Professional Documents
Culture Documents
DNA recombination:
General recombination (homologous recombination)
Site-specific recombination
DNA Recombination
Definition
Classification
2. Site-specific recombination
Key Terms of Recombination
Homologous Recombination
Key Concepts
• Occurs at the “four strand” stage of
meiosis during spermatogenesis or
oogenesis
• Can occur anywhere in the homologous
nucleotide sequences of the two
participating strands
• Creates a heteroduplex region that can
be thousands of base pairs long
• No nucleotide sequences altered at the
site of exchange
Recombination Occurs at the Prophase of Meiosis
Synaptonemal Complex Links Homolog Pairs
Key Terms
•The synaptonemal complex describes the
morphological structure of synapsed chromosomes.
•An axial element is a proteinaceous structure around
which the chromosomes condense at the start of
synapsis.
•A lateral element is a structure in the synaptonemal
complex. It is an axial element that is aligned with the
axial elements of other chromosomes.
•The central element is a structure that lies in the
middle of the synaptonemal complex, along which the
lateral elements of homologous chromosomes align.
Key Concepts
•During the early part of meiosis, homologous
chromosomes are paired in the synaptonemal complex.
•The mass of chromatin of each homologue is separated
from the other by a proteinaceous complex.
Recombination in Meiosis
Key Concepts
• Recombination is initiated by making a double-strand break in one (recipient) DNA duplex.
• Exonuclease action generates 3’ single-stranded ends that invade the other (donor) duplex.
• New DNA synthesis replaces the material that has been degraded.
• This generates a recombinant joint molecule in which the two DNA duplexes are connected
by heteroduplex DNA.
Spo11 Creates DSBs
Key Concepts
•Double-strand breaks that initiate recombination
occur before the synaptonemal complex forms.
•If recombination is blocked, the synaptonemal
complex cannot form.
•Spo11 is homologous to the catalytic subunits of a
family of type II topoisomerases.
•Spo11 interacts reversibly with DNA; the break is
converted into a permanent structure by an
interaction with another protein that dissociates the
Spo11 complex.
•Removal of Spo11 is followed by nuclease action.
•At least 9 other proteins are required to process
the double-strand breaks. One group of proteins is
required to convert the double-strand breaks into
protruding 3’–OH single-stranded ends. Another
group then enables the single-stranded ends to
invade homologous duplex DNA.
Role of RecBCD in Recombination
Key Concepts
•The RecBCD complex has nuclease and helicases
activities.
Chi Sequence
5’ GCTGGTGG 3’
3’ CGACCACC 5’
RecA catalyzes Strand Exchange
Key Concepts
RecA forms filaments with single-stranded or duplex DNA and catalyzes the ability of a single-
stranded DNA with a free 3’ to displace its counterpart in a DNA duplex.
RecA Creates Recombination Intermediates
Role of RuvABC in Recombination
Key Concepts
•The Ruv complex acts on recombinant
junctions.
•RuvA (27 kDa) recognizes the structure
of the junction.
•RuvB (37 kDa) is a helicase that
catalyzes branch migration.
•RuvC (19 kDa) cleaves junctions to
generate recombination intermediates.
Holliday Junction
Resolution of Holliday Junction
The continuous strands of the stackedX structure (a) which form the wide angles in the
unfolded RuvCjunction complex (b) are indicated by asterisks. The site of incision are
indicated by scissors. The products of resolution (C) can be repaired by DNA ligase.
RecA Homologs in Eukaryotes
Recombination Can Lead to Gene Conversion
Key Terms
•Postmeiotic segregation describes the
segregation of two strands of a duplex DNA that bear
different information (created by heteroduplex
formation during meiosis) when a subsequent
replication allows the strands to separate.
•Gene conversion is the alteration of one strand of
a heteroduplex DNA to make it complementary with
the other strand at any position(s) where there were
mispaired bases.
Key Concepts
•Heteroduplex DNA that is created by recombination
can have mismatched sequences where the
recombining alleles are not identical.
•Repair systems may remove mismatches by
changing one of the strands so its sequence is
complementary to the other.
Recombination Functions as a DNA Repair Mechanism
DoubleStrand Break and
Recombination Repair
Summary
• Homologous recombination allows large section of the DNA to
move from one chromosome to another; occurs only between
homologous DNA molecules.
DNA Recombination and Repair
DNA recombination:
General recombination (homologous recombination)
Site-specific recombination
DNA repair:
DNA damage
DNA damage response
DNA repair pathways
Base excision repair
Nucleotide excision repair
Mismatch repair
SiteSpecific Recombination
Transposition
Key Terms
Transposase:
An enzyme encoded by the transposon and
disconnecting the transposon from one piece of DNA and
inserting it into a new target DNA site.
Classes of Transposable Elements
DNAOnly Transposon
Cutandpaste transposition
RetroviralLike Retrotransposition
Mechanism of Integrase
Key Concepts
•Integrases are related to topoisomerases, and the
recombination reaction resembles topoisomerase action
except that nicked strands from different duplexes are
sealed together.
Nonretroviral retrotransposition
Conservative SiteSpecific Recombination
Summary
Mobile genetic elements (transposons and viruses) can move from one
position in the genome to another by either a transpositional or a
conservative site-specificRecombination process
DNA Damage and Repair
DNA damage and repair:
DNA damage
DNA damage response
DNA repair pathways and their relationship with cancers
Base excision repair
Nucleotide excision repair
Mismatch repair
Types of DNA Damage
DNA lesions and structures that elicit DNA response reactions. Some of the
base backbone lesions and noncanonical DNA structures that elicit DNA
response reactions are shown. O6MeGua indicates O6-methyl-
deoxyguanosine, T<>T indicates a cyclobutane thymine dimer, and the
cross-link shown is cisplatin G-G interstrand cross-link.
Endogenous DNA Damage
Mismatch Derived from Normal DNA Metabolism
5’ 3’
G
T
3’
3’
5’
5
’
DNA replication errors DNA recombination
Exogenous DNA Damage
Ultraviolet irradiation introduces covalent
bonds between two adjacent thymine
bases and causes formation of intrastrand
pyrimidine dimer. The dimer blocks
replication and transcription.
DNA Damage and Repair in Cancer
DNA Damage Response Pathways
DNA damage response reactions in mammalian cells. The four responses (DNA
repair, transcriptional response, DNA damage checkpoints, and apoptosis) may
function independently, but frequently a protein primarily involved in one response
may participate in other responses.
SOS Response in E. coli
Key Terms
•An SOS response in E. coli describes the
coordinate induction of many enzymes (more than
20), including repair activities, in response to
irradiation or other damage to DNA; results from
activation of protease activity by RecA to cleave
LexA repressor.
Key Concepts
•Damage to DNA causes RecA to trigger the SOS
response, consisting of genes coding for many
repair enzymes.
•RecA activates the autocleavage activity of LexA.
•LexA represses the SOS system; its autocleavage
activates target gene expression.
DNA Damage Checkpoint
Proteins
DNA damage Checkpoints are
biochemical pathways that delay or
arrest cell cycle progression in
response to DNA damage. Like other
signal transduction pathways, the DNA
damage checkpoint has three types of
components: sensors, signal
transducers, and effectors. The
damage is detected by sensors that,
with the aid of mediators, transduce
the signal to transducers. The
transducers, in turn, activate or
inactivate other proteins (effectors)
that directly participate in inhibiting
the G1/S transition, S-phase
progression, or the G2/M transition.
Sensors: ATM and ATR Proteins
• ATM (ataxia telangiectesia mutated) is a 350-kDa protein with serine- and
threonine-specific protein kinase activity, it belongs to the phosphoinositide 3-
kinase-like kinase (PIKK). Upon exposure of cells to ionizing radiation (IR),
ATM phosphorylates many proteins, including p53, Chk1, NBS1, BRCA1, and
itself.
• ATR (ATM-related) gene encodes for a protein of 303-kDa with protein kinase
activity. Mutations in ATR are associated with the human autosomal recessive
disorder Seckel syndrome, which shares features in common with A-T. In
contrast to ATM, ATR is activated by UV light rather than by IR.
• ATRIP (ATR interacting protein) is a 86-kDa protein that interacts with ATR.
ATRIP may confer some specificity for binding of the ATR-ATRIP complex to RPA
coated DNA rather than naked DNA.
Sensors: Rad17RFC and the 911 Complex
Mediators
Signal Transducers
• There are two signal transducers, Chk1 and Chk2. These S/T
kinases play a strict signal transduction function in cell cycle
regulation and checkpoint responses.
Effectors
G1/S Checkpoint
ATMRegulated SPhase
Checkpoint
In response to double-strandbreaks
induced by ionizing radiation, ATM
triggers two cooperating parallel
cascades to inhibit replicative DNA
synthesis. ATM, through the
intermediacy of MDC1, H2AX, and
53BP1, phosphorylates Chk2 on Thr68 to
induce ubiquitin-mediated degradation
of Cdc25A phosphatase. The degradation
locks the S phase-promoting Cyclin
E/Cdk2 in its inactive, phosphorylated
form and prevents the loading of Cdc45
on the replication origin. ATM also
initiates a second pathway by
phosphorylating NBS1 of the M/R/N
complex, as well as SMC1, BRCA1, and
FANCD2.
ATRRegulated SPhase
Checkpoint
Direct Repair of Photodimer
Direct repair by photoreactivation.
Photolyase binds to DNA containing a
pyrimidine dimer in a light-
independent reaction and flips the
dimer out into the active site pocket.
Catalysis is initiated by light. The
photoantenna cofactor,
methenyltetrahydrofolate (5,10-
MTHF), absorbs a photon and
transfers the excitation energy to the
catalytic cofactor, FADH-. Then, the
excited state FADH- transfers an
electron to the pyrimidine dimer,
splitting the dimer into two
pyrimidines. The electron returns to
the flavin radical to regenerate FADH-,
and the enzyme dissociates from the
repaired DNA.
DNA Repair
Base Excision Repair
Base Excision Repair
UracilDNA Gylycosylase
DNA Glycosylases
Enzyme Substrate
Glycosylase Associated with Lyase Activity
AP Endonuclease and Lyase
ase
ucle
n
do
P en
A
AP
lya
se
Mechanism of Base Excision Repair
A damaged base is removed by a DNA
glycosylase to generate an AP site.
Depending on the initial events in base
removal, the repair patch may be a single
nucleotide (short patch) or 2-10 nucleotides
(long patch). When the base damage is
removed by a glycosylase/AP lyase that
cleaves the phosphodiester bond 3' to the AP
site, APE1 endonuclease cleaves the 5' bond
to the site and recruits Polβ to fill in a 1-nt
gap that is ligated by Lig3/XRCC1 complex.
When the AP site is generated by hydrolytic
glycosylases or by spontaneous hydrolysis,
repair usually proceeds through the long-
patch pathway. APE1 cleaves the 5'
phosphodiester bond, and the RFC/PCNA-Polδ
/ε complex carries out repair synthesis and
nick translation, displacing several
nucleotides. The flap structure is cleaved off
by FEN1 endonuclease and the long-repair
patch is ligated by Ligase 1.
DNA Damage and Repair
Nucleotide Excision Repair in E. coli
UvrABC Endonuclease
UvrA:
103 kDa
DNA-independent ATPase
DNA-damage binding activity
Forms a dimer with UvrB
UvrB:
76 kDa
Endonuclease activity
Forms a dimer with UvrA
UvrC:
68 kDa
Endonuclease activity
Interacts with UvrB
Damage Recognition by UvrAB
Incision of the Damaged Nucleotides by UvrBC
Repair Synthesis
The UvrABC System
Defects in NER Predispose to Cancer
NER in Human Cells
Mechanism of Nucleotide
Excision repair
Xeroderma Pigmentosum Complementation Group
XPA
XPB
XPC
XPD NER
XPE
XPF
XPG
5’ A A
3’ T T
DNA Damage and Repair
DNA Mismatch Repair
What is DNA Mismatch?
What is mismatch?
NonWatsonCrick base pairs
Two classes of mismatches
Basebase mismatch
GT, AC, AA, AG, GG, CC, CT, TT
Insertiondeletion (unpaired) mismatch
CA
CACACACACACACA CACACACACACACACA
GTGTGTGTGTGTGTGTGTGTGTGTGTGTCA
Key MMR Components
MutS:
97 kDa
Mismatch recognition protein
ATPase activity
MutL:
70 kDa
ATPase activity
MutH:
23 kDa
Endonuclease activity
Mismatch Repair in E. coli
MutS, L, and H Proteins
Mismatch Repair in E. Coli
CH 3 CH 3
MutS
Ligase
CH 3
MutL CH3
Pol III holoenzyme
MutH Helicase II
CH 3 SSB CH 3
ExoI, ExoVII,
RecJ,ExoX
Models for the Initiation of Mismatch repair
A, Translocation model. ATP reduces the
mismatch binding affinity of MutS dimer and
ATP hydrolysis drives bi-directional translocation
of MutS to form an α-like loop structure of DNA.
B, Molecular switch model. MutS is suggested to
be present in either an ADP-bound form or an
ATP-bound form. Binding of the ADP-bound
MutS to a mismatch stimulates the exchange of
ADP for ATP. The nucleotide switch results in a
conformational change of MutS and promotes
the ATP-MutS complex to diffuse along the DNA
helix. ATP is not hydrolyzed in this diffusible
complex. C, Transactivation model. Binding of
ATP enables MutS to release a homoduplex DNA
(upper) or to continue to bind a heteroduplex
DNA through a loosening interaction (lower). In
the presence of MutL, MutH, and the hemi-
methylated GATC sequence, the bound ATP
molecules allow the MutS-mismatch complex to
form a repair complex of the three proteins with
two DNA recognition sites and initiate mismatch
repair. The ATP bound by MutS is shown in
purple, and the ATP hydrolyzed by MutL during
the trans-activation is shown in orange.
Characteristic of MMR
• MutHLS-dependent
• Bi-directional process
Crystal Structure of MutS
DNA Mismatch Repair
Human Mut Homologs
E. coli Human
MSH2
MutSα MutSβ
(MutS)2 MSH3
MSH6
MLH1
(MutL)2 MutLα PMS1 MutLβ
MutLγ
PMS2
MLH3
MutH ?
MMR Components in Humans
E. coli Human
MutS MutSαMutS
β
MutL MutLα MutLβMutL
γ
MutH ?
UvrD ?
ExoI, ExoVII, ExoX, RecJ ExoI (others?)
SSB RPA
Pol III holoenzyme Pol δ (α, ε?)
DNA ligase ?
PCNA
RFC
HMGB1
Human Mismatch Repair
The human MMR system can bi-directionally process all eight base-base mismatches
and 1-16 nt ID mispairs. The repair process in each case involves repair initiation,
excision, and resynthesis. Except for mismatch recognition, where hMutSα and hMutS
β are required to distinguish specific substrates as indicated, activities required for the
remaining steps of the reaction are believed to be the same for the processing of
base-base mismatches and ID mispairs.
DNA Mismatch Repair
Microsatellite and Its Instability
Key Terms
Microsatellite:
Simple repetitive DNA sequences are called microsatellite.
For example: (A)n
(CA)n
(CAG)n
(CACA)n
There are hundreds and thousands of microsatellite
sequences in our DNA, and the are located mostly in non-
coding regions.
Microsatellite Instability in Cancer
Dinucleotide repeat polymorphisms in normal (N) and tumor (T) tissue from patients
with hereditary non-polyposis colorectal cancer (HNPCC) (A and B) and patients with
sporadic colorectal cancer (C and D). Genomic DNAs were amplified by PCR using
microsatellite markers D2S123 abd D10S197, and the products were separated in 6%
polyacrylamide gels.
MMR Genes and Colorectal Cancer
HNPCCa Sporadic
Population incidence ~1 in 500 1 in 20
Microsatellite instability >90% of kindreds 13%
MMR gene mutations 70% ~65% of CRC with MSI
m
----CA-----CG----
Sodium bisulfite
m
----UA-----CG----
PCR
m
----TA-----CG----
7 8 17 10 15 16 L E M H2O
UM UM UM UM UM UM UM UM UM UM
Hypermethylation in sporadic breast cancers. DNA from breast tumors were tretaed
with sodiumn bisulfite. The C region of the hMLH1 promoter was amplified by PCR.
M, methylation specific primers; U, unmethylation-specific primers.
GCGC GmCGC
Sensitive to
HpaII Yes No
MspI Yes Yes
5’ GCGC 3’ 5’ G mC G C 3’
3’ CGCG 5’ 3’ C G mC G 5’
HpaII or Msp1 HpaII Msp1
PCR PCR PCR
MLH1 Hypermethylation in Sporadic Cancers
Analysis of methylation status of the hMLH1 promoter. Shown is the product resulting from PCR
amplification of the hMLH1 promoter region before or after digestion. U, Undigested; H, digested
with HpaII; M, digested with MspI. The methylation status (+, methylated; -, unmethylated) of the
hMLH1 promoter is designated below each sample.
Induction of hMLH1 Expression by 5-azacytidine
Germline Epimutation of MLH1 in Cancer
DNA Mismatch Repair
DNA DamageInduced Apoptosis
TK6 MT1
MNNG - + - +
TK6 Proficient WT
MutSα Binds to Damaged DNA
Cisplatin adducts
Aminofluorene adducts
UV dimer
Mechanism of MMRMediated Apoptosis
Tumor Suppression of MMR
Wildtype cells MMR mutant cells
Functions of MMR
• Repair function
Correcting heteroduplexes
• Apoptosis function
Eliminating damaged cells from body by promoting apoptosis
Summary
Defects in MMR are the genetic basis for certain types of cancer.
1. Genetic mutations, particularly in MSH2 and MLH1
2. Hypermethylation of MLH1 gene