Professional Documents
Culture Documents
APPLICATIONS
DNA PROFILING
• Genetic
Fingerprinting (also
called DNA testing,
DNA typing, or DNA
profiling) is a
technique used to
distinguish between
individuals of the
same species using
only samples of their
DNA.
Who Invented it?
• The process of DNA
fingerprinting was
invented by Alec
Jeffreys at the
University of Leicester
in 1985.
• He was knighted in
1994.
• To understand DNA profiling, you first have to know that
large portions of any single person's DNA are the same as
every other person's. Because we're all human beings, a
large chunk of our DNA is dedicated to our species-
specific traits - we have feet instead of hooves, skin instead
of scales, etc. But other sections - or fragments - of human
DNA are unique to the individual. These fragments are
called polymorphic because they vary in shape from
person to person. Essentially, DNA profiling is the process
of separating an individual's unique, polymorphic,
fragments from the common ones.
• Although two individuals will have the vast majority of their
DNA sequence in common, DNA profiling exploits highly
variable repeat sequences called VNTRs.
• These loci are variable enough that two unrelated humans are
unlikely to have the same alleles.
AATG
7 repeats
8 repeats
• Each of us has a unique DNA profile or fingerprint. A
technique called electrophoresis is used to obtain
DNA profiles, relying on sections of our DNA that
are known as non-coding DNA – that does not code
for a protein.
• For example, you may have a stretch of DNA made
up of the following base sequence:
ATCTTCTAACACATGACCGATCATGC
ATGCATGCATGCATGCATGCATGCAT
GCATGCATGCATGTTCCATGATAGCA
CAT
• Polymerase chain reaction (PCR) is used first to
produce many copies of the ten STRs before they are
analyzed using electrophoresis. The different lengths
will show up as bands at different spots on the
electrophoresis gel. The banding pattern produced is
called a DNA profile or fingerprint, and can be
analyzed.
How can DNA be used to identify
an individual?
• Every single cell in our bodies contains DNA, the
genetic material that programs how cells work.
99.9 percent of human DNA is the same in
everyone, meaning that only 0.1 percent of our
DNA is unique.
• Each human cell contains three billion DNA base
pairs. Our unique DNA, 0.1 percent of 3 billion,
amounts to 3 million base pairs. This is more than
enough to provide profiles that accurately identify
a person. The only exception is identical twins,
who share 100 percent identical DNA.
• At a crime scene, DNA is everywhere. It is present in
all kinds of evidence collected at the scene, including
blood, hair, skin, saliva and semen. Scientists can
analyze the DNA in evidence samples to see if it
matches a suspect's DNA.
Biological materials used for DNA
profiling
• Blood
• Hair
• Saliva
• Semen
• Body tissue cells
• DNA samples have been
obtained from vaginal
cells transferred to the
outside of a condom
during intercourse.
Stages of DNA Profiling
• Stage 1:
Cells are broken down
to release DNA