Eur J Plant Pathol (2012) 133:141–157

DOI 10.1007/s10658-011-9925-9

Cellular and molecular analyses of coffee resistance

to Hemileia vastatrix and nonhost resistance to Uromyces
vignae in the resistance-donor genotype HDT832/2
Inês Diniz & Pedro Talhinhas &
Helena Gil Azinheira & Vítor Várzea &
Clara Medeira & Isabel Maia &
Anne-Sophie Petitot & Michel Nicole &
Diana Fernandez & Maria do Céu Silva

Accepted: 12 December 2011 / Published online: 27 December 2011

# KNPV 2011

Abstract In Arabica coffee breeding, some of the most
used sources of resistance to leaf rust (Hemileia vast-
atrix) are natural Coffea arabica x canephora hybrids
(“Híbrido de Timor”). To decipher the cellular and mo-
lecular nature of that resistance, leaves of genotype
HDT832/2, were challenged with H. vastatrix race II,
and monitored using light microscopy and RT-qPCR
expression analysis of genes involved in plant immunity
mechanisms (receptor-like kinase, WRKY transcription
factor 1, phenylalanine ammonia-lyase, chalcone syn-
thase, 13-lipoxygenase, glycosyltransferase, pathogen-
esis related PR1b and PR10). These were compared to
I. Diniz : P. Talhinhas (*) : H. G. Azinheira : V. Várzea :
M. do Céu Silva
Centro de Investigação das Ferrugens do Cafeeiro, Instituto
de Investigação Científica Tropical,
Quinta do Marquês,
2784-505 Oeiras, Portugal
e-mail: ptalhinhas@iict.pt
C. Medeira : I. Maia
Instituto Nacional de Recursos Biológicos,
Avenida da República, Nova Oeiras,
2784-505 Oeiras, Portugal
A.-S. Petitot : M. Nicole : D. Fernandez
UMR 186 IRD/CIRAD‐UM2 Résistance des Plantes aux
Bioagresseurs, Institut de Recherche pour le
Développement,
911, avenue Agropolis, BP64501,
34394 Montpellier cedex 5, France
the nonhost resistance responses of HDT832/2 to the
infection by the cowpea rust fungus (Uromyces vignae).
H. vastatrix ceased growth more frequently after stoma-
ta penetration, forming few haustoria, inducing a
hypersensitive-like response, phenol accumulation and
haustorium encasement with callose. U. vignae could
enter stomata but failed to form haustoria, while induc-
ing hypersensitive-like responses and phenol accumula-
tion. In host and nonhost interactions, activation of
genes involved in signalling coincided with the differ-
entiation of appressoria, and cellular responses (hyper-
sensitive-like responses and accumulation of phenolic
compounds) were recorded from the full appressorium
or penetration hypha stages onwards. Similarly, a gene
related to the JA pathway was first activated at the
penetration hypha stage for both interactions, while
genes related to the SA pathway were only activated in
the host interaction, the latter being the single clear
difference between host and nonhost interactions. The
cellular and molecular resistance responses of HDT832/
2 to these rust fungi suggest that common immunity
components are shared between host and nonhost resis-
tance, which may explain the longer durability of this
resistance.
Keywords Basal immunity . Coffea arabica . Coffea
canephora . Coffee leaf rust . Defence gene expression .
Hypersensitive response
142 Eur J Plant Pathol (2012) 133:141–157

Abbreviations A major breakthrough on the Coffee Rusts Re-

An Anchor search Center (CIFC) plant breeding programme for
Ap Appressorium obtaining resistant varieties was the discovery, in the
bp base pair late 1950s, of “Híbrido de Timor” (HDT) genotypes,
CHS Chalcone Synthase most of them offering resistance to all known rust
CIFC Coffee Rusts Research races. HDTs are natural hybrids between C. arabica
Center/Tropical Research Institute and C. canephora Pierre, and received from the latter
ETI Effector-Triggered Immunity the genes responsible for resistance to several rust
GAPDH Glyceraldehyde 3-Phosphate races (SH6, SH7, SH8, SH9 and others not yet identi-
Dehydrogenase fied). HDT-derived varieties, that join the resistance of
GT Glycosyltransferase HDT and the good agronomic traits of commercial
hai hours after inoculation varieties, like Catimor (Caturra x HDT832/1), Colombia
HDT Timor Hybrid (Híbrido de Timor) (Caturra x HDT1343) and Sarchimor (Villa Sarchi x
HMC Haustorial Mother Cell HDT832/2), have replaced the traditional susceptible
HR Hypersensitive Response cultivars in many coffee growing countries (Bettencourt
IH Infection hypha and Rodrigues 1988; Rodrigues et al. 1975). However,
JA Jasmonic Acid in some areas in China, India, Philippines, Thailand,
LOX Lipoxygenase Vietnam, Papua New Guinea, Brazil and Colombia,
PAL L- phenylalanine Ammonia-Lyase there were recent reports on the breakdown of
PAMP Pathogen-Associated Molecular resistance of some HDT-derived genotypes after
Patterns 30-40 years of cultivation, especially in Catimors
PH penetration hypha derived from HDT832/1 and HDT1343, due to the
PR Pathogenesis-Related appearance of new rust races (Prakash et al. 2010;
PTI PAMP-Triggered Immunity Várzea and Marques 2005). Recently Prakash et
R resistance gene/protein al. (2010) reported the breakdown of HDT832/1
RLK Receptor-Like Kinase and HDT832/2 resistance in an Indian germplasm
RT-qPCR Reverse Transcription-quantitative bank, although the clone HDT832/2 (as well as
Polymerase Chain Reaction some plants of Sarchimor, designated by Chandragiri
SA Salicylic Acid in India) presented a very low level of disease severity in
SV substomatal vesicle the field as compared to the clone HDT832/1 (Prakash,
u.v. ultra-violet light personal communication). These new Indian rust races
are now being characterised at CIFC (under greenhouse
conditions) and similar results are being obtained, with
unstable reaction types observed in HDT832/2, ranging
Introduction from complete resistance to intermediate interactions.
Still, in countries like Brazil and Costa Rica HDT832/2
Leaf rust, caused by the biotrophic fungus Hemileia was used extensively in many breeding programmes
vastatrix Berk. and Br., is considered the main disease and both the released varieties and the original
of Arabica coffee (Coffea arabica L.), and may cause up HDT832/2 remain resistant to local rust races. This
to 40% losses if no control measures are implemented evidence suggest that the resistance in HDT832/2 may
(Silva et al. 2006). Coffee—rust interactions are gov- be more durable than in other HDT genotypes, raising
erned by the gene-for-gene relationship and the resis- the need to better characterise the resistance of this
tance of coffee plants is conditioned at least by nine particular coffee genotype.
major dominant genes (SH1—SH9) singly or associated To escape from potential pathogens, plants have
(Bettencourt and Rodrigues 1988; Rodrigues et al. evolved various constitutive and induced defence
1975), although other major and minor genes may also mechanisms leading to basal innate immunity. Non-
be involved (Bettencourt and Rodrigues 1988; Várzea host resistance (i.e., the resistance shown by an entire
and Marques 2005). The use of resistant cultivars has plant species to all genetic variants of a pathogen
been the most efficacious strategy to control this disease. species) is the most common and durable form of plant
Eur J Plant Pathol (2012) 133:141–157
immunity (Heath 2000; Niks and Rubiales 2002).
Nonhost resistance results from preformed physical
and chemical barriers, and from responses induced
by pathogen-associated molecular patterns (PAMPs)
(Jones and Dangl 2006; Lipka et al. 2008). PAMP-
triggered immunity (PTI) is largely race non-specific
and so may be more durable. This contrasts with
R-gene mediated resistance which induces a rapid
hypersensitive response (HR) after detection of elic-
itors that are unique to specific strains of the pathogen
(Christopher-Kozjan and Heath 2003). R-gene medi-
ated resistance can break down if the pathogen loses or
mutates the elicitor gene, and so is likely to be less
durable. Nevertheless, HR may also be associated to
nonhost resistance in some interactions (Azinheira et
al. 2010; Mellersh and Heath 2003). Both PAMP-
induced responses and R gene-controlled responses
can include activation of mitogen-activated protein
kinase signalling cascades, production of phytohor-
mones and anti-microbial compounds (e.g. reactive ox-
ygen species), transcriptional induction of pathogenesis-
related (PR) genes and callose deposition (Loehrer et al.
2008; Zipfel and Robatzek 2010).
Cytological studies comparing host and nonhost
resistance to haustorium-forming specialised pathogens,
such as rust fungi, showed that R gene-controlled host
resistance is almost invariably expressed after the
formation of the first haustorium, often in the form of
HR of the invaded cell, and prehaustorial signs are rare
(Mellersh and Heath 2003). In contrast, nonhost resis-
tance is typically expressed before haustorium forma-
tion (prehaustorial or penetration resistance) (Azinheira
et al. 2010; Mellersh and Heath 2003; Niks and Rubiales
2002 and references therein). In host interactions,
prehaustorial resistance can also be identified playing
a major role in the so-called partial resistance (Parlevliet
1983), which may be more durable than resistance
controlled by R genes (Niks and Rubiales 2002; Zang
et al. 1994).
The initiation of the uredial stage of H. vastatrix on
coffee leaves involves specific events including ap-
pressorium formation over stomata and penetration
of the substomatal cavity by a penetration hypha
which develops two thick lateral branches resembling
an anchor. Each lateral branch of the anchor forms a
haustorial mother cell (HMC), and the stomatal sub-
sidiary cells are the first plant cells invaded by haus-
toria. Further inter- and intracellular colonisation of
mesophyll cells leads to the formation of uredosporic
143
sori, around 20 days after infection (Rodrigues et al.
1975; Silva et al. 1999). On the other side, in a number
of coffee genotypes the resistance to H. vastatrix is
posthaustorial (in that the fungus ceases its growth at
different stages of infection, but more frequently after
the formation of the first haustorium) (Silva et al. 2006
and references therein), although other coffee geno-
types may present prehaustorial resistance (Ganesh et
al. 2006; Silva et al. 2008). Both post- and prehausto-
rial coffee immune responses are associated with HR
(Silva et al. 2006 and references therein, Silva et al.
2008). Several genes with a putative function in im-
mune responses were identified in Coffea spp.-H. vast-
atrix interactions, including receptor kinases, WRKY
transcription factors, glucosyltransferases, lipoxyge-
nases and PRs (Fernandez et al. 2004; Guzzo et al.
2009; Ramiro et al. 2009, 2010).
This study aims to better understand the cellular
and molecular nature of the long-lasting resistance to
H. vastatrix of the coffee genotype HDT 832/2. For
such, light microscopy and Reverse Transcription-
quantitative Polymerase Chain Reaction (RT-qPCR)
expression studies were conducted to characterise this
host interaction using the nonhost interaction of coffee
with the cowpea rust fungus (Uromyces vignae) as a
comparative model. For expression studies, eight
genes were chosen due to their likely involvement in
recognition, signalling or defence. The CaRLK gene is
predicted to encode a receptor-like kinase (Fernandez
et al. 2004), some members of this class of proteins
being involved in resistance signalling pathways
(Morris and Walker 2003). The CaGT gene is pre-
dicted to encode a salicylic acid (SA)—glucosyl trans-
ferase (Ramiro et al. 2009), enzymes referred as key
factors in activating the defence mechanisms depend-
ing on SA levels (Horvath and Chua 1996; Umemura
et al. 2009). The CaWRKY1 gene showed regulation in
response to biotic and abiotic treatments (Petitot et al.
2008) and putatively encodes a WRKY protein, a
member of the zinc finger-type transcription factors
involved in the regulation of plant defence responses
(Eulgem and Somssich 2007; Ramiro et al. 2010).
The gene CaLOX13 is predicted to encode a 13-
lipoxygenase, a key enzyme in the biosynthesis
of the hormone jasmonic acid (JA), involved in resis-
tance signalling pathways (Wasternack 2007). The
genes PR1b and PR10 may encode PR proteins
and were chosen based on their specific expression
in several plant-pathogen interactions. The protein
144
PR1b is highly responsive to pathogen attack, wound-
ing, and SA (Thomma et al. 2001) while the protein
PR10 seems to be related with the JA-dependent re-
sistance pathway (van Loon et al. 2006) and accumu-
lates in host cells in incompatible interactions (Soh et
al. 2012). The phenylalanine ammonia lyase (PAL)
and chalcone synthase (CHS) genes putatively encode
enzymes belonging to the phenylpropanoid pathway
(Zabala et al. 2006) which is involved in the biosyn-
thesis of secondary metabolites with anti-microbial
activity, including lignin, phytoalexines, isoflavo-
noides and phenolics.
Material and methods
Coffee plants and rusts
Clones of HDT832/2 (about 7-years old and 1.5 m
tall), bearing the resistance genes to H. vastatrix
SH5,6,7,8,9 and other unidentified genes (Bettencourt
and Rodrigues 1988), were used for each assay in host
(coffee—H. vastatrix) and nonhost (coffee—U.
vignae) interactions. The coffee plants were main-
tained in greenhouse conditions at temperatures be-
tween 15 and 30°C (average minimum and maximum
temperatures, respectively).
Young (10- to 12-day old), fully expanded leaves of
the terminal node were inoculated with fresh uredo-
spores of H. vastatrix isolate 1065 (race II, virulence
gene v5 - the most common race throughout the world—
Bettencourt and Rodrigues 1988; Rodrigues et al. 1975;
and CIFC records) and of U. vignae isolate CPR-1 (race
1). Following a routine procedure used at CIFC, H.
vastatrix uredospores (1 mg per pair of leaves) were
placed with a scalpel on the lower surface of the leaf and
then brushed gently with a camel-hair brush (D’Oliveira
1954-57). U. vignae uredospores were washed with
0.01% (v/v) Tween 20 for 30 s at room temperature
(24°C) to remove self-inhibitors of germination, and
then rinsed several times with sterile distilled water, as
previously described (Mellersh and Heath 2003). U.
vignae was then inoculated by brushing 1 mg of uredo-
spores per pair of leaves. The inoculated leaves were
sprayed with distilled water and the plants were placed
for 24 h under darkness in moist chambers, after which
they were removed to greenhouse benches (D’Oliveira
1954-57). Mock-inoculated leaves were used as
controls.
Eur J Plant Pathol (2012) 133:141–157
Evaluation of Reaction types:
The evaluation of reaction types was done accord-
ing the following qualitative scale (Bettencourt and
Rodrigues 1988; D’Oliveira 1954-57):
i immune (no visible symptoms)
; necrotic spots, visible macroscopically at the
penetration site or dispersed over the infected
area
flt small chlorotic flecks associated with punctiform
tumefactions, at the penetration sites
0 chlorotic spots, more or less intense, in the
infected area, sometimes associated with small
necrotic areas, but without spore production
1 rare sporulating sori, always very small,
sometimes only visible with a pocket-lens, in
areas which are mainly chlorotic, sometimes as-
sociated with necrosis
2 small or medium-sized pustules, diffused but
visible macroscopically, in areas with intense
chlorosis
3 Medium-sized or large pustules, surrounded by
chlorosis
4 Large sporulating pustules, without true
hypersensitivity, but sometimes surrounded by a
slight chlorotic halo (highly susceptible or
compatible)
X Heterogeneous reaction with uredosporic
pustules very variable in size associated with
resistant reaction types.
The coffee-rust interactions most frequently found
at CIFC are the flt and the type 4, usually designated
resistant and susceptible, respectively. The reactions
types i, flt and 0 correspond to expressions of com-
plete resistance. The reaction types 1 and 2 are con-
sidered as moderately resistant and moderately
susceptible respectively, and the reaction types 3 and
4 are considered susceptible.
Light microscopy
Germination of uredospores and formation of appres-
soria were evaluated on leaf slices (1 cm2) 2–24 h after
inoculation (hai) with H. vastatrix and 2–10 hai with
U. vignae according to Silva et al (1999). The lower
surface of leaf slices was painted with transparent nail
polish and, about 24 h later, the nail polish (leaf
replica) was removed with tweezers, stained and
mounted in cotton blue lactophenol. Counts of the
Eur J Plant Pathol (2012) 133:141–157
germinated uredospores and appressoria formed on
stomata were made on a minimum of six microscope
fields of 100 uredospores each per experiment.
Cross sections of infected leaf fragments made with
a freezing microtome were stained and mounted in
cotton blue lactophenol to evaluate fungal post-
penetration stages (Silva et al. 1999). Hyphal length
inside leaf tissues was estimated using a micrometric
eyepiece. Data were recorded from 60 infection sites
per experiment 2, 4, 6, 8, 10, 12, 17, 24, 48, 72, 96 hai.
To detect autofluorescent cells, cross sections of
infected leaf fragments were placed in 0.07 M pH
8.9 phosphate solution (K2HPO4) for 5 min, and
mounted in the same solution (Silva et al. 2002).
Autofluorescence under blue light epifluorescence is
thought to indicate the presence of phenolic-like com-
pounds and cytoplasmic autofluorescence and/or
browning is frequently associated with plant cell death
(Bennett et al. 1996; Heath 1998). Autofluorescence
can also be used as an indicator of fungal death (Heath
1984).
To detect callose deposition, cross sections of
infected leaf fragments were placed in 0.07 M pH
8.9 phosphate solution (K2HPO4) for 10 min, and then
transferred into a 0.01% solution of aniline blue in the
phosphate solution, for 10 min, before being mounted
in the same solution (Silva et al. 2002). Callose depo-
sition was identified by bright yellow fluorescence
(Eschrich and Currier 1964).
Observations were made using light microscopes
(Leitz Dialux 20 and Leica DM-2500) equipped with
mercury bulbs HB 100 W, ultra-violet light (excitation
filter BP 340–380; barrier filter LP 430) and blue light
(excitation filter BP 450–490; barrier filter LP 515).
Data concerning fungal growth and plant responses
were presented as the combined values of at least two
experiments when no significant differences were
found between them. Arcsine-transformed percentages
and Student test were used for statistical analyses.
Real time quantitative PCR assay of gene expression
According to the results of light microscope observa-
tions, samples were obtained at 3, 6, 9 and 12 hai for
the nonhost interaction and at 6, 9, 12, 18, 21 and 24
hai for the host interaction. Two independent experi-
ments were conducted and two pairs of leaves were
sampled at each collection time point.
145
Total RNA was extracted from frozen plant samples
using the RNeasy Plant Mini kit (Qiagen, Germany),
with addition of an in-solution DNase I digestion,
according to Appendix E of the RNeasy Plant Mini
kit manual. Only RNA samples with 260 nm: 280 nm
wavelength ratio betwe en 1. 9 a nd 2.1 a nd
260 nm:230 nm wavelength ratio greater than 2.0
before and after DNase I digestion, were used for
cDNA synthesis. The quality of RNA samples was
also assessed by electrophoresis on 1.2% agarose gels.
RNA quantity was determined by means of UV-VIS-
spectrophotometry (Lambda EZ201, Perkin-Elmer,
USA). A control qPCR was run on extracted RNA
samples to check for the absence of genomic DNA
with CaGAPDH gene primers (Table 1). First-strand
cDNAs were synthesised from 1 μg of total RNA in
20 μl final volume, using Omniscript RT kit (Qiagen)
and oligo(dT)18 primer (MBI Fermentas, Lithuania)
following the manufacturer’s instructions. For each
sample, cDNAs were diluted to a final volume of
500 μl and stored at −20°C.
RT-qPCR primers previously designed (Barsalobres-
Cavallari et al. 2009; Petitot et al. 2008; Ramiro et al.
2009, 2010) for the genes of interest (CaRLK,
CaWRKY1, CaPAL, CaCHS, CaLOX13, CaGT,
CaPR1b and CaPR10) and for the reference genes
(CaGAPDH and CaUbiquitin), listed in Table 1, were
synthesised by Stabvida (Caparica, Portugal). Efficien-
cies varied from 90% to 110% for all primer pairs tested
(data not shown).
The RT-qPCRs were performed using an iQ5 real-
time thermalcycler (Bio-Rad, USA), using EvaGreen
Supermix (BioRad). Each 15 μl reaction comprised
6 μl template, 7.5 μl EvaGreen Supermix, 0.4 μl of
each primer (10 μM) and 0.7 μl of sterile distilled
water. The reactions were subjected to an initial dena-
turation step at 95°C during 10 min, followed by 45
cycles at 95°C for 15 s, 60°C for 30 s. A melting curve
analysis was performed at the end of the PCR run over
the range 60–95°C, increasing the temperature in a
stepwise fashion by 0.5°C every 10 s. Each PCR
reaction was performed in duplicate and the specificity
of the amplicons was checked by melting curve anal-
ysis and by 3% agarose gel electrophoresis. The ex-
pression stability of the two candidate reference genes
(CaGAPDH and CaUbiquitin) across biological sam-
ples was evaluated using geNorm version 3.4 (Micro-
soft Excel VSA applet; http://medgen.ugent.be/
~jvdesomp/genorm). Gene expression quantification
146 Eur J Plant Pathol (2012) 133:141–157

Table 1 Primer sequence of coffee genes used in temporal gene expression analysis by reverse transcription quantitative PCR

Gene Primer sequence Accession no. Amplicon References

(forward and reverse) length (bp)

CaRLK ATGGGAGAAAAGAATGGCAGAAG CF589181 189 Ramiro et al. (2009)

GGCCAATTACAGTTTGAAAACACC
CaWRKY1 TGCAACAAGGACAGCACCAG CO773974 64 Petitot et al. (2008)
CGTGATCGCGGCCGT
CaPAL GCAGGTCCTACTCATTATACAAGC DQ067599; JF838179 294 Fernandez et al. (unpublished)
CCATTCCACTCTTTCAAACAATCC
CaCHS GTTACAGCAGCCCAAACCAT CF588802 157 Fernandez et al. (2004)
TACCGAGAGGCTCAAATGCT
CaLOX13 GGTCCGCAAGTGTGTGAAC DV704189 186 Ramiro et al. (2010)
GCAAGCCAGATGAGAGTAGTC
CaGT ACTCCAGCAACAACCACCATTA CO773975 240 Ramiro et al. (2009)
GAGACGTCTTGCAAGGTTTTGA
CaPR1 GATTACCTGGACGCCCATAA DQ335594 170 Ramiro et al. (2009)
GCTGCCAGGTTTTCTCCATA
CaPR10 GCCACCATCCTTGAAGAGAA CF589103 151 Ramiro et al. (2009)
CAACTCTCTGCTTGGCAGTCT
CaGAPDH TTGAAGGGCGGTGCAAA SGN-U619744 59 Barsalobres-Cavallari et al. (2009)
AACTAGGGTGCATCCTTGCT
CaUbiquitin AACATTGAGGGTGGTTCTGTTC AF297089 79 Ramiro et al. (2009)
GCAGAAAACCAACTAAGACCTAACAA

was performed using the comparative Ct method
(Livak and Schmittgen 2001).
Results
Macro- and microscopic analysis of host and nonhost
interactions
According to the qualitative scale of reaction types
previously described, in HDT832/2 coffee leaves the
reactions flt (chlorotic flecks associated with tumefac-
tions) and i (immune) were observed from two weeks
after challenge with H. vastatrix and U. vignae, respec-
tively (Figs. 1a, b).
For H. vastatrix and U. vignae, uredospore germi-
nation and appressorium formation on coffee leaves
were initiated at 2 and 4 hai, respectively (Fig. 2a, b).
The germination of H. vastatrix uredospores (Fig. 2a)
ceased by 8 hai [the mean values observed between
8 hai (86%) and 24 hai (89%) did not differ signifi-
cantly] and the same happened with appressoria dif-
ferentiation at 12 hai (48% and 51% at 12 and 24 hai,
respectively). In the case of U. vignae (Fig. 2b), the
uredospore germination and the appressoria formation
ceased at 6 hai (43%) and 8 hai (40%), respectively.
Thus, the pre-penetration stages of H. vastatrix
developed more slowly comparatively to U. vignae.
The maximum values observed for uredospore germi-
nation were significantly higher for H. vastatrix (89%)
than for U. vignae (44%), while appressoria differen-
tiation was similar for both fungi (51% and 41% for H.
vastatrix and U. vignae, respectively).
The differentiation of post-penetration infection struc-
tures of both fungi had slight differences (Fig. 3a–f), as
previously described in their respective hosts (Rodrigues
et al. 1975; Silva et al. 1999; Stark-Urnau and Mendgen
1993). A detailed analysis of the differentiation of infec-
tion structures in the host interaction (Fig. 4a) revealed
that, at 4 hai, 97% of H. vastatrix infections sites had full
appressoria over stomata (non-collapsed appressorium
that did not give rise to penetration hyphae yet) and the
differentiation of penetration hyphae only occurred in 3%
of infection sites. The highest percentage of penetration
hyphae occurred at 17 hai (68%). The anchor stage was
first observed at 17 hai, the haustorium mother cell
(HMC) stage at 24 hai, and the haustorium formation
was initiated at 48 hai. H. vastatrix ceased the growth
with higher frequency at the penetration hypha stage
(54%) and haustoria were detected in a low percentage
of infection sites (6%). The mean number of haustoria per
infection site with HMCs ranged from 2 to 3 (in the
stomatal subsidiary cells and in the cells of the first layer
of the spongy parenchyma). The mean values of hyphal
Eur J Plant Pathol (2012) 133:141–157 147
Fig. 1 Reaction types ob-
served: flt—chlorotic flecks
with tumefaction (host in-
teraction) (a); i - immune
(nonhost interaction) (b)

length per infection site did not differ at 72 hai (21.7±
3.8 μm) and 96 hai (27.3±2.7 μm), but were significantly
higher than at previous times.
As observed with H. vastatrix, at 4 hai almost all U.
vignae infection sites (95%) had full appressoria over
stomata and the differentiation of penetration hyphae
was observed only in 5% of the infection sites
(Fig. 4b). At 6 hai, contrary to H. vastatrix, besides
penetration hyphae, U. vignae was able to differentiate
subsequent infection structures (substomatal vesicles
and infection hyphae). HMCs and haustoria were
never observed. As shown in Fig. 4b, U. vignae ceased
its growth with higher frequency in the stages of
appressorium (51%) and substomatal vesicle (33%).
The mean values of hyphal length per infection site
did not differ from 24 hai (23.40±2.26 μm) to 96 hai
(26.5±3.1 μm), but were significantly higher than the
values observed at earlier times. In the coffee leaves,
autofluorescent hyphae of H. vastatrix and U. vignae
(Fig. 3h, j–l) began to be observed from 24 and 12 hai,
respectively, thus confirming that the fungus death
occurred early in the infection process.

Fig. 2 Percentage of germinated uredospores and appressoria formed by Hemileia vastatrix (host interaction) (a) and Uromyces vignae
(nonhost interaction) (b) on stomata of coffee leaves, at different times after inoculation
148 Eur J Plant Pathol (2012) 133:141–157
 Eur J Plant Pathol (2012) 133:141–157
ƒFig. 3 Hemileia vastatrix and Uromyces vignae growth and cel-
lular responses induced in coffee leaf cells: light microscope
observations (a-l); cotton blue lactophenol staining (a-f); epifluor-
escence test (blue light) (g-h,j-l); aniline blue fluorescence test (u.
v. light) (i); infection sites in the host interaction (coffee - H.
vastatrix) (a-c) showing an appressorium (Ap) 24 hai (a), an
anchor (An) 72 hai (b), and haustorial mother cells with haustoria
(arrows) 72 hai (c); infection sites in the nonhost interaction
(coffee - U. vignae) (d-e) with a penetration hypha (PH) 12 hai
(d), a substomatal vesicle (SV) 24 hai (e), and an infection hypha
(IH) 24 hai (f); infection sites in host interaction (coffee - H.
vastatrix) showing autofluorescence of cell walls and cytoplas-
matic contents of the guard and subsidiary cells (arrows) (g-h)
associated with a full (non-collapsed) appressorium over a stoma
24 hai (g) and with an autofluorescent anchor 24 hai (h); hausto-
rium encasement with callose (arrow) in a subsidiary cell 72 hai
(i); infection sites in the nonhost interaction (coffee - U. vignae)
?(j-l) showing autofluorescence of guard cells (arrow) associated
with a penetration hypha 72 hai (j) and autofluorescence of the
guard and subsidiary cells (arrows) associated with a substomatal
vesicle (k) and an infection hypha 72 hai (l). Note the autofluor-
escence of U. vignae post-penetration structures (j,k,l)
The first cytological responses induced by both rust
fungi on coffee leaves were similar, but were detected
earlier in the nonhost (6 hai) than in the host interac-
tion (12 hai) (Tables 2 and 3, Fig. 3g–l). These early
responses were observed in the guard cells only or in
both guard and subsidiary cells and corresponded to
accumulation of phenolic-like compounds (indicated
by autofluorescence in the walls and cytoplasmic con-
tents) and to hypersensitive-like cell death (monitored
by the autofluorescence and/or browning of the cyto-
plasmic contents). These responses were observed at
the infection sites in which H. vastatrix and U. vignae
reached the stages of appressorium or penetration
hypha. In both interactions, during the time course of
infection, autofluorescence in the walls of plant cells
(guard cells only or in both guard and subsidiary cells)
was detected in a very low percentage of infection
sites (Tables 2 and 3). On the contrary, a progressively
higher percentage of infection sites exhibited plant cell
death (Tables 2 and 3, Fig. 3g–l). In the host interac-
tion, at 24 hai, death of stomatal cells (guard and
subsidiary cells) was observed in 50% of the infection
sites, and at 72 and 96 hai, death of mesophyll cells
invaded by haustoria was also observed, but only in
5% of infection sites. In the nonhost interaction, at 24
hai, death of stomatal cells (guard and subsidiary cells)
occurred in 65% of infection sites. Death of stomatal
and mesophyll cells was observed, from 48 to 96 hai,
but only in 2% of infection sites in which the fungus
stopped its growth in the stage of infection hypha.
149
Another host response detected in the host interaction
from 48 hai was the haustoria encasement with callose
(Table 2; Fig. 3i).
Gene expression profiles
In this work, CaGAPDH and CaUbiquitin were
assessed as reference genes, following previous
use in gene expression studies in coffee plants
(Barsalobres-Cavallari et al. 2009; Cruz et al. 2009).
The analysis of Cq profiles for these two genes shows
stable profiles along time, with none of the genes
being more stable than the other. In fact, geNorm
software showed that the geometric average of Cq
values for these two genes was more stable than any
of them individually (Table 4) for both experiments.
Therefore, this average was used for the normalisation
of the expression of genes of interest.
Gene expression studies by RT-qPCR of eight
genes involved in recognition, signalling and defence
showed that most genes were activated in the host
interaction (Fig. 5). After challenge with H. vastatrix
the coffee genes CaRLK, CaWRKY1, CaPAL,
CaLOX13, CaPR1b, CaPR10 and CaGT presented
two activation peaks, the first in a period when ap-
pressoria differentiation and penetration hypha forma-
tion occurred, and the plant responses at cellular level
begun (6 to 12 hai), and the second when anchors and
haustoria mother cells differentiated and plant
responses were recorded in more than 50% of infec-
tion zones (21–24 hai) (Fig. 4a; Table 2).
In the nonhost interaction (Fig. 5) most genes
were not regulated or were poorly activated in the first
hours after inoculation (3–6 hai) but some genes
(namely CaLOX13 and CaRLK) were moderately
activated in that period. By 9–12 hai, when new
post-penetration fungal infection structures were dif-
ferentiated (Fig. 4b) and plant responses were detected
in over 50% of infection zones (Table 3), all genes
(except CaGT) were activated for the nonhost interac-
tion (Fig. 5).
Discussion
Modern plant breeding programmes include the iden-
tification and optimisation of effective and durable
resistance traits (Loehrer et al. 2008). Although non-
host resistance is of little direct interest for breeders,
150
Fig. 4 Percentage of infection sites with infection structures
differentiated by Hemileia vastatrix (host interaction) (a) and
Uromyces vignae (nonhost interaction) (b), at different times
after inoculation. In the host interaction, mode [the value (the
fungal growth stage) represented by the greatest number of
individuals] corresponded to appressorium at 4, 6, 8, 10 and
the similarity between prehaustorial resistance mech-
anisms in host and nonhost plants is of practical inter-
est for breeding (Niks and Rubiales 2002). Examples
of host prehaustorial resistance include cultivated bar-
ley carrying the gene mlo, which gives a very high level
of protection in commercial fields against powdery
Eur J Plant Pathol (2012) 133:141–157
12 hai and to penetration hypha at 17, 24, 48, 72 and 96 hai. In
the nonhost interaction, the mode corresponded to the appres-
sorium stage in all sampled time-points. For each interaction, in
each bar, the same letter indicates that the weighted averages are
not significantly different according to Fisher’s Least Signifi-
cance Difference Test (P≤ 0.05)
mildew—Blumeria graminis f.sp. graminis (Lyngkjaer
et al. 2000), wheat carrying the major gene Lr34, which
confers resistance against leaf rust - Puccinia triticina
(Rubiales and Niks 1995), and some germplasm acces-
sions of garlic resistant to rust - P. allii (Fernandez-
Aparicio et al. 2011). According to Niks and Rubiales
Eur J Plant Pathol (2012) 133:141–157 151

Table 2 Percentage of infection

sites with cytological responses Time after Autofluorescence and/or browning of the cells Haustorium
induced by Hemileia vastatrix in inoculation (hours) encasement
coffee leaves, at different times Guard (G) G+Subsidiary (S) G+S+
after inoculation Mesophyll

W W+C W W+C W W+C

W0wall; C0cytoplasmic con-
tents. Autofluorescence of cyto- 10 0a 0a 0a 0a 0 0 0
plasmic contents indicated cell 12 8±7ab 5±5ab 0a 2±2a 0 0 0
death
17 4±3ab 17±13bc 1±1a 12±9b 0 0 0
Values represent Mean ± Stan-
dard Deviation 24 13±8b 27±3c 0a 23±8c 0 0 0
In each sub-column, values fol- 48 10±10ab 33±13c 0a 38±10c 0 0 3±3a
lowed by the same letter do not 72 5±5ab 45±12c 0a 40±11c 0 5±3a 5±5a
differ at P≤ 0.05 based on Fisher’s 96 0a 45±15c 0a 45±24c 0 5±5a 6±6a
Least Significance Difference Test

(2002), the evidence so far is that the prehaustorial
resistance, particularly if not associated with HR, is hard
to overcome by the pathogen, and therefore very
valuable.
The present study aimed at elucidating whether the
cellular and molecular mechanisms involved in the
long-lasting resistance of coffee genotype HDT832/2
to H. vastatrix share any similarity with its nonhost
resistance to the non-adapted rust fungus U. vignae.
Previous studies have shown that, while in most host-
rust interactions uredospore germination and appresso-
rium formation are independent of the plant genotype
(Heath 1974; Silva 1996; Silva et al. 2002), nonhost
resistance sometimes involves pre-penetration events,
such as poor location and recognition of nonhost stoma-
ta, and invariably involves restricted growth if the fun-
gus enters the substomatal cavity. In such cases, fungal
growth may be inhibited before the formation of a HMC
or HMC may fail to penetrate a plant cell (Mellersh and
Heath 2003).
In the present study, H. vastatrix presented a higher
percentage of uredospore germination at the surface of
coffee leaves comparatively to U. vignae, and the rate
of appressoria differentiation was similar for both rust
fungi. H. vastatrix ceased its growth with higher fre-
quency in the stage of penetration hypha, contrary to
the post-haustorial resistance that is generally de-
scribed for coffee - H. vastatrix and other host-rust
incompatible interactions (Mellersh and Heath 2003;
Silva et al. 2002, 2006). U. vignae developed faster
than H. vastatrix, stopped its growth more frequently
in the stages of appressoria and substomatal vesicle
and failed to form HMCs. As previously reported
(Madrid et al. 2010; Ramiro et al. 2009), in the present

Table 3 Percentage of infection

sites with cytological responses Time after inoculation (hours) Autofluorescence and/or browning of the cells
induced by Uromyces vignae in
coffee leaves, at different times Guard (G) G+Subsidiary (S) G+S+Mesophyll
after inoculation
W W+C W W+C W W+C

6 5±5a 3±3a 3±3a 7±7a 0 0a

W0wall; C0cytoplasmic con- 8 4±4a 8±8a 3±3a 20±13b 0 0a
tents. Autofluorescence of cyto- 10 4±4a 27±6b 5±4a 35±11b 0 0a
plasmic contents indicated cell 12 3±2a 38±18b 2±2a 42±20b 0 0a
death
17 2±2a 38±15b 2±2a 44±18b 0 0a
Values represent Mean ± Stan-
dard Deviation 24 2±2a 38±13b 0a 45±13b 0 0a
In each sub-column, values fol- 48 0a 42±8b 2±2a 52±10bc 0 2±2a
lowed by the same letter do not 72 0a 33±3b 0a 65±5c 0 2±2a
differ at P≤ 0.05 based on Fisher’s 96 0a 33±14b 0a 68±11c 0 2±2a
Least Significance Difference Test
152
Table 4 Stability of reference genes CaGAPDH, CaUbiquitin
and CaGAPDH+CaUbiquitin, estimated by geNorm
Experiment Gene expression stability value
CaGAPDH CaUbiquitin CaGAPDH+
CaUbiquitin
1 0.490 0.487 0.326
2 0.357 0.348 0.235
study the expression profiles of the coffee genes
CaRLK and CaWRKY1 in both host and nonhost inter-
actions suggested that the recognition of the fungus
and signalling occurred during the formation of ap-
pressoria, with a second peak of activation coinciding
with the differentiation of the first post-penetration
infection structures.
At the cellular level, coffee pre-haustorial resistance
to H. vastatrix and U. vignae was associated with the
hypersensitive-like response, particularly of the sto-
matal cells (guard cells only or guard and subsidiary
cells), monitored by cell autofluorescence, which also
indicated the accumulation of phenolic-like com-
pounds. Cell death was first observed at infection sites
in which H. vastatrix and U. vignae reached the stages
of full appressorium or penetration hypha and was
progressively associated with subsequent pre-
haustorial infection structures. Thus, at these early
stages of infection, it seems that the contact between
any of these rust fungi and the coffee leaves was
sufficient to induce a hypersensitive-like response of
stomatal cells, as noted for other incompatible coffee-
H. vastatrix interactions (Rijo et al. 1982; Silva et al.
2002; 2008) and in nonhost interactions of coffee with
U. vignae and U. appendiculatus (Diniz et al. 2010;
Silva 1996) and Arabidopsis thaliana with H. vastatrix
(Azinheira et al. 2010). In fact, a transcriptomic analysis
conducted on H. vastatrix in vitro germinating spores
and appressoria showed a strong activity of fungal genes
encoding small putatively-secreted proteins, as early as
in the germ tube stage (Talhinhas et al. 2010). We can
speculate that among these proteins may be virulence
effectors, then causing effector triggered immunity
(ETI) prior to haustoria formation. Although this host
resistance was mostly pre-haustorial, a few haustoria
were formed in a low percentage of infection sites
(6%), where death of guard cells and of subsidiary and
mesophyll cells invaded by haustoria was observed from
Eur J Plant Pathol (2012) 133:141–157
72 hai, as described in other incompatible coffee - H.
vastatrix interactions (Silva et al. 2002; 2008), suggesting
the existence of an haustoria-related ETI.
Phytohormones such as JA and SA are recognized
as being involved in disease resistance signalling path-
ways in plants. In this study the gene CaLOX13, a
marker of the JA pathway (Wasternack 2007), was
moderately activated in both interactions, with the first
peak coinciding with the onset of the detection of cell
death (HR). Also, CaLOX13 is the only gene, among
the eight genes studied, with expression levels in the
nonhost interaction as high as in the host interaction.
Genes CaPR1b and CaGT, which are known to be
involved in the SA pathway (Horvath and Chua
1996; Thomma et al. 2001), exhibited high expression
levels in the host interaction, with two peaks of acti-
vation (at 6–12 and 21–24 hai). Interestingly, while
CaGT was much more activated in experiment 2 than
in experiment 1, the opposite could be reported for
CaPR1b. Contrasting with the host interaction, these
two genes were only poorly activated in the nonhost
interaction, which is the single clear difference be-
tween host and nonhost interactions in this study.
Thus, these results suggest that both SA and JA path-
ways may coexist in pre-haustorial coffee resistance to
H. vastatrix, resembling the PTI of Solanum tuber-
osum to Phythophtora infestans (Halim et al. 2009),
showing a potential synergistic action of JA and SA.
Although HR may occur in nonhost plants, eviden-
ces suggest that processes leading to cell death are not
necessarily the same in host and nonhost interactions
(Christopher-Kozjan and Heath 2003; Prats et al.
2007). On the other hand, as in the present work,
several studies agree that accumulation of phenols
may be associated with cell death in both types of
resistance (Azinheira et al. 2010; Diniz et al. 2010;
Prats et al. 2007; Silva et al. 2002). Although the
accumulation of phenols was observed in the cells at
the infection sites (from 12 hai in the host interaction
and from 6 hai in the nonhost interaction), the gene
CaPAL was only moderately activated in the host
interaction (inconclusive results in the nonhost inter-
action), while CaCHS was not regulated. This accu-
mulation of phenols may arise from post-translational
modifications in PAL or from the expression of other
genes (Dorey et al. 1997).
The two-peak profile recorded for most genes (ex-
cept CaCHS) in the host interaction suggests the oc-
currence of two levels of response, the first coinciding
Eur J Plant Pathol (2012) 133:141–157 153

Fig. 5 Relative gene expression of CaRLK, CaWRKY1, CaPAL, and CaUbiquitin as control genes (results from two independent
CaCHS, CaLOX13, CaGT, CaPR1b and CaPR10 along the first experiments)
24 and 12 hai in host and nonhost interactions, using CaGAPDH
154 Eur J Plant Pathol (2012) 133:141–157

Fig. 5 (continued)
Eur J Plant Pathol (2012) 133:141–157
with appressoria formation and the second coinciding
with the formation of post-penetration infection struc-
tures, which could correspond to different levels of
pathogen recognition as previously recorded (Ramiro
et al. 2009). A third level of response, suggested by
haustoria-induced cell death in the host interaction,
could not be traced at the molecular level, presumably
because of the low level of infection sites where haus-
toria were formed. Interestingly, a similar biphasic
activation of fungal genes involved in signalling and
pathogenesis was reported at similar differentiation
stages of H. vastatrix during colonisation in compati-
ble interactions with C. arabica (Vieira et al. 2011).
Overall, our results suggest that HDT832/2 displays
similar cellular and molecular mechanisms in host resis-
tance to H. vastatrix and in nonhost resistance to U.
vignae, suggesting that in the rapid resistance response
to adapted and non-adapted rust fungi that prevents
formation of haustoria may lay the basis for the longer
durability of the resistance of this coffee genotype to H.
vastatrix races. Further comparisons between pre- and
post-haustorial resistance to H. vastatrix in coffee may
contribute to dissect the factors governing pre-haustorial
resistance, leading to a more sustained employment of
resistance-donor genotypes.
Acknowledgements This work was financially supported by
Fundação para a Ciência e a Tecnologia (Portugal), project
PTDC/AGR-AAM/71866/2006 and through a French-
Portuguese collaborative project (Partenariat Hubert Curien
PHC-Pessoa 22583XM) funded by the Ministère des Affaires
Étrangères et Européennes of France. Uromyces vignae uredo-
spores and Vigna unguiculata seeds were kindly given by Pro-
fessor Kurt Mendgen (Departament of Phytopathology,
University of Konstanz, Germany). We also appreciate the tech-
nical support provided by Paula Leandro.
References
Azinheira, H. G., Silva, M. C., Talhinhas, P., Medeira, C., Maia,
I., Petitot, A.-S., & Fernandez, D. (2010). Arabidopsis
thaliana non-host resistance responses to the coffee leaf
rust fungus (Hemileia vastatrix). Botany, 88, 621–629.
Barsalobres-Cavallari, C. F., Severino, F. E., Maluf, M. P., &
Maia, I. G. (2009). Identification of suitable internal
control genes for expression studies in Coffea arabica
under different experimental conditions. BMC Molecular
Biology, 10, 1.
Bennett, M., Gallagher, M., Fagg, J., Bestwick, C., Paul, T., Beale,
M., & Mansfield, J. (1996). The hypersensitive reaction,
membrane damage and accumulation of autofluorescent
155
phenolics in lettuce cells challenged by Bremia lactucae.
The Plant Journal, 9, 851–865.
Bettencourt, A. J., & Rodrigues, C. J., Jr. (1988). Principles and
practice of coffee breeding for resistance to rust and other
diseases. In R. J. Clarke & R. Macrae (Eds.), Coffee
Agronomy Vol. 4 (pp. 199–234). London and New York:
Elsevier Applied Science Publishers LTD.
Christopher-Kozjan, R., & Heath, M. C. (2003). Cytological and
pharmacological evidence that biotrophic fungi trigger dif-
ferent cell death execution processes in host and nonhost
cells during the hypersensitive responses. Physiological
and Molecular Plant Pathology, 62, 265–275.
Cruz, F., Kalaoun, S., Nobile, P., Colombo, C., Almeida, J.,
Barros, L. M. G., Romano, E., Grossi-de-Sá, M. F., Vaslin,
M., & Alves-Ferreira, M. (2009). Evaluation of coffee
reference genes for relative expression studies by quantita-
tive real-time RT-PCR. Molecular Breeding, 23, 607–616.
D’Oliveira, B. (1954-57). As ferrugens do cafeeiro. Revista do
Café Português, 1(4), 5-13, 2(5), 5-12, 2(6), 5-15 ,2(7), 9-
187, 2(8), 5-22, 4(16), 5-15
Diniz, I., Talhinhas, P., Azinheira, H. G., Várzea, V., Oliveira,
H., Fernandez, D. & Silva, M. C. (2010). Cellular and
molecular responses in host and nonhost coffee-rust inter-
actions (Hemileia vastatrix and Uromyces vignae). (In
Proceedings of the 23 rd International Conference on Cof-
fee Science (ASIC), 3-8 October 2010, (pp. 748-753). Bali)
Dorey, S., Baillieul, F., Pierrel, M. A., Saindrenan, P., Fritig, B.,
& Kauffmann, S. (1997). Spatial and temporal induction of
cell death, defense genes, and accumulation of salicylic
acid in tobacco leaves reacting hypersensitively to a fungal
glycoprotein elicitor. Molecular Plant-Microbe Interac-
tions, 10, 646–655.
Eschrich, W., & Currier, H. B. (1964). Identification of callose
by its diachrome and fluochrome reactions. Stain Technol-
ogy, 39, 303–304.
Eulgem, T., & Somssich, I. (2007). Networks of WRKY tran-
scription factors in defense signaling. Current Opinion in
Plant Biology, 10, 366–371.
Fernandez, D., Santos, P., Agostini, C., Bon, M.-C., Petitot,
A.-S., Silva, M. C., Guerra-Guimarães, L., Ribeiro, A.,
Argout, X., & Nicole, M. (2004). Coffee (Coffea arabica
L.) genes early expressed during infection by the rust
fungus (Hemileia vastatrix). Molecular Plant Pathology,
5, 527–536.
Fernandez-Aparicio, M., Barilli, E., Mansilla, F., & Rubiales, D.
(2011). Identification and characterisation of resistance
against rust (Puccinia allii) in garlic (Allium sp.) germ-
plasm. Annals of Applied Biology, 159, 93–98.
Ganesh, D., Petitot, A., Silva, M. C., Alary, R., Lecouls, A. C.,
& Fernandez, D. (2006). Monitoring of the early molecular
resistance responses of coffee (Coffea arabica L.) to the
rust fungus (Hemileia vastatrix) using real-time quantita-
tive RT-PCR. Plant Science, 170, 1045–1051.
Guzzo, S. D., Harakava, R., & Tsai, S. M. (2009). Identification
of coffee genes expressed during systemic acquired resis-
tance and incompatible interaction with Hemileia vastatrix.
Journal of Phytopathology, 157, 625–638.
Halim, V., Altmann, S., Ellinger, D., Eschen-Lippold, L.,
Miersch, O., Scheel, D., & Rosahl, S. (2009). PAMP-
induced defense responses in potato require both salicylic
acid and jasmonic acid. The Plant Journal, 57, 230–242.
156
Heath, M. C. (1974). Light and electron microscope studies of
the interactions of host and nonhost plants with cowpea
rust - Uromyces phaseoli var. vignae. Physiological and
Molecular Plant Pathology, 4, 403–414.
Heath, M. C. (1984). Relationship between heat-induced fungal
death and plant necrosis in compatible and incompatible
interactions involving the bean and cowpea rust fungi.
Pthytopathology, 74, 1370–1376.
Heath, M. C. (1998). Involvement of reactive oxygen species in
the response of resistant (hypersensitive) or susceptible
cowpeas to the cowpea rust fungus. New Phytologist,
138, 251–263.
Heath, M. C. (2000). Nonhost resistance and non-specific plant
defenses. Current Opinion in Plant Biology, 3, 315–319.
Horvath, D. M., & Chua, N. H. (1996). Identification of an
immediate-early salicylic acid-inducible tobacco gene and
characterization of induction by other compounds. Plant
Molecular Biology, 31, 1061–1072.
Jones, J. D. G., & Dangl, J. L. (2006). The plant immune
system. Nature, 444, 323–329.
Lipka, U., Fuchs, R., & Lipka, V. (2008). Arabidopsis non-host
resistance to powdery mildews. Current Opinion in Plant
Biology, 11, 404–411.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative
gene expression data using real-time quantitative PCR and
the 2-ΔΔCT method. Methods, 25, 402–408.
Loehrer, M., Langenbach, C., Goellner, K., Conrath, U., &
Schaffrath, U. (2008). Characterization of nonhost resis-
tance of Arabidopsis to the Asian soybean rust. Molecular
Plant-Microbe Interactions, 21, 1421–1430.
Lyngkjaer, M. F., Newton, A. C., Atzema, J. L., & Baker, S. J.
(2000). The balrley mlo gene: an important powdery mil-
dew resistance source. Agronomie, 20, 745–756.
Madrid, E., Gil, J., Rubiales, D., Krajinski, F., Schlereth, A., &
Millán, T. (2010). Transcription factor profiling leading to
the identification of putative transcription factors involved
in the Medicago truncatula – Uromyces striatus interac-
tion. Theoretical and Applied Genetics, 12, 1311–1321.
Mellersh, D. G., & Heath, M. C. (2003). An investigation into
the involvement of defense signaling pathways in compo-
nents of the nonhost resistance of Arabidopsis thaliana to
rust fungi also reveals a model system for studying rust
fungal compatibility. Molecular Plant-Microbe Interac-
tions, 16, 398–404.
Morris, E. R., & Walker, J. (2003). Receptor-like protein
kinases: the keys to response. Current Opinion in Plant
Biology, 6, 339–342.
Niks, R. E., & Rubiales, D. (2002). Potentially durable resis-
tance mechanisms in plants specialised fungal pathogens.
Euphytica, 124, 201–216.
Parlevliet, J. E. (1983). Models explaining the specificity and
durability of host resistance derived from the observations
on the barley – Puccinia hordei system. In F. Lamberti, J.
M. Wallen, & N. A. van Graaff (Eds.), Durable Resistance
in Crops (pp. 57–80). New York: Plenum Press.
Petitot, A.-S., Lecouls, A.-C., & Fernandez, D. (2008). Sub-
genomic origin and regulation patterns of a duplicated
WRKY gene in the allotetraploid species Coffea arabica.
Tree Genetics and Genomes, 4, 379–390.
Prakash, N., Bhat, S. S., Hanumantha, B. T., Várzea, V. M. P.,
Marques, D., Silva, M. C. & Jayarama (2010). Break down
Eur J Plant Pathol (2012) 133:141–157
of rust resistance in some HdT introductions and its deriv-
atives in India-New challenges for Arabica coffee breeding
in the light of increasing pathogen virulence. (Poster pre-
sented at the 23 rd International Conference on Coffee
Science (ASIC), 3-8 October 2010, Bali.)
Prats, E., Martinez, F., Rojas-Molina, M. M., & Rubiales, D.
(2007). Differential effects of phenylalanine ammonia
lyase, cynnamyl alcohol dehydrogenase, and energetic
metabolism inhibition on resistance of appropriate hostand
nonhost cereal – rust interactions. Phytopathology, 97,
1578–1583.
Ramiro, D., Escoute, J., Petitot, A. S., Nicole, M., Maluf, M., &
Fernandez, D. (2009). Biphasic haustorial differentiation of
the orange rust Hemileia vastatrix race II associated with
differential defense responses in resistant coffee cultivar.
Plant Pathology, 58, 944–955.
Ramiro, D., Jalloul, A., Petitot, A.-S., Maluf, M., & Fernandez,
D. (2010). Identification of coffee WRKY transcription
factor genes and expression profiling in resistance
responses to pathogens. Tree Genetics and Genomes, 6,
767–781.
Rijo, L., Rodrigues, C. J., Jr., & Vasconcelos, M. I. (1982).
Immunity on the coffee-orange rust association. Histopath-
ological aspects. Garcia de Orta, 9, 101–104.
Rodrigues, C. J., Jr., Bettencourt, A. J., & Rijo, L. (1975). Races
of the pathogen and resistance to coffee rust. Annual
Review of Phytopathology, 13, 49–70.
Rubiales, D., & Niks, R. E. (1995). Characterization of Lr34, a
major gene conferring nonhypersensitive resistance to
wheat leaf rust. Plant Disease, 79, 1208–1212.
Silva, M. C. (1996). Estudos histológicos e de ultrastrutura em
interacções de Coffea spp. e espécies não hospedeiras com
Hemileia vastatrix, e de Coffea arabica com ferrugens não
patogénicas. Dissertation, Universidade Técnica de Lisboa
(Instituto Superior de Agronomia), Lisbon
Silva, M. C., Nicole, M., Rijo, L., Geiger, J. P., & Rodrigues, C.
J. (1999). Cytochemistry of plant-rust fungus interface
during the compatible interaction Coffea arabica (cv.
Caturra)-Hemileia vastatrix (race III). International Jour-
nal of Plant Sciences, 160, 79–91.
Silva, M. C., Nicole, M., Guerra-Guimarães, L., & Rodrigues,
C. J., Jr. (2002). Hypersensitive cell death and post-
haustorial defence responses arrest the orange rust (Hemi-
leia vastatrix) growth in resistant coffee leaves. Physiolog-
ical and Molecular Plant Pathology, 60, 169–183.
Silva, M. C., Várzea, V., Guerra-Guimarães, L., Azinheira, H.
G., Fernandez, D., Petitot, A.-S., Bertrand, B., Lashermes,
P., & Nicole, M. (2006). Coffee resistance to the main
diseases: leaf rust and coffee berry disease. Brazilian Jour-
nal of Plant Physiology, 18, 119–147.
Silva, M. C., Guerra-Guimarães, L., Loureiro, A., & Nicole, M.
R. (2008). Involvement of peroxidases in the coffee resis-
tance to orange rust (Hemileia vastatrix). Physiological
and Molecular Plant Pathology, 72, 29–38.
Soh, H. C., Park, A. R., Park, S., Back, K., Yoon, J. B., Park, H.
G., & Kim, Y. S. (2012). Comparative analysis of
pathogenesis-related protein 10 (PR10) genes between fun-
gal resistant and susceptible peppers. European Journal of
Plant Pathology, 132, 37–48.
Stark-Urnau, M., & Mendgen, K. (1993). Differentiation of
aecidiospore- and uredospore-derived infection structures
Eur J Plant Pathol (2012) 133:141–157
on cowpea leaves and on artificial surfaces by Uromyces
vignae. Canadian Journal of Botany, 71, 1236–1242.
Talhinhas, P., Azinheira, H. G., Loureiro, A., Batista, D., Vieira,
B., Pina-Martins, F., Tisserant, E., Petitot, A.-S., Paulo, O.
S., Duplessis, S., Silva, M. C. & Fernandez, D. (2010).
Overview of the functional virulent genome of the coffee
leaf rust pathogen Hemileia vastatrix. (In Proceedings of
the 23 rd International Conference on Coffee Science
(ASIC), 3-8 October 2010, (pp. 414-422). Bali)
Thomma, B., Penninckx, I., Broekaert, W., & Cammue, B.
(2001). The complexity of disease signaling in Arabidop-
sis. Current Opinion in Immunology, 13, 63–68.
Umemura, K., Junji, S., Michiaki, I., Nobuyuki, U., Jinichiro,
K., Tomonori, K., Koshiba, T., Anzai, H., & Mitomi, M.
(2009). Contribution of salicylic acid glucosyltransferase,
OsSGT1, to chemically induced disease resistance in rice
plants. The Plant Journal, 57, 463–472.
Van Loon, L. C., Rep, M., & Pieterse, C. M. J. (2006). Signif-
icance of inducible defense-related proteins in infected
plants. Annual Review of Phytopathology, 44, 135–162.
Várzea, V. M. P., & Marques, D. V. (2005). Population variability
of Hemileia vastatrix vs coffee durable resistance. In L.
Zambolim, E. Zambolim, & V. M. P. Várzea (Eds.), Durable
157
resistance to coffee leaf rust (pp. 53–74). Viçosa: Universi-
dade Federal de Viçosa.
Vieira, A., Talhinhas, P., Loureiro, A., Duplessis, S., Fernandez,
D., Silva, M. C., Paulo, O. S. & Azinheira, H. G. (2011).
Expression profiling of genes involved in the biotrophic
colonisation of Coffea arabica leaves by Hemileia vast-
atrix. European Journal of Plant Pathology, this issue.
Wasternack, C. (2007). Jasmonates: an update on biosynthesis,
signal transduction and action in plant stress response,
growth and development. Annals of Botany, 100, 1114–
1119.
Zabala, G., Zou, J., Tuteja, J., Gonzalez, D., Clough, S. J., &
Vodkin, L. (2006). Transcriptome changes in the phenyl-
propanoid pathway of Glycine max in response to Pseudo-
monas syringae infection. BMC Plant Biology, 6, 26.
Zang, H.-S., De la Rosa, R., Rubiales, D., Lubbers, H. H.,
Molenveld, J. W., & Niks, R. E. (1994). Role of partial
resistance to Puccinia hordei in barley in the defence of barley
to inappropriate rust fungi. Physiological and Molecular Plant
Pathology, 45, 219–228.
Zipfel, C., & Robatzek, S. (2010). Pathogen-associated molec-
ular pattern-triggered immunity: veni, vidi…? Plant Phys-
iology, 154, 551–554.