Stohs, S.J., 2000. The relative abilities of
TCDD and its congeners to induce oxidative stress in the hepatic and
brain tissues of rats after subchronic exposure. Toxicology 145, 103-113.

Hassoun, E.A., Wang, H., Abushaban, A., Stohs, S.J., 2002. Induction of
oxidative stress in the tissues of rats after chronic exposure to TCDD,
2,3,4,7,8-pentachlorodibenzofuran, and 3,3',4,4',5-pentachlorobiphenyl. J
Toxicol Environ Health A 65, 825-842.

125
Hausman, D.B., DiGirolamo, M., Bartness, T.J., Hausman, G.J., Martin, R.J.,
2001. The biology of white adipocyte proliferation. Obesity reviews : an
official journal of the International Association for the Study of Obesity 2,
239-254.

Haws, L.C., Su, S.H., Harris, M., DeVito, M.J., Walker, N.J., Farland, W.H.,
Finley, B., Birnbaum, L.S., 2006. Development of a Refined Database of
Mammalian Relative Potency Estimates for Dioxin-like Compounds.
Toxicological Sciences 89, 4-30.

Heindel, J.J., Newbold, R., Schug, T.T., 2015a. Endocrine disruptors and obesity.
Nature reviews. Endocrinology 11, 653-661.

Heindel, J.J., vom Saal, F.S., Blumberg, B., Bovolin, P., Calamandrei, G.,
Ceresini, G., Cohn, B.A., Fabbri, E., Gioiosa, L., Kassotis, C., Legler, J.,
La Merrill, M., Rizzir, L., Machtinger, R., Mantovani, A., Mendez, M.A.,
Montanini, L., Molteni, L., Nagel, S.C., Parmigiani, S., Panzica, G.,
Paterlini, S., Pomatto, V., Ruzzin, J., Sartor, G., Schug, T.T., Street, M.E.,
Suvorov, A., Volpi, R., Zoeller, R.T., Palanza, P., 2015b. Parma
consensus statement on metabolic disruptors. Environmental Health 14,
1-7.

Hennig, B., Boissonneault, G.A., Chow, C.K., Wang, Y., Matulionis, D.H.,
Glauert, H.P., 1990. Effect of vitamin E on linoleic acid-mediated induction
of peroxisomal enzymes in cultured porcine endothelial cells. J Nutr 120,
331-337.

Hennig, B., Hammock, B.D., Slim, R., Toborek, M., Saraswathi, V., Robertson,
L.W., 2002. PCB-induced oxidative stress in endothelial cells: modulation
by nutrients. Int J Hyg Environ Health 205, 95-102.

Henriksen, G.L., Ketchum, N.S., Michalek, J.E., Swaby, J.A., 1997. Serum dioxin
and diabetes mellitus in veterans of Operation Ranch Hand. Epidemiology
8, 252-258.

Herzig, S., Long, F., Jhala, U.S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D.,
Schutz, G., Yoon, C., Puigserver, P., Spiegelman, B., Montminy, M., 2001.
CREB regulates hepatic gluconeogenesis through the coactivator PGC-1.
Nature 413, 179-183.

Hestermann, E.V., Stegeman, J.J., Hahn, M.E., 2000. Relative contributions of

affinity and intrinsic efficacy to aryl hydrocarbon receptor ligand potency.
Toxicol Appl Pharmacol 168, 160-172.

Hotamisligil, G.S., 2006. Inflammation and metabolic disorders. Nature 444, 860-
867.

126
Hsia, M.T., Kreamer, B.L., 1985. Delayed wasting syndrome and alterations of
liver gluconeogenic enzymes in rats exposed to the TCDD congener 3,3',
4,4'-tetrachloroazoxybenzene. Toxicol Lett 25, 247-258.

Hsu, H.F., Tsou, T.C., Chao, H.R., Kuo, Y.T., Tsai, F.Y., Yeh, S.C., 2010. Effects
of 2,3,7,8-tetrachlorodibenzo-p-dioxin on adipogenic differentiation and
insulin-induced glucose uptake in 3T3-L1 cells. Journal of hazardous
materials 182, 649-655.

Hu, D., Lehmler, H.J., Martinez, A., Wang, K., Hornbuckle, K.C., 2010.
Atmospheric PCB congeners across Chicago. Atmospheric environment
(Oxford, England : 1994) 44, 1550-1557.

IARC, 2016. Polychlorinated biphenyls and polybrominated biphenyls / IARC

Working Group on the Evaluation of Carcinogenic Risks to Humans
nternational Agency for Research on Cancer, (2013: Lyon, France).

Janesick, A., Blumberg, B., 2011a. Endocrine disrupting chemicals and the
developmental programming of adipogenesis and obesity. Birth defects
research. Part C, Embryo today : reviews 93, 34-50.

Janesick, A., Blumberg, B., 2011b. Minireview: PPARgamma as the target of

obesogens. The Journal of steroid biochemistry and molecular biology
127, 4-8.

Janesick, A.S., Blumberg, B., 2016. Obesogens: an emerging threat to public

health. American Journal of Obstetrics and Gynecology 214, 559-565.

Kalhan, S.C., Mahajan, S., Burkett, E., Reshef, L., Hanson, R.W., 2001.
Glyceroneogenesis and the source of glycerol for hepatic triacylglycerol
synthesis in humans. J Biol Chem 276, 12928-12931.

Kamstra, J.H., Hruba, E., Blumberg, B., Janesick, A., Mandrup, S., Hamers, T.,
Legler, J., 2014. Transcriptional and epigenetic mechanisms underlying
enhanced in vitro adipocyte differentiation by the brominated flame
retardant BDE-47. Environmental science & technology 48, 4110-4119.

Kersten, S., 2014. Integrated physiology and systems biology of PPARα.

Molecular metabolism 3, 354-371.

Kersten, S., Seydoux, J., Peters, J.M., Gonzalez, F.J., Desvergne, B., Wahli, W.,
1999. Peroxisome proliferator-activated receptor alpha mediates the
adaptive response to fasting. J Clin Invest 103, 1489-1498.

127
Klaren, W.D., Gadupudi, G.S., Wels, B., Simmons, D.L., Olivier, A.K., Robertson,
L.W., 2015. Progression of micronutrient alteration and hepatotoxicity
following acute PCB126 exposure. Toxicology 338, 1-7.

Kliewer, S.A., Mangelsdorf, D.J., 2010. Fibroblast growth factor 21: from
pharmacology to physiology. The American journal of clinical nutrition 91,
254s-257s.

Knittle, J.L., Timmers, K., Ginsberg-Fellner, F., Brown, R.E., Katz, D.P., 1979.
The growth of adipose tissue in children and adolescents. Cross-sectional
and longitudinal studies of adipose cell number and size. The Journal of
Clinical Investigation 63, 239-246.

Knutson, J.C., Poland, A., 1980. 2,3,7,8-Tetrachlorodibenzo-p-dioxin: Failure to

demonstrate toxicity in twenty-three cultured cell types. Toxicology and
Applied Pharmacology 54, 377-383.

Koh, W.X., Hornbuckle, K.C., Thorne, P.S., 2015. Human Serum from Urban and
Rural Adolescents and Their Mothers Shows Exposure to Polychlorinated
Biphenyls Not Found in Commercial Mixtures. Environmental science &
technology 49, 8105-8112.

Kornberg, H., 1966. Anaplerotic sequences and their role in metabolism. Essays
Biochem 2, 1-31.

Krishnan, V., Porter, W., Santostefano, M., Wang, X., Safe, S., 1995. Molecular
mechanism of inhibition of estrogen-induced cathepsin D gene expression
by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in MCF-7 cells. Mol Cell
Biol 15, 6710-6719.

La Merrill, M., Emond, C., Kim, M.J., Antignac, J.P., Le Bizec, B., Clement, K.,
Birnbaum, L.S., Barouki, R., 2013. Toxicological function of adipose
tissue: focus on persistent organic pollutants. Environ Health Perspect
121, 162-169.

Lai, I., Chai, Y., Simmons, D., Luthe, G., Coleman, M.C., Spitz, D., Haschek,
W.M., Ludewig, G., Robertson, L.W., 2010. Acute toxicity of 3,3',4,4',5-
pentachlorobiphenyl (PCB 126) in male Sprague-Dawley rats: effects on
hepatic oxidative stress, glutathione and metals status. Environ Int 36,
918-923.

Lai, I.K., Dhakal, K., Gadupudi, G.S., Li, M., Ludewig, G., Robertson, L.W.,
Olivier, A.K., 2012. N-acetylcysteine (NAC) diminishes the severity of PCB
126-induced fatty liver in male rodents. Toxicology 302, 25-33.

128
Lauby-Secretan, B., Loomis, D., Baan, R., El Ghissassi, F., Bouvard, V.,
Benbrahim-Tallaa, L., Guha, N., Grosse, Y., Straif, K., 2015. Use of
mechanistic data in the IARC evaluations of the carcinogenicity of
polychlorinated biphenyls and related compounds. Environmental science
and pollution research international.

Lazarow, P.B., 1981. [19] Assay of peroxisomal β-oxidation of fatty acids. In

John, M.L., (Ed.), Methods in Enzymology. Academic Press, pp. 315-319.

Lee, D.H., Lind, L., Jacobs, D.R., Jr., Salihovic, S., van Bavel, B., Lind, P.M.,
2012. Associations of persistent organic pollutants with abdominal obesity
in the elderly: The Prospective Investigation of the Vasculature in Uppsala
Seniors (PIVUS) study. Environ Int 40, 170-178.

Lee, H., Bach, J., Chae, H., Lee, S., Joo, W., Choi, S., Kim, K., Lee, W., Kim, S.,
2004. Mitogen-activated protein kinase/extracellular signal-regulated
kinase attenuates 3-hydroxykynurenine-induced neuronal cell death. J
Neurochem 88, 647-656.

Lee, J.H., Wada, T., Febbraio, M., He, J., Matsubara, T., Lee, M.J., Gonzalez,
F.J., Xie, W., 2010. A novel role for the dioxin receptor in fatty acid
metabolism and hepatic steatosis. Gastroenterology 139, 653-663.

LG, L., 1992. Histopathalogic methods and color atlas of special stains and
tissue artifacts. American Histolabs, Gaitheresburg, MD.

Li, L.I., Tang, L., 2015. Multiple roles of fibroblast growth factor 21 in metabolism.
Current pharmaceutical design 21, 3041-3050.

Li, W., Vogel, C.F.A., Fujiyoshi, P., Matsumura, F., 2008. Development of a
human adipocyte model derived from human mesenchymal stem cells
(hMSC) as a tool for toxicological studies on the action of TCDD.
Biological Chemistry 389, 169-177.

Lind, L., Penell, J., Luttropp, K., Nordfors, L., Syvanen, A.C., Axelsson, T.,
Salihovic, S., van Bavel, B., Fall, T., Ingelsson, E., Lind, P.M., 2013.
Global DNA hypermethylation is associated with high serum levels of
persistent organic pollutants in an elderly population. Environ Int 59, 456-
461.

Little, R.R., Rohlfing, C.L., Sacks, D.B., 2011. Status of hemoglobin A1c
measurement and goals for improvement: from chaos to order for
improving diabetes care. Clinical chemistry 57, 205-214.

129
Lo, R., Celius, T., Forgacs, A.L., Dere, E., MacPherson, L., Harper, P.,
Zacharewski, T., Matthews, J., 2011. Identification of aryl hydrocarbon
receptor binding targets in mouse hepatic tissue treated with 2,3,7,8-
tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 257, 38-47.

Longnecker, M.P., Rogan, W.J., Lucier, G., 1997. The human health effects of
DDT (dichlorodiphenyltrichloroethane) and PCBS (polychlorinated
biphenyls) and an overview of organochlorines in public health. Annu Rev
Public Health 18, 211-244.

Luthe, G.M., Schut, B.G., Aaseng, J.E., 2009. Monofluorinated analogues of

polychlorinated biphenyls (F-PCBs): synthesis using the Suzuki-coupling,
characterization, specific properties and intended use. Chemosphere 77,
1242-1248.

Mandard, S., Muller, M., Kersten, S., 2004. Peroxisome proliferator-activated

receptor alpha target genes. Cellular and molecular life sciences : CMLS
61, 393-416.

Manikkam, M., Tracey, R., Guerrero-Bosagna, C., Skinner, M.K., 2012. Dioxin
(TCDD) induces epigenetic transgenerational inheritance of adult onset
disease and sperm epimutations. PLoS One 7, e46249.

Maroni, M., Colombi, A., Arbosti, G., Cantoni, S., Foa, V., 1981a. Occupational
exposure to polychlorinated biphenyls in electrical workers. II. Health
effects. British journal of industrial medicine 38, 55-60.

Maroni, M., Colombi, A., Cantoni, S., Ferioli, E., Foa, V., 1981b. Occupational
exposure to polychlorinated biphenyls in electrical workers. I.
Environmental and blood polychlorinated biphenyls concentrations. British
journal of industrial medicine 38, 49-54.

Martins-Santos, M.E., Chaves, V.E., Frasson, D., Boschini, R.P., Garofalo, M.A.,
Kettelhut Ido, C., Migliorini, R.H., 2007. Glyceroneogenesis and the supply
of glycerol-3-phosphate for glyceride-glycerol synthesis in liver slices of
fasted and diabetic rats. American journal of physiology. Endocrinology
and metabolism 293, E1352-1357.

Matsumoto, M., Pocai, A., Rossetti, L., DePinho, R.A., Accili, D., 2007. Impaired
Regulation of Hepatic Glucose Production in Mice Lacking the Forkhead
Transcription Factor Foxo1 in Liver. Cell Metabolism 6, 208-216.

Mayr, B., Montminy, M., 2001. Transcriptional regulation by the phosphorylation-

dependent factor CREB. Nature reviews. Molecular cell biology 2, 599-
609.

130
Mayr, B.M., Canettieri, G., Montminy, M.R., 2001. Distinct effects of cAMP and
mitogenic signals on CREB-binding protein recruitment impart specificity
to target gene activation via CREB. Proceedings of the National Academy
of Sciences 98, 10936-10941.

Mimura, J., Fujii-Kuriyama, Y., 2003. Functional role of AhR in the expression of
toxic effects by TCDD. Biochim.Biophys.Acta 1619, 263.

Mlinar, B., Marc, J., 2011. New insights into adipose tissue dysfunction in insulin
resistance. Clinical chemistry and laboratory medicine : CCLM / FESCC
49, 1925-1935.

Morris, D.L., Rui, L., 2009. Recent advances in understanding leptin signaling
and leptin resistance. American journal of physiology. Endocrinology and
metabolism 297, E1247-1259.

Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival:
Application to proliferation and cytotoxicity assays. Journal of
Immunological Methods 65, 55-63.

Narbonne, J.F., Robertson, L.W., 2014. 7th International PCB Workshop:

Chemical mixtures in a complex world. Environmental science and
pollution research international 21, 6269-6275.

Nash, J.T., Szabo, D.T., Carey, G.B., 2013. Polybrominated diphenyl ethers alter
hepatic phosphoenolpyruvate carboxykinase enzyme kinetics in male
Wistar rats: implications for lipid and glucose metabolism. J Toxicol
Environ Health A 76, 142-156.

Nault, R., Forgacs, A.L., Dere, E., Zacharewski, T.R., 2013. Comparisons of
differential gene expression elicited by TCDD, PCB126, betaNF, or ICZ in
mouse hepatoma Hepa1c1c7 cells and C57BL/6 mouse liver. Toxicol Lett
223, 52-59.

Neel, B.A., Sargis, R.M., 2011. The paradox of progress: environmental

disruption of metabolism and the diabetes epidemic. Diabetes 60, 1838-
1848.

Nordlie, R.C., Foster, J.D., Lange, A.J., 1999. Regulation of glucose production
by the liver. Annual review of nutrition 19, 379-406.

NTP, 2006. NTP toxicology and carcinogenesis studies of 3,3',4,4',5-

pentachlorobiphenyl (PCB 126) (CAS No. 57465-28-8) in female Harlan
Sprague-Dawley rats (Gavage Studies), Natl Toxicol Program Tech Rep
Ser, pp. 4-246.

131
Nye, C.K., Hanson, R.W., Kalhan, S.C., 2008. Glyceroneogenesis Is the
Dominant Pathway for Triglyceride Glycerol Synthesis in Vivo in the Rat.
The Journal of Biological Chemistry 283, 27565-27574.

Oh, K.J., Han, H.S., Kim, M.J., Koo, S.H., 2013. CREB and FoxO1: two
transcription factors for the regulation of hepatic gluconeogenesis. BMB
reports 46, 567-574.

Ohlstein, J.F., Strong, A.L., McLachlan, J.A., Gimble, J.M., Burow, M.E., Bunnell,
B.A., 2014. Bisphenol A enhances adipogenic differentiation of human
adipose stromal/stem cells. Journal of molecular endocrinology 53, 345-
353.

Okey, A.B., 2007. An aryl hydrocarbon receptor odyssey to the shores of

toxicology: the Deichmann Lecture, International Congress of Toxicology-
XI. Toxicol.Sci. 98, 5.

Olswang, Y., Cohen, H., Papo, O., Cassuto, H., Croniger, C.M., Hakimi, P.,
Tilghman, S.M., Hanson, R.W., Reshef, L., 2002. A mutation in the
peroxisome proliferator-activated receptor gamma-binding site in the gene
for the cytosolic form of phosphoenolpyruvate carboxykinase reduces
adipose tissue size and fat content in mice. Proc Natl Acad Sci U S A 99,
625-630.

Ovando, B.J., Ellison, C.A., Vezina, C.M., Olson, J.R., 2010. Toxicogenomic
analysis of exposure to TCDD, PCB126 and PCB153: identification of
genomic biomarkers of exposure to AhR ligands. BMC genomics 11, 583.

Owen, O.E., Kalhan, S.C., Hanson, R.W., 2002. The key role of anaplerosis and
cataplerosis for citric acid cycle function. J Biol Chem 277, 30409-30412.

Patel, R.D., Murray, I.A., Flaveny, C.A., Kusnadi, A., Perdew, G.H., 2009. Ah
receptor represses acute-phase response gene expression without
binding to its cognate response element. Laboratory investigation; a
journal of technical methods and pathology 89, 695-707.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-
time RT-PCR. Nucleic Acids Research 29.

Pilkis, S.J., Granner, D.K., 1992. Molecular physiology of the regulation of

hepatic gluconeogenesis and glycolysis. Annu Rev Physiol 54, 885-909.

Pitot, H.C., Peraino, C., Morse, P.A., Jr., Potter, V.R., 1964. Hepatomas in tissue
culture compared with adapting liver in vivo. National Cancer Institute
monograph 13, 229-245.

132
Pohjanvirta, R., Tuomisto, J., 1987. Han/Wistar rats are exceptionally resistant to
TCDD. II. Archives of toxicology. Supplement. = Archiv fur Toxikologie.
Supplement 11, 344-347.

Pohjanvirta, R., Tuomisto, J., Vartiainen, T., Rozman, K., 1987. Han/Wistar rats
are exceptionally resistant to TCDD. I. Pharmacology & toxicology 60,
145-150.

Polyzos, S.A., Kountouras, J., Mantzoros, C.S., 2015. Adipokines in nonalcoholic

fatty liver disease. Metabolism: clinical and experimental.

Pond, S.M., 1982. Effects on the liver of chemicals encountered in the workplace.
The Western journal of medicine 137, 506-514.

Poosch, M.S., Yamazaki, R.K., 1986. Determination of peroxisomal fatty acyl-

CoA oxidase activity using a lauroyl-CoA-based fluorometric assay.
Biochim Biophys Acta 884, 585-593.

Potthoff, M.J., Inagaki, T., Satapati, S., Ding, X., He, T., Goetz, R., Mohammadi,
M., Finck, B.N., Mangelsdorf, D.J., Kliewer, S.A., Burgess, S.C., 2009.
FGF21 induces PGC-1alpha and regulates carbohydrate and fatty acid
metabolism during the adaptive starvation response. Proc Natl Acad Sci U
S A 106, 10853-10858.

Puga, A., Ma, C., Marlowe, J.L., 2009. The aryl hydrocarbon receptor cross-talks
with multiple signal transduction pathways. Biochem.Pharmacol. 77, 713-
722.

Puigserver, P., Rhee, J., Donovan, J., Walkey, C.J., Yoon, J.C., Oriente, F.,
Kitamura, Y., Altomonte, J., Dong, H., Accili, D., Spiegelman, B.M., 2003.
Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1[alpha]
interaction. Nature 423, 550-555.

Puigserver, P., Spiegelman, B.M., 2003. Peroxisome Proliferator-Activated

Receptor-γ Coactivator 1α (PGC-1α): Transcriptional Coactivator and
Metabolic Regulator. Endocrine Reviews 24, 78-90.

Quinn, P.G., Wong, T.W., Magnuson, M.A., Shabb, J.B., Granner, D.K., 1988.
Identification of basal and cyclic AMP regulatory elements in the promoter
of the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 8, 3467-
3475.

Reddy, J.K., Hashimoto, T., 2001. Peroxisomal beta-oxidation and peroxisome

proliferator-activated receptor alpha: an adaptive metabolic system.
Annual review of nutrition 21, 193-230.

133
Regnier, S.M., Sargis, R.M., 2014. Adipocytes under assault: environmental
disruption of adipose physiology. Biochim Biophys Acta 1842, 520-533.

Reshef, L., Olswang, Y., Cassuto, H., Blum, B., Croniger, C.M., Kalhan, S.C.,
Tilghman, S.M., Hanson, R.W., 2003. Glyceroneogenesis and the
Triglyceride/Fatty Acid Cycle. Journal of Biological Chemistry 278, 30413-
30416.

Reynisdottir, S., Angelin, B., Langin, D., Lithell, H., Eriksson, M., Holm, C., Arner,
P., 1997. Adipose Tissue Lipoprotein Lipase and Hormone-Sensitive
Lipase: Contrasting Findings in Familial Combined Hyperlipidemia and
Insulin Resistance Syndrome. Arteriosclerosis, Thrombosis, and Vascular
Biology 17, 2287-2292.

Risebrough, R.W., Rieche, P., Peakall, D.B., Herman, S.G., Kirven, M.N., 1968.
Polychlorinated biphenyls in the global ecosystem. Nature 220, 1098-
1102.

Robertson, L.W., Berberian, I., Borges, T., Chen, L.C., Chow, C.K., Glauert, H.P.,
Filser, J.G., Thomas, H., 2007. Suppression of peroxisomal enzyme
activities and cytochrome P450 4A isozyme expression by congeneric
polybrominated and polychlorinated biphenyls. PPAR research 2007,
15481.

Robertson, L.W., Hansen, L.G., 2001. PCBs : recent advances in environmental

toxicology and health effects. University Press of Kentucky, Lexington, Ky.
:.

Robertson, L.W., Parkinson, A., Bandiera, S., Lambert, I., Merrill, J., Safe, S.H.,
1984. PCBs and PBBs: biologic and toxic effects on C57BL/6J and
DBA/2J inbred mice. Toxicology 31, 191-206.

Rodriguez, A.M., Elabd, C., Delteil, F., Astier, J., Vernochet, C., Saint-Marc, P.,
Guesnet, J., Guezennec, A., Amri, E.Z., Dani, C., Ailhaud, G., 2004.
Adipocyte differentiation of multipotent cells established from human
adipose tissue. Biochem Biophys Res Commun 315, 255-263.

Roos, V., Ronn, M., Salihovic, S., Lind, L., Bavel, B.v., Kullberg, J., Johansson,
L., Ahlstrom, H., Lind, P.M., 2013. Circulating levels of persistent organic
pollutants in relation to visceral and subcutaneous adipose tissue by
abdominal MRI. Obesity (Silver Spring, Md.) 21, 413-418.

Rosen, E.D., Sarraf, P., Troy, A.E., Bradwin, G., Moore, K., Milstone, D.S.,
Spiegelman, B.M., Mortensen, R.M., 1999. PPAR gamma is required for
the differentiation of adipose tissue in vivo and in vitro. Mol Cell 4, 611-
617.

134
Rui, L., 2014. Energy metabolism in the liver. Comprehensive Physiology 4, 177-
197.

Ruzzin, J., 2012. Public health concern behind the exposure to persistent organic
pollutants and the risk of metabolic diseases. BMC public health 12, 298.

Ruzzin, J., Petersen, R., Meugnier, E., Madsen, L., Lock, E.J., Lillefosse, H., Ma,
T., Pesenti, S., Sonne, S.B., Marstrand, T.T., Malde, M.K., Du, Z.Y.,
Chavey, C., Fajas, L., Lundebye, A.K., Brand, C.L., Vidal, H., Kristiansen,
K., Froyland, L., 2010. Persistent organic pollutant exposure leads to
insulin resistance syndrome. Environ Health Perspect 118, 465-471.

Safe, S., 1993. Toxicology, structure-function relationship, and human and

environmental health impacts of polychlorinated biphenyls: progress and
problems. Environmental Health Perspectives 100, 259-268.

Safe, S., 1997. Limitations of the toxic equivalency factor approach for risk
assessment of TCDD and related compounds. Teratogenesis,
carcinogenesis, and mutagenesis 17, 285-304.

Safe, S., Bandiera, S., Sawyer, T., Robertson, L., Safe, L., Parkinson, A.,
Thomas, P.E., Ryan, D.E., Reik, L.M., Levin, W., Denomme, M.A., Fujita,
T., 1985. PCBs: structure–function relationships and mechanism of action.
Environmental Health Perspectives 60, 47-56.

Safe, S., Wang, F., Porter, W., Duan, R., McDougal, A., 1998. Ah receptor
agonists as endocrine disruptors: antiestrogenic activity and mechanisms.
Toxicol Lett 102-103, 343-347.

Safe, S., Wormke, M., 2003. Inhibitory Aryl Hydrocarbon Receptor−Estrogen

Receptor α Cross-Talk and Mechanisms of Action. Chemical Research in
Toxicology 16, 807-816.

Safe, S.H., 1994. Polychlorinated biphenyls (PCBs): environmental impact,

biochemical and toxic responses, and implications for risk assessment.
Crit Rev Toxicol 24, 87-149.

Sargis, R.M., Brady, M.J., 2010. Making fat work. Perspectives in biology and
medicine 53, 630-647.

Sato, S., Shirakawa, H., Tomita, S., Tohkin, M., Gonzalez, F.J., Komai, M., 2013.
The aryl hydrocarbon receptor and glucocorticoid receptor interact to
activate human metallothionein 2A. Toxicol Appl Pharmacol 273, 90-99.

135
Seefeld, M.D., Corbett, S.W., Keesey, R.E., Peterson, R.E., 1984a.
Characterization of the wasting syndrome in rats treated with 2,3,7,8-
tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 73, 311-322.

Seefeld, M.D., Keesey, R.E., Peterson, R.E., 1984b. Body weight regulation in
rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl
Pharmacol 76, 526-536.

Seefeld, M.D., Peterson, R.E., 1984. Digestible energy and efficiency of feed
utilization in rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol
Appl Pharmacol 74, 214-222.

Shaywitz, A.J., Greenberg, M.E., 1999. CREB: A stimulus-induced transcription

factor activated by a diverse array of extracellular signals. Annual review
of biochemistry 68, 821-861.

She, P., Shiota, M., Shelton, K.D., Chalkley, R., Postic, C., Magnuson, M.A.,
2000. Phosphoenolpyruvate Carboxykinase Is Necessary for the
Integration of Hepatic Energy Metabolism. Mol.Cell.Biol. 20, 6508-6517.

Sheehan, D.C., Hrapchak, B.B., 1987. Theory and practice of histotechnology.

Battelle Press, Columbus, Ohio.

Shimba, S., Wada, T., Tezuka, M., 2001. Arylhydrocarbon receptor (AhR) is
involved in negative regulation of adipose differentiation in 3T3-L1 cells:
AhR inhibits adipose differentiation independently of dioxin. Journal of cell
science 114, 2809-2817.

Silberhorn, E.M., Glauert, H.P., Robertson, L.W., 1990. Carcinogenicity of

polyhalogenated biphenyls: PCBs and PBBs. Crit Rev Toxicol 20, 440-
496.

Silkworth, J.B., Carlson, E.A., McCulloch, C., Illouz, K., Goodwin, S., Sutter, T.R.,
2008. Toxicogenomic analysis of gender, chemical, and dose effects in
livers of TCDD- or aroclor 1254-exposed rats using a multifactor linear
model. Toxicol Sci 102, 291-309.

Silverstone, A.E., Rosenbaum, P.F., Weinstock, R.S., Bartell, S.M., Foushee,

H.R., Shelton, C., Pavuk, M., 2012a. Polychlorinated biphenyl (PCB)
exposure and diabetes: results from the Anniston Community Health
Survey. Environ Health Perspect 120, 727-732.

Somm, E., Schwitzgebel, V.M., Toulotte, A., Cederroth, C.R., Combescure, C.,
Nef, S., Aubert, M.L., Huppi, P.S., 2009. Perinatal exposure to bisphenol a
alters early adipogenesis in the rat. Environ Health Perspect 117, 1549-
1555.

136
Spalding, K.L., Arner, E., Westermark, P.O., Bernard, S., Buchholz, B.A.,
Bergmann, O., Blomqvist, L., Hoffstedt, J., Naslund, E., Britton, T.,
Concha, H., Hassan, M., Ryden, M., Frisen, J., Arner, P., 2008. Dynamics
of fat cell turnover in humans. Nature 453, 783-787.

Srebocan, V., Pompe-Gotal, J., Brmalj, V., Plazonic, M., 1977. Effect of
polychlorinated biphenyls (Aroclor 1254) on liver gluconeogenic enzyme
activities in embryonic and growing chickens. Poultry science 56, 732-735.

Su, Y., Kanamoto, R., Miller, D.A., Ogawa, H., Pitot, H.C., 1990. Regulation of
the expression of the serine dehydratase gene in the kidney and liver of
the rat. Biochem Biophys Res Commun 170, 892-899.

Swanson, H.I., 2002a. DNA binding and protein interactions of the AHR/ARNT
heterodimer that facilitate gene activation. Chem.Biol.Interact. 141, 63.

Swanson, H.I., 2002b. DNA binding and protein interactions of the AHR/ARNT
heterodimer that facilitate gene activation. Chem Biol Interact 141, 63-76.

Swedenborg, E., Ruegg, J., Makela, S., Pongratz, I., 2009. Endocrine disruptive
chemicals: mechanisms of action and involvement in metabolic disorders.
Journal of molecular endocrinology 43, 1-10.

Tang-Peronard, J.L., Andersen, H.R., Jensen, T.K., Heitmann, B.L., 2011.

Endocrine-disrupting chemicals and obesity development in humans: a
review. Obesity reviews : an official journal of the International Association
for the Study of Obesity 12, 622-636.

Tang, Q.Q., Lane, M.D., 2012. Adipogenesis: from stem cell to adipocyte. Annual
review of biochemistry 81, 715-736.

Tanos, R., Patel, R.D., Murray, I.A., Smith, P.B., Patterson, A.D., Perdew, G.H.,
2012. Aryl hydrocarbon receptor regulates the cholesterol biosynthetic
pathway in a dioxin response element-independent manner. Hepatology
55, 1994-2004.

Taura, D., Noguchi, M., Sone, M., Hosoda, K., Mori, E., Okada, Y., Takahashi,
K., Homma, K., Oyamada, N., Inuzuka, M., Sonoyama, T., Ebihara, K.,
Tamura, N., Itoh, H., Suemori, H., Nakatsuji, N., Okano, H., Yamanaka,
S., Nakao, K., 2009. Adipogenic differentiation of human induced
pluripotent stem cells: comparison with that of human embryonic stem
cells. FEBS Lett 583, 1029-1033.

137
Taxvig, C., Dreisig, K., Boberg, J., Nellemann, C., Schelde, A.B., Pedersen, D.,
Boergesen, M., Mandrup, S., Vinggaard, A.M., 2012. Differential effects of
environmental chemicals and food contaminants on adipogenesis,
biomarker release and PPARgamma activation. Mol Cell Endocrinol 361,
106-115.

Tchkonia, T., Morbeck, D.E., Von Zglinicki, T., Van Deursen, J., Lustgarten, J.,
Scrable, H., Khosla, S., Jensen, M.D., Kirkland, J.L., 2010. Fat tissue,
aging, and cellular senescence. Aging cell 9, 667-684.

Terai, M., Uyama, T., Sugiki, T., Li, X.K., Umezawa, A., Kiyono, T., 2005.
Immortalization of human fetal cells: the life span of umbilical cord blood-
derived cells can be prolonged without manipulating p16INK4a/RB braking
pathway. Molecular biology of the cell 16, 1491-1499.

Thayer, K.A., Heindel, J.J., Bucher, J.R., Gallo, M.A., 2012. Role of
environmental chemicals in diabetes and obesity: a National Toxicology
Program workshop review. Environ Health Perspect 120, 779-789.

Thorens, B., 1996. Glucose transporters in the regulation of intestinal, renal, and
liver glucose fluxes. The American journal of physiology 270, G541-553.

Thorens, B., Mueckler, M., 2010. Glucose transporters in the 21st Century.
American Journal of Physiology - Endocrinology and Metabolism 298,
E141-E145.

Tontonoz, P., Spiegelman, B.M., 2008. Fat and beyond: the diverse biology of
PPARgamma. Annual review of biochemistry 77, 289-312.

Uemura, H., Arisawa, K., Hiyoshi, M., Kitayama, A., Takami, H., Sawachika, F.,
Dakeshita, S., Nii, K., Satoh, H., Sumiyoshi, Y., Morinaga, K., Kodama, K.,
Suzuki, T., Nagai, M., 2009. Prevalence of metabolic syndrome
associated with body burden levels of dioxin and related compounds
among Japan's general population. Environ Health Perspect 117, 568-
573.

Valvi, D., Mendez, M.A., Martinez, D., Grimalt, J.O., Torrent, M., Sunyer, J.,
Vrijheid, M., 2012. Prenatal concentrations of polychlorinated biphenyls,
DDE, and DDT and overweight in children: a prospective birth cohort
study. Environ Health Perspect 120, 451-457.

Van Birgelen, A.P., Van der Kolk, J., Fase, K.M., Bol, I., Poiger, H., Brouwer, A.,
Van den Berg, M., 1994. Toxic potency of 3,3',4,4',5-pentachlorobiphenyl
relative to and in combination with 2,3,7,8-tetrachlorodibenzo-p-dioxin in a
subchronic feeding study in the rat. Toxicol Appl Pharmacol 127, 209-221.

138
Van den Berg, M., Birnbaum, L., Bosveld, A.T., Brunstrom, B., Cook, P., Feeley,
M., Giesy, J.P., Hanberg, A., Hasegawa, R., Kennedy, S.W., Kubiak, T.,
Larsen, J.C., van Leeuwen, F.X., Liem, A.K., Nolt, C., Peterson, R.E.,
Poellinger, L., Safe, S., Schrenk, D., Tillitt, D., Tysklind, M., Younes, M.,
Waern, F., Zacharewski, T., 1998. Toxic equivalency factors (TEFs) for
PCBs, PCDDs, PCDFs for humans and wildlife. Environ Health Perspect
106, 775-792.

Van den Berg, M., Birnbaum, L.S., Denison, M., De Vito, M., Farland, W., Feeley,
M., Fiedler, H., Hakansson, H., Hanberg, A., Haws, L., Rose, M., Safe, S.,
Schrenk, D., Tohyama, C., Tritscher, A., Tuomisto, J., Tysklind, M.,
Walker, N., Peterson, R.E., 2006. The 2005 World Health Organization
reevaluation of human and Mammalian toxic equivalency factors for
dioxins and dioxin-like compounds. Toxicol Sci 93, 223-241.

VanBirgelen, A., DeVito, M.J., Akins, J.M., Ross, D.G., Diliberto, J.J., Birnbaum,
L.S., 1996. Relative potencies of polychlorinated dibenzo-p-dioxins,
dibenzofurans, and biphenyls derived from hepatic porphyrin accumulation
in mice. Toxicology and Applied Pharmacology 138, 98-109.

Vega, R.B., Huss, J.M., Kelly, D.P., 2000. The Coactivator PGC-1 Cooperates
with Peroxisome Proliferator-Activated Receptor α in Transcriptional
Control of Nuclear Genes Encoding Mitochondrial Fatty Acid Oxidation
Enzymes. Mol.Cell.Biol. 20, 1868-1876.

Vezina, C.M., Walker, N.J., Olson, J.R., 2004. Subchronic exposure to TCDD,
PeCDF, PCB126, and PCB153: effect on hepatic gene expression.
Environ Health Perspect 112, 1636-1644.

Vijayan, M.M., Aluru, N., Maule, A.G., Jorgensen, E.H., 2006. Fasting augments
PCB impact on liver metabolism in anadromous arctic char. Toxicol Sci
91, 431-439.

Viluksela, M., Stahl, B.U., Birnbaum, L.S., Rozman, K.K., 1997.

Subchronic/chronic toxicity of 1,2,3,4,6,7,8-heptachlorodibenzo-p-dioxin
(HpCDD) in rats. Part II. Biochemical effects. Toxicol Appl Pharmacol 146,
217-226.

Viluksela, M., Stahl, B.U., Birnbaum, L.S., Rozman, K.K., 1998.

Subchronic/chronic toxicity of a mixture of four chlorinated dibenzo-p-
dioxins in rats. II. Biochemical effects. Toxicol Appl Pharmacol 151, 70-78.

Viluksela, M., Stahl, B.U., Rozman, K.K., 1995. Tissue-specific effects of 2,3,7,8-
Tetrachlorodibenzo-p-dioxin (TCDD) on the activity of
phosphoenolpyruvate carboxykinase (PEPCK) in rats. Toxicol Appl
Pharmacol 135, 308-315.
139
Viluksela, M., Unkila, M., Pohjanvirta, R., Tuomisto, J.T., Stahl, B.U., Rozman,
K.K., Tuomisto, J., 1999. Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin
(TCDD) on liver phosphoenolpyruvate carboxykinase (PEPCK) activity,
glucose homeostasis and plasma amino acid concentrations in the most
TCDD-susceptible and the most TCDD-resistant rat strains. Arch Toxicol
73, 323-336.

Wahlang, B., Beier, J.I., Clair, H.B., Bellis-Jones, H.J., Falkner, K.C., McClain,
C.J., Cave, M.C., 2013a. Toxicant-associated steatohepatitis. Toxicologic
pathology 41, 343-360.

Wahlang, B., Falkner, K.C., Gregory, B., Ansert, D., Young, D., Conklin, D.J.,
Bhatnagar, A., McClain, C.J., Cave, M., 2013b. Polychlorinated biphenyl
153 is a diet-dependent obesogen that worsens nonalcoholic fatty liver
disease in male C57BL6/J mice. The Journal of nutritional biochemistry
24, 1587-1595.

Walker, N.J., Crockett, P.W., Nyska, A., Brix, A.E., Jokinen, M.P., Sells, D.M.,
Hailey, J.R., Easterling, M., Haseman, J.K., Yin, M., Wyde, M.E., Bucher,
J.R., Portier, C.J., 2005. Dose-additive carcinogenicity of a defined
mixture of "dioxin-like compounds". Environmental Health Perspectives
113, 43-48.

Wang, C., Xu, C.X., Krager, S.L., Bottum, K.M., Liao, D.F., Tischkau, S.A., 2011.
Aryl hydrocarbon receptor deficiency enhances insulin sensitivity and
reduces PPAR-alpha pathway activity in mice. Environ Health Perspect
119, 1739-1744.

Ward, E.M., Schulte, P.A., Straif, K., Hopf, N.B., Caldwell, J.C., Carreon, T.,
DeMarini, D.M., Fowler, B.A., Goldstein, B.D., Hemminki, K., Hines, C.J.,
Pursiainen, K.H., Kuempel, E., Lewtas, J., Lunn, R.M., Lynge, E.,
McElvenny, D.M., Muhle, H., Nakajima, T., Robertson, L.W., Rothman, N.,
Ruder, A.M., Schubauer-Berigan, M.K., Siemiatycki, J., Silverman, D.,
Smith, M.T., Sorahan, T., Steenland, K., Stevens, R.G., Vineis, P., Zahm,
S.H., Zeise, L., Cogliano, V.J., 2010. Research recommendations for
selected IARC-classified agents. Environ Health Perspect 118, 1355-
1362.

Weber, L.W., Lebofsky, M., Stahl, B.U., Gorski, J.R., Muzi, G., Rozman, K.,
1991. Reduced activities of key enzymes of gluconeogenesis as possible
cause of acute toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in
rats. Toxicology 66, 133-144.

140
Weber, L.W., Lebofsky, M., Stahl, B.U., Smith, S., Rozman, K.K., 1995.
Correlation between toxicity and effects on intermediary metabolism in
2,3,7,8-tetrachlorodibenzo-p-dioxin-treated male C57BL/6J and DBA/2J
mice. Toxicol Appl Pharmacol 131, 155-162.

Whitlock, J.P., Jr., 1989. The control of cytochrome P-450 gene expression by
dioxin. Trends in pharmacological sciences 10, 285-288.

Xu, A., Wang, Y., Keshaw, H., Xu, L.Y., Lam, K.S., Cooper, G.J., 2003. The fat-
derived hormone adiponectin alleviates alcoholic and nonalcoholic fatty
liver diseases in mice. J Clin Invest 112, 91-100.

Xu, J., Xiao, G., Trujillo, C., Chang, V., Blanco, L., Joseph, S.B., Bassilian, S.,
Saad, M.F., Tontonoz, P., Lee, W.N.P., Kurland, I.J., 2002. Peroxisome
Proliferator-activated Receptor α (PPARα) Influences Substrate Utilization
for Hepatic Glucose Production. Journal of Biological Chemistry 277,
50237-50244.

Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., Yamashita,
S., Noda, M., Kita, S., Ueki, K., Eto, K., Akanuma, Y., Froguel, P.,
Foufelle, F., Ferre, P., Carling, D., Kimura, S., Nagai, R., Kahn, B.B.,
Kadowaki, T., 2002. Adiponectin stimulates glucose utilization and fatty-
acid oxidation by activating AMP-activated protein kinase. Nat Med 8,
1288-1295.

Yang, J., Kalhan, S.C., Hanson, R.W., 2009a. What is the metabolic role of
phosphoenolpyruvate carboxykinase? J Biol Chem 284, 27025-27029.

Yang, J., Reshef, L., Cassuto, H., Aleman, G., Hanson, R.W., 2009b. Aspects of
the Control of Phosphoenolpyruvate Carboxykinase Gene Transcription.
Journal of Biological Chemistry 284, 27031-27035.

Ye, R., Scherer, P.E., 2013. Adiponectin, driver or passenger on the road to
insulin sensitivity? Molecular metabolism 2, 133-141.

Yoon, J.C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant,
G., Stafford, J., Kahn, C.R., Granner, D.K., Newgard, C.B., Spiegelman,
B.M., 2001. Control of hepatic gluconeogenesis through the transcriptional
coactivator PGC-1. Nature 413, 131-138.

Yu, M.L., Guo, Y.L.L., Hsu, C.C., Rogan, W.J., 1997. Increased mortality from
chronic liver disease and cirrhosis 13 years after the Taiwan ''yucheng''
(''oil disease'') incident. Am. J. Ind. Med. 31, 172-175.

141
Zannikos, P.N., Bandyopadhyay, A.M., Robertson, L.W., Blouin, R.A., 1994.
Cytochrome P450 2B enzyme induction defect after 2,2',4,4',5,5'-
hexachlorobiphenyl treatment in the fa/fa Zucker rat. The Journal of
pharmacology and experimental therapeutics 268, 1565-1570.

Zeiger, M., Haag, R., Höckel, J., Schrenk, D., Schmitz, H.-J., 2001. Inducing
Effects of Dioxin-like Polychlorinated Biphenyls on CYP1A in the Human
Hepatoblastoma Cell Line HepG2, the Rat Hepatoma Cell Line H4IIE, and
Rat Primary Hepatocytes: Comparison of Relative Potencies.
Toxicological Sciences 63, 65-73.

Zhang, W., Sargis, R.M., Volden, P.A., Carmean, C.M., Sun, X.J., Brady, M.J.,
2012. PCB 126 and other dioxin-like PCBs specifically suppress hepatic
PEPCK expression via the aryl hydrocarbon receptor. PLoS One 7,
e37103.

Zhang, X., Soda, Y., Takahashi, K., Bai, Y., Mitsuru, A., Igura, K., Satoh, H.,
Yamaguchi, S., Tani, K., Tojo, A., Takahashi, T.A., 2006. Successful
immortalization of mesenchymal progenitor cells derived from human
placenta and the differentiation abilities of immortalized cells. Biochem
Biophys Res Commun 351, 853-859.

142