DNA PROFILING & ITS

APPLICATIONS
DNA PROFILING
• Genetic
Fingerprinting (also
called DNA testing,
DNA typing, or DNA
profiling) is a
technique used to
distinguish between
individuals of the
same species using
only samples of their
DNA.
 Who Invented it?
• The process of DNA
fingerprinting was
invented by Alec
Jeffreys at the
University of Leicester
in 1985.

• He was knighted in
1994.
• To understand DNA profiling, you first have to know that
large portions of any single person's DNA are the same as
every other person's. Because we're all human beings, a
large chunk of our DNA is dedicated to our species-
specific traits - we have feet instead of hooves, skin instead
of scales, etc. But other sections - or fragments - of human
DNA are unique to the individual. These fragments are
called polymorphic because they vary in shape from
person to person. Essentially, DNA profiling is the process
of separating an individual's unique, polymorphic,
fragments from the common ones.
• Although two individuals will have the vast majority of their
DNA sequence in common, DNA profiling exploits highly
variable repeat sequences called VNTRs.
• These loci are variable enough that two unrelated humans are
unlikely to have the same alleles.

AATG

7 repeats

8 repeats
• Each of us has a unique DNA profile or fingerprint. A
technique called electrophoresis is used to obtain
DNA profiles, relying on sections of our DNA that
are known as non-coding DNA – that does not code
for a protein.
• For example, you may have a stretch of DNA made
up of the following base sequence:
ATCTTCTAACACATGACCGATCATGC
ATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGTTCCATGATAGCA
CAT
• Polymerase chain reaction (PCR) is used first to
produce many copies of the ten STRs before they are
analyzed using electrophoresis. The different lengths
will show up as bands at different spots on the
electrophoresis gel. The banding pattern produced is
called a DNA profile or fingerprint, and can be
analyzed.
 How can DNA be used to identify
an individual?
• Every single cell in our bodies contains DNA, the
genetic material that programs how cells work.
99.9 percent of human DNA is the same in
everyone, meaning that only 0.1 percent of our
DNA is unique.
• Each human cell contains three billion DNA base
pairs. Our unique DNA, 0.1 percent of 3 billion,
amounts to 3 million base pairs. This is more than
enough to provide profiles that accurately identify
a person. The only exception is identical twins,
who share 100 percent identical DNA.
• At a crime scene, DNA is everywhere. It is present in
all kinds of evidence collected at the scene, including
blood, hair, skin, saliva and semen. Scientists can
analyze the DNA in evidence samples to see if it
matches a suspect's DNA.
 Biological materials used for DNA
profiling
• Blood
• Hair
• Saliva
• Semen
• Body tissue cells
• DNA samples have been
obtained from vaginal
cells transferred to the
outside of a condom
during intercourse.
 Stages of DNA Profiling
• Stage 1:
Cells are broken down
to release DNA

If only a small amount of

DNA is available it can be
amplified using the
polymerase chain reaction
(PCR)
 Stages of DNA Profiling
• Step 2:
The DNA is cut into fragments using restriction enzymes.

Each restriction enzyme cuts DNA at a specific base

sequence.
 Stages of DNA Profiling
• The sections of DNA that are cut out are
called restriction fragments.

• This yields thousands of restriction

fragments of all different sizes because the
base sequences being cut may be far apart
(long fragment) or close together (short
fragment).
 Stages of DNA Profiling
Stage 3:
• Fragments are
separated on the basis
of size using a process
called gel
electrophoresis.
• DNA fragments are
injected into wells and
an electric current is
applied along the gel.
 Stages of DNA Profiling
DNA is negatively
charged so it is
attracted to the
positive end of the gel.
The shorter DNA
fragments move faster
than the longer
fragments.
DNA is separated on
basis of size.
 Stages of DNA Profiling
• A radioactive material
is added which
combines with the
DNA fragments to
produce a fluorescent
image.
• A photographic copy
of the DNA bands is
obtained.
 Stages of DNA Profiling
Stage 4:
• The pattern of fragment distribution is then
analysed.
 Uses of DNA Profiling
• DNA profiling is used to
solve crimes and medical
problems
• Parentage testing
(explored in more
detail)
• Victim identification
in mass disasters
• Animal identification-
e.g. racehorses
• Conservation biology
and evolutionary
 METHODOLOGY

• DNA fingerprinting begins by extracting

DNA from the cells in a sample of blood,
saliva, semen, or other appropriate fluid or
tissue.
 METHODS
• RFLP – ( Restriction Fragment
Length Polymorphism -
pronounced as "rif-lip" )
• PCR – (Polymerase chain
reaction )
• Y- chromosome analysis
• STR – (short tandem repeats)
• ampFLP
• mitochondrial analysis
 RFLP (RESTRICTION FRAGMENT
LENGTH POLYMORPHISM )

• The first methods used for DNA fingerprinting

involved restriction enzyme digestion, followed
by Southern blot analysis.
• Although polymorphisms can exist in the
restriction enzyme cleavage sites, more
commonly the enzymes and DNA probes were
used to analyze VNTR loci.
 RFLP - TECHNIQUE
• The technique for detecting RFLPs involves the
fragmentation of genomic DNA by a restriction
enzyme, which can recognize and cut DNA
wherever a specific short sequence occurs, in a
process known as a restriction digest.
• The resulting DNA fragments are then
separated by length through a process known as
agarose gel electrophoresis, &
• transferred to a membrane via the Southern blot
procedure
 RFLP
• Hybridization of the membrane to a labeled
DNA probe then determines the size of the
fragments which are complementary to the
probe.
• An RFLP occurs when the size of a detected
fragment varies between individuals. Each
fragment size is considered an allele, and can
be used in genetic analysis.
• The analysis of VNTR alleles continues, but
is now usually performed by polymerase
chain reaction (PCR) methods.
• For example, the standard protocols for
DNA fingerprinting involve PCR analysis
of panels of more than a dozen VNTRs.
 PCR (POLYMEREASE CHAIN
REACTION)
• DNA fingerprinting took huge
strides forward in both
discriminating power and the
ability to recover information
from very small (or degraded)
starting samples.
• PCR greatly amplifies the
amounts of a specific region of
DNA, using oligonucleotide
primers and a thermostable
DNA polymerase.
• PCR method is
readily adaptable for
analyzing VNTR loci.
• In US, the FBI has
standardized a set of
13 VNTR assays for
DNA typing, and has
organized database
for forensic
identification in
criminal cases.
• Similar assays and
databases have been
set up in other
countries..
 PCR
VIDEO
 Y CHROMOSOME ANALYSIS
• Recent innovations have included the creation of
primers targeting polymorphic regions on the Y-
chromosome (Y-STR), which allows resolution of a
mixed DNA sample from a male and female and/or
cases in which a differential extraction is not possible.
• Y-chromosomes are paternally inherited, so Y-STR
analysis can help in the identification of paternally
related males.
• Y-STR analysis was performed in the Sally Hemings
controversy to determine if Thomas Jefferson had
sired a son with one of his slaves. It turns out that he
did.