Molecular Ecology (1999) 8, 2141 2152

PRIMER NOTES
Blackwell Science, Ltd

Isolation and characterization of microsatellites in Theobroma cacao L.

Graphicraft Limited, Hong Kong 0 100

C. LANAUD, A. M. RISTERUCCI, I . P I E R E T T I , M . FA L Q U E , A . B O U E T and P. J . L . L A G O D A

CIRAD BIOTROP, Avenue Agropolis, BP 5035, 34032 Montpellier cdex, France Keywords: breeding, cocoa, diversity, identication, microsatellites Received 9 May 1999; revision accepted 19 July 1999 Correspondence: C. Lanaud. Fax: +33 (0) 467615605; E-mail: lanaud@cirad.fr

Theobroma cacao L. (2n = 2x = 20) is a Sterculiaceae native from central and south America. Three main genetic groups may be distinguished: Criollo, Forastero and their hybrid form, Trinitario. Molecular markers, mainly restriction fragment length polymorphisms (RFLP) and random amplied polymorphic DNA (RAPD) have been applied to evaluate genetic resources and rene T. cacao classication (Laurent et al. 1993; NGoran et al. 1994). Several hypotheses were advanced for the origin of the Criollo group, the rst domesticated cacao, and the one that gives the nest chocolate. Microsatellites would be particularly useful to better understand the origin and domestication of Criollo. To isolate cocoa microsatellites, we screened several different libraries. A partial PstI genomic library was constructed by cloning total DNA in puc18, and had an insert size ranging between 0.5 and 2 kb (Laurent et al. 1993). Two hundred and seventy-ve unique inserts were screened with (TC)10 (AC)10 (GC)8 (AT)15, for detection of simple sequence repeats (SSR). Inserts were amplied from the cloning vector using universal primers (M13 forward and M13 reverse), electrophoresed, transfered onto Hybond N+ membranes and probed with [ 32P]-dATP end-labelled oligonucleotides. Libraries enriched separately for GA and GT were also constructed according to a modied version of Karagyozov et al. (1993). Five-hundred inserts from each library were probed with [ 32P]-dATP end-labelled (GA)15 and (GT)15. After hybridization with (TC) 10 and (AC)10, 4% and 1.5%, respectively, of the genomic clones from the PstI library were positive. No positive signals were obtained after hybridization with (GC)8 or (AT)15. Nevertheless, the presence of microsatellites such as (AT)n were revealed after sequencing some clones, demonstrating the difculties that occur during hybridization with these autocomplementary oligonucleotides. Approximately 90% of the sequenced positive candidate clones contained GA or GT repeats. Perfect or imperfect SSR were observed, and the number of perfect repeats varied from two to 28. Primers were dened in the anking regions of the SSR using the software oligo (Rychlik 1992). Not all of
1999 Blackwell Science Ltd

the candidate clones could be used to dene primers due to the redundancy of some, or to the extreme position of SSR in the DNA fragment. Microsatellite polymorphisms were screened on several genotypes of cocoa belonging to the different groups of T. cacao. PCR amplication was performed in a MJ Research PTC 100 thermal cycler, in a 20-L reaction containing 1 U of Taq polymerase (Eurobio), 10 ng of cocoa DNA, 0.2 mm dNTP mix, 2 mm MgCl2, 50 mm KCl, 10 mM Tris-HCl (pH 8.3) and 2 pmol primer (5 end-labelled with [ 33P]-dATP). These were overlaid with a drop of ultra-pure mineral oil. The samples were denaturated at 94 C for 4 min, and subjected to 32 repeats of the following cycle: 30 s at 94 C, 1 min at 46 C or 51 C, and 1 min at 72 C. They were then kept at 4 C prior to analysis. After adding 20 L of loading buffer (98% formamide, 10 mm EDTA, bromophenol blue, xylene cyanol), the mix was denaturated at 92 C for 3 min and kept at 70 C. Four L of each sample was loaded in a 5% polyacrylamide sequencing gel with 7.5 m urea in 0.5% TBE buffer and electrophoresed at 55 W for 1 h 40 min. The gel was dried for 30 min at 80 C and exposed overnight to X-ray lm (Fuji RX). For approximately 45% of candidate clones, primers generating a polymorphic amplied product could be dened, equal to 23 microsatellites as dened in Table 1. In the analysed samples, the observed mean heterozygosity per locus varies from 0.14 to 0.66 (mean 0.46) and the number of alleles per loci from 2 to 13 (mean 5.6). The results could be compared with previous diversity studies realized with nine isozymes (Lanaud 1987) and 31 RFLP probes (Laurent et al. 1993) on larger populations (300 and 180 genotypes, respectively) where a mean number of alleles per locus of 3.3 and 2.4 was observed, with 5 and 4 alleles observed as maximum in each case. These 23 microsatellites were also tested with the same PCR conditions on one sample of eight other species more or less botanically distant from T. cacao but belonging to the same family (Sterculiaceae) (Table 2). In order to conrm the presence of the microsatellite, amplication products were probed with (GA)15 and (GT)15. The membranes were exposed for 2 h to X-ray lm. Approximately 50% of the primers dened in T. cacao could amplify a clearly visible DNA fragment that contains a microsatellite in species belonging to the same genus Theobroma or to the closely related genus Herrania. Six primer pairs could also amplify microsatellite-containing fragments of Cola nitida. In some cases, no signal was observed in spite of the presence of an amplied DNA fragment that had the same size as the amplied cocoa fragment. This could reect the total absence of microsatellite, the presence of very small microsatellites in homologous DNA fragments, or the presence of imperfect microsatellites that prevented the hybridization with (GA)15 and (GT)15. The large polymorphism revealed by these rst microsatellites

2142 P R I M E R N O T E S
Table 1 Characteristics of 23 cocoa microsatellites EMBL accession number Y16883 Y16978 Y16977 Y16979 Y16980 Y16981 Y16982 Y16983 Y16984 Y16985 Y16986 Y16987 Y16988 Y16989 Y16990 Y16991 Y16992 Y16994 Y16995 Y16996 Y16997 Y16998 Y16999 Size of cloned allele (bp) 143 254 249 259 231 160 301 274 208 298 188 258 254 308 271 345 376 157 289 198 153 298 336

Marker name mTcCIR1 mTcCIR2 mTcCIR3 mTcCIR4 mTcCIR6 mTcCIR7 mTcCIR8 mTcCIR9 mTcCIR10 mTcCIR11 mTcCIR12 mTcCIR13 mTcCIR15 mTcCIR16 mTcCIR17 mTcCIR18 mTcCIR19 mTcCIR21 mTcCIR22 mTcCIR24 mTcCIR25 mTcCIR26 mTcCIR28

Primer sequence (5 3) GCAGGGCAGGCTCAGTGAAGCA TGGGCAACCAGAAAACGAT CAGGGAGCTGTGTTATTGGTCA AGTTATTGTCGGCAAGGAGGAT CATCCCAGTATCTCATCCATTCAGT CTGCTCATTTCTTTCATATCA CGACTAAAACCCAAACCATCAA AATTATTAGGCAACCCGAACTT TTCCCTCTAAACTACCCTAAAT TAAAGCAAAGCAATCTAACATA ATGCGAATGACAACTGGT GCTTTCAGTCCTTTGCTT CTAGTTTCCCATTTACCA TCCTCAGCATTTTCTTTC ACCATGCTTCCTCCTTCA ACATTTATACCCCAACCA ACAGATGGCCTACACACT CAAGCAAGCCTCATACTC TTTGGTGATTATTAGCAG GATTCGATTTGATGTGAG TCTGACCCCAAACCTGTA ATTCCAGTTAAAGCACAT CAGTCTAACAAAGGTGAG TGCCCCACTTGACAACTA CAGCCGCCTCTTGTTAG TATTTGGGATTCTTGATG ACCTTCACCAGCTCACC TAAATTCTACTAGCAAATTACC AAGGATGAAGGATGTAAGAGAG CCCATACGAGCTGTGAGT GATAGCTAAGGGGATTGAGGA GGTAATTCAATCATTTGAGGATA CACAACCCGTGCTGATTA GTTGTTGAGGTTGTTAGGAG GTCGTTGTTGATGTCGGT GGTGAGTGTGTGTGTTTGTCT ATTCTCGCAAAAACTTAG GATGGAAGGAGTGTAAATAG TTTGGGGTGATTTCTTCTGA TCTGTCTCGTCTTTTGGTGA CTTCGTAGTGAATGTAGGAG TTAGGTAGGTAGGGTTATCT GCATTCATCAATACATTC GCACTCAAAGTTCATACTAC GATCAATCAGAAGCAAACACAT TAAAGCAGCCTACCAAGAAAAG

Ta(C) 51 51 46 51 46 51 46 51 46 46 46 46 46 46 51 51 46 46 46 46 46 46 46

Repeat structure (CT)14 (GA)3N5(AG)2GG(AG)4 (CT)20(TA)21 (TCTCTG)2(TC)8 (TG)7(GA)13 (GA)11 (TC)5TT(TC)17TTT(CT)4 (CT)8N15(CT)5N9(TC)10 (TG)13 (TC)13 (CATA)4N18(TG)6 (AG)13 (TC)19 (TC)9N37(TC)13 (GT)7N4(GA)12 (GA)12 (CT)28 (TC)11N5(CA)12 (TC)12N146(CT)10 (AG)13 (CT)21 (TC)9C(CT)4TT(CT)11 (TC)8

N 18 8 18 14 24 24 24 18 18 24 24 14 24 14 14 24 18 18 14 18 24 14 4

No. of alleles 3 3 6 3 8 6 5 4 4 9 10 4 10 3 3 8 6 6 4 4 13 6 2

HO 0.5 0.55 0.54 0.66 0.54 0.42 0.33 0.45 0.56 0.46 0.62 0.33 0.62 0.14 0.5 0.46 0.58 0.47 0.29 0.35 0.42 0.41 0.43

HE 0.62 0.51 0.77 0.45 0.57 0.75 0.55 0.59 0.71 0.81 0.87 0.47 0.84 0.45 0.87 0.72 0.72 0.68 0.43 0.31 0.84 0.67 0.41

Ta, annealing temperature used; HO, observed mean heterozygosity; HE, expected heterozygosity.

isolated in cocoa conrm their usefulness for mapping and diversity studies, as well as for identication purposes. This could be applied to conrm the conformity of germplasm or the genetic origin of cocoa beans sent to chocolate manufacturers from various tropical countries. The potential

use of some primers dened in T. cacao to reveal polymorphism in species of the same family also represents a major interest to the management of genetic resources of species that have not been well studied because of few available means.
1999 Blackwell Science Ltd, Molecular Ecology, 8, 2141 2152

P R I M E R N O T E S 2143
Table 2 Screening of the 23 microsatellites isolated in Theobroma cacao and studied on eight different species belonging to the same family (Sterculiaceae) than T. cacao Microsatellite mTcCIR T. cacao T. grandiora T. microcarpa T. mamosum T. bicolor T. angustifolia H. umbratica H. cuatrescasana Cola nitida 1 + a + + a + a a + 2 + + + + + + + a 3 + a a a a a a 4 + + + a + a a + + 6 + 7 + a a a a a + + 8 + a a a a + 9 + + + + + + + + + 10 + + + a a + + 11 + + + + a + a a a 12 + + + + + + a a 13 + + + + + + + + 15 + + + a 16 + a a a 17 + + + + + + + + + 18 + + + a a 19 + + + + + + + a a 21 + + + + + + 22 + + + + + + + a + 24 + 25 + + + + + a a 26 + + + + + + + a 28 + + + + + a + +

+, corresponds to a microsatellite locus-specic amplication; , corresponds to a non specic or no amplication; a, corresponds to an amplication, but without detection of microsatellites after hybridization.

Acknowledgements
We wish to thank Dr B. Vosman for helpful discussions on microsatellite production and Dr C. Kaye for English corrections.

References
Karagyozov L, Kalcheva ID, Chapman VM (1993) Construction of random small-insert genomic libraries highly enriched for simple sequence repeats. Nucleic Acids Research, 21, 3911 3912. Lanaud C (1987) Nouvelles donnes sur la biologie du cacaoyer (T. cacao L.): diversit des populations, systme dincompatibilit, haplodes spontans. Leurs consquences sur lamlioration gntique de cette espce. Universit de Paris XI, centre dOrsay, doctorat dtat. Laurent V, Risterucci AM, Lanaud C (1993) Genetic diversity in cocoa revealed by cDNA probes. Theoretical and Applied Genetics, 88, 193 198. NGoran JAK, Laurent V, Risterucci AM, Lanaud C (1994) Comparative genetic diversity studies of Theobroma cacao L. using RFLP and RAPD markers. Heredity, 73, 589597. Rychlik W (1992) OLIGO 4.06, Primer Analysis Software. National Biosciences Inc. Publishers, Plymouth, USA.
Graphicraft 0 1 primer no. Limited, Hong Kong no 808 1999 no supplier ID 800issuenotes number of article

Polymorphic microsatellite DNA markers in the ant Gnamptogenys striatula

T. G I R A U D , * R . B L AT R I X , * M . S O L I G N A C and P. J A I S S O N *
*Laboratoire dthologie exprimentale et compare, Universit de Villetaneuse, avenue J. B. Clment, 93 430 Villetaneuse, France, Laboratoire Populations, Gntique et Evolution, CNRS, 91198 Gif-sur-Yvette Cedex, France Keywords: ants, Gnamptogenys striatula, microsatellites Received 18 June 1999; revision accepted 28 July 1999 Correspondence: T. Giraud. Fax: +33 1 30 83 31 95; E-mail: giraud@versailles.inra.fr

Gnamptogenys striatula (Hymenoptera: Formicidae: Ponerinae) is distributed throughout Central and South America, where it can be found in open habitats and in humid forests (Lattke 1995). There have been few studies on social structure in this genus (Prat 1994; Gobin et al. 1998). Colonies of G. striatula are functionally polygynous (several mated queens reproduce simultaneously), which is uncommon in the subfamily Ponerinae. Workers mate under some conditions and give workers (R. Blatrix and P. Jaisson, unpublished). It is necessary to understand the genetic relationships between individuals within a colony to interpret the social structure of G. striatula and its evolution. Variable genetic markers are needed to estimate the genetic diversity, structure of population, reproductive strategy, and relatedness between colony members. G. striatula DNA was isolated using the QIAamp DNA Mini Kit (Qiagen) and was digested with Sau3A (Eurogentec). A partial genomic library was constructed according to Estoup et al. (1993). Restriction fragments were ligated into the pUC19 vector, and electrotransformed into Escherichia coli DH5- strains. Two-thousand clones of the resulting library were screened with the following oligonucleotide probes: (TC)10 (TG)10 (CAC)5CA, CT(CCT)5, CT(ATCT)6 and (TGTA)4TG. A total of 100 colonies were positive. Thirty-one positive colonies were sequenced and all revealed microsatellite loci: 28 dinucleotide repeats, two trinucleotide repeats and one tetranucleotide repeat. A group of 24 microsatellites was selected to test the variablity of G. striatula populations from Brasil. PCR primers were designed from nucleotide sequences anking the microsatellites, using the computer program OLIGO (Macintosh version 4.0, National Bioscience). Each locus was screened for variation using a panel of 39 ants: 31 individuals were sampled in 1999 from different colonies along a 50-km transect and the eight remaining individuals were collected in the same region in 1997. PCR amplications were performed using a Biometra thermal cycler, with 35 cycles (except for L8, for which 50 cycles were necessary) of 94 C for 30 s, 53/55/57/ 60 C (Table 1) for 30 s, and 72 C for 30 s. Each reaction (10 L) contained 1 L of 10 reaction buffer (50 mm KCl,

1999 Blackwell Science Ltd, Molecular Ecology, 8, 21412152

2144 P R I M E R N O T E S

Table 1 Characteristics of microsatellite loci in the ant Gnamptogenys striatula, including repeat array, primer sequences, GenBank Accession no. of the complete cloned sequence, conditions for amplication, and polymorphism data. The observed (HO) and expected heterozygozity (HE) were calculated for the 31 individuals sampled in 1999, for the loci where more than one allele was detected in these 31 ants. Successful cross-species amplication is indicated by species abbreviations* Repeat array in cloned allele (GA)12A3(GA)3 (CA)10 (AG)14GG(AG)21 (CA)6(TA)22 (CA)2CG(CA)9 (TG)35 (TC)12 (GA)35 (AG)12 (CT)18 GenBank Accession no. AF146882 AF170285 AF170286 AF170287 AF170288 AF170289 AF170290 AF170291 AF170292 AF170293 Annealing temp. (C) 60 60 55 55 60 53 57 60 60 60 MgCl2 (mm) 1.5 1.5 1.5 1.5 1.5 2 1.25 2 1.5 2 Size of PCR product (bp) 150 163 230 237 173 234 146 250 130 220 No. of alleles 3 2 3 2 2 3 2 5 4 3 13 32 48 55 16 37 47 52 58 15 35 32 46 51 Amplication in other species* Cb, Et, Er, Pa, Cn Cb, Er, Pa, Po, Cn Cb, Et, Er, Pa, Po Cb, Et Cb, Er, Cn Er, Pa, Cn Cb Cb, Et, Er Cb, Et, Er, Pa, Po, Cn Cb, Et, Er, Pa, Po, Cn

Locus L2 L3 L4 L6 L7 L8 L12 L16 L19 L20 1999 Blackwell Science Ltd, Molecular Ecology, 8, 2141 2152

Primer sequence (5 3) F: AGATACAGCGGTCGGTCAGG R: CGTACGGATGCGATTTCAGC F: AGCACATCCTTGTTTCCTCTTC R: TTTCACGCGTGACTTGAACAAT F: TGCCGTGACGACCCATACCA R: CGCAAAGCAGAGGAAGAGAA F: AAGCTTACGACCGAGAAGGA R: CGACGTGCGCTAACTCTTGG F: TAGAGCACATCCTTGTTTCCTC R: TCTTCTTCGAGTGATTTTCA F: CGTTAACGCGTGTGTGAGG R: GGGGATAAGAGTGTGAGATGAG F: AATCCCTTTTCCTCTTTGTTCT R: TTCTACTTACGCAGACCATA F: GCTCGTTCGGACAGGATGC R: TTCCCTCCGTCCATCTCCTG F: ATTGCCGGGGGAGACATTAT R: TCCTTACCCCTTTGCCACTC F: ACATGCGCGAGGGATACATC R: GAAGGAGAGGGCTCATTCAA

HO (%) 6

HE (%) 18

*Et, Ectatomma tuberculatum; Er, E. ruidum; Tb, Tetramorium bicarinatum; Cb, Cerapachys biroi; Po, Pachycondyla obscuricornis; Pa, P. apicalis; Ci, Cataglyphis iberica; Cn, Cataglyphis niger.

P R I M E R N O T E S 2145
0.1% Triton X-100, 10 mm Tris-HCl, pH 9.0), 75 m of dCTP, dGTP, dTTP, 6 m of dATP, 0.02 L of 33P-dATP, 0.2 g/L BSA, 1.25/1.5/2 mm MgCl2 (Table 1), 2.5 pmol of each primer, 0.25 U of Taq DNA polymerase (Boehringer Mannheim), and approximately 10 ng of sample DNA. PCR products were analysed in 6% polyacrylamide gels and visualized by autoradiography. Alleles were scored by length in base pairs. Only 10 of the 24 microsatellite loci tested in G. striatula were polymorphic in the 39 individuals tested (Table 1). The number of alleles per locus was rather small (2 5), with a mean of 2.5. The number of alleles seemed to be independent of the length of the repeat array. There seems to be less polymorphism in G. striatula than in other insect species, perhaps due to a recent bottleneck or a small effective population size (Ne). The observed (HO) and expected heterozygosity (HE) were calculated taking into account only the 31 individuals sampled in 1999 (Table 1). HO was lower than HE for almost all loci, which may reect population subdivision, inbreeding, or the presence of null alleles. The microsatellites identied in this work should permit study of ne-scale genetic variation and relatedness in G. striatula. We examined the ability of primers to amplify appropriately sized products in several other species of ant (35 cycles of 94 C for 30 s, 50 C for 30 s, and 72 C for 30 s; 2 mm MgCl2). No PCR products were obtained in Anomma nigricans and Eciton burchelli, but amplication was successful in several other species. The loci for which a clear amplication was obtained are indicated in Table 1. The polymorphism in these species was not tested, but the markers could potentially be useful in several genera of ants. This is especially valuable as all primers that have previously been published for ant species have been cloned only in distant genera. Acknowledgements
We thank Yves Brygoo and Pathologie Vgtale group (INRA, France) for allowing part of the work to be done in their laboratory, Dominique Vautrin for technical assistance, Jacques Delabie for eld and taxonomy expertise, Cyril Astruc for testing the primers on some ant species, Emmanuelle Baudry for many invaluable contributions, and Owen Parkes for correcting the English text. This research was partly funded by the Cellule des relations internationales de lUniversit Paris 13.

Microsatellites from a teleost, orange roughy (Hoplostethus atlanticus), and their potential for determining population structure
C A T H E R I N E S . O K E , * Y. C H I N G C R O Z I E R , * R O S S H . C R O Z I E R * and R O B E R T D . WA R D
*Department of Genetics, La Trobe University, Bundoora, Victoria 3083, Australia, CSIRO Marine Research, GPO Box 1538, Hobart, Tasmania 7001, Australia Keywords: sheries population structure, Hoplostethus atlanticus, microsatellites, orange roughy Received 21 May 1999; revision accepted 19 June 1999 Correspondence: C. Oke. Fax:+ 61 3-94792480; E-mail: genco@gen.latrobe.edu.au

References
Estoup A, Solignac M, Harry M, Cornuet J-M (1993) Characterization of (GT)n and (CT)n microsatellites in two insect species: Apis mellifera and Bombus terrestris. Nucleic Acids Research, 21, 14271431. Gobin B, Peeters C, Billen J (1998) Colony reproduction and arboreal life in the ponerine ant Gnamptogenys menadensis (Hymenoptera: Formicidae). Netherlands Journal of Zoology, 48, 53 63. Lattke JE (1995) Revision of the ant genus Gnamptogenys in the new world (Hymenoptera: Formicidae). Journal of Hymenoptera Research, 4, 137193. Pratt SC (1994) Ecology and behaviour of Gnamptogenys horni (Formicidae: Ponerinae). Insectes Sociaux, 41, 255262.
G 2 1 primer notes no 761supplier if known Limited, Hong Kong 8 raphicraft ID number of article

Orange roughy, Hoplostethus atlanticus, supports commercially important sheries across its circumglobal distribution (Kaiola et al. 1993). Within these sheries, population structure is uncertain, hindering effective management. Genetic and nongenetic studies have been conducted in Australian waters. The nongenetic studies [parasites (Lester et al. 1988), otolith microchemistry (Edmonds et al. 1991) and morphology (Elliott & Ward 1992) ] have generally suggested multiple stocks, whereas the genetic studies [allozyme (Elliott & Ward 1992) and mitochondrial DNA (Smolenski et al. 1993) ] have generally suggested a single Australian stock. The two types of studies could be reconciled if sufcient gene ow renders populations homogenous, with most individuals self-recruiting to natal areas. Microsatellites offer higher resolving power for sheries population genetic studies than previous molecular markers (Wright & Bentzen 1994). In some sh [northwest Atlantic cod (Gadus morhua) (Ruzzante et al. 1996) and Arctic charr (Salvelinus alpinus) (Brunner et al. 1998) ], microsatellites have revealed population structure not apparent from earlier allozyme or mitochondrial DNA (mtDNA) analysis. The 10 microsatellite loci characterized here may help to clarify the currently uncertain situation regarding orange roughy stock composition. Locus polymorphism was tested using 87 458 sh (Table 1) combined from 1 to 9 separate collections from across their global range. Six populations were taken from Australia (19971998), two from the North Atlantic (1991, 1998) and one from Namibia (1998). All samples were collected for the authors except those from the North Atlantic in 1991, kindly supplied by Elliott et al. (1994), and stored at either 20 C (in ethanol) or 70C. Genomic DNA was cut with Sau3A and RsaI and sizeselected fragments (500 800 bp) were cloned into BamHI and Hinc2-digested pUC19 puried with GENECLEAN (BIO101 Inc.). Membrane lifts [Hybond N+(Amersham) ] of the resulting library were prehybridized in 0.5% sodium dodecyl sulphate (SDS), 6 sodium chloride/citrate (SSC), 5 Denhardts solution and then hybridized with di-(GT)10 or tetra-(GTGA)8 nucleotide repeat probes (5 end-labelled with [33P]-ATP using T4 polynucleotide kinase) in 0.1% SDS, 6 SSC, 5

1999 Blackwell Science Ltd, Molecular Ecology, 8, 21412152

2146 P R I M E R N O T E S
Table 1 Microsatellite loci in the teleost Orange roughy (Hoplostethus atlanticus Collett). GenBank Accession nos are given under their appropriate locus No. of alleles 24 24 16 18 16 14 14 24 24 16

Locus Hat2a AFI46636 Hat3 AFI46637 Hat78b AFI46638 Hat9a AFI46639 Hat49 AFI46640 Hat41 AFI46641 Hat4 AFI46642 Hat7 AFI46643 Hat45 AFI46644 Hat19 AFI46645

N (n) 150 (6) 458 (9) 174 (2) 183 (2) 87 (2) 96 (1) 177 (2) 137 (2) 92 (3) 192 (2)

Repeat motif (GCTC)3(ACTC)4 (GT)12 (CT)3(GT)10 (CA)15 (CA)4(15 bp) (CA)24 (GT)4(TTT)(GT)5 (GT)12 (CT)14 (CA)27 (GT)29 (GT)8 (4 bp) (GT)10

HO* 0.807 0.721 0.85 0.87 0.910 0.743 0.847 0.910 0.978 0.73

HE* 0.879 0.770 0.862 0.89 0.764 0.864 0.767 0.93 0.867 0.70

Flanking primer sequences (53) F: GTGTGCAATTTCCTTACCTAC R: GCAATTTACAGTTGTGCAATTTG F: GATCCAGAGAAACTGAAAATCTT R: ACTACAAATACTCCATTCTGATG F-CCACTATCAGGGTTTTTATCG R: GCGTGGTAGAGATATGGCAT F: CAAGCCTGGACAATGTATCT R: AACACAAACTCTCTAATTCAC F: GACTGTGAACTCCGACCTC R: TATGACCATGATTACGCCAAG F: GTCAGAACGTCATGGCAGG R: GCCTGTTGATAGTCTTCCTC F: GCTTAATGGATAATGAGTGGAC R: TAGGGATGTTATAGTGGTTCTT F: GTGACTTTGGGGTTGAGGG R: GCCTTGTAACTCATTCCGCT F: CTCCTTATCTGCTGCTTTATG R: CACTACCACTCAACCTCAAC F: GCTACAATAAAACCTGACTGG R: CTACCTGGGACAATGGACTT

Size (bp) 166 244 116164 61149 126 164 207 400 156 184 166 220 207267 120 168 108 140

*Mean heterozygosity across all individuals calculated according to Nei (1987). N is the total number of individuals screened; n is the number of populations combined to screen.

Denhardts solution. The membranes were washed at room temperature in 400 mL of 6 SSC twice for 6 min, then at 55 C in 600 mL of 6 SSC for 4 min, then at room temperature in 2 SSC for 4 min, before autoradiography. Twenty-four clones were cycle-sequenced and run on a Perkin-Elmer ABI 377. Ten primer pairs were designed using Oligo 4.0 (National Biosciences Inc.). No clones with the GTGA repeat were found. For polymerase chain reaction (PCR) amplication, DNA was extracted by two separate methods, cetyltri methylammoniumbromide (CTAB) or a modied Chelex extraction method (Fitzsimmons et al. 1997). For the latter, 800 L of 5% Chelex and 5 L of 14 mg/mL proteinase K were added to 5 mm3 of crushed muscle tissue and left overnight at 57 C. PCR was carried out without oil in a 25-L reaction made up of 11.315.3 L of dH2O, 2.5 L Taq 10 buffer without MgCl2 (500 mm KCI, 100 mm Tris-HCl (pH 9.0 at 25 C), 1.0% Triton X-100) (Promega), 3 L of 25 mm MgCl2, 1 L of 10 mm dNTP mix, 1 L of 5 m reverse primer, 1 L of 5 m uorescent labelled (Hex, Tet or Fam) forward primer, 0.2 L of Taq polymerase (5units/mL, Promega) and 1 L (CTAB DNA) or 5 L (Chelex) of DNA. PCR was performed in a PerkinElmer 9700 thermocycler with the prole: initial denaturing for 3 min at 94 C then 10 cycles of 30 s denaturing at 94 C; 30 s annealing at 45 C: 30 s extension at 72 C followed by 35 cycles of 30 s denaturing at 94 C: 30 s annealing at 50 C: 30 s extension at 72 C. The size of amplication products was determined using TAMRA400 internal size standard and the Genescan 2.0.1 (Perkin-Elmer/ABI) software. The loci were highly polymorphic with between 14 and 24 alleles (Table 1). Observed heterozygosities for the pooled

populations ranged from 0.721 (Hat3) to 0.978 (Hat45). The populations were analysed separately using genepop (Raymond & Rousset 1995) and the genotypic and genic differentiation tests and FST values calculated indicated population differentiation. These preliminary results suggest structuring between populations which, if conrmed, will have signicance for stock management. All primers amplied individuals from three other Hoplostethus species (H. lateus, H. intermedius and H. gigas) and two other sh from the Trachichthyidae family, Darwins roughy (Gephyroberyx darwinii) and sandpaper sh (Paratachichthys sp.) (N = 6 per species). There was an indication of variation within and amongst the three genera. Acknowledgements
We thank the Australian Fisheries Research and Development Corporation and the Australian Research Council for nancial support, Peter Grewe for help with automated sequencing, the Marine and Freshwater Research Institute, Victoria and Dennis White for help in obtaining the Australian samples, Peter Smith for help in obtaining the Namibian collections, and Pascal Lorance of IFREMER France for help in obtaining the 1998 North Atlantic samples.

References
Brunner PC, Douglas MR, Bernatchez L (1998) Microsatellite and mitochondrial DNA assessment of population structure and stocking effects in arctic charr Salvelinus alpinus (teleostei, 1999 Blackwell Science Ltd, Molecular Ecology, 8, 2141 2152

P R I M E R N O T E S 2147
salmonidae) from central alpine lakes Source. Molecular Ecology, 7, 209223. Edmonds JS, Caputi N, Morita M (1991) Stock discrimination by trace element analysis of otoliths of orange roughy (Hoplostethus atlanticus) a deep water marine teleost. Australian Journal of Marine and Freshwater Research., 42, 383389. Elliott NG, Smolenski AJ, Ward RD (1994) Allozyme and mitochondrial DNA variation in orange roughy, Hoplostethus atlanticus (Teleostei: Trachichthyidae): little differentiation between Australian and North Atlantic populations. Marine Biology, 119, 621 627. Elliott NG, Ward RD (1992) Enzyme variation in orange roughy, Hoplostethus atlanticus (Teleostei: Trachichthyidae), from southern Australian and New Zealand waters. Australian Journal of Marine and Freshwater Research, 43, 15611571. Fitzsimmons NN, Limpus CJ, Norman JA, Goldizen AR, Miller JD, Moritz C (1997) Philopatry of male marine turtles inferred from mitochondrial DNA markers. Proceedings of the National Academy of Sciences of the USA, 94, 89128917. Kaiola PJ, Williams MJ, Stewart PC, Reichelt RE, McNee A, Grieve C (1993) Australian Fisheries Resources. Bureau of Resource Sciences, Department of Primary Industries and Energy and The Fisheries Research and Development Corporation, Canberra, Australia. Lester RJG, Sewell KB, Barnes A, Evans K (1988) Stock discrimination of orange roughy, Hoplostethus atlanticus, by parasite analysis. Marine Biology, 99, 137143. Nei M (1987) Molecular Evolutionary Genetics. Columbia University Press, New York. Raymond M, Rousset F (1995) GENEPOP (Version 1.2) population genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248 249. Ruzzante DE, Taggart CT, Cook D (1996) A nuclear DNA basis for shelf- and bank-scale population structure in northwest Atlantic cod (Gadus morhua): Labrador to Georges Bank. Molecular Ecology, 7, 1663 1680. Smolenski AJ, Ovenden JR, White RWG (1993) Evidence of stock separation in southern hemisphere orange roughy (Hoplostethus atlanticus) from restriction-enzyme analysis of mitochondrial DNA. Marine Biology, 116, 219 230. Wright JM, Bentzen P (1994) Microsatellites: genetic markers for the future. Reviews in Fish Biology and Fisheries, 4, 384388.
Graphicraft 0 1 primer no. Limited, Hong Kong no 785 1999 no supplier ID 800issuenotes number of article

Polymerase chain reaction (PCR) primers for the amplication of ve nuclear introns in vertebrates
V. L . F R I E S E N , * B . C . C O N G D O N , * M . G . K I D D * and T. P. B I RT *
*Department of Biology, Queens University, Kingston, Ontario K7L 3N6, Canada Keywords: intron, nuclear genes, PCR, SSCP, vertebrate Received 1 April 1999; revision received 27 June 1999; accepted 2 July 1999 Correspondence: V. L. Friesen. Fax: + 01-613-5336617; E-mail: friesenv@biology.queensu.ca Present addresses: School of Tropical Biology, James Cook University, Cairns, Queensland 4870, Australia; The Alder Institute, PO Box 774, Station C, St. Johns, Newfoundland A1C 5L4, Canada.

Advancements in evolutionary genetics, as well as the conservation of biodiversity, increasingly require direct analyses of sequence variation in nuclear DNA. Recent studies indicate that nuclear introns have variabilities useful for both phylogenetics and population genetics (reviewed in Friesen 2000); however, use of introns is currently limited by a paucity of polymerase chain reaction (PCR) primers that have been demonstrated to have broad taxonomic utility (although several primers with less general or uncertain utilities have been published; reviewed in Friesen 2000). We have designed 30 general PCR primers for nuclear introns for vertebrates. Genes for which sequences were available for a variety of vertebrates and for which sizes and locations of introns were known for at least one species were extracted from GenBank and aligned by eye. Primers were designed from sequences of avian DNA to anneal to conserved sites within exons and to amplify introns 100 500 bp in size (the size optimal for analysis of single-stranded conformational polymorphisms [SSCPs]; Hayashi 1991) as well as approximately 50 bp of anking exon (so that gene homology can be conrmed by sequencing; Palumbi & Baker 1994). When possible, primers were designed to enable amplication and sequencing at high temperatures if required either to improve specicity or to overcome strong secondary structure. Sequence variation in 121 marbled murrelets (Brachyramphus marmoratus) was analysed, and cross-species reactivity of primers was tested using the protocols for amplication, analysis of SSCPs and sequencing described in Friesen et al. (1997). All but 30 of 1200 loci examined were rejected because: (i) they lacked introns; (ii) sizes or locations of introns were not reported for any species; (iii) exon sequences were not available for any birds; (iv) loci occurred in large multigene families; (v) loci had pseudogenes; (vi) sequences could not be aligned unambiguously; and/or (vii) conserved priming sites could not be identied. Primer sequences, PCR protocols and results of test amplications for four loci are reported in Friesen et al. (1997); primers have now been tested for ve more loci (Fig. 1): (1) Lactate dehydrogenase (LDH) catalyses the interconversion of NADH/pyruvate to NAD+/lactate, and serves as a lens protein (-crystallin) in the vertebrate eye; it is a member of a small multigene family. Primers were designed from sequences that are conserved across species for LDH-B but that are variable across analogues, so that only one locus should amplify. (2) Myelin proteolipid protein (MPP) creates a hydrophilic layer on the outside of myelin sheaths, thus enabling close juxtaposition of neighbouring membranes (Schliess & Stoffel 1991). (3) Ornithine decarboxylase (OD) catalyses the conversion of ornithine to putrescine, which functions in the control of cell growth, development and division (Yao et al. 1995). (4) Ribosomal protein 40 (RP40) functions primarily in ribosome formation and regulation of ribosome activity, but also serves as a precursor for a membrane-associated laminin receptor. The chicken has one gene; mammals have multiple copies, most of which are probably pseudogenes (Clausse et al. 1996). Tropomyosin (TROP) is a myobrillar protein involved in

1999 Blackwell Science Ltd, Molecular Ecology, 8, 21412152

2148 P R I M E R N O T E S
Fig. 1 Sequences of PCR primers (for representative birds) and corresponding priming sites (for other species) for ve nuclear introns for various vertebrates. Numbers represent GenBank accession numbers. Chicken, Gallus gallus; cow, Bos taurus; dog, Canis familiaris; duck, Anas platyrhynchus; frog, Xenopus laevis; human, Homo sapiens; killish, Fundulus heteroclitus; mouse, Mus musculus; pig, Sus scrofa; quail, Coturnix coturnix; rabbit, Oryctolagus cuniculus; rat, Rattus norvegicus; zebrash, Danio rerio.

Table 1 Primer locations, results of test amplications, observed (HO) and expected (HE) heterozygosities and numbers of alleles among 121 marbled murrelets for ve nuclear introns Results of test amplications* Locus LDH-B MPP OD RP40 TROP Primer locations exons 3 & 4 exons 4 & 5 exons 6 & 8 exons 5 & 6 exons 5 & 6 murrelet 480 390 730 410 1360 murre 525 400 625 450 275 rhea Y Y Y Y Y nch 700 400 650 400 450 snake ~ ~ 400 ~ 800 rabbit 275 ~ x 150 210 frog x ~ x ~ ~ redsh x ~ x ~ 450 HO 0.32 0.40 0.65 0.73 0.69 HE 0.33 0.42 0.65 0.78 0.69 No. of alleles 7 4 8 8 7

*rhea, Rhea spp.; murre, Uria aalge; nch, Poephila acuticaudata; snake, Sistrurus catensus; rabbit, Sylvilagus oridanus; frog, Rana pipens; redsh, Sebastes marinus. Numbers denote approximate sizes of amplication products (including primers); x denotes no amplication; ~ denotes multiple bands or smears on agarose gels. Y indicates amplications for rheas produced clean products, but sizes are not available.

regulating contraction and relaxation of muscle bres; it is part of a multigene family, and consists of and subunits (Cummins & Perry 1973). Sequence analyses indicated that amplication products for murrelets probably represented the target loci: of 29 nucleotide differences between exon sequences of murrelets and the reference bird, only four involved amino acid differences. Among murrelets, heterozygosities were ~10 higher than in a complementary study of allozymes (mean for 29 presumptive loci = 0.026, SE = 0.011; Friesen et al. 1997; Table 1). Substitutions did not differ from expectations of the neutral theory: most substitutions within exons were silent; substitutions were distributed randomly within introns; transitions outnumbered transversions; and tests for selection were not

signicant (V. L. Friesen & B. C. Congdon unpublished). Primers yielded a PCR product in all species of birds and mammals that were tested (Table 1); in other vertebrates, primers often yielded either multiple bands or a smear, but should yield a clean band with either renement of PCR protocols or use of primers with sequences more specic for these taxa (Fig. 1). References
Clausse N, Jackers P, Jares P et al. (1996) Identication of the active gene coding for the metastasis-associated 37LRP/p40 multifunctional protein. DNA and Cell Biology, 15, 1009 1023. 1999 Blackwell Science Ltd, Molecular Ecology, 8, 2141 2152

P R I M E R N O T E S 2149
Cummins P, Perry SV (1973) The subunits and biological activity of polymorphic forms of tropomyosin. Biochemistry Journal, 133, 765 777. Friesen VL (2000) Introns. In: Molecular Methods in Ecology (ed. Baker AJ) Blackwell Science, Oxford, in press. Friesen VL, Congdon BC, Walsh HE, Birt TP (1997) Intron variation in marbled murrelets detected using analyses of single-stranded conformational polymorphisms. Molecular Ecology, 6, 1047 1058. Hayashi K (1991) PCR-SSCP: a simple and sensitive method for detection of mutations in the genomic DNA. PCR Methods and Applications, 1, 34 38. Palumbi SR, Baker CS (1994) Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales. Molecular Biology and Evolution, 11, 426435. Schliess F, Stoffel W (1991) Evolution of the myelin integral membrane proteins of the central nervous system. Biological Chemistry Hoppe-Seyler, 372, 865 874. Yao J, Zadworny D, Khnlein U, Hayes JF (1995) Molecular cloning of a bovine ornithine decarboxylase cDNA and its use in the detection of restriction fragment length polymorphisms in Holsteins. Genome, 38, 325 331.
Graphicraft 0 1 primer no. Limited, Hong Kong no 809 1999 no supplier ID 800issuenotes number of article

Isolation and characterization of microsatellite loci in the freshwater gastropod, Biomphalaria glabrata, an intermediate host for Schistosoma mansoni
C AT H E R I N E S . J O N E S , * A N N E E . L O C K Y E R , * D AV I D R O L L I N S O N , S T U A RT B . P I E RT N E Y * and LESLIE R. NOBLE*
*Zoology Department, Aberdeen University, Tillydrone Avenue, AB24 2TZ, UK, Zoology Department, Natural History Museum, Cromwell Road, London SW7 5BD, UK Keywords: Biomphalaria glabrata, freshwater snails, genetic markers, microsatellites Received 18 June 1999; revision accepted 31 July 1999 Correspondence: C. S. Jones. Fax: +44 (0) 1224 272396; E-mail: c.s.jones@abdn.ac.uk

Planorbid snails of the genus Biomphalaria are important intermediate hosts of medically signicant schistosomes. Attempts to control freshwater snails should be an integral part of schistosomiasis control programmes but chemical and biological methods tend to be labour intensive and costly and require long-term commitment to be successful. However, susceptibility to the parasite has a strong genetic component, offering the potential for investigation into host parasite interactions at the molecular level, perhaps leading to novel control approaches. Hence, the identication, mapping and ultimately the molecular characterization of genes which inuence parasite compatibility in intermediate hosts is fundamental to the control of parasitic diseases, as well as being of intrinsic interest to evolutionary biologists
1999 Blackwell Science Ltd, Molecular Ecology, 8, 21412152

and epidemiologists studying coevolution and population dynamics of hostparasite systems. Our hunt for resistance genes in Biomphalaria glabrata (Rollinson et al. 1998), with the aim of advancing current understanding of the evolutionary processes driving parasite resistance and host speciation, has prompted a search for molecular markers to anchor preliminary linkage maps. Microsatellite loci are highly polymorphic, single-locus, and codominant and have been advocated as excellent markers for linkage analysis of quantitative trait loci (Lymbery 1996). Here, we report the isolation and characterization of the rst microsatellite loci from the tropical freshwater snail B. glabrata, which acts as an intermediate host for Schistosoma mansoni in South America and the Caribbean. This species is a facultatively self-fertile hermaphrodite, and therefore a necessary prerequisite of linkage analysis is to conrm that progeny in F2 mapping populations are the product of outcrossing. Hence there is a need for accurate, unambiguous genetic markers for the assessment of parentage and estimates of map distances. These highly polymorphic loci may also be used to study the population structure and mating system of this hermaphroditic species. Total genomic DNA was extracted using a modied phenol-chloroform extraction procedure following Vernon et al. (1995) using foot tissue from ethanol-preserved specimens from two snail strains, resistant 1778 (Belo Horizonte, Brazil) and susceptible 1742 (Puerto Rico). Size-selected (Rassmann et al. 1991) partial genomic libraries (300 800 bp) were constructed by ligating Sau3AI-digested DNA into either -Zap phage (Strategene) or dephosphorylated pUC18 vector digested with BamHI (Pharmacia). These libraries were probed with 32P-labelled AG, AC (10 000 transformants from the rst library gave 15 positives; 3400 recombinant colonies from the second library gave 26 positives), TAA, TAAA, GAAA and CAAA (two positives from the second library only) oligonucleotide repeats at high stringency. All positives were sequenced using an ABI 377 automated sequencer (cycle sequenced using the Big Dye dye-terminator kit according to the manufacturers protocols) and primers were designed, using the software program OLIGO Macintosh version 4.1 (National Biosciences Inc., USA), from the unique sequence anking the microsatellite repeats found. Initially, the amplication efcacy of 20 primer pairs from both microsatellite screening methods was tested against individuals which constituted the original clone and a few randomly chosen individuals from the resistant and susceptible strains. Amplied samples were run on 2% 1 TBE agarose gels at 80 V and stained with ethidium bromide. Polymerase chain reactions (PCRs) were performed on a Hybaid PCR Express thermal cycler using the touchdown protocol (Don et al. 1991). PCR reaction mixes contained 10 ng of template DNA, 1.5 2.5 mm MgCl2, 0.2 mm of each nucleotide, 5 pmoles of each primer, 0.2 units of Taq polymerase (Bioline), and 1 NH4 buffer (16 mm (NH4)2SO4, 67 mm Tris-HCL, pH 8.8, 0.01% Tween-20), in a nal reaction volume of 10 L. Nine primer pairs produced bright resolvable products in all samples and each of these usable primers were then tested on a further 80 snails from the two strains. In addition,

2150 P R I M E R N O T E S
Table 1 Characterization of six Biomphalaria glabrata microsatellite loci. The repeat structure, primer sequences, allele size range, and annealing temperatures are given for each locus. Additionally, the number of alleles and the per cent observed heterozygosity (%HO) is presented for each of the two snail strains, resistant (R) and susceptible (S). The alleles were observed from approximately 40 individuals from each of two strains (total n = 80) No. of alleles Locus* Bg8 Bg10 Bg15 Bg16 Bg1 Bg2 Repeat (TG)7TT(TG)10 (CA)11 (GA)14(G)11 (TC)24(TATC)6 (TC)20 (GT)20 Primer sequences (5 3) F: GCACGAATGTTTGTTGAC R: CCTATTGATTGAAGTGTTTCC F: AAACACCCACTCACTCTCC R: GTTCAATAAGGTCAGGCAAG F: AGGTTTGTATGTCTTGCTG R: GGTTCACTCAGATACATCC F: CTGTTATTCATTATTTCATAGAGC R: GGGGATCTAACACATCAG F: TTAATTCTACTGGACTCACATGG R: CTGCCAATGTTTACATGCTG F: AGTCTGCTCCAGATTCATTACG R: GCTTATTTTCACCTCTGAATGC Size range (bp) 131107 (131) 107 93 (95) 182162 (178) 138 124 (138) 200 160 (186) 280 248 (254) T (C) 53 55 50 52 57 58 both 3 3 3 3 6 5 R 1 2 2 2 2 2 S 2 2 2 2 5 3 %HO both 2.5 4.2 22 8.7 52 52 R 0 3 20 2.5 50 32 S 5 5 25 16 54 73

*Bg, locus nomenclature for pUC18/BamHI vector microsatellite isolation method; Bg, locus nomenclature for -Zap phagemid vector microsatellite isolation method. Cloned insert size in parentheses; GenBank Accession nos are AF157698AF157701 and AF157703AF157704, respectively, of the sequenced clones from which the primers were designed.

we checked a cross between the two strains (both parents, 10 F1 and 10 F2) to assess inheritance of markers. These amplied products were resolved either on 4% 1 TBE, MetaPhor (FMC) agarose gels, run at 80 V on long gels (20 30 cm) for 8 h and ethidium bromide stained or 8% denaturing polyacrylamide gels stained with a Silver Sequence kit (Promega). Product sizes were determined by comparison with an M13mp8 DNA sequence standard produced by cycle sequencing from the Silver Sequence kit on polyacrylamide gels or to a 20-bp ladder (Advanced Biotechnologies) and to known products on agarose gels. Promegas protocol recommends the use of 6% gels as higher polyacrylamide concentrations cause the gel to crack and become unscoreable. However, superior resolution (differences of 2 bp) was obtained with 8% gels in which cracking was circumvented by the addition of a nal step of soaking the stained gel in 3% glycerol solution for 1 h prior to air drying. Three loci were xed for alternative alleles in the resistant and susceptible strains and are not described further. Results of optimization and screening of six polymorphic loci in the two B. glabrata strains are given in Table 1. Analysis of the banding patterns within the family crosses indicate that all loci segregate according to Mendelian expectations, with no evidence of null alleles. The number of alleles at each locus ranged from 3 to 6 and observed heterozygosity ranged from 2.5% at locus Bg8 to 52% for locus Bg2, with the susceptible strain exhibiting the highest heterozygosities across loci. These primers should prove suitable for linkage analyses utilizing crosses of inbred laboratory strains and in elucidating levels of population structuring in wild-caught samples. Furthermore, we show that presumably orthologous microsatellite loci can be successfully amplied in related

species of Biomphalaria (Table 2). Although sample sizes for the neotropical species tested were small (n = 3) the African species B. pfeifferi proved more polymorphic than the Neotropical species B. straminea, B. occidentalis and B. tenagophila, with the latter amplifying with the least number of loci. The results ranged from four out of six variable loci amplied from B. pfeifferi to only three yielding scoreable PCR products in B. tenagophila, none of which was polymorphic. The proportion of ampliable loci in each species is consistent with the phylogeny suggested by Woodruff & Mulvey (1997). Based on 20 allozyme loci, they deduced that South American B. glabrata had closer afnities to African than to other neotropical species, with B. tenagophila being most distantly related. Further, their work suggests that the African species are younger than their neotropical congeners, with the B. pfeifferiprotoglabrata lineage conservatively estimated to have evolved in Africa from neotropical founders 2.3 4.5 million years ago as a result of earlier transatlantic dispersal from the Americas. Consequently, the markers described here for B. glabrata may be more useful for examining population structure of other African than neotropical Biomphalaria species. Acknowledgements
This work was supported by the Wellcome Trust (project grant 042687/Z/94/Z to L.R.N. and a Biodiversity Fellowship to C.S.J.), BBSRC (Advanced Fellowship to C.S.J., grant number 1/ AF09056) and NERC (S.B.P.). We would also like to thank Alison Perry, Sarah Hughes and Mike Anderson for technical assistance and Dr Cecelia Pereira de Souza (Centro de Pesquisas Ren Rachou, Belo Horizonte, Brazil) for providing the snails. 1999 Blackwell Science Ltd, Molecular Ecology, 8, 2141 2152

P R I M E R N O T E S 2151
Table 2 Amplications across species within the genus Biomphalaria Locus Species B. pfeifferi B. straminea B. occidentalis B. tenagophila N 13 3 3 3 Bg1 *p (4) *p (2) * * Bg2 *p (2) * * Bg8 *

Bg10 * * *

Bg15 *p (5) *
*

Bg16 *p (3) * * *

*, One or two clear bands; *p, polymorphic, where polymorphism is detected the minimum number of alleles is given in parentheses; , multiple bands, smear or no product; N, sample size. Phylogenetic distance from B. glabrata moving down the rst column in the table.

References
Don RH, Cox PT, Wainright BT, Baker K, Mattick JS (1991) Touchdown PCR to circumvent spurious priming during gene amplication. Nucleic Acids Research, 19, 4008. Lymbery AJ (1996) Finding genetic markers for complex phenotypic traits in parasites. International Journal of Parasitology, 26, 717. Rassmann K, Schlotterer C, Tautz D (1991) Isolation of simple sequence loci for use in polymerase chain reaction-based DNA ngerprinting. Electrophoresis, 12, 113118. Rollinson D, Stothard JR, Jones CS et al. (1998) Molecular characterization of intermediate snail hosts and the search for resistance genes. Memorias Do Instituto Oswaldo Cruz, 93, 111116. Vernon JG, Jones CS, Noble LR (1995) Random amplied polymorphic DNA (RAPD) markers reveal cross-fertilisation in Biomphalaria glabrata from wild populations. Journal of Molluscan Studies, 61, 455 465. Woodruff DS, Mulvey M (1997) Neotropical schistosomiasis: African afnities of the host snail Biomphalaria glabrata (Gastropoda: Planorbidae). Biological Journal of the Linnean Society, 60, 505 516.
Graphicraft 0 1 primer no. Limited, Hong Kong no 803 1999 no supplier ID 800issuenotes number of article

Isolation and characterization of microsatellite loci in the European plaice, Pleuronectes platessa L. (Teleostei: Pleuronectidae)
P. C . WAT T S , * R . D . M . N A S H , S . G . G E O R G E and S . J . K E M P *
*Laboratory 1.03, Donnan Laboratories, Crown Street, School of Biological Sciences, University of Liverpool, Liverpool, L69 7ZD, UK, Port Erin Marine Laboratory, School of Biological Sciences, University of Liverpool, Port Erin, Isle of Man, IM9 6JA, Institute of Aquaculture, University of Stirling, Stirling, FK9 4LA, UK Keywords: European plaice, glutathione S-transferase, microsatellite, Pleuronectes platessa Received 19 May 1999; revision accepted 13 July 1999 Correspondence: P. C. Watts. Fax: + 44-(0)-151-794-3655; E-mail: p.c.watts@liv.ac.uk

European plaice, Pleuronectes platessa (L.), is a commercially important atsh that inhabits shelf waters of the Northeastern Atlantic. It is particularly common in European seas, where it is a major constituent of the demersal sheries. Plaice annually migrate and have specic spawning grounds within regional seas, although the amount of interbreeding among sh from different areas is not known. Morphometric and biological characteristics suggest that this species comprises several stocks. Knowledge of the movements of different stocks and their breeding habits is essential for the management of exploited sh species. Molecular markers offer a method of determining migration and stock structure of marine sh (Carvalho & Pitcher 1995). Due to their high levels of polymorphism, microsatellites are especially likely to prove useful for stock discrimination, but no microsatellite loci have yet been described for P. platessa. DNA was isolated from the muscle tissue of a single plaice and approximately 10 g was digested with SauIIIA. The 400 900 bp size fraction was recovered and cloned into dephosphorylated pUC18 (Boehringer Mannheim) digested with BamHI. Ligation products were subsequently transformed into competent cells (Stratagene). Approximately 500 recombinant clones were xed to Hybond-N membranes (Amersham) and screened for microsatellites using a (CA)10 probe. Hybridizations were undertaken using a nonradioactive digoxigenin (Boehringer Mannheim) protocol (Estoup & Turgeon 1996). Nineteen positive clones were isolated, of which 12 were sequenced using an ABI 377 sequencer. Primers were designed on the basis of sequences anking the repeat regions using a computer programme (S. J. Kemp, unpublished results) for six loci, of which four amplied consistently and showed products within the expected size range (Table 1). Several dinucleotide repeat regions are also present in a contiguous sequence of approximately 14 kb, which contains three glutathione S-transferase genes in P. platessa (Leaver et al. 1997) (GenBank Accession no. X95199). Primers were designed for ve of these microsatellite loci, of which three proved to be polymorphic (Table 1). DNA was extracted from the muscle tissue of 14 individuals caught from Port Erin Bay, Isle of Man using conventional methods (Sambrook et al. 1989) and resuspended in TE (pH 8.0). Primers were labelled through incubation

1999 Blackwell Science Ltd, Molecular Ecology, 8, 21412152

2152 P R I M E R N O T E S
Table 1 Characterization and estimates of variability at seven microsatellite loci for 14 plaice collected from Port Erin Bay, Isle of Man. Accession numbers of the cloned sequences deposited in GenBank are: LIST1001AF149831; LIST1002AF149830; LIST1003 AF149829; LIST1004 AF149828. The base locations of the primer and microsatellite sequences within the glutathione S-transferase gene cluster (GenBank X95199) are: Pplgst12769..2925; Pplgst23109..3217; Pplgst46623..6800 Locus LIST1001 LIST1002 LIST1003 LIST1004 Pplgst1 Pplgst2 Pplgst4 Primer sequences (5(r)3) AATCCAAAAGCAGGGGTCC GGTTGTAGTTATACTCAGGC CTTTTCATCACCTGTTCCG CTATTCTCTCAATGCCTGG AGAGCTATTGTGGTTCCACC CATGTCCTGAGATTCACTGC GATTAACTATGGGCAAGTGC TCTAGAGGATCCCTTTCCC TCAGTTTAAGTCTCAGGGCC CACGTTTAGAGTGTTGGTGC CAGCGCAAACAGACACATGG AGACGATCACATCAGCCAGC AACTCAAACTCTGGGAGG AAAACGGTCACATCAGCC Repeat array (AC)9(CA) (CA)11(A)2(CA)6(C)CA (CTT)(TTT)(CTT)(TCT)(CTT)4(CTG) (CA)(TA)(CA)82(A)4 (AC)3(TC)(AG)(AC)6 (AC)6 (CA)(A)(CA)2(A)2(CA)14 Ta 50 50 50 49.5 50 50 45 bp 8797 187189 156175 113165 155157 124132 178196 NA 6 2 4 8 2 3 8 HO 0.58 0.14 0.25 0.82 0.33 0.39 0.81 HE 0.60 0.14 0.27 0.38 0.40 0.46 0.71 MgCl2 1.5 1.5 1.5 2.0 1.5 1.5 1.5

Ta, primer annealing temperature (C); bp, size range of alleles; NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; MgCl2, MgCl2 concentration for PCR (mm).

with PNK and [ 33P]-ATP for 4555 min at 37 C. PCR amplication was undertaken in a 5-L volume using a PTC-10096V MJ thermal cycler (MJ Research Inc.) and Reddy-Load PCR Mix (Advanced Biotechnologies). Each reaction contained 20 50 ng of template DNA, 75 mm Tris-HCl, 20 mm (NH4)2SO4, 0.01% (v/v) Tween 20, 0.2 mm of each dNTP, 1.5 2.0 mm MgCl2, 0.66 pmol of each primer and 0.125 units of Taq polymerase (Advanced Biotechnologies). PCR conditions were: (i) an initial denaturation for 1 min at 95 C; (ii) six cycles of denaturation for 30 s at 95 C, 30 s at the specied annealing temperature (Table 1) and extension for 45 s at 72 C; (iii) a subsequent 26 cycles of 30 s denaturation at 92 C, 30 s of primer annealing and 55 s at 72 C; and (iv) a nal extension at 72 C of 30 min. Microsatellite variability was determined by electrophoresis on a 6% denaturing polyacrylamide gel (Severn Biotech Ltd). Vertical gels were run at 90 W for 3.5 h, xed, dried for 45 min and then exposed to a phosphor screen (Molecular Dynamics Inc.) overnight; the phosphor screens were scanned using a Storm imaging system (Molecular Dynamics Inc.). All alleles were run alongside an M13 sequencing ladder. Similar to those of other coldwater marine teleosts, many of the microsatellite arrays identied here comprise imperfect repeats (Table 1); the reasons for this phenomenon are still unclear (but see Brooker et al. 1994). The number of alleles varied between two and eight and the observed heterozygosities ranged between 0.14 and 0.82 (Table 1). Given that the sh used were taken from a relatively limited part of this species geographical range, these microsatellite loci will probably prove very useful for studying gene ow and stock dynamics. The glutathione S-transferases from which these sequences are derived are thought to be primarily involved in the detoxication of oxidation products of essential polyunsaturated fatty acids (Leaver & George 1998). However,

this superfamily of enzymes also detoxies drugs, pollutants and pesticides. The microsatellite loci described here may therefore act as valuable genetic markers with which to investigate tolerance to pollution in plaice. It must be remembered that the Pplgst microsatellites described here are linked and thus their independence cannot be assumed when used for population studies. Acknowledgements
We are grateful to Dr Mark Hughes and Faye Barker for their input and Dr Harry Noyes for sequencing. The University of Liverpool supported this work through RDF Grant no. 2531.

References
Brooker AL, Cook D, Bentzen P, Wright JM, Doyle RW (1994) Organisation of microsatellites differs between mammals and cold-water teleost shes. Canadian Journal of Fisheries and Aquatic Sciences, 51, 19591966. Carvalho G, Pitcher TJ (1995) Molecular Genetics in Fisheries. Chapman & Hall, London. Estoup A, Turgeon J (1996) Microsatellite markers: isolation with non-radioactive probes and amplication. http:/ / www.inapg.inra.fr/dsa/microsat/microsat.htm. Leaver MJ, George SG (1998) A piscine glutathione S-transferase which effectively conjugates the end-products of lipid peroxidation. Marine Environmental Research, 46, 7174. Leaver MJ, Wright J, George SG (1997) Structure and expression of a cluster of glutathione S-transferase genes from a marine sh, the plaice (Pleuronectes platessa). Biochemical Journal, 321, 405412. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, New York. 1999 Blackwell Science Ltd, Molecular Ecology, 8, 2141 2152